DOCSLIB.ORG

A Novel Mutation in HESX1 Causes Combined Pituitary Hormone Deficiency Without Septo Optic Dysplasia Phenotypes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Novel Mutation in HESX1 Causes Combined Pituitary Hormone Deficiency Without Septo Optic Dysplasia Phenotypes 2016, 63 (4), 405-410 Note A novel mutation in HESX1 causes combined pituitary hormone deficiency without septo optic dysplasia phenotypes Masaki Takagi1), 2) *, Mai Takahashi3) *, Yoshiaki Ohtsu3), Takeshi Sato1), Satoshi Narumi1), Hirokazu Arakawa3) and Tomonobu Hasegawa1) 1) Department of Pediatrics, Keio University School of Medicine, Tokyo, Japan 2) Department of Endocrinology and Metabolism, Tokyo Metropolitan Children’s Medical Center, Tokyo, Japan 3) Department of Pediatrics, Gunma University Graduate School of Medicine, Maebashi, Japan Abstract. Heterozygous and/or homozygous HESX1 mutations have been reported to cause isolated growth hormone deficiency (IGHD) or combined pituitary hormone deficiency (CPHD), in association with septo optic dysplasia (SOD). We report a novel heterozygous HESX1 mutation in a CPHD patient without SOD phenotypes. The propositus was a one- year-old Japanese girl. Shortly after birth, she was found to be hypoglycemic. She was diagnosed with central adrenal insufficiency based on low cortisol and ACTH at a time of severe hypoglycemia. Further endocrine studies indicated that the patient also had central hypothyroidism and growth hormone deficiency. Using a next-generation sequencing strategy, we identified a novel heterozygous HESX1 mutation, c.326G>A (p.Arg109Gln). Western blotting and subcellular localization revealed no significant difference between wild type and mutant HESX1. Electrophoretic mobility shift assays showed that the mutant HESX1 abrogated DNA-binding ability. Mutant HESX1 was unable to repress PROP1-mediated activation. In conclusion, this study identified Arg109 as a critical residue in the HESX1 protein and extends our understanding of the phenotypic features, molecular mechanism, and developmental course associated with mutations in HESX1. When multiple genes need to be analyzed for mutations simultaneously, targeted sequence analysis of interesting genomic regions is an attractive approach. Key words: HESX1, Combined pituitary hormone deficiency, Homeobox, Targeted next-generation sequencing THE PROLIFERATION and terminal differentia- tion to these genes, some causative genes for Kallmann tion of the anterior pituitary gland are strongly influ- syndrome (KS), which is defined by hypogonadotropic enced by the precise spatial and temporal expression hypogonadism with anosmia, have been identified of transcription factors [1-3]. Mutations in these tran- in a small number of CPHD and septo optic dyspla- scription factors result in various types of congenital sia (SOD), a condition characterized by pituitary hor- hypopituitarism, ranging from isolated growth hor- mone deficiencies, optic nerve hypoplasia and midline mone deficiency (IGHD) to combined pituitary hor- defects [4-7]. mone deficiency (CPHD). Several transcription factor Among transcription factor genes responsible for genes have been linked to the pathogenesis of CPHD, CPHD, human HESX1 mutation was first reported including POU1F1, PROP1, LHX3, LHX4, OTX2, in sibling case with SOD in homozygous state [8-9]. SOX2, SOX3, GLI2, and HESX1 [2]. Recently, in addi- Subsequently, heterozygous HESX1 mutations were also shown to be associated with CPHD or IGHD, with Submitted Jul. 14, 2015; Accepted Dec. 17, 2015 as EJ15-0409 or without SOD phenotypes [10-12]. To date, more Released online in J-STAGE as advance publication Jan. 15, 2016 than 22 mutations in HESX1 have been described Correspondence to: Tomonobu Hasegawa, M.D., Ph.D., (HGMD; http://www.hgmd.cf.ac.uk). The majority Department of Pediatrics, Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. of these are missense mutations (14 missense, 2 non- E-mail: [email protected] sense, 2 splice site, 1 gross insertion, and 3 frameshift *Masaki Takagi and Mai Takahashi contributed equally to this work. mutations). Here, we report a case of CPHD without ©The Japan Endocrine Society 406 Takagi et al. SOD phenotypes carrying a novel heterozygous mis- PROP1, LHX3, LHX4, HESX1, OTX2, SOX3, SOX2, sense mutation in HESX1. Through molecular analy- GLI2, and 12 genes implicated in KS, including CHD7, ses, we showed that substitution of a conserved, critical FGFR1, FGF8, GNRH1, GNRHR, KISS1, KISS1R, amino acid within the homeobox domain of HESX1 PROK2, PROKR2, TAC3, TACR3 and KAL1 using abrogated DNA-binding, and was unable to repress the MiSeq instrument (Illumina Inc, San Diego, CA, PROP1-mediated activation. This study extends our USA) according to the SureSelect protocol (Agilent understanding of the phenotypic features, molecular Technologies, Santa Clara, CA, USA) as described mechanism, and developmental course associated with before [13]. mutations in the HESX1 gene. Crystal structure modeling Patient The crystal structure of the paired homeodomain of The propositus was a one-year-old Japanese girl born Drosophila melanogaster (protein data bank ID 1FJL; at 38 weeks of gestation after an uncomplicated preg- http://www.rcsb.org/pdb/, whose sequence identity nancy and delivery. The parents were nonconsanguin- with human HESX1 homeobox domain is 67%) was eous and phenotypically normal. The father was 160.5 used as a reference wild-type structure for modeling cm (-0.6 SD) tall and mother was 162 cm (0.8 SD) tall. the structure of p.Arg109Gln HESX1 using the PyMOL Apgar scores were 8 and 9 at 1 and 5 min, respectively. Molecular Graphics System (http://www.pymol.org). At birth her weight was 2,525 g (-1.3 SD), and length was 46.0 cm (-1.1 SD). Frequent apneic spells ensued Functional studies shortly after birth, and she was found to be hypogly- Construction of expression vectors cemic (blood glucose 20 mg/dL). She was diagnosed To generate HESX1 expression vectors, 2001 bp with central adrenal insufficiency based on low cortisol comprising the entire genomic HESX1 locus was (<1.0 μg/dL) and adrenocorticotropin (ACTH) (<2.0 cloned into pCMV-myc (Clontech, Palo Alto, CA) pg/mL) at a time of severe hypoglycemia. Further and pEGFPN1 (Clontech, Palo Alto, CA). To gen- endocrine studies indicated that the patient also had erate PROP1 expression vectors, PROP1 cDNA central hypothyroidism on the basis of a low free T4 was cloned into pCMV-myc vector. We introduced (0.44 ng/dL: Ref. 0.99–1.91) with an inappropriately the mutation by site-directed mutagenesis using the normal thyroid-stimulating hormone (TSH) concen- Prime STAR Mutagenesis Basal kit (TaKaRa, Otsu, tration of 3.09 mU/L (Ref. 0.77–7.3), and growth hor- Japan). The primer pairs, forward (F) and reverse mone (GH) deficiency based on no GH response on (R), used for mutagenesis were as follows: for- arginine hydrochloride testing (GH peak <0.1 ng/mL, ward 5′-AGAGGCCAAAGACCAAGAACTGCTTT Ref. 6<). The brain MRI exhibited anterior pituitary TAC-3′, reverse 5′-TTGGTCTTTGGCCTCTATAC hypoplasia, absent pituitary stalk, and ectopic posterior CAACTCAACT-3′. A luciferase reporter vector pituitary. Optic nerve hypoplasia was not evident. She was constructed by inserting six P3 sequences was diagnosed as CPHD and replacement therapy with (5′-AGCTTGAGTCTAATTGAATTACTGTAC-3′) L-thyroxine, hydrocortisone and recombinant human into a pGL4.24 [luc2P/minP] vector (Promega, GH was started. Examination by experienced oph- Madison, WI). thalmologists revealed no eye abnormality. At the last Western blotting examination at age of 17 months, she measured 71.9 COS1 cells transfected with the myc-tagged HESX1 cm (-2.4 SD), and weighed 7.24 kg (-2.5 SD). No other were harvested, and nuclear protein was isolated with family members showed growth disorders. the NE-PER nuclear extraction reagent kit (Pierce, Rockford, IL). Western blotting was performed with Mutation screening a mouse anti-myc monoclonal antibody (Invitrogen). After obtaining informed consent, and with the Subcellular localization analyses approval of the Institutional Review Board of Tokyo We visualized and photographed COS1 cells trans- Metropolitan Children’s Medical Center, genomic fected with GFP-tagged HESX1 using a BZ-X700 flu- DNA was extracted from peripheral blood leuco- orescence microscope (Keyence, Osaka, Japan). cytes of the propositus and her parents. We sequenced EMSA experiment 9 genes implicated in CPHD, including POU1F1, The sequences of the biotin-labeled double stranded A novel HESX1 mutation 407 oligonucleotide used as probe in the EMSA experiment was 5′-AGCTTGAGTCTAATTGAATTACTGTAC-3′ (P3 sequence). Five microgram of nuclear protein extraction was incubated at room temperature in 20-μL binding reaction mixture contained 20 fmol probe, 50 mM KCl, 5 mM MgCl2, 2.5% glycerol, 0.05% NP-40, and 1 μg poly (dI-dC) for 20 min. For competition experiments, a large excess (200x) of unlabeled com- petitor oligonucleotides was included in the binding reactions. The protein-DNA complexes were subject to gel electrophoresis and transferred to a nylon mem- brane. The biotin-labeled probe was detected with the Lightshift chemiluminescent EMSA kit (Pierce). For super-shift assay, we used a mouse polyclonal anti- HESX1 antibody (ab67728, Abcam, Cambridge, MA). Transactivation assay HESX1 has been shown to function as a repres- sor of PROP1-mediated gene stimulation [14]. To assess the ability of the mutatnt HESX1 to repress transcription, wild-type or mutant HESX1 pCMV- myc expression vectors were transfected into COS1 cells together with PROP1, in the presence of the 6xP3Luc plasmid that contains six copies of consen- sus P3 target sites common to PROP1 and HESX1 (5′-AGCTTGAGTCTAATTGAATTACTGTAC-3′, underlined) [8, 15], and pRL-CMV vector used
Load more

Recommended publications
  • Activated Peripheral-Blood-Derived Mononuclear Cells
    Transcription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays.
    [Show full text]
  • Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
    International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R.
    [Show full text]
  • Specificity Landscapes Unmask Submaximal Binding Site Preferences of Transcription Factors
    Specificity landscapes unmask submaximal binding site preferences of transcription factors Devesh Bhimsariaa,b,1, José A. Rodríguez-Martíneza,2, Junkun Panc, Daniel Rostonc, Elif Nihal Korkmazc, Qiang Cuic,3, Parameswaran Ramanathanb, and Aseem Z. Ansaria,d,4 aDepartment of Biochemistry, University of Wisconsin–Madison, Madison, WI 53706; bDepartment of Electrical and Computer Engineering, University of Wisconsin–Madison, Madison, WI 53706; cDepartment of Chemistry, University of Wisconsin–Madison, Madison, WI 53706; and dThe Genome Center of Wisconsin, University of Wisconsin–Madison, Madison, WI 53706 Edited by Michael Levine, Princeton University, Princeton, NJ, and approved September 24, 2018 (received for review July 13, 2018) We have developed Differential Specificity and Energy Landscape Here, we report the development of Differential Specificity (DiSEL) analysis to comprehensively compare DNA–protein inter- and Energy Landscapes (DiSEL) to compare experimental actomes (DPIs) obtained by high-throughput experimental plat- platforms, computational methods, and interactomes of TFs, forms and cutting edge computational methods. While high-affinity especially those factors that bind identical consensus motifs. Our DNA binding sites are identified by most methods, DiSEL uncovered results reveal that (i) most high-throughput experimental plat- nuanced sequence preferences displayed by homologous transcription forms reliably identify high-affinity motifs but yield less reliable factors. Pairwise analysis of 726 DPIs uncovered homolog-specific dif- information on submaximal sites; (ii) with few exceptions, com- ferences at moderate- to low-affinity binding sites (submaximal sites). putational methods model DPIs with a focus on high-affinity DiSEL analysis of variants of 41 transcription factors revealed that sites; (iii) submaximal sites improve the annotation of biologi- many disease-causing mutations result in allele-specific changes in cally relevant binding sites across genomes; (iv) among members binding site preferences.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name LIM homeobox 4 Gene Symbol LHX4 Organism Human Gene Summary This gene encodes a member of a large protein family which contains the LIM domain a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. Gene Aliases CPHD4, FLJ22769 RefSeq Accession No. NC_000001.10, NG_008081.1, NT_004487.19 UniGene ID Hs.658487 Ensembl Gene ID ENSG00000121454 Entrez Gene ID 89884 Assay Information Unique Assay ID qHsaCED0002909 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000263726 Amplicon Context Sequence CTATGGAATCCCCCAGTCTCCATCCTCCATATCGTCCCTGCCATCCCACGCTCCT TTGCTCAATGGGCTGGATTACACGGTGGACAGTAATTTGGGCATCATTGC Amplicon Length (bp) 75 Chromosome Location 1:180243462-180243566 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 94 R2 0.9993 cDNA Cq 24.14 cDNA Tm (Celsius) 82.5 gDNA Cq 23.49 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report LHX4, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online.
    [Show full text]
  • MECHANISMS in ENDOCRINOLOGY: Novel Genetic Causes of Short Stature
    J M Wit and others Genetics of short stature 174:4 R145–R173 Review MECHANISMS IN ENDOCRINOLOGY Novel genetic causes of short stature 1 1 2 2 Jan M Wit , Wilma Oostdijk , Monique Losekoot , Hermine A van Duyvenvoorde , Correspondence Claudia A L Ruivenkamp2 and Sarina G Kant2 should be addressed to J M Wit Departments of 1Paediatrics and 2Clinical Genetics, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, Email The Netherlands [email protected] Abstract The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFkB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature.
    [Show full text]
  • Hesx1 Homeodomain Protein Represses Transcription As a Monomer and Antagonises Transactivation of Specific Sites As a Homodimer
    193 Hesx1 homeodomain protein represses transcription as a monomer and antagonises transactivation of specific sites as a homodimer J Quirk and P Brown MRC Human Reproductive Sciences Unit, 37 Chalmers Street, Edinburgh EH3 9ET, UK (Requests for offprints should be addressed to P Brown; Email: [email protected]) Abstract The homeobox repressor Hesx1, expressed throughout Rathke’s pouch and required for normal pituitary development, has been implicated in anterior pituitary pathogenesis in man. Prolonged expression of Hesx1 delays the appearance of anterior pituitary terminal differentiation markers in mice, particularly the gonadotroph hormones. We tested if Hesx1 could modulate gonadotrophin gene expression directly, and found that Hesx1 repressed both common alpha subunit (αGSU) and luteinising hormone β-subunit (LHβ) gene promoters. Repression mapped to the Pitx1 homeodomain protein transactivation site in the proximal αGSU promoter, but did not map to the equivalent site on LHβ. Hesx1 repression of the αGSU Pitx1 site was overridden by co-transfection of Pitx1. In contrast, Hesx1 antagonised Pitx1 transactivation of LHβ in a dose-dependent manner. This was due to monomeric binding of Hesx1 on αGSU and homodimerisation on LHβ. The homodimerisation site comprises the Pitx1 DNA binding site and a proximal binding site, and mutation of either inhibited homodimer formation. Conversion of the LHβ Pitx1 DNA binding site to an αGSU-type did not promote homodimer formation, arguing that Hesx1 has pronounced site selectivity. Furthermore, mutation of the proximal half of the homodimerisation site blocked Hesx1 antagonisation of Pitx1 transactivation. We conclude that Hesx1 monomers repress gene expression, and homodimers block specific transactivation sites.
    [Show full text]
  • LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA809561 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] Product data: Product Type: Primary Antibodies Clone Name: OTI4E11 Applications: WB Recommended Dilution: WB 1:500~2000 Reactivity: Human, Mouse, Rat Host: Mouse Isotype: IgG1 Clonality: Monoclonal Immunogen: Human recombinant protein fragment corresponding to amino acids 1-260 of human LHX4 (NP_203129) produced in E.coli. Formulation: PBS (PH 7.3) containing 1% BSA, 50% glycerol and 0.02% sodium azide. Concentration: 1 mg/ml Purification: Purified from mouse ascites fluids or tissue culture supernatant by affinity chromatography (protein A/G) Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Predicted Protein Size: 42.9 kDa Gene Name: LIM homeobox 4 Database Link: NP_203129 Entrez Gene 16872 MouseEntrez Gene 360858 RatEntrez Gene 89884 Human Q969G2 Background: This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor involved in the control of differentiation and development of the pituitary gland. Mutations in this gene cause combined pituitary hormone deficiency 4. [provided by RefSeq, Dec 2010] Synonyms: CPHD4 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 LHX4 Mouse Monoclonal Antibody [Clone ID: OTI4E11] – TA809561 Protein Families: Druggable Genome, Transcription Factors Product images: HEK293T cells were transfected with the pCMV6- ENTRY control (Left lane) or pCMV6-ENTRY LHX4 ([RC204014], Right lane) cDNA for 48 hrs and lysed.
    [Show full text]
  • PDF Download
    Review Xatzipsalti Maria et al. Congenital Hypopituitarism: Various Genes, … Horm Metab Res 2018; 00: 00–00 Congenital Hypopituitarism: Various Genes, Various Phenotypes Authors Maria Xatzipsalti1, 2, Antonis Voutetakis1, Lela Stamoyannou2, George P. Chrousos1, Christina Kanaka-Gantenbein1 Affiliations ABSTRacT 1 Division of Endocrinology, Diabetes and Metabolism, The ontogenesis and development of the pituitary gland is a First Department of Pediatrics, Medical School, National highly complex process that depends on a cascade of transcrip- and Kapodistrian University of Athens, “Aghia Sofia” tion factors and signaling molecules. Spontaneous mutations Children's Hospital, Athens, Greece and transgenic murine models have demonstrated a role for 2 First Department of Pediatrics, “Aglaia Kyriakou” many of these factors, including HESX1, PROP1, PIT1, LHX3, Children's Hospital, Athens, Greece LHX4, SOX2, SOX3, OTX2, PAX6, FGFR1, SHH, GLI2, and FGF8 in the etiology of congenital hypopituitarism. Genetic muta- Key words tions in any of these factors can lead to congenital hypopitui- pituitary, combined pituitary hormone deficiency, congenital tarism, which is characterized by the deficiency in one or more hypopituitarism, transcription factors, syndromic hypopitui- pituitary hormones. The phenotype can be highly variable, tarism, non-syndromic hypopituitarism consisting of isolated hypopituitarism or more complex disor- ders. The same phenotype can be attributed to different gene received 27.03.2018 mutations; while a given gene mutation can
    [Show full text]
  • The Tumor Suppressor HHEX Inhibits Axon Growth When Prematurely Expressed in Developing Central Nervous System Neurons
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by epublications@Marquette Marquette University e-Publications@Marquette Biological Sciences Faculty Research and Biological Sciences, Department of Publications 9-1-2015 The umorT Suppressor HHEX Inhibits Axon Growth when Prematurely Expressed in Developing Central Nervous System Neurons Matthew .T Simpson Marquette University Ishwariya Venkatesh Marquette University Ben L. Callif Marquette University Laura K. Thiel Marquette University Denise M. Coley Marquette University See next page for additional authors Accepted version. Molecular and Cellular Neuroscience, Vol 68 )September 2015): 272-283. DOI. © 2015 Elsevier Inc. Used with permission. NOTICE: this is the author’s version of a work that was accepted for publication in Molecular and Cellular Neuroscience. Changes resulting from the publishing process, such as peer review, editing, corrections, structural formatting, and other quality control mechanisms may not be reflected in this document. Changes may have been made to this work since it was submitted for publication. A definitive version was subsequently published in Molecular and Cellular Neuroscience, Vol 68 )September 2015): 272-283. DOI. Authors Matthew T. Simpson, Ishwariya Venkatesh, Ben L. Callif, Laura K. Thiel, Denise M. Coley, Kristen N. Winsor, Zimei Wang, Audra A. Kramer, Jessica K. Lerch, and Murray G. Blackmore This article is available at e-Publications@Marquette: https://epublications.marquette.edu/bio_fac/515 NOT THE PUBLISHED VERSION; this is the author’s final, peer-reviewed manuscript. The published version may be accessed by following the link in the citation at the bottom of the page. The Tumor Suppressor HHEX Inhibits Axon Growth When Prematurely Expressed in Developing Central Nervous System Neurons Matthew T.
    [Show full text]
  • Regulation of Type I Interferons in Health and Autoimmune Disease
    Regulation of type I interferons in health and autoimmune disease Antonios Psarras Submitted in accordance with the requirements for the degree of Doctor of Philosophy (PhD) University of Leeds Leeds Institute of Rheumatic and Musculoskeletal Medicine September 2018 i Intellectual property and publication statements The candidate confirms that the work submitted is his own, except where work which has formed part of jointly-authored publications has been included. The contribution of the candidate and the other authors to this work has been explicitly indicated below. The candidate confirms that appropriate credit has been given within the thesis where reference has been made to the work of others. Chapter 1 includes data from a jointly-authored publication: Psarras A, Emery P, Vital EM. Type I interferon-mediated autoimmune diseases: pathogenesis, diagnosis and targeted therapy. Rheumatology (Oxford). 2017;56(10):1662-75. Psarras A performed the review of literature, critically appraised scientific evidences of the relevant topics and led the writing of the manuscripts. Emery revised the manuscripts for important intellectual content and final approval of the manuscript. Chapter 3 includes data from two jointly-authored publications: El-Sherbiny YM*, Psarras A*, Yusof MYM, Hensor EMA, Tooze R, Doody G, et al. A novel two-score system for interferon status segregates autoimmune diseases and correlates with clinical features. Sci Rep. 2018;8(1):5793. *joint first author El-Sherbiny YM, Emery P, and Vital EM performed conception and design
    [Show full text]
  • Transcription Factor Hlx Controls a Systematic Switch from White to Brown Fat Through Prdm16-Mediated Co-Activation
    University of Massachusetts Medical School eScholarship@UMMS Open Access Articles Open Access Publications by UMMS Authors 2017-07-12 Transcription factor Hlx controls a systematic switch from white to brown fat through Prdm16-mediated co-activation Lei Huang University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs Part of the Biochemistry, Biophysics, and Structural Biology Commons, Cellular and Molecular Physiology Commons, and the Genetics and Genomics Commons Repository Citation Huang L, Pan D, Chen Q, Zhu L(, Ou J, Wabitsch M, Wang Y. (2017). Transcription factor Hlx controls a systematic switch from white to brown fat through Prdm16-mediated co-activation. Open Access Articles. https://doi.org/10.1038/s41467-017-00098-2. Retrieved from https://escholarship.umassmed.edu/ oapubs/3214 Creative Commons License This work is licensed under a Creative Commons Attribution 4.0 License. This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. ARTICLE DOI: 10.1038/s41467-017-00098-2 OPEN Transcription factor Hlx controls a systematic switch from white to brown fat through Prdm16-mediated co-activation Lei Huang1, Dongning Pan1, Qingbo Chen1, Lihua J. Zhu1, Jianhong Ou1, Martin Wabitsch2 & Yong-Xu Wang1 Browning of subcutaneous white fat (iWAT) involves several reprograming events, but the underlying mechanisms are incompletely understood. Here we show that the transcription factor Hlx is selectively expressed in brown adipose tissue (BAT) and iWAT, and is translationally upregulated by β3-adrenergic signaling-mediated suppression of the translational inhibitor 4E-BP1.
    [Show full text]