DOCSLIB.ORG

Specificity Landscapes Unmask Submaximal Binding Site Preferences of Transcription Factors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Specificity Landscapes Unmask Submaximal Binding Site Preferences of Transcription Factors Specificity landscapes unmask submaximal binding site preferences of transcription factors Devesh Bhimsariaa,b,1, José A. Rodríguez-Martíneza,2, Junkun Panc, Daniel Rostonc, Elif Nihal Korkmazc, Qiang Cuic,3, Parameswaran Ramanathanb, and Aseem Z. Ansaria,d,4 aDepartment of Biochemistry, University of Wisconsin–Madison, Madison, WI 53706; bDepartment of Electrical and Computer Engineering, University of Wisconsin–Madison, Madison, WI 53706; cDepartment of Chemistry, University of Wisconsin–Madison, Madison, WI 53706; and dThe Genome Center of Wisconsin, University of Wisconsin–Madison, Madison, WI 53706 Edited by Michael Levine, Princeton University, Princeton, NJ, and approved September 24, 2018 (received for review July 13, 2018) We have developed Differential Specificity and Energy Landscape Here, we report the development of Differential Specificity (DiSEL) analysis to comprehensively compare DNA–protein inter- and Energy Landscapes (DiSEL) to compare experimental actomes (DPIs) obtained by high-throughput experimental plat- platforms, computational methods, and interactomes of TFs, forms and cutting edge computational methods. While high-affinity especially those factors that bind identical consensus motifs. Our DNA binding sites are identified by most methods, DiSEL uncovered results reveal that (i) most high-throughput experimental plat- nuanced sequence preferences displayed by homologous transcription forms reliably identify high-affinity motifs but yield less reliable factors. Pairwise analysis of 726 DPIs uncovered homolog-specific dif- information on submaximal sites; (ii) with few exceptions, com- ferences at moderate- to low-affinity binding sites (submaximal sites). putational methods model DPIs with a focus on high-affinity DiSEL analysis of variants of 41 transcription factors revealed that sites; (iii) submaximal sites improve the annotation of biologi- many disease-causing mutations result in allele-specific changes in cally relevant binding sites across genomes; (iv) among members binding site preferences. We focused on a set of highly homologous of TF families, homolog-specific preferences are most evident at factors that have different biological roles but “read” DNA using iden- submaximal affinity sites rather than high-affinity motifs; (v) tical amino acid side chains. Rather than direct readout, our results among closely related homologs that use identical side chains to indicate that DNA noncontacting side chains allosterically contribute interact with DNA, the residues that face away from the DNA to sculpt distinct sequence preferences among closely related mem- can allosterically confer homolog-specific preferences for sub- BIOPHYSICS AND bers of transcription factor families. maximal sites; and (vi) among naturally occurring alleles of COMPUTATIONAL BIOLOGY specific factors, several disease-causing alleles impact binding to Differential Specificity and Energy Landscapes | cognate site identification | submaximal affinity sites (24). Taken together, DiSEL analysis DNA–protein interactome | DNA sequence recognition | allostery readily unmasks the differences between experimental platforms and computational models and identifies submaximal sites that enome-wide binding profiles of hundreds of transcription Gfactors (TFs) have made it abundantly clear that these Significance proteins bind to a large spectrum of sequences to manifest their – biological functions (1 3). The affinity for different biologically Several experimental platforms and computational methods relevant binding sites can vary dramatically. Surprisingly, only a have been developed to identify DNA binding sites of over 1,000 fraction of the genomic sites occupied in living cells can be an- transcription factors. Often, high-affinity (maximal) binding sites are notated using high-affinity motifs assigned to a given TF (1). To reported as consensus motifs. Differences between experimental further confound annotation, high-affinity sites can be bound platforms contribute to uncertainty in ascribing binding to sub- interchangeably by TFs that bear a common DNA binding fold maximal sites. However, biological studies emphasize the impor- (4–6). This is especially true for highly homologous TFs that tance of submaximal binding sites in shaping regulatory functions of often bind indistinguishably to consensus high-affinity sites (6, 7). transcription factors. To bridge this gap, we developed Differential Increasingly, moderate- to low-affinity (submaximal or sub- Specificity and Energy Landscapes to unmask differences between optimal affinity) binding sites have been shown to guide selective experimental and computational methods as well as capture distinct binding of individual TFs to distinct genomic loci (8–11). In submaximal binding site preferences of transcription factors. Our other words, energetically subtle preferences for different mod- results suggest that subtle variation in protein structure can allo- erate- to low-affinity sites govern selective binding and distinct sterically confer homolog-specific differences in binding to sub- biological roles of closely related homologous TFs (8–11). maximal affinity sites. The quest to identify consensus binding sites of all DNA (and RNA) binding proteins encoded within the human genome is Author contributions: D.B., J.A.R.-M., Q.C., P.R., and A.Z.A. designed research; D.B., being driven by high-throughput experimental platforms and new J.A.R.-M., J.P., D.R., E.N.K., Q.C., P.R., and A.Z.A. performed research; D.B., P.R., and A.Z.A. contributed new reagents/analytic tools; D.B., J.A.R.-M., J.P., D.R., and E.N.K. ana- computational approaches (12, 13). Each experimental and lyzed data; and D.B., J.A.R.-M., J.P., D.R., E.N.K., Q.C., P.R., and A.Z.A. wrote the paper. computational approach has inbuilt advantages and limitations Conflict of interest statement: A.Z.A. is the sole member of VistaMotif, LLC and founder (14–16). While high-affinity sites are readily identified, binding of the educational nonprofit WINStep Forward. to submaximal affinity sites is nontrivial and is often overlooked. This article is a PNAS Direct Submission. However, an unexpected result from recent analyses is that high- Published under the PNAS license. “ ” affinity consensus binding sites often do not predict in vivo 1Present address: Bio Informaticals, Jaipur, Rajasthan 302016, India. genome-wide binding profiles (chromatin immunoprecipitation 2Present address: Department of Biology, University of Puerto Rico–Rio Piedras, San Juan, followed by sequencing or ChIP-seq) as effectively as models that Puerto Rico 00925. include sequences of submaximal affinities (17). Pairwise com- 3Present address: Departments of Chemistry and Physics & Biomedical Engineering, Boston parisons of DNA–protein interactomes (DPIs) suggest that most University, Boston, MA 02215. experimental platforms capture high-affinity sites with remarkable 4To whom correspondence should be addressed. Email: [email protected]. fidelity (18–23).However,theextenttowhich platform-dependent This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. idiosyncrasies thwart the identification of submaximal binding sites 1073/pnas.1811431115/-/DCSupplemental. is underscrutinized and poorly understood. www.pnas.org/cgi/doi/10.1073/pnas.1811431115 PNAS Latest Articles | 1of10 Downloaded by guest on September 24, 2021 are preferred by homologous proteins with indistinguishable high- A affinity target sites. Our results highlight the importance of non- obvious allosteric contributors in conferring differential sequence specificity. While widely ignored, such allosteric effects likely con- tribute to sequence specificity beyond current models of direct and indirect readout of DNA sequence and shape. Increased evaluation of differential binding to submaximal affinity sites will undoubtedly improve the ability to decipher how genomic information is utilized by TFs to manifest their regulatory functions in vivo. Results Specificity and Energy Landscapes Display Binding Affinities for an B Entire Sequence Space. DPIs from high-throughput experimental methods are typically distilled down to a position weight matrix (PWM)-based “consensus motif” or a limited set of motifs (12, 25, 26) (Fig. 1A). While PWM-based motifs efficiently summa- rize sequence preferences of a DNA binding protein, they compress related sequences into a consensus, overlook the impact of flanking sequences, and underestimate the full spectrum of cognate sites contained within a given interactome. We utilize sequence specificity landscapes (SSLs) to visualize individual interactomes (19, 27) (Fig. 1B). When binding affinities are measured and correlated with cog- nate sites within an interactome, the resulting plots display binding energy landscapes [Specificity and Energy Landscapes (SELs)] of individual TFs (27, 28). In SSL/SEL plots, the binding affinities for a k-mer sequence space are represented in a series of concentric rings organized by a “seed motif.” All sequences in a DPI are then placed at different positions along the concentric circles based on sequence similarity to the seed motif (Fig. 1B and SI Appendix,Fig.S1). SELs of different classes of proteins reveal the range of binding modes displayed by a given TF and impact of flanking sequences and mis- matches on binding (6, 19). C To elucidate similarities and differences in DPIs obtained by various experimental methods and sequence preferences of highly homologous TFs, we now report the development
Load more

Recommended publications
  • Dissection of the Role of VIMP in Endoplasmic Reticulum-Associated
    www.nature.com/scientificreports OPEN Dissection of the Role of VIMP in Endoplasmic Reticulum-Associated Degradation of CFTRΔF508 Received: 10 November 2017 Xia Hou1,2, Hongguang Wei1, Carthic Rajagopalan1, Hong Jiang1, Qingtian Wu2, Accepted: 6 March 2018 Khalequz Zaman3, Youming Xie4 & Fei Sun1 Published: xx xx xxxx Endoplasmic reticulum (ER)-associated protein degradation (ERAD) is an important quality control mechanism that eliminates misfolded proteins from the ER. The Derlin-1/VCP/VIMP protein complex plays an essential role in ERAD. Although the roles of Derlin-1 and VCP are relatively clear, the functional activity of VIMP in ERAD remains to be understood. Here we investigate the role of VIMP in the degradation of CFTRΔF508, a cystic fbrosis transmembrane conductance regulator (CFTR) mutant known to be a substrate of ERAD. Overexpression of VIMP markedly enhances the degradation of CFTRΔF508, whereas knockdown of VIMP increases its half-life. We demonstrate that VIMP is associated with CFTRΔF508 and the RNF5 E3 ubiquitin ligase (also known as RMA1). Thus, VIMP not only forms a complex with Derlin-1 and VCP, but may also participate in recruiting substrates and E3 ubiquitin ligases. We further show that blocking CFTRΔF508 degradation by knockdown of VIMP substantially augments the efect of VX809, a drug that allows a fraction of CFTRΔF508 to fold properly and mobilize from ER to cell surface for normal functioning. This study provides insight into the role of VIMP in ERAD and presents a potential target for the treatment of cystic fbrosis patients carrying the CFTRΔF508 mutation. Elimination of misfolded endoplasmic reticulum (ER) proteins by the ER-associated protein degradation (ERAD) pathway is an important physiological adaptation to ER stress1,2.
    [Show full text]
  • Locating Mammalian Transcription Factor Binding Sites: a Survey of Computational and Experimental Techniques
    Downloaded from genome.cshlp.org on September 26, 2021 - Published by Cold Spring Harbor Laboratory Press Review Locating mammalian transcription factor binding sites: A survey of computational and experimental techniques Laura Elnitski,1,4 Victor X. Jin,2 Peggy J. Farnham,2 and Steven J.M. Jones3 1Genomic Functional Analysis Section, National Human Genome Research Institute, National Institutes of Health, Rockville, Maryland 20878, USA; 2Genome and Biomedical Sciences Facility, University of California–Davis, Davis, California 95616-8645, USA; 3Genome Sciences Centre, British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada V5Z-4E6 Fields such as genomics and systems biology are built on the synergism between computational and experimental techniques. This type of synergism is especially important in accomplishing goals like identifying all functional transcription factor binding sites in vertebrate genomes. Precise detection of these elements is a prerequisite to deciphering the complex regulatory networks that direct tissue specific and lineage specific patterns of gene expression. This review summarizes approaches for in silico, in vitro, and in vivo identification of transcription factor binding sites. A variety of techniques useful for localized- and high-throughput analyses are discussed here, with emphasis on aspects of data generation and verification. [Supplemental material is available online at www.genome.org.] One documented goal of the National Human Genome Research and other regulatory elements is mediated by DNA/protein in- Institute (NHGRI) is the identification of all functional noncod- teractions. Thus, one major step in the characterization of the ing elements in the human genome (ENCODE Project Consor- functional elements of the human genome is the identification tium 2004).
    [Show full text]
  • Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
    International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name LIM homeobox 4 Gene Symbol LHX4 Organism Human Gene Summary This gene encodes a member of a large protein family which contains the LIM domain a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. Gene Aliases CPHD4, FLJ22769 RefSeq Accession No. NC_000001.10, NG_008081.1, NT_004487.19 UniGene ID Hs.658487 Ensembl Gene ID ENSG00000121454 Entrez Gene ID 89884 Assay Information Unique Assay ID qHsaCED0002909 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000263726 Amplicon Context Sequence CTATGGAATCCCCCAGTCTCCATCCTCCATATCGTCCCTGCCATCCCACGCTCCT TTGCTCAATGGGCTGGATTACACGGTGGACAGTAATTTGGGCATCATTGC Amplicon Length (bp) 75 Chromosome Location 1:180243462-180243566 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 94 R2 0.9993 cDNA Cq 24.14 cDNA Tm (Celsius) 82.5 gDNA Cq 23.49 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report LHX4, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • The Hippo Pathway Component Wwc2 Is a Key Regulator of Embryonic Development and Angiogenesis in Mice Anke Hermann1,Guangmingwu2, Pavel I
    Hermann et al. Cell Death and Disease (2021) 12:117 https://doi.org/10.1038/s41419-021-03409-0 Cell Death & Disease ARTICLE Open Access The Hippo pathway component Wwc2 is a key regulator of embryonic development and angiogenesis in mice Anke Hermann1,GuangmingWu2, Pavel I. Nedvetsky1,ViktoriaC.Brücher3, Charlotte Egbring3, Jakob Bonse1, Verena Höffken1, Dirk Oliver Wennmann1, Matthias Marks4,MichaelP.Krahn 1,HansSchöler5,PeterHeiduschka3, Hermann Pavenstädt1 and Joachim Kremerskothen1 Abstract The WW-and-C2-domain-containing (WWC) protein family is involved in the regulation of cell differentiation, cell proliferation, and organ growth control. As upstream components of the Hippo signaling pathway, WWC proteins activate the Large tumor suppressor (LATS) kinase that in turn phosphorylates Yes-associated protein (YAP) and its paralog Transcriptional coactivator-with-PDZ-binding motif (TAZ) preventing their nuclear import and transcriptional activity. Inhibition of WWC expression leads to downregulation of the Hippo pathway, increased expression of YAP/ TAZ target genes and enhanced organ growth. In mice, a ubiquitous Wwc1 knockout (KO) induces a mild neurological phenotype with no impact on embryogenesis or organ growth. In contrast, we could show here that ubiquitous deletion of Wwc2 in mice leads to early embryonic lethality. Wwc2 KO embryos display growth retardation, a disturbed placenta development, impaired vascularization, and finally embryonic death. A whole-transcriptome analysis of embryos lacking Wwc2 revealed a massive deregulation of gene expression with impact on cell fate determination, 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; cell metabolism, and angiogenesis. Consequently, a perinatal, endothelial-specific Wwc2 KO in mice led to disturbed vessel formation and vascular hypersprouting in the retina.
    [Show full text]
  • MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature
    J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature.
    [Show full text]
  • DNA Binding Site of the Growth Factor-Inducible Protein Zif268
    Proc. Natl. Acad. Sci. USA Vol. 86, pp. 8737-8741, November 1989 Biochemistry DNA binding site of the growth factor-inducible protein Zif268 ("zinc fingers"/transcription factor/cell growth) BARBARA CHRISTY AND DANIEL NATHANS* Howard Hughes Medical Institute and the Department of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, Baltimore, MD 21205 Contributed by Daniel Nathans, August 31, 1989 ABSTRACT Zif268, a zinc finger protein whose mRNA is The recombinant plasmid was transfected into E. coli strain rapidly activated in cells exposed to growth factors or other BL21(DE3) and the transfected cells were grown as described signaling agents, is thought to play a role in regulating the (22) to an optical density of about 0.6 before induction of T7 genetic program induced by extracellular ligands. We report RNA polymerase with 0.4 mM isopropyl B-D-thiogalacto- that Zif268 has one of the characteristics of a transcriptional pyranoside (IPTG). Bacterial extracts used for DNA binding regulator, namely, sequence-specific binding to DNA. Zif268 were prepared as described (23). After solubilization of synthesized in Escherichia coli bound to two sites upstream of proteins with 4 M urea the preparation was dialyzed against the zif268 gene and to sites in the promoter regions of other 20 mM Tris, pH 7.7/50 mM KCI/10 mM MgCl2/i mM genes. The nucleotide sequences responsible for binding were EDTA/10 ,uM ZnSO4/20% (vol/vol) glycerol/1 mM dithio- defined by DNase I footprinting, by methylation interference threitol/0.2 mM phenylmethylsulfonyl fluoride/1 mM so- experiments, and by use of synthetic oligonucleotides.
    [Show full text]
  • Direct Inhibition of the DNA-Binding Activity of POU Transcription Factors
    Published online 25 April 2008 Nucleic Acids Research, 2008, Vol. 36, No. 10 3341–3353 doi:10.1093/nar/gkn208 Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication Paul Peixoto1,2, Yang Liu3, Sabine Depauw1,2, Marie-Paule Hildebrand1,2,4, David W. Boykin3, Christian Bailly1,2, W. David Wilson3 and Marie-He´ le` ne David-Cordonnier1,2,* Downloaded from https://academic.oup.com/nar/article/36/10/3341/2410535 by guest on 23 September 2021 1INSERM U-837, Team 4-‘Molecular and cellular targeting for cancer treatment’, Jean-Pierre Aubert Research Center, Institut de Recherches sur le Cancer de Lille, Place de Verdun, F-59045 Lille, 2IMPRT-IFR114, Lille, France, 3Department of Chemistry, Georgia State University, Atlanta, GA, USA and 4Institut de Recherches sur le Cancer de Lille - IRCL, Lille, France Received February 5, 2008; Revised and Accepted April 8, 2008 ABSTRACT control of transcription factors activity by those The development of small molecules to control gene compounds. expression could be the spearhead of future- targeted therapeutic approaches in multiple pathol- ogies. Among heterocyclic dications developed with INTRODUCTION this aim, a phenyl-furan-benzimidazole dication The aim of exerting precise control over the expression DB293 binds AT-rich sites as a monomer and level of specified genes using a small molecule drug is an ’ 5 -ATGA sequence as a stacked dimer, both in the objective with major consequences for many therapeutic minor groove. Here, we used a protein/DNA array applications including cancer, chronic inflammatory dis- approach to evaluate the ability of DB293 to specif- orders, neuro-degenerative or cardiovascular diseases ically inhibit transcription factors DNA-binding in a (1–4).
    [Show full text]
  • Nomogram Developed with Selenoprotein S (Sels) Genetic Variation and Clinical Characteristics Predicting Risk of Coronary Artery Disease in a Chinese Population
    777 Original Article Nomogram developed with selenoprotein S (SelS) genetic variation and clinical characteristics predicting risk of coronary artery disease in a Chinese population Ding-Yu Wang1#, Ting-Ting Wu1#, Ying-Ying Zheng2, Yi-Tong Ma1, Xiang Xie1 1Department of Cardiology, First Affiliated Hospital of Xinjiang Medical University, Urumqi, China; 2Department of Cardiology, First Affiliated Hospital of Zhengzhou University, Zhengzhou, China Contributions: (I) Conception and design: X Xie; (II) Administrative support: YT Ma; (III) Provision of study materials or patients: DY Wang; (IV) Collection and assembly of data: TT Wu; (V) Data analysis and interpretation: YY Zheng; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Xiang Xie. Department of Cardiology, First Affiliated Hospital of Xinjiang Medical University, No. 137, Liyushan Road, Urumqi 830011, China. Email: [email protected]. Background: Selenoprotein S (SelS) is a novel selenoprotein encoded by the SelS gene on chromosome 15q26.3. SelS is associated with the development of diabetes, dyslipidemia and macrovascular complications. However, the relationship between genetic polymorphisms of SelS and coronary artery disease (CAD) remains unclear. Methods: In the present study, we genotyped four single nucleotide polymorphisms (rs117613208, rs117512970, rs986500879, rs542989868) of SelS gene using direct sequencing method in a case-control study (576 CAD cases and 452 control subjects). Furthermore, we developed a predictive model using SelS genetic variation and clinical variables to predict risk of CAD. Results: We found that rs117613208 T allele was more frequent in the CAD cases than that in the controls. Logistic regression analysis suggested after adjustment of other confounders, the difference remained significant between the two groups [odds ratio (OR) =2.107, 95% confidence interval (CI): 1.239– 3.583, P<0.006].
    [Show full text]
  • An In-Depth Analysis of Proteomics Expression Profiling in Rat Glomeruli Utilizing LC-MS
    Articles Preclinical Medicine July 2010 Vol.55 No.20: 2142–2151 doi: 10.1007/s11434-010-3291-4 SPECIAL TOPICS: An in-depth analysis of proteomics expression profiling in rat glomeruli utilizing LC-MS HONG Quan1*, XUE Peng2*, LÜ Yang1, CHEN XiangMei1, QI Ka1 & WU Di1† 1 Kidney Department & Institute of Nephrology, Division of Clinical Internal Medicine, Chinese PLA General Hospital, Beijing 100853, China 2 Laboratory of Proteomics, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China Received December 23, 2009; accepted April 8, 2010 Glomeruli are an essential functional element of renal filtration. The majority of renal diseases caused by glomerular sclerosis or fibrosis may result in renal dysfunction. A fomulate protein profile, a comprehensive analysis of glomeruli of normal rats was conducted in this study via protein spectrum. Functional annotation and classification of these proteins were performed and it was found that 26 had the same glomerule (endothelial cells, podocytes and mesangial cells) markers with proteins. glomeruli, protein spectrum, multidimensional protein identification technology, glomerule marker, homologene Citation: Hong Q, Xue P, Lü Y, et al. An in-depth analysis of proteomics expression profiling in rat glomeruli utilizing LC-MS. Chinese Sci Bull, 2010, 55: 2142−2151, doi: 10.1007/s11434-010-3291-4 Glomeruli are a critical element of the kidneys, and func- disease (CDK) have proposed to analyze the proteins in the tions’ urine filtration. Glomerular dysfunction due to scle- urine, which may represent the plasma protein instead of rosis or fibrosis is a common cause of the end stages of re- native proteins of kidneys in terms of the abnormal tubule nal diseases.
    [Show full text]
  • LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA809561 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] Product data: Product Type: Primary Antibodies Clone Name: OTI4E11 Applications: WB Recommended Dilution: WB 1:500~2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-260 of human LHX4 (NP_203129) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 42.9 kDa Gene Name: LIM homeobox 4 Database Link: NP_203129 Entrez Gene 16872 MouseEntrez Gene 360858 RatEntrez Gene 89884 Human Q969G2 Background: This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. [provided by RefSeq, Dec 2010] Synonyms: CPHD4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561 Protein Families: Druggable Genome, Transcription Factors Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY LHX4 ([RC204014], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]
  • Inducers of the Endothelial Cell Barrier Identified Through Chemogenomic Screening in Genome-Edited Hpsc-Endothelial Cells
    Inducers of the endothelial cell barrier identified through chemogenomic screening in genome-edited hPSC-endothelial cells Filip Roudnickya,1, Jitao David Zhang (张继涛)b,1,2, Bo Kyoung Kimc, Nikhil J. Pandyab, Yanjun Lana, Lisa Sach-Peltasond, Heloise Ragellec, Pamela Strassburgerc, Sabine Gruenerc, Mirjana Lazendicc, Sabine Uhlesc, Franco Revelantc, Oliv Eidamd, Gregor Sturmb, Verena Kueppersc, Klaus Christensena, Leonard D. Goldsteine, Manuel Tzourosb, Balazs Banfaib, Zora Modrusane, Martin Grafa, Christoph Patscha, Mark Burcina, Claas A. Meyera,3, Peter D. Westenskowc,2,3, and Chad A. Cowanf,g,h,2,3 aTherapeutic Modalities, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; bPharmaceutical Sciences, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; cOcular Technologies, Immunology, Infectious Diseases and Ophthalmology, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; dPharma Research and Early Development Informatics, Pharmaceutical Research and Early Development, Roche Innovation Center Basel, F. Hoffmann-La Roche Ltd., CH-4070 Basel, Switzerland; eMolecular Biology Department, Genentech Inc., South San Francisco, CA 94080; fDivision of Cardiology, Department of Medicine, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, MA 02215; gDepartment of Stem Cell and Regenerative
    [Show full text]