Random Mutagenesis for the Discovery of Obligate Intracellular Bacterial In vivo

Virulence Genes

DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

By

Hannah S. Bekebrede

Graduate Program in Molecular Cellular and Developmental Biology

The Ohio State University

2019

Dissertation Committee

Yasuko Rikihisa

Amal Amer

Estelle Cormet-Boyaka

Stephanie Seveau

Copyrighted by

Hannah S. Bekebrede

2019

ABSTRACT

Ehrlichia spp. are emerging tick-borne obligatory intracellular bacteria that cause febrile diseases with abnormal blood cell counts and signs of hepatitis. Ehrlichia HF strain provides an excellent mouse disease model of fatal human ehrlichiosis. We recently established stable culture of Ehrlichia HF strain in DH82 canine macrophage cell line, and annotated its whole genome sequence. To identify genes required for in vivo virulence of Ehrlichia, we constructed random insertional HF strain mutants by using

Himar1 transposon-based mutagenesis procedure. Of total 158 insertional mutants isolated, 84 insertions were within the non-coding regions, and 74 insertions were in the coding regions of 55 distinct protein coding genes including TRP120 and multi-copy genes, such as p28/omp-1, virB2, and virB6. Using limited dilution methods, nine stable clonal mutants that had no apparent defect for intracellular multiplication in DH82 macrophages, were obtained. Mouse virulence of seven mutant clones was similar to that of wild-type HF strain, whereas two mutant clones showed significantly retarded growth in blood, livers, and spleens, and the mice inoculated with them lived longer than mice inoculated with wild-type. The two clones contained mutations in genes conserved among Ehrlichia spp., but lacked homology to other bacterial genes. Inflammatory cytokine mRNA levels in the liver of mice infected with the two mutants were significantly diminished than those infected with HF strain wild-type, except IFN-γ, IL-

1β, and IL-12 p40 in one clone. Thus, we identified two Ehrlichia genes responsible for non-macrophage infection-related virulence.

ii ACKNOWLEDGEMENTS

I must first thank my advisor Dr. Yasuko Rikihisa for making this work possible.

Thank you for your guidance, patience, and expertise. I have been particularly inspired by your emphasis on innovative work and curiosity. I also extend thanks to my graduate studies committee Dr. Amal Amer, Dr. Estelle Cormet-Boyaka, and Dr. Stephanie

Seveau for guidance, clarity, and encouragement. Thank you also Dr. Mingqun Lin for equipping me with the skills I needed to complete this project, and for patiently answering all my questions. I am indebted to my lab colleagues Drs. Omid

Teymournejad, Weiyan Huang, Wenqing Zhang, Khem Budachetri, Pratibha Sharma,

Qingming Xiong, as well as fellow students Qi Yan, Mariella Mestres-Villanueva, Qian

Zhang, Anthony Smith, and Katie Bachman. Thank you for being willing to workshop

(more specifically, listening to me rant) and for your support and humor; especially to

Anthony who helped with H58 mouse and PCR experiments. Thank you to my family for your simultaneous high expectations that encouraged me to pursue graduate studies and support that allowed me to continue them, especially over the last few months. Mike, thank you for joining me and for your support. Your sacrifice and patience will mean everything forever. I want to extend gratitude also to my friends, especially Alecia,

Deena, Paul, and Victoria, as well as Kaitlin, Lisa, and Megan for sharing my triumphs and failures. The mouse studies described here would not have been possible without the

University Laboratory Animal Resources facilities, staff, and training. This work was generously funded by the National Institute of Health and the C. Glenn Barber intramural fund.

iii VITAE

2006-2010………………………………………………………B.S. Cedarville University

2010-2011……………………………………….. MLS Southwest General Health Center

School of Medical Technology

2011-2014…………………………………………………...Medical Laboratory Scientist,

Southwest General Health Center

2014-present………………………………………………...Graduate Research Associate,

The Ohio State University

Publication

Xiong, Q., H. Bekebrede, et al. (2016). "An Ecotype Neorickettsia risticii Causing Potomac Horse Fever in Canada." Applied and Environmental Microbiology 82(19): 6030-6036

Fields of Study

Major Field: Graduate Program in Molecular Cellular and Developmental Biology

iv Table of Contents ABSTRACT ...... ii ACKNOWLEDGEMENTS ...... iii Vitae ...... iv Table of Contents ...... v List of Tables ...... vi List of Figures ...... vii CHAPTER ONE INTRODUCTION ...... 1 Chapter Two ...... 14 HIMAR1 RANDOM TRANSPOSON LIBRARY IN HF STRAIN EHRLICHIA ... 14 2.1 Abstract ...... 14 2.2 Introduction ...... 15 2.3 Materials and Methods ...... 19 2.4 Results ...... 24 2.5 Discussion...... 29 Chapter Three ...... 83 MUTATED EHF_RS04100 AND EHF_0962 DO NOT AFFECT EHRLICHIA HF PROLIFERATION IN DH82 NOR ISE6 BUT DELAY INFECTION IN MICE ... 83 3.1 Abstract ...... 83 3.2 Introduction ...... 84 3.3 Materials and Methods ...... 86 3.4 Results ...... 90 3.5 Discussion...... 92 CHAPTER FOUR: MUTATED EHF_RS04100 AND_EHF0962 ALTER IMMUNE RESPONSE IN MICE ...... 105 4.1 Abstract ...... 105 4.2 Introduction ...... 106 4.3 Materials and Methods ...... 110 4.4 Results ...... 114 4.5 Discussion...... 115 CONCLUSION ...... 124 REFERENCES ...... 125

v List of Tables

Table 1 Himar1 Insertion Sites in HF Genome ...... 61

Table 2 Primers used ...... 81

vi List of Figures

Figure 2.1 pCis mCherry-SS Himar A7...... 33 Figure 2.2. Illustration of the ST-PCR scheme ...... 34 Figure 2.3 Insertion site-specific PCR to verify insertion site and flank PCR to verify clonality...... 35 Figure 2.4 HF mutant H53 expressing mCherry fluorescence ...... 36 Figure 2.5 Second-round ST-PCR ...... 37 Figure 2.6 Mapping the insertion site from sequenced ST-PCR product: one example ... 56 Figure 2.7 Genomic map of the HF strain, showing transposon insertion sites ...... 59 Figure 2.8 Effect of 30 degree incubation on transformation efficiency ...... 60 Figure 2.9 Flank PCRs confirm single insertion population in cloned Himar mutants in DH82 macrophages ...... 78 Figure 2.10 flank PCR showing method sensitivity ...... 80 Figure 3.1 Infectivity of cloned HF Himar1 mutants in tick cells ...... 95 Figure 3.2 Kaplan-Meier survival curves for mice inoculated with 9 cloned mutants and one mixture ...... 96 Figure 3.3 insert PCRs and diagrams showing H58 mixture ...... 97 Figure 3.4 Flank PCR showing that HF Ehrlichia Himar clones infecting ISE6 and mouse cells contain clones for their respective single insertions ...... 98 Figure 3.5. Growth curves of H43B and H59 clones ...... 102 Figure 3.6 LD50 of the Wild-type (WT) HF strain ...... 104 Figure 4.1 Spleen indices in mice infected with two different mutants...... 117 Figure 4.2 Proinflammatory cytokines gene expression in livers of mice inoculated with H59, H43B, and WT HF strain ...... 118 Figure 4.3 Anti-inflammatory cytokine gene expression in livers of mice infected with H59, H43B, and WT HF strain ...... 120 Figure 4.4 Kaplan-Meyer survival curves and flank PCR to detect the clonality of H34B and H59 ...... 121 Figure 4.5 Bacterial load in mice inoculated with H59, H43B, and WT HF strain…….122

vii

CHAPTER ONE INTRODUCTION

Human monocytic ehrlichiosis (HME)

Human monocytic ehrlichiosis (HME), discovered in 1986 (Maeda, Markowitz et al. 1987), is a serious emerging infectious disease that can cause severe morbidity and mortality and require hospitalization in as much as 60% of diagnosed cases (Olano,

Hogrefe et al. 2003) with complications such as pulmonary insufficiency, renal failure, encephalopathy and disseminated intravascular coagulation (DIC) leading to approximately 3% mortality rate (CDC 2019) in diagnosed cases. This organ failure may be caused by septic shock-like syndrome, especially in immunocompromised patients

(Fichtenbaum, Peterson et al. 1993, Pandey, Kochar et al. 2013). HME can be particularly dangerous to children, the immunocompromised, and elderly; between 2008 and 2012, the highest case fatality rate in the United States as reported by the Nationally

Notifiable Diseases Surveillance System (NNDSS) was seen in children (Paddock and

Childs 2003, Oteo and Brouqui 2005, Nichols Heitman, Dahlgren et al. 2016).

Furthermore, the incidence of immunocompromised adults in the United States is likely remaining stagnant or increasing due to HIV (Nosyk, Zang et al. 2019) and prescription of immunosuppressant medical interventions (Harpaz, Dahl et al. 2016). The population of the elderly (>/= 65 years) will increase from under 10% to 17% worldwide by 2050

(NIH 2016) and the overall seriousness of HME will increase accordingly.

1 Diagnosis

HME can be challenging to diagnose as it presents with nonspecific flu-like symptoms such as myalgia, headache, fever, and nausea (Paddock and Childs 2003,

Miura and Rikihisa 2007, Cheng, Nair et al. 2013) in humans. Initial laboratory findings are also quite nonspecific including leukopenia, thrombocytopenia, and elevated liver transaminases (Rikihisa 1991, Dumler, Madigan et al. 2007). Microscopic observation of morulae is extremely specific and is indeed how the pathogen was first identified (Ristic,

Holland et al. 1991), but has only an estimated 4% sensitivity (Woody and Hoskins

1991), and a hematology-trained medical laboratory scientist may not recognize this unfamiliar white blood cell inclusion. Morulae could easily be mistaken for nuclear fragments, Dohle bodies, or even toxic vacuolization. Indirect fluorescence antibody

(IFA) test against infected cells grown in vitro is the reference standard for diagnosing

HME, and acute and convalescent serum must be tested to notify the CDC. Whole blood, tissue, and bone marrow PCR for organism-specific genes is also highly sensitive before treatment (CDC 2019).

Veterinary presentation

E. canis was first identified in dogs in Algeria (Donatien and Lestoquard 1935).

In dogs, symptoms include fever, malaise, and pale mucosa (Straube 2010). A rapid antigen test is commercially available for E. canis diagnosis against outer membrane proteins rP30 antigen (Ohashi, Unver et al. 1998) called the SNAP test. PCR diagnosis is also available from some specialized laboratories. Where advanced diagnostic technology is unavailable, an experienced veterinarian might use thrombocytopenia as a diagnostic 2 marker for the canine disease (Bulla, Kiomi Takahira et al. 2004), or even be alerted by prolonged bleeding at a phlebotomy site (Ryan Llera 2018). Pet owners desire to protect their pets from insidious, potentially fatal, and expensive disease: German Shepherd dogs may develop severe disease more than other breeds (Nyindo, Huxsoll et al. 1980).

Vaccination and treatment options are also valuable to the military as E. canis is known for killing hundreds of military dogs during the Vietnam war (Rikihisa 1991).

Ehrlichia species also causes disease in economically-important livestock animals. Heartwater caused by E. ruminantium affects ruminants such as cattle, sheep, and goats causes hydropericardium, ascites, and internal edema, resulting in high fever, depression, and neurological symptoms. In acute form of the disease, death usually occurs within a week of symptom onset (Cowdry 1925, Rikihisa 1991).

Parasite lifecycle

While HME is not contagious between humans, it is zoonotic via Amblyomma americanum (Paddock and Childs 2003), Rhipicephalus sanguineus (Gondard, Cabezas-

Cruz et al. 2017) and Ixodes scapularis (Pritt, Allerdice et al. 2017) ticks. White-tailed deer are the primary host of E. chaffeensis, and domestic dogs may be the secondary host, where the bacteria do not cause disease (Ewing, Dawson et al. 1995). Ehrlichia must be acquired by feeding on mammals during tick development, since the organism cannot be transmitted vertically (Cheng, Nair et al. 2013). Recent studies also point to Eastern gray squirrels as another natural host for E. chaffeensis (Goessling, Allan et al. 2012). Not only do ticks use several mechanisms to disguise their bite in order to stay alive and attached long enough to take a blood meal (Kazimirova and Stibraniova 2013), symptoms 3 do not typically appear for 1-4 weeks after tick bite (Parola, Davoust et al. 2005), further complicating diagnosis. Frequently patients testing positive for tick-borne illness do not even recall being bitten (Kazimirova and Stibraniova 2013).

Humans can be infected with four different Ehrlichia species: E. chaffeensis, E. ewingii, Venezuelan Human Ehrlichiosis (VHE) of E. canis, and E. muris subsp. eauclairensis subsp. nov. (Pritt, Sloan et al. 2011, Pritt, Allerdice et al. 2017) (Anderson,

Dawson et al. 1991, Perez, Rikihisa et al. 1996, Buller, Arens et al. 1999). Ehrlichiosis is one of the most prevalent tick-borne zoonosis in North America (McQuiston, Paddock et al. 1999), with a range throughout the Eastern United States. Most cases reported to the

CDC come from Missouri, Oklahoma, Tennessee, Arkansas, and Maryland (Bakken,

Dumler et al. 1994). HME has also been reported in China, Korea, Mali, and Peru

(Whitlock, Fang et al. 2000).

Ehrlichia

Ehrlichia are alpha-proteobacteria that infect monocyte-macrophages and endothelial cells by ligand-mediated endocytosis rather than phagocytosis (Mohan

Kumar, Yamaguchi et al. 2013). In fact, if bacteria are phagocytosed rather than mediating their own uptake, they travel to the lysosome and are digested rather than staying in their early endosome-like inclusion as they prefer (Rikihisa 2003). This inclusion called a morula is decorated with several markers like Rab 5, early endosome antigen 1 (EEA) and the vacuolar (H+) ATPase that signal the cell to exclude it from the recycling pathway. Unlike other gram negative bacteria, Ehrlichia do not include common PAMPS like LPS, flagella, or peptidoglycan (Miura, Matsuo et al. 2011). This

4 trait has a dual function: the bacteria do not need these gene products since their small structure and obligate intracellular nature protect them from the need for protective, motility, and stabilizing agents. Lacking these components also helps Ehrlichia evade the mammalian immune system. Not only does eliminating common antigens disguise the organism, infected host cells demonstrate down-regulated PRRs (Yu, McBride et al.

2000). Typically of an obligate intracellular organism, Ehrlichia cannot utilize glucose as a carbon source, and is auxotrophic for 14-17 amino acids. Conversely, 40 E. chaffeensis genes encode binding and transport proteins. E. chaffeensis can synthesize all necessary nucleotides, vitamins and cofactors including biotin, folate, FAD, NAD, CoA, thiamine and protoheme. Infected host cells also upregulate human protein expression involved in cytoskeleton components, vesicular trafficking, cell signaling, and energy metabolism

(Yu, McBride et al. 2000, Lin, Zhi et al. 2002).

The gene expression of E. chaffeensis proteins differs widely within different host cell environments (Singu, Liu et al. 2005, Singu, Peddireddi et al. 2006, Seo, Cheng et al.

2008, Lin, Daugherty et al. 2013). For example, Ehrlichia express immunogenic membrane protein p28-Omp19 and p28-Omp20 in canine macrophage DH82 cells, but p28-Omp14 in tick cell line ISE6 (Singu, Liu et al. 2005). Our lab’s RNASeq data (NCBI

GEO accession number GPL18497) (Lin, Daugherty et al. 2013) revealed over 60 ORFs from 8 Ehrlichia strains including HF more than 10 or more-fold differentially expressed between ISE6 and canine DH82 cells, suggesting differential requirement of these gene products in two types of host cells. This differential gene expression within different cellular environments contributes to its host diversity and persistence (Ganta, Cheng et al.

2007, Lin, Daugherty et al. 2013).

5 Vaccines

No vaccine is currently available for veterinary or human use. Demand for vaccination options may expand as HME continue to increase and public awareness of tick-borne disease expands with burgeoning tick population. Various strategies have been adopted in the search for a human and veterinary Ehrlichia vaccine including attenuated whole-organism, single-component, and multi-component protein vaccines.

Inactivated E. canis organisms induce an immune response, but incomplete clinical protection against acute disease (Mahan, Kelly et al. 2005). A naturally attenuated strain of E. canis isolated from a dog in Israel protected experimentally intravenously inoculated dogs from clinical signs and bacterial load (Rudoler, Baneth et al. 2012). E. chaffeensis strains experimentally attenuated with Himar transposon mutagenesis were used to inoculate deer and dogs as representatives of Ehrlichia’s reservoir and accidental host respectively (Nair, Cheng et al. 2015), and one of these mutants were shown to restore some of the immune function characteristically disrupted in Ehrlichia infection (McGill, Nair et al. 2016).

Several single component vaccines have been tested against Ehrlichia species.

Inoculation with immunogenic p28 and Hsp60 have been shown to induce immune response and resistance to bacterial load against murine-tropic E. muris (Thomas,

Thirumalapura et al. 2011), (Crocquet-Valdes, Thirumalapura et al. 2011). Another outer membrane protein OMP-19 could even protect mice against virulent HF strain Ehrlichia

(Nandi, Hogle et al. 2007). Ehrlichial invasion EtpE immunization also resulted in significantly reduced infection of E. chaffeensis in mice (Mohan Kumar, Lin et al. 2015).

6 While none of these single methods have entered the market for human or animal use, a combination of factors may be feasible in the future.

Doxycycline

Doxycycline is a broad-spectrum antibiotic used to treat many intracellular diseases such as Lyme (Kowalski, Tata et al. 2010), macrolide-resistant mycoplasma (Ha,

Oh et al. 2018), chlamydia (Miller 2006), anthrax (CDC 2017), and rocky mountain spotted fever (CDC 2018). It also has wide clinical utility for off-label use as it is generally anti-inflammatory and anti-angiogenic, making it useful for chronic lymphocytic rhinitis (Windsor and Johnson 2006), rosacea (Rivero and Whitfeld 2018), and vascular diseases (Brown, Desai et al. 2004). Such wide usage makes the drug a valuable tool, but also opens up the risk of antibiotic resistance. Considering it is the choice indicated treatment for Ehrlichiosis (Paddock and Childs 2003) antibiotic-resistant organisms would be a disaster.

Furthermore, two populations cannot take doxycycline: those with tetracycline allergy and pregnant women. Since the drug needs to be taken for a 5-7 day course (CDC

2019), a drug allergy could be fatal. Although doxycycline is no longer strictly contraindicated during pregnancy (Muffly, McCormick et al. 2008), many providers may still be hesitant to use it due to a paucity of data on its safe use.

What happens if someone is diagnosed with HME and cannot take doxycycline?

What happens in the case of antibiotic resistant bacteria? Conventional medical laboratory technology currently has no way to carry out prompt Ehrlichia sensitivity

7 testing since this testing is only carried out on organisms easily culturable on plates. Even if HME was sent out for diagnostic culture, which is so unlikely as to be impossible, culturing the organism from blood would take weeks, which would be too late, and it is unlikely that even a reference laboratory would have protocols in place to test drug sensitivity. Thus, the only way antibiotic resistance would be discovered would be for several patients to die after treatment with doxycycline.

Doxycycline is also used off-label as an anti-inflammatory for disorders like rosacea (Rivero and Whitfield, 2018). It is known to inhibit proinflammatory cytokines

IL-1β, IL-6, TNF-α, IFN-γ in vitro (Krakauer and Buckley 2003). When administered 5-7 days after mouse infection with HF, it does not save mice from death, but does restore previously pathogenically depleted NKT cells to the spleen and inhibits TNF-α, IFN-γ, and IL-10 there as well (Stevenson, Estes et al. 2010). This could partly explain why

HME does not respond to any other antibiotics, including those that work in vitro: once the pathogenesis begins, it takes more than simply growth of the bacteria to cure the disease; the immunopathogenesis must also resolve. As we learn more about how this process works in fatal Ehrlichia infection, we may find alternative drugs for accomplishing this.

HF Ehrlichia

A less-characterized strain of Ehrlichia called HF was discovered in Ixodes ovatus ticks in Japan (Shibata, Kawahara et al. 2000) when tick homogenates were inoculated into laboratory mice, and the mice surprisingly died of Ehrlichiosis. The new

8 strain was propagated by passaging infected mouse spleens through further homogenization and inoculation until it was cultured in the Rikihisa lab [Lin, unpublished]. Since then, HF Ehrlichia has also been found in France (Matsumoto,

Joncour et al. 2007) and Romania (Andersson, Radbea et al. 2018). The strain is also sometimes called Ixodes ovatus Ehrlichia (IOE). In experimentally infected mice, light and electron microscopy revealed organisms in the Kupffer cells, endothelial cells near liver necrotic foci, mononuclear cells in the spleen and liver sinuses, and bone marrow endothelial cells of HF-infected mice (Shibata, Kawahara et al. 2000). Dogs experimentally infected with HF demonstrate no clinical signs for 41 days. Mild, transient thrombocytopenia and splenomegaly were considered minor consequences, thought interestingly one serum sample cross-reacted with E. canis antibody (Watanabe,

Oikawa et al. 2006).

Since this HF Ehrlichia can kill immunocompetent laboratory mice, it makes an excellent in vivo model for HME in scientifically and economically feasible small mammal model. Previous work on HME had been carried out with variously virulent strains of Ehrlichia chaffeensis in SCID mice (Li, Yager et al. 2001, Li, Chu et al. 2002,

Miura and Rikihisa 2007, Miura and Rikihisa 2009, Miura, Matsuo et al. 2011).

However, since a major symptom of HME is leukopenia significantly affecting lymphocytes (Ismail, Walker et al. 2012), and occasionally lymphocytic meningitis

(Gayle and Ringdahl 2001), and the immunopathology and protection against the disease involves T- and B- cells, an ideal animal model will involve in vivo T- and B- cells.

9 Immune response and dysregulation in fatal Ehrlichiosis

Effective immune response involves CD4+ and NKT cells producing IFN-γ activating macrophages to clear intracellular infection (Bitsaktsis, Huntington et al. 2004,

Ismail, Soong et al. 2004). CD8+ T cells (Ismail, Soong et al. 2004) and macrophages produce TNF-α, which stimulates macrophage signal cascades for producing other inflammatory cytokines, cell proliferation, and anti-apoptosis (Parameswaran and Patial

2010). In fatal Ehrlichia infection, this balance is disrupted.

The classic immunopathology of fatal ehrlichiosis is TNF-α overproduction by

CD8+ T cells, and IFN- γ underproduction accompanied by insufficiency of CD4+ T cells (Ismail, Soong et al. 2004, Bitsaktsis and Winslow 2006, Miura and Rikihisa 2007).

Rather than working together and regulating one another to clear infection, CD8+ overtakes CD4+ T cells in function. This leads to major overproduction of TNF-α, which is the most major source of liver damage (Ismail, Soong et al. 2004, Stevenson, Crossley et al. 2008). The Ehrlichia factor leading to this immune dysregulation is unknown.

Transposon mutagenesis

The Himar transposon was discovered in insects, then it was also discovered to be an extremely conserved sequence across several insect and other eukaryote species including nematodes, flatworms, and humans (Zhang, Sankar et al. 1998). It is named for the horn fly Haematobia irritans, which has 17,000 copies of Himar1, and is implicated in horizontal transfer to at least 2 other insect species (Lampe, Churchill et al. 1997). This led scientists to speculate that the transposition site was uncommonly nonspecific;

10 transposon mutagenesis was not a new concept and indeed had been in use by several groups (Kaufman and Rio 1991, Oram, Avdalovic et al. 2002, Hudson, Gorton et al.

2006), but these transposons were species- and to a lesser degree site-specific. Himar in vitro mechanism and non-specificity were tested by cloning the transposon complete with transposase on one vector, and co-transfecting it with a prey vector. From this, they learned that the transposon does not require any more elements than its transposase and inverted repeats, and that it inserts randomly at TA sites. This idea was further developed when groups transfected E. coli and GC-rich Mycobacteria with Himar1 and while

Himar1 was able to enter the Mycobacteria genome, it did so at a lower rate due to the relative paucity of available AT sites (Rubin, Akerley et al. 1999). The discovery of hyperactive Himar1 transposase mutants further enhanced the utility of the system

(Lampe, Akerley et al. 1999). From here, scientists realized that they could use Himar1 for random transposon mutagenesis, and did so enthusiastically including in

Streptococcus (May, Walker et al. 2004), Vibrio (Kim and Rhee 2003), Francisella

(Maier, Pechous et al. 2006), and Bacillus (Le Breton, Mohapatra et al. 2006), and even

Borellia (Morozova, Dubytska et al. 2005).

One ambitious group realized that this nonspecific, hyperactive transposon could be used to breach the previously genetically intractable obligate intracellular bacteria.

They engineered a vector with Himar1 transposase under control of the Anaplasma tr promotor so when transformed, the Anaplasma could use its own machinery to integrate the transposon into its genome, accomplishing random mutagenesis and allowing for gene function elucidation (Felsheim, Herron et al. 2006). This represented one of the best early random transposon mutagenesis methods; researchers had previously relied on 11 other, more specific transposons, and plasmid transformation, and overall favorite homologous recombination for other genetic manipulation.

Objectives of this Study

HF Ehrlichia is the best small mammal model for studying HME. The primary goal of this study is to identify virulence factors of HF Ehrlichia.

Overall hypothesis:

 A random HF Ehrlichia mutant library can be used to identify virulence factors –

both immune dysregulators and infection/survival factors – relevant to human and

veterinary disease caused by several members of the Anaplasmataceae.

Chapter 2: Generating an Ehrlichia HF strain random Himar1 transposon mutant library

Hypothesis: a random transposon mutant library can be generated in HF Ehrlichia recovered in DH82 cells.

Aims:

1. Transform HF Ehrlichia with a vector containing the Himar transposon, resulting in antibiotic resistant, red fluorescent, gene-knockout bacteria.

2. Identify Himar insertion sites

3. Evaluate mutants based on inter- or intra-genic disruption, gene product size, predicted function, and homology to other pathogens

12 Chapter 3: Mutated EHF_RS04100 and EHF_0962 do not affect HF Ehrlichia growth in DH82 nor ISE6 but delay infection in mice

Hypothesis: some mutants will demonstrate retarded growth in vitro and in vivo

Aims:

1. Evaluate selected cloned mutant growth in vitro in mammalian cells

2. Evaluate selected cloned mutant infection of in vitro tick cells

3. Evaluate cloned Himar mutants in mice

Chapter 4: Mutated EHF_RS04100 and EHF_0962 alter immune response in mice

Hypothesis: the gene product or products that causes immune dysregulation in HME can be identified by knocking it out in HF

Aims:

1. Measure spleen index in two mutant clone-infected mice

2. Measure cytokine expression in two mutant clone-infected mice in primary site of organ injury liver

13

Chapter Two

GENERATING AN EHRLICHIA HF STRAIN RANDOM HIMAR1 TRANSPOSON MUTANT LIBRARY 2.1 Abstract

Ehrlichia spp. are emerging tick-borne obligatory intracellular bacteria that infect monocytes-macrophages or granulocytes, and cause febrile diseases with abnormal blood cell counts and signs of hepatitis. Ehrlichia HF strain, which is most closely related to E. muris subsp. eauclairensis subsp. nov., a newly discovered human ehrlichiosis agent, provides an excellent mouse disease model of fatal human ehrlichiosis. The Rikihisa lab recently established stable culture of Ehrlichia HF strain in DH82 cells, and annotated its whole genome sequence. To identify genes required for in vivo virulence of Ehrlichia, I constructed random insertional HF strain mutants by using Himar 1 transposon-based mutagenesis procedure. Of total 158 insertional mutants isolated, 84 insertions were within the non-coding regions and 74 insertions were in the coding regions of 55 distinct protein coding genes. Using limited dilution methods, nine stable clonal mutants were obtained. The clones contained mutations in genes conserved among Ehrlichia spp, but without known homology to other bacterial genes. Thus, we generated a Himar random mutant library in HF strain Ehrlichia, a cloning scheme, and a flank PCR to verify clonality.

14

2.2 Introduction

Obligate intracellular organisms like Ehrlichia have historically been genetically intractable due to the necessity of keeping them alive during mutagenesis procedures.

Even when intracellular organisms such as Coxiella were manipulated using plasmid transformation (Suhan, Chen et al. 1996), Ehrlichia resisted because it does not harbor plasmids over its replication lifecycle. More recently, several methods have been developed to study Ehrlichia’s genome and components through mutagenesis. Both random and directed mutagenesis can be accomplished and each method has pros and cons. Random mutagenesis is carried out through transposon mutagenesis using hyperactively inserting transposons originally found in insects. Directed mutagenesis can be accomplished with group two introns called TargeTron (Cheng, Nair et al. 2013) and some success has been achieved with allelic exchange mutagenesis (Wang, Wei et al.

2017). In each case, Ehrlichia are transformed with plasmids or other constructs, and the mutation is carried out before the bacteria divide and overtake the population with the constructs. Furthermore, a technique is available to knock down transcribed gene products using peptide nucleic acid (Sharma, Teymournejad et al. 2017).

We chose to use random transposon mutagenesis due to the paucity of information on Ehrlichia gene functions. Fortunately, our lab has been able to culture, sequence, and annotate the HF genome so gene functions can sometimes be estimated as they are mutated. The creation of a random Himar1 transposon mutant library allows us to identify gene functions relating to in vivo infection and mutagenesis because if a specific gene mutant causes an effect in mouse infection, we know that gene was

15 important. We cannot study genes essential to in vitro mammalian cell infection because mutants corresponding to those genes cannot be recovered in our culture system. We tried recovering mutants in the in vitro system involving Ixodes scapularis embryonic (ISE6) cells, but though Ehrlichia could infect ISE6 cells, infected cells could not be passaged.

However, the mammalian in vivo system is complicated and different enough from in vitro mammalian DH82 culture that mutants recovered in DH82 cells can still exhibit an effect different from wild type in mice.

The Himar transposon is attractive for use due to its incredibly random insertion pattern (May, Walker et al. 2004), insertion pattern in TA and only once per genome

(Cartman and Minton 2010, Cheng, Nair et al. 2013),validated vector creation and use in previous studies (Felsheim, Herron et al. 2006), and mutant stability (Cheng, Nair et al.

2013).

All Ehrlichiae have extremely limited genome sizes due to their obligate intracellular nature. Since they obtain nutrients and energy from host cells, it is energenically inefficient for them to make their own. Thus, they encode only 866 ORFs in 1.18 Mb (GenBank accession NZ_CP007474 (Lin, Daugherty et al. 2013)). Of these

ORFs, more than 60% are housekeeping genes and mutants would not be recovered due to their critical nature. 60 are redundant including type IV secretion system, two- component system, are outer membrane proteins (porin, lipoproteins) etc., are essential for infection and not highly inflammatory (Kumagai, Cheng et al. 2006, Huang, Lin et al.

2008, Kumagai, Huang et al. 2008, Mohan Kumar, Yamaguchi et al. 2013, Rikihisa

2015, Lin, Liu et al. 2016, Rikihisa 2017, Sharma, Teymournejad et al. 2017,

Teymournejad, Lin et al. 2017, Yan, Lin et al. 2018). Out of the remaining 240 genes,

16 most which encode hypothetical proteins, our previous RNASeq data (Cheng, Lin et al.

2014) revealed ~100 ORFs are not expressed in both tick and mammalian cell culture, and ~100 ORFs of the HF strain are differentially expressed (>10 fold difference) between tick and human cells in culture, suggesting differential requirement of these gene products in two types of host cells. Thus, we expect maximum 140 KO mutants can be recovered by using tick and mammalian cell lines. We knew from previous experiments that once optimized, transformation experiments could yield 10 mutants per electroporation, so the odds of hitting at least one important gene are favorable.

One of the major obstacles to Ehrlichia mutagenesis is that bacteria must be released from the host cells they need to live, mutated, and then recovered in new host cells. This is accomplished by using highly infected cultures to effect host cell lysis on ice to prevent death from localized heat buildup, then electroporating in osmonically supportive but non-conductive sucrose. Even so, electroporation is expected to kill approximately half of the purified Ehrlichia, so sufficient culture must be used. Indeed, if dead bacteria are not seen in the cuvette, the efficacy of the procedure is viewed with suspicion. Electroporation is used because it allows for supercoiled plasmid DNA to be introduced into the bacteria via the pores it forms. Plasmid concentration is another variable to consider: too little plasmid results in low transformation efficiency, while other groups found that attempting to increase the DNA concentration above 10 μg results in arcing, killing all bacteria (Maglennon, Cook et al. 2013). Then, bacteria are plated in a minimal volume of very supportive media so that spatially they are more likely to come in contact with DH82 cells to infect. Bacterial viability after electroporation is enhanced by adding pyruvate to the recovery medium after pulsing. 17 Recovery of slow growing mutants is improved by culturing transformants in six-well plates rather than larger flasks. In this way, different transformants are separated from the initiation of culture, allowing slow-growing mutants, to thrive without competing for space and nutrients with faster-growing mutants. These slow-growing mutants are important because their mutated genes are likely important but not essential for host cell invasion, growth, and survival. This makes them promising candidates for in vivo study.

Once Ehrlichia were transformed and recovered in DH82 cells, they were treated with streptomycin and spectinomycin to remove untransformed bacteria. Since bacteria with the transposon insert now express aad streptomycin/spectinomycin antibiotic cassette, they survive this treatment. These antibiotics are suitable because they cannot treat infection in humans (Felsheim, Herron et al. 2006) so generating resistant mutants does not represent a public health risk.

The pCis Himar construct includes red fluorescent protein mCherry. This allows us to visualize fluorescent red mutated bacteria. Others have used GFP to similar effect

(Cheng, Nair et al. 2013); this may be useful in the future for complementation. Since only one antibiotic method can be responsibly used, mutants complemented by an alternative method of mutagenesis such as allelic exchange (Wang, Wei et al. 2017) with functional gene and GFP could be separated from un-complemented mutants with FACS and/or fluorescent screening similar to the method we use for cloning.

Other methods such as Southern blotting and simple nested PCR has been used to identify transposon mutants (Cheng, Nair et al. 2013), but semi-random, two step polymerase chain reaction (ST-PCR) balances sensitivity, specificity, and efficient use of time. Briefly, one primer has a mix of degenerate and specific sequence (semi-random)

18 that binds anywhere in the HF genome, while the other binds within the insert. This results in many nonspecific PCR products. The second step utilizes primers that bind to the primer sequence of the first PCR, resulting in a one or a few specific products (Chun,

Edenberg et al. 1997), which can be sequenced. These products are compared to the

Ehrlichia genome using a basic local alignment search tool (BLAST), revealing the insertion site or sites.

Many groups use pooled mutant testing to determine if certain mutants can infect laboratory animals. In this way they can determine if a gene is critical for infection in vivo because if one clone is not recovered from the animal’s tissues, that gene was likely important. However as I am seeking virulence factors, I needed to take a different approach. Inoculating a mixture of mutants would likely result in a normal course of infection since even if one mutated gene important for virulence is inoculated, others in the group would compensate. If the mutated gene was important for virulence but not critical for infection, it would still be recovered, and the effect would be obfuscated. For this reason, I sought to develop a cloning scheme to isolate and test single populations from mixtures resulting from high transformation efficiency.

2.3 Materials and Methods

HF Ehrlichia culture and purification

Canine histiocytic leukemia DH82 cells were cultured in DMEM (Dulbecco minimal essential medium; Mediatech, Manassas, VA) supplemented with 5% fetal bovine serum

(FBS; Atlanta Biologicals, Lawrenceville, GA) and 2 mM L-glutamine (L-Gln; GIBCO,

Waltham, MA) at 37°C under 5% CO2 in a humidified atmosphere as described

19 previously (Rikihisa, Stills et al. 1991, Mohan Kumar, Yamaguchi et al. 2013). Ehrlichia sp. HF was cultured in DH82 cells with the addition of 0.1μg/mL cycloheximide

(Millipore Sigma, Burlington, MA) at the same condition. The degree of bacterial infection in host cells was assessed by Diff-Quik staining. Briefly, a drop of infected cells were centrifuged onto a slide in a Cytospin 4 cytocentrifuge (Thermo Fisher, Waltham,

MA), then fixed and stained with HEMA 3 staining solutions (Thermo Fisher).

The ISE6 cell line, derived from the Ixodes scapularis tick embryo, was cultured in L15C300 medium at 34°C as described previously (Munderloh, Jauron et al. 1999).

Confluent Ehrlichia–infected DH82 cells at above 90% infectivity were harvested from three T25 flasks. Host cell–free bacteria was obtained by sonication on ice for 8 sec twice at output setting 3 using a fine tip on a W380 Sonicator (Heat Systems, Newtown,

CT). Lysed cells were centrifuged at 700 × g (Sorvall 6000D, Thermo Fisher) to remove unbroken cells and nuclei, filtered sequentially through 5.0- and 2.7-µm nylon syringe filters (Millipore, Billerica, MA), and centrifuged in 40 mL polycarbonate high speed centrifuge tubes (Nalgene Nunc International Corporation, Rochester, NY) at 10,000 × g

(Sorvall RC 5C Plus using SS-34 rotor) to pellet host cell–free bacteria as described previously (Lin, Liu et al. 2016).

pCis-mCherry-SS-Himar A7 plasmid purification and transformation of Ehrlichia sp. HF pCis mCherry-SS Himar A7 plasmid (Felsheim, Herron et al. 2006) (Figure 2.1) was used for transformation of Ehrlichia sp. HF. This plasmid carries a Himar1 mariner transposase, and genes encoding mCherry and spectinomycin/streptomycin antibiotic

20 resistance (aad) that are flanked by the inverted repeats recognizable by the transposase and to be inserted into the target genome. Both genes are controlled by the Anaplasma marginale transcriptional regulator 1 (Am-Tr1) promoter. The plasmids were purified from overnight dam-/dcm- E. coli cultures (200 ml) containing the plasmids using

EndoFree plasmid purification Maxi kit according to the manufacturer’s instructions

(Qiagen).

Freshly purified host cell-free bacteria were washed twice with 1 ml ice-cold 0.3

M sucrose and resuspended in 85 µl of 0.3 M sucrose. Bacteria were mixed with 6-8 µg plasmid, transferred to a 2-mm gap electroporation cuvette (Bio-Rad, Hercules, CA), and incubated on ice for 15 min (Qi Yan 2017 paper). Bacteria were electroporated at 2,500

V, 25 µF, and 400 Ω using a Gene Pulser Xcell™ Electroporation System (Bio-Rad,

Hercules, CA). Transformed HF were cultured in 6-well plate with a confluent monolayer of DH82 cells in 1 mL DMEM supplemented with 30% FBS, 4 mM L-Gln, and 10 mM sodium pyruvate (Corning), incubated at 30˚C for 16-20 hours to enhance aad expression, and then transferred to a 37°C incubator. After 2 days, transformed HF expressing aad were selected in the presence of 100 µg/ml spectinomycin, 100 µg/ml streptomycin, and 0.1 µg/ml cycloheximide, and the culture medium containing antibiotics was replaced twice a week until % infected cells reached above 10% (~ 2 weeks).

21 Image acquisition and analysis by DeltaVision microscopy

DH82 cells infected with Ehrlichia sp. HF transformed with pCis mCherry-SS Himar A7 plasmids were cytocentrifuged onto a slide and fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM

KH2PO4, pH 7.4) for 20 min at room temperature. After washing the cells with PBS, glass coverslips were mounted on the slide with an Antifade Mountant (Invitrogen), and sealed by a nail polish. Fluorescence images with overlay differential interference contrast (DIC) images were captured using a DeltaVision PersonalDV Deconvolution microscope system (GE Healthcare, Marlborough, MA). Ehrlichia sp. HF mutants expressing mCherry was visualized using TRITC filter sets.

Determine genomic insertion loci using semi-random nested PCR and Bioinformatics analysis

The genomic loci of the Himar insertion sites were determined by semi-random nested

PCR as previously described (Cheng, Nair et al. 2013) (Figure 2.2), using primers listed in Table 2. Briefly, DNA was purified from Ehrlichia sp. HF mutants using QIAamp

DNA blood mini kit according to the manufacturer’s instructions (Qiagen, Germantown,

MD). The first-step PCR reaction used transposon-specific primers outer P1 or P5 and a semi-conserved degenerate primer P2, which has a defined adapter sequence at the 5’-end that pairs with the universal primer P4 and a random sequence near the 3’-end to allow for random annealing in Ehrlichia chromosome. The first PCR reaction yielded a longer product that served as the template in the second-step PCR reaction using transposon-

22 specific inner primers (P3 or P6) and a second universal primer (P4) that anneals to the

5’-end of primer P2, allowing for specific amplification of the longer PCR product.

Residual primers, dNTPs, and enzymes were removed from the first-step PCR products using GeneJET DNA purification kit (Thermo, Waltham, MA). The final PCR products were resolved by 1% agarose gel electrophoresis, and the specific DNA bands were purified from the gel using a QIAquick Gel Extraction Kit (QIAGEN), and sequenced using transposon-specific primers P3 or P6. The resulting sequences were compared with

Ehrlichia sp. HF genome sequence (NCBI GenBank accession number:

NZ_CP007474.1) by BLASTN (Altschul, Gish et al. 1990) to map the transposon insertion sites on the genome. These insertion loci were mapped to the circular Ehrlichia sp. HF genome using GenomeViz software (Ghai, Hain et al. 2004).

NCBI conserved domain search was used to identify potential function of targeted proteins, and NCBI BLASTP was used to identify homology within the family

Anaplasmataceae and other related bacteria. Primers were designed using the NCBI primer-BLAST (Ye, Coulouris et al. 2012).

Cloning mutants by limiting dilution

104 DH82 cells resuspended in 50 μL DMEM culture medium (supplemented with 5%

FBS, 2 mM L-Gln, and 0.1 μg/mL cycloheximide) were seeded into each wells of a 96 well flat-bottomed plate (Greiner, Monroe, NC). Approximately 3 Ehrlichia sp. HF mutant-infected DH82 cells resuspended in 50 μL culture medium were inoculated into each well. After overnight incubation, 100 μL of additional culture medium was added to

23 each well and cells were allowed to grow to confluency. Then monolayers were scraped with sterile pipette tips and approximately 104 cells in 20 µL were transferred to a new

96-well flat, clear-bottom black plate (Tecan, Morrisville, NC). After cells reached confluency at approximate four days, mCherry fluorescence were detected using a Tecan

Infinite M Nano+ microplate reader (Tecan). Positive wells were expanded and checked for single insert clones using PCR analysis with primers flanking specifically to the target insertion sites.

Validating insertions and clonality by flanking PCR

Primers were designed upstream and downstream of Himar insertions in selected populations. PCR product was designed to be 90-400 bp for unmutated product. Since the inserted portion of the Himar transposon is 1833 bp, mutated products would be 1900 -

2285 bp; thus extending time was set to 3 minutes to recover these large products (Figure

2.3B).

2.4 Results

Transformation experiments leading to mutant bacteria

The Himar 1 transposase system has become the most popular method for random mutagenesis in obligate intracellular organisms like Anaplasmataceae (Felsheim, Herron et al. 2006, Cheng, Nair et al. 2013, Chavez, Fairman et al. 2015, Lamason, Kafai et al.

2018). The single-plasmid transposon construct modified from A. phagocytophilum

(Felsheim, Herron et al. 2006) and previously used in E. chaffeensis (Cheng, Nair et al. 24 2013) contained transposase and transposon insert cassette with inverted repeats recognized by the hyperactive transposase under the control of Amtr promotor from A. marginale (Fig 2.1) was used to generate a HF Ehrlichia transposon library. 69 independent transformation experiments were performed, and 23 experiments successfully led to the recovery of mutant HF Ehrlichia. Selected cultures were also screened for mutation using PCR for inserted sequence. Mutants recovered with streptomycin and spectinomycin were also checked for red fluorescence from mCherry expression (Fig 2.4).

ST-PCR

ST-PCR (Chun, Edenberg et al. 1997) was used to map the locus of each Himar insertion in the HF genome. 55 independent ST-PCR experiments were performed using the schematic in Figure 2.2. 2nd round ST-PCR products were resolved on an agarose gel

(Fig 2.5) and bands were gel purified, then submitted for sequencing and compared to the

HF genome using BLAST. Bands less than 500 bp tended to result in fragments that did not BLAST to the genome. Examples of alignment data are shown in Figure 2.6.

Random transposon mutagenesis resulted in 158 transposon insertions resulting from 23 successful transformation procedures (Table 1). Of these, 84 insertions were within non- coding regions and 74 insertions were in the coding regions of 55 distinct protein-coding genes (Fig 2.7A). Of the 55 protein-coding genes disrupted, 34 were annotated, and 21 were hypothetical proteins. Insertion in the genome was random as shown by distribution throughout the genome. Transposon mutants were also remarkably stable, being cultured

25 continuously for at least 20 passages representing 2 months at a time with no loss in bacterial resistance or transposon presence confirmed by PCR.

Each disrupted gene was BLASTed to other available genomes on NCBI and screened for homology to Anaplasmataceae and other pathogens (Table 1). Many of the genes are fractionally homologous to human pathogens E. chaffeensis and E. muris ssp. euclairensis.

Cloning HF strain mutants

Himar1 transposon insertions occur mostly once or twice per genome (Cheng,

Nair et al. 2013). As previous studies with Himar1 transposon mutagenesis of Anaplasma and Ehrlichia Cheng, Nair et al. 2013)(Felsheim, Herron et al. 2006) in many rounds of transformation, we obtained a mixture of several insertional mutants, as shown by ST-

PCR results from the same cultures. To confirm the present of Himar1 insertion mutants, insert-specific PCR experiments were performed with primers designed to anneal near identified insertion sites paired with primers annealing to mCherry or aad genes in the inserted transposon (Fig. 2.3) (Table 2). To isolate individual clones, limiting dilution of infected DH82 cells was used. To verify the clonality, specific PCR experiments that amplify the genome sequences flanking the insertion site were developed for each mutant clone (Table 2) (Fig 2.3). For the flank PCR, primers flanking both sides of the insertion were designed and used to generate PCR products up to 2,500 bp (Fig. 2.9) (Table 2).

Wild-type (WT) or other Himar1 insertional mutants, if present, would show the smaller

PCR product as they lack the Himar1 insert at this genomic locus. Multiple samples from frozen-thawed cells of 10-20 culture passages (~ 2 passages/week), were examined by the

26 insertion-specific flank PCR. Of nine clones identified, four were obtained in DH82 cell culture after limiting dilution, and five were clones from original transformation and confirmed by flank PCR (Fig 2.9)(Table 2). Sensitivity of flank PCR was evaluated using serially diluted DNA template that had been quantified with qPCR (Fig 2.10).

Sensitivity was relatively low at about 100 bacteria detected, but this represents only 1-20 infected host cells. When DNA is purified, at least 50,000 cells are used with at least 10% infection accounting for an estimated 50,000 bacteria. Furthermore, clonality was verified several times during culture, especially directly before evaluating clones behavior in vitro and in vivo.

Mutations in conserved genes

Of 23 paralogs of p28/omp-1 of the HF strain, insertion was detected in four p28/omp-1s: EHF_0066, EHF_0067, EHF_0045 (2 different insertions), and EHF_0048

(4 different insertions), showing not all P28/OMP-1s are required for growth in macrophages. There are five virB2 paralogs, and one of which virB2-4 had insertion.

Insertion was also detected in one of four tandem virB6 paralogs, virB6-4. One of two copies of bolA encoding transcription factor BolA related to stress resistance (Santos,

Freire et al. 1999, Cheng, Miura et al. 2011) had an insertion. In addition to these genes with multiple duplicates, a single copy gene trp120, a homolog E. chaffeensis TRP120, a type I secretion system effector, which has been extensively studied (Yu, McBride et al.

2000, Luo, Kuriakose et al. 2011, Zhu, Kuriakose et al. 2011, Dunphy, Luo et al. 2013,

Dunphy, Luo et al. 2014), had the insertion near 5’ end (Fig. 2.7B), indicating this gene is not required for Ehrlichia HF infection of macrophages.

27 Himar1 intragenic insertion mutants were also identified in genes for vitamin synthesis thiamine biosynthesis protein ThiC (Lawhorn, Gerdes et al. 2004) and dethiobiotin synthase (Otsuka, Buoncristiani et al. 1988), mutation repair rmuC (Slupska,

Chiang et al. 2000), DNA mismatch repair proteins MutS and MutL (Mansour, Doiron et al. 2001), transcriptional regulation DNA-3-methyladenine glycosylase family protein

(Wyatt, Allan et al. 1999), transcriptional regulator NrdR (Torrents, Grinberg et al. 2007), several nutrient transport sugar (and other) transporter family protein, sodium:alanine symporter family protein segregation (Khani, Popp et al. 2018), MFS transporter(Quistgaard, Low et al. 2016), bacterial division and chromosomal segregation parB/RepB/Spo0J family partition domain protein, cobQ/CobB/MinD/ParA nucleotide binding domain protein required for chromosome segregation (Lutkenhaus 2012), cell division ZapA family protein (Small, Marrington et al. 2007), and others amidophosphoribosyltransferase ComF (Bhagavan and Ha 2015), tellurium resistance protein TerC (Turkovicova, Smidak et al. 2016), RDD family protein (Shao, Abdel-

Motaal, et al. 2018), glutathione S-transferase (Nebert and Vasiliou 2004), aspartate kinase (Min, Li et al. 2015), FAD-dependent oxidoreductase (Selles Vidal, Kelly et al.

2018), gamma carbonic anhydrase family protein (Hewett-Emmett and Tashian 1996), octaprenyl-diphosphate synthase (Ashby and Edwards 1990)). These genes are apparently not required for HF strain infection of macrophages. 6 insertions were found within 5% the length of the ORF from the C terminus of EHF_0075, EHF_0332, EHF_0513,

EHF_0717, EHF_0733, EHF_0768; these protein functions may not be disrupted by the

Himar insert. Remaining insertions were found in 21 genes encoding hypothetical proteins.

28

Incubating cultures at 30°C enhances transformation efficiency

Early attempts were focused on recovering any bacteria at all, so the recommended 30°C incubation time was not used after electroporation. Once transformant recovery was more efficiently accomplished, transformants were incubated at 30°C as recommended, leading to much greater success (Figure 2.8). Cultures not incubated at 30°C resulted in an average of two mutants per electroporation, and cultures incubated at 30°C resulted in 14 average mutants per electroporation. This is because the

Am-tr promoter used to express transposase and cassette genes functions in Anaplasma in ticks, where the bacteria grow at 30°C.

2.5 Discussion

In this study, a random transposon mutant library was generated in the HF

Ehrlichia genome cultured and recovered in mammalian DH82 cells. As 55 different genes were directly disrupted by the transposon, these 55 genes are not critical for infection and growth in vitro. Of these disrupted genes, 20 are conserved hypothetical proteins that are homologous to other Ehrlichia species, but not other bacteria. These genes are likely unique to living in the unique niche occupied by Ehrlichia.

This is the first mutagenesis study to verify clonality after culture, and before and after each evaluation. While some groups are able to use plaque expansion to clone mutants (Lamason, 2018 #6664), they were not tested in vivo. While some groups tested mutants in vivo (Cheng, Nair et al. 2013, Crosby, Brayton et al. 2015) and in vitro

29 (Chavez, Fairman et al. 2015), this clone stringency is novel and important. Testing clones one at a time is important to examine the effect of each mutated gene.

Despite reductive genome evolution resulting in a very small genome,

P44/Msp2/OMP-1/P28/P30 genes were expanded by duplication in Ehrlichia and

Anaplasma species (Rikihisa 2010) and genes encoding VirB/D type IV secretion apparatus are expanded among the order Rickettsiales (Rikihisa 2017), suggesting these duplications are important for the bacterial lifecycle. However, not all of these genes are required for in vitro growth in mammalian cells in culture in the absence of immune pressure. Indeed, our and previous publications showed that VirB6-4, the largest, most downstream gene in the VirB6 operon is consistently disrupted by Himar1 transposon without affecting Anaplasma or Rickettsia growth in mammalian host cells (Felsheim,

Herron et al. 2006, Lamason, Kafai et al. 2018). Despite extensive arrays of in vitro functions proposed for TRP120 (former gp120) for E. chaffeensis infection of macrophages studied (Yu, McBride et al. 2000, Luo, Kuriakose et al. 2011, Zhu,

Kuriakose et al. 2011, Dunphy, Luo et al. 2013, Dunphy, Luo et al. 2014), the gene encoding HF strain TRP120 homolog had the insertion near 5’ end, indicating this gene is not required for Ehrlichia HF infection of macrophages. TRP120 is abundantly produced

(Yu, McBride et al. 2000), TRP mutant of HF obtained in our study will help elucidate in vivo or other functions of TRP120 in the future.

Felsheim et al (Felsheim, Herron et al. 2006) reported isolation of four intragenic insertions APH 0928, 0798/0797, 0546, 0377 and APH0584 in Anaplasma phagocytophilum cultured in HL-60 cells. APH 0584 encodes O-methyltransferase and the mutant is unable to grow in ISE6 tick cells (Oliva Chavez, Fairman et al. 2015).

30 Cheng et al., identified ECH_0379, ECH_0601, and ECH_0660 intragenic insertions

(Cheng, Nair et al. 2013). The mutant of ECH_0660 that contained a putative conserved domain having significant homology to a phage protein in the phage capsid assembly, was cloned, and shown unable to infect deer, and this mutant was used to vaccinate dogs and protect dogs from E. chaffeensis infection by syringe and tick inoculation of E. chaffeensis (Nair, Cheng et al. 2015, McGill, Nair et al. 2016). Lamason et al (Lamason,

Kafai et al. 2018) reported Himar1 insertion in 75 distinct genes of Rickettsia parkeri.

Except the VirB6-4 homolog, conserved hypothetical protein EHF_0332 homolog

ECH_0379 in E. chaffeensis, M16 family peptidase EHF_0125 homolog MC1_01650, and DNA mismatch repair protein MutS EHF_0723 homolog MC1_02260 in R. parkeri, the present study did not find other insertions in homologous genes that had an insertion in these three studies. As members of the order Rickettsiales evolutionary share many genes and lifestyle, growing numbers of mutants and their functional characterization, undoubtedly advance our understanding of obligatory intracellular bacteria, and their pathogenesis.

There are many virulence factors that were not detected by this method because mutants cannot infect or grow in DH82 cells. Of 866 protein-coding open reading frames

(ORFs) in the HF genome, over 60% (533) ORFs are house-keeping genes, and knockout mutants of these genes cannot survive in DH82 cell culture systems. Of remaining ORFs, our previous studies showed approximately 60 ORFs of orthologs of E. chaffeensis including type IV secretion system apparatus (23 ORFs) and effector proteins (3), two- component regulatory system (6), and outer membrane proteins (porin, lipoproteins, invasin; ~30 ORFs) etc., are essential for infection of macrophages (Kumagai, Cheng et 31 al. 2006, Huang, Lin et al. 2008, Kumagai, Huang et al. 2008, Mohan Kumar, Yamaguchi et al. 2013, Rikihisa 2015, Lin, Liu et al. 2016, Rikihisa 2017, Sharma, Teymournejad et al. 2017, Teymournejad, Lin et al. 2017, Yan, Lin et al. 2018). Over 240 genes, most of which encode hypothetical proteins or proteins with unknown functions, our previous

RNASeq data (NCBI GEO accession number GPL18497) (Lin, Daugherty et al. 2013) revealed that over 60 ORFs were differentially expressed (>10 fold differences) between

ISE6 and canine DH82 cells, suggesting differential requirement of these gene products in two types of host cells. Thus, we expect maximum 140 knockout intragenic insertional mutants can be recovered by using tick and mammalian cell lines in the future.

Unlike spotted fever group Rickettsia sp. Ehrlichia sp. does not produce distinct plaques, therefore, the limited dilution procedure described here is required to obtain the clonal population. We established a procedure to verify clonality at every step of cloning and experiments in this study. We could not deny the possibility that reduced growth of

H43B and H59 is due to secondary mutation as complementation experiments are not feasible at this time. However, studies with recombinant proteins, and or anti-sense protein nucleic acid (Sharma, Teymournejad et al. 2017, Yan, Lin et al. 2018) will potentially verify the present results in the future.

32 Figure 2.1 pCis mCherry-SS Himar A7 plasmid purified and resolved on 1% agarose gel. MW: GeneRuler 1kb Plus DNA ladder, Himar: purified plasmid. Total plasmid length is 8kb, supercoiled plasmid resolves at 6kb.

33 Figure 2.2. Illustration of the ST-PCR scheme

34 Figure 2.3 Insertion site-specific PCR to verify insertion site and flank PCR to verify clonality

A. Specific insert PCR showing insertion sites at specific genome loci of

EHF_0522::Himar1 and EHF_0048::Himar1.

B. Flank PCR demonstrating clonality of EHF_0962::Himar1, arrows - PCR primers, red bar – Himar1 insert containing aad/mCherry, white boxes with arrow - ORFs. The lengths of ORFs and Himar1 insert were drawn to scale except primers that are enlarged.

35 Figure 2.4 HF mutant H53 expressing mCherry fluorescence. N, nucleus. mCherry fluorescence/Differential Interference Microscopy. DeltaVison deconvolution microscopy, Scale bar, 10 µm.

36 Figure 2.5 Second-round ST-PCR performed with P4 and P3/P6. MW: GeneRuler 1kb

Plus DNA ladder, Ech/HF ctrl: wild type control, HF/Himar lanes are numbered transformation experiments. PCR products were resolved on 1% agarose gel for 30 minutes at 90 V.

continued

37 Figure 2.5 continued

continued

38 Figure 2.5 continued

continued 39 Figure 2.5 continued

continued

40 Figure 2.5 continued

continued

41 Figure 2.5 continued

continued 42 Figure 2.5 continued

continued

43 Figure 2.5 continued

continued 44 Figure 2.5 continued

continued

45 Figure 2.5 continued

continued 46 Figure 2.5 continued

continued

47 Figure 2.5 continued

continued

48 Figure 2.5 continued

continued 49 Figure 2.5 continued

continued 50 Figure 2.5 continued

continued 51 Figure 2.5 continued

continued 52 Figure 2.5 continued

continued

53 Figure 2.5 continued

continued

54 Figure 2.5 continued

55 Figure 2.6 Mapping the insertion site from sequenced ST-PCR product: one example. The sequence derived from gel-purified ST-PCR band was BLASTed against both the HF genome and pCis Himar plasmid. The site in the HF genome where alignment begins is the site where insertion occurred. Exact insert site is marked by the cursor in DNAStar.

H19 P3 500 bp sequence

GCCTSCTCGATCAACTCATGACCATTAACGCTTCCTTCCATGTGCACCTTAAA

TCTCATAAACTCTTTGATGATCGCCATATTATCTTCCTCTCCCTTGCTGACCAT

TATAATATCCCTTATGTTACTCAGATAACTTAGGATAAATCATACATAATGTT

AATGCAACAGTTATTTAATGTATGGTTGTAATAATAAAACTGTAAATGGTATG

CTAGATTAAAAATAAAATCATCAATAAATATCCGGGAAACTTCCGGAGATTT

TTTGAGGCAGCGCGCTGGGCACTTGTTAGTGCGCGCGTTTTATGCTAGCATGC

GGCGATCGTTCTAGGAGGAGCCGAATTCAGACCGGGGACTTATCAGCCAACC

TGTTATAAGTACATATTACACCAACAATCCATAGCATCACTATAATTAGACCA

ATACTTAATCCAATAACCATACGTATTTTATTTTTTTCCATTATAATTTCCTTT

AATTAAAATATCTATTTTATGTAATACAACAAGCCTCAAAGCAGCCTATATCC

CCCCCCCCCGTACTAGTCRACGCGTGGCASAATTTGATTTAGGGAGATCTTCT

CTTGTTCATGGGATTGAAGTCATGGGTCTTGGGTTTGKAGGTTTTTGAAGTTY

TTTKAGTATKTATGCAACCTTTGACCTTTTTTAAGAGCGKYATGRAGGCWATT

GATAGACAAACTRKACTAAAAGAGATAK

56 Figure 2.6 continued

continued

57 Figure 2.6 continued

58 Figure 2.7 Genomic map of the HF strain, showing transposon insertion sites.

A. Ehrlichia sp. HF chromosomal map showing transposon insertion sites. Black lines represent intragenic insertions and red lines represent intergenic insertions.

B. HF mutant H60E (EHF_0993::Himar1). Insertion site is upstream of the 4¼ of the

300-bp tandem repeats in TRP120, likely disrupting this protein’s expression or function.

59 Figure 2.8 Effect of 30 degree incubation on transformation efficiency Blue bar without 30°C incubation, N=14, orange bar with 30°C incubation, N=9

35

30

25

20 Without 30°C incubation

15 With 30°C incubation

10 Average Average of # insert sites

5

0

60

Table 1:Himar 1 insertion sites in HF genome ID Genomi Locus ID Gene product Conservatio c loci n in Ehrlichia species H5 98810 Intergenic n/a n/a H19 245409 EHF_0231 Hypothetical protein 32% Eucl, 28% Emu H34 580467 EHF_0522 rmuC family protein 96% Emu, 94% Eucl, 94% Emu, 89% Ech, 85% Eca, 85% Emin, 60% Ana H35 364974 Intergenic n/a n/a H43A 835933 EHF_0733 Hypothetical protein with GTA 94% Emu, TIM-barrel-like domain protein 94% Eucl, 83% Ech, 79% Eca, 77% Emin, 63% Eru, 40% Wol, 38% Ana H43B 1050791 EHF_RS0410 Conserved hypothetical protein 62% Emu, 0 with SSL domain 44% Ech, 37% Emin, 34% Eca, 25% Eru H43F 133819 EHF_0135 trbC/VIRB2 family protein 90% Emu, 84% Eucl, 78% Ech, 74% Emin, 71% Eru, 74% Ana H47 839819 Intergenic, 9 Major facilitator superfamily 90% Emu, bp upstream of protein 90% Eucl, EHF_0735 83% Ech, 78% Eca, 76% Emin, 67% Eru, 36% Wol

61 H53C 252371 Intergenic, Conserved hypothetical protein n/a 343 up EHF_0242 H53D 371562 Intergenic n/a n/a -1 H53D 794748 EHF_0703 thiamine biosynthesis protein 95% Emu, -2 ThiC Eucl, 92%, Ech, 88% Eca, 88% Emin, 88% Eru, 75% Nlo, 73% Aov, 72% Ama, 69% Aph H53E 150136 EHF_0140 Conserved hypothetical protein 72% Emu, 50% Ech, 46% Emin, 48% Eca, 41% Eru, 25% Ana H53F 884488 Intergenic n/a n/a H54 241428 Intergenic n/a n/a H55 406316 EHF_0382 comEC/Rec2-related domain 93% Emu, protein 93% Eucl, 80% Ech, 74% Eca, 73% Emin, 63% Eru, 47% Nlo, 45% Wol, 42% Aov, 39% Ama, 40% Aph H55E 973392 Intergenic, COQ9 family protein n/a 376 bp up EHF_0841 H56A 1143100 Intergenic, 120 kDa immunodominant n/a 157 bp up surface protein, Ferredoxin EHF_0993 and 126 bp up EHF_RS0448 0 H56B 353657 EHF_0324 lipoate-protein ligase B (LipB) 95% Eucl, 95% Emu,

62 86% Ech, 80% Eca, 80% Emin, 76% Eru, 60% Aph, 57% Wol, 59% Nlo H56D 424981 Intergenic, Polyprenyl synthetase protein, n/a 130 bp up Ribonucleoside-diphosphate EHF_0399 reductase subunit and 439 bp up EHF_0402 H57A 695771 EHF_0623 Conserved hypothetical protein 47% Eucl, 46% Emu, 31% Ech, 24% Emin H57B 1122448 Intergenic n/a n/a H58A 908826 Intergenic n/a n/a H58C 871479 EHF_0758 Hypothetical protein 43% Eucl, 44% Emu, 30% Eca, 30% Emin, DNA pol region only: 30% Ech H58D 163171 Intergenic, type I secretion outer n/a 184 bp up membrane/TolC family protein EHF_0151 H59 1106870 EHF_0962 Conserved hypothetical protein 80% Emu, 80% Ech, 71% Eca, 62% Emin, 48% Eru H60D 144692 Intergenic, Conserved hypothetical protein n/a 506 bp up EHF_0139 H60E 1142873 EHF_0993 120 kDa immunodominant 44% Emu, surface protein 38% Eucl, 41% Eca, 30% Ech H62 1048515 Intergenic n/a n/a H64A 163135 Intergenic, type I secretion outer n/a 148 bp up membrane/TolC family protein, EHF_0151 ribosomal protein L13

63 and 411 bp up EHF_0152 H64C 341553 Intergenic n/a n/a H64F- 253435 EHF_0242 Hypothetical protein 78% Eucl, 1 78% Emu, 72% Ech, 51% Eca, 32% Eru H64F- 754040 EHF_0671 Conserved hypothetical protein 78% Eucl, 2 78% Emu, 72% Ech, 50% Eca, 31% Eru H65A 117218 Intergenic n/a n/a H65D 1018235 EHF_0880 Conserved hypothetical protein 72% Emu, 52% Eca, 55% Emin, 53% Ech H66A 1074892 EHF_0933 Conserved hypothetical protein 92% Emu, 82% Eca, 80% Ech, 76% Emin, 77% Eru, 48% Ana, 54% Nlo, 44% Rick H66C 357439 Intergenic, DNA / pantothenate n/a 289 bp metabolism flavoprotein upstream family protein, class II fumarate EHF_0326 hydratase and 78 bp up EHF_0328 H66E 364844 EHF_0332 Conserved hypothetical protein 74% Emu, 73% Eucl, 58% Ech, 45% Eca, 44% Emin, 38% Eru H67A 309891 Intergenic, Phosphoglycolate hydrolase n/a 560 bp up EHF_0288 H67C 61587 EHF_0066 major outer membrane protein 93% Emu, OMP1-2 90% Eucl, 65% Ech, 56% Eca, 64 56% Emin, 45% Eru H67E 1074820 Intergenic, ATP synthase subunit delta n/a 311 bp up EHF_0932 H67F 792889 EHF_0702 Smr domain-containing protein 87%. Emu, 87% Eucl, 76% Ech, 66% Eca, 64% Emin H68B 593034 Intergenic, gram-negative porin family n/a 199 bp up protein EHF_0532 H68C- 671520 Intergenic n/a n/a 1 H68C- 269259 Intergenic, Conserved hypothetical protein n/a 2 254 bp up EHF_0253 H68E 1035030 Intergenic, Hypothetical protein n/a 468 bp up EHF_0893 H69C 569620 Intergenic, Conserved hypothetical protein n/a 272 bp up EHF_0515 H69E 810865 EHF_0717 major facilitator family 96% Eucl, transporter 94% Emu, 83% Ech, 74% Eca, 72% Emin, 68% Eru H69F- 579965 EHF_0522 DNA recombination protein See H34 1 RmuC H69F- 45987 EHF_0048 major outer membrane protein 94% Emu, 2 OMP1-17 93% Eucl, 85% Ech, 79% Emin, 70% Eca, 68% Eru, 67% Eew H72A 161141 EHF_0150 Conserved hypothetical protein 96% Eucl, -1 94% Emu, 85% Ech, 79% Eca, 78% Emin, 63% Eru, 65 35% Nlo, 30% Ana, Wol and Rick DUF superfamily domain H72A 1083158 307 bp up citrate (Si)-synthase n/a -2 EHF_0939 H72B 1059627 EHF_0919 amidophosphoribosyltransferas 93% Emu, e 82% Ech, 80% Eca, 74% Eru, 54% Wol, 55% Nlo, 45% Aph, 41% Ama, 39% Aov H72C 872359 EHF_0758 Hypothetical protein See H58C H72D 63069 Intergenic, 23 major outer membrane protein bp upstream of OMP1-1 89% Emu, EHF_0067 88% Eucl, 80% Ech, 72% Eca, 71% Emin, 66% Eew, 60% Eru, 43% Nlo H72E 248268 EHF_0237 DNA-3-methyladenine 93% Emu, glycosylase family protein 87% Ech, 80% Eca, 78% Emin, 73% Eru, 63% Wol, 63% Nlo, 56% Ots H73A 72763 EHF_0075 dethiobiotin synthase 91% Eucl, -1 92% Emu, 79% Ech, 72% Eca, 73% Emin, 70% Eru, 50% Ace, 50% Ama, 48% Aph

66 H73A 186084 Intergenic, transcription termination factor n/a -2 516 bp up Rho EHF_0173 H73B 308181 Intergenic, pyruvate, phosphate dikinase n/a 390 bp up EHF_0286 H73C 456831 Intergenic n/a n/a H73D 21696 Intergenic n/a n/a -1 H73D 566454 EHF_0513 tellurium resistance protein 91% Emu, -2 TerC 90% Eucl, 83% Ech, 82% Eca, 79% Emin, 72% Eru, 52% Nlo, 52% Wol, 44% Aov, 44% Ama, 43% Ace H73E- 490405 EHF_0445 trbL/VirB6 plasmid conjugal 77% Emu, 1 transfer family protein 73% Eucl, 82% Ech, 51% Eca, 52% Emin, 70% Eru H73E- 1016610 EHF_0877 transcriptional regulator NrdR 99% Emu, 2 94% Ech, 89% Eca, 91% Emin, 88% Eru, 68% Nlo, 59% Ace, 58% Aov, 59% Aph H73F 456831 Intergenic n/a n/a H74A 47534 Intergenic, P44/Msp2 family outer n/a -1 188 bp up membrane protein EHF_0050 H74A 699943 Intergenic, 68 bifunctional FolC family n/a -2 bp up protein, aspartyl/glutamyl- EHF_0625 tRNA amidotransferase and 363 bp up subunitA EHF_0626

67 H74B- 366003 EHF_0333 dihydropteroate synthase 94% Emu, 1 94% Eucl, 71% Eru, 56% Ech, 56% Eca, 56% Emin H74B- 822691 Intergenic, 34 DNA mismatch repair protein EHF_0723: 2 bp up MutS, aspartyl/glutamyl-tRNA 97 Eucl, 98% EHF_0723 amidotransferase subunitA Emu, 93% and 140 bp up Ech, 88% EHF_0724 Emin, 89% Eca, 79% Eru, 67% Nlo, 63% Wol, 59% Aph, 57% Ama, 57% Aov, 57% Ace, 51% Rick H74C 28140 EHF_0031 Chromosome partitioning 97% Emu, ATPase, ParA family 98% Eucl, 89% Eru, 95% Ech, 94% Eca, 93% Emin, 89% Nlo, 70% Aov, Ama, 67% Wol, 66% Rick H74D 1086516 EHF_0943 Hypothetical protein 63% Eucl, 59% Emu, 37% Emin, 33% Ech, 36% Eca H74E 257823 Intergenic n/a n/a H74F- 470413 Intergenic, 16 tRNA-Arg n/a 1 bp up EHF_0435 H74F- 886486 EHF_0768 conserved hypothetical protein 61% Emu, 2 46% Ech, 32% Eru H75A 354464 Intergenic n/a n/a -1

68 H75A 428707 Intergenic n/a n/a -2 H75A 188310 Intergenic n/a n/a -3 H75B- 45586 EHF_0048 Major outer membrane protein See H69F-2 1 OMP1-17 H75B- 1028718 Intergenic, NADP-dependent malic n/a 2 319 bp up enzyme, ABC transporter EHF_0885, 222 bp up EHF_0888 H75C 308227 EHF_0287 RDD family protein 92% Emu, 90% Eucl, 81% Ech, 81% Eca, 80% Emin, 67% Eru, 35% Ana, 42% Wol, 33% Rick H75D 838124 Intergenic n/a n/a -1 H75D 765049 Intergenic, 19 RNA pseudouridylate synthase EHF_0677: -2 bp up family protein, extragenic 92% Emu, EHF_0677, suppressor protein suhB (suhB) 91% Eucl, 502 bp up 79% Ech, EHF_0678 76% Eca, 74% Emin, 67% Eru, 49% Wol, 47% Ana, 39% Rick H75E 939557 Intergenic, 99 patatin-like phospholipase n/a bp up family protein EHF_0812 H75F- 869649 EHF_0758 hypothetical protein See H58C 1 H75F- 582106 Intergenic n/a n/a 2 H75F- 364700 EHF_0332 conserved hypothetical protein See H66E 3 H75F- 831375 EHF_0732 phage conserved hypothetical 93% Emu, 4 BR0599 family protein 83% Ech, 76% Emin, 77% Eca, 69 66% Eru, 49% Nlo, 40% Wol, 40% Ana H76A 847362 EHF_0743 glutathione S-transferase 97% Emu, -1 97% Eucl, 94% Ech, 94% Emin, 95% Eca, 86% Eru, 68% Nlo, 63% Wol, 60% Ana, 48% Rick H76A 273766 Intergenic n/a n/a -2 H76A 43980 Intergenic, P44/Msp2 family outer n/a -3 122 bp up membrane protein EHF_0045 H76B- 1086497 EHF_0943 hypothetical protein See H74D 1 H76B- 517679 EHF_0470 conserved hypothetical protein 79% Emu, 2 73% Ech, 66% Eca, 66% Emin, 50% Eru, 30% Ana H76C 1092639 Intergenic, protein translocase subunit n/a 262 bp up SecF, archaeal holliday EHF_0950, junction resolvase family 121 up protein EHF_0951 H76D 1112797 Intergenic, 1-acyl-sn-glycerol-3-phosphate n/a -1 183 bp up acyltransferase EHF_0967 AND 844 bp up EHF_0966 H76D-2 376020 Intergenic, SPFH domain / Band 7 family n/a 142 bp up (membrane) protein EHF_0341 H76E- 150664 EHF_0140 conserved hypothetical protein See H53E 1 H76E- 149069 Intergenic, conserved hypothetical protein n/a 2 268 bp up EHF_0140 70 H76F 179134 EHF_0167 aspartate kinase 96% Emu, 95% Eucl, 93% Ech, 93% Eca, 91% Emin, 81% Eru, 65% Nlo, 51% Ana H77A 792823 EHF_0702 smr domain protein See H67F -1 H77A 765387 Intergenic, pseudouridine synthase n/a -2 360 bp up EHF_0677 H77A 41666 Intergenic, P44/Msp2 family outer n/a -3 166 bp up membrane protein EHF_0042 H77A 43288 EHF_0045 major outer membrane protein 95% Emu, -4 OMP1-19 92% Eucl, 84% Ech, 78% Emin, 70% Eca, 66% Eru H77A 150664 EHF_0140 conserved hypothetical protein See H53E -5 H77B- 43813 EHF_0045 major outer membrane protein See H77A-4 1 OMP1-19 H77B- 516921 Intergenic, 66 conserved hypothetical protein n/a 2 bp up EHF_0470 H77B- 46141 EHF_0048 major outer membrane protein See H69F-2 3 OMP1-17 H77C- 516769 Intergenic, conserved hypothetical protein n/a 1 218 bp up EHF_0470 H77C- 217716 Intergenic n/a n/a 2 H77D 1125230 Intergenic, 2,3,4,5-tetrahydropyridine-2,6- n/a -1 143 bp up dicarboxylate N- EHF_0978 succinyltransferase, and 62 bp up hypothetical protein with EHF_0979 MJ0042 family finger-like domain protein H77D 525060 Intergenic n/a n/a -2

71 H77E- 448957 Intergenic, Xaa-Pro aminopeptidase n/a 1 626 bp 425 bp up EHF_0423 H77E- 753371 EHF_0671 Hypothetical protein See H64F-2 2 H77F 936950 EHF_0810 bolA protein 83% Eucl, 94% Emu, 72% Ech, 73% Emin, 70% Eca, 64% Eru, 51% Wol, 40% Aph H78 257958 Intergenic n/a n/a H79A 1132802 Intergenic, GTP cyclohydrolase n/a -1 440 bp up EHF_0987 H79A 813074 EHF_0718 major facilitator family 94% Eucl, -2 transporter 95% Emu, 75% Ech, 75% Eca, 65% Eru, 37% Nlo, 35% Ana H79A 64253 EHF_0069 nucleoside-diphosphate kinase 96% Eucl, -3 97% Emu, 94% Ech, 91% Eca, 88% Eru, 73% Nlo, 64% Ana, 69% Wol, 64% Nhe, 64% Nsen H79C- 870872 EHF_0758 hypothetical protein See H58C 1 H79C- 834447 EHF_0733 hypothetical protein with GTA See H43A 2 TIM-barrel-like domain protein H79C- 152197 Intergenic n/a 3 H79C- 62134 Intergenic, P44/Msp2 family outer n/a 4 438 bp up membrane protein EHF_0066 H79D 513076 EHF_RS0207 Hypothetical protein n/a -1 5 (pseudogene due to frameshift) 72 H79D 827624 Intergenic n/a n/a -2 H79E- 946167 Intergenic n/a n/a 1 H79E- 407501 EHF_0383 sodium:alanine symporter 95% Eucl, 2 family protein 96% Emu, 90% Ech, 88% Emin, 87% Eca, 70% Eru, 60% Nlo, 57% Wol, 54% Ana, 39% Nhe, 37% Nri H80A 42923 Intergenic, major outer membrane protein n/a -1 246 bp up OMP1-20 EHF_0044 H80A 1061828 Intergenic, 83 n/a n/a -2 bp up EHF_0922 H80B- 1044678 EHF_0905 hypothetical protein 55 Eucl, 55% 1 Emu, 36% Ech H80B- 1005383 Intergenic, n/a n/a 2 164 bp up EHF_0868 H80B- 112044 EHF_0115 hexapeptide transferase family 92% Eucl, 3 protein 95% Emu, 96% Ech, 80% Emin, 82% Eca, 64% Eru, 64% Nlo, 63% Wol, 63% Ana, 57% Nsen, 55% Nri H80B- 820620 EHF_0723 DNA mismatch repair protein See H74B-2 4 MutS H80B- 1008450 Intergenic n/a n/a 5 H80C- 919082 986 bp up n/a n/a 1 EHF_0795

73 H80C- 1131409 EHF_0984 conserved hypothetical protein 88% Eucl, 2 85% Emu, 82% Ech72% Emin, 71% Eca, 62% Eru H80C- 382057 EHF_0346 cell division ZapA family 96% Eucl, 3 protein 98% Emu, 88% Ech, 80% Emin, 80% Eca, 76% Eru, 40- 50% Wo, 35%. Aov, 33% Ama, 28% Bart H80D 763703 Intergenic n/a n/a -1 H80D 607098 139 bp up conserved hypothetical protein n/a -2 EHF_0545 - pseudogene H80D 810577 EHF_0717 MFS transporter See H69E -3 H80E 1018051 7 bp up conserved hypothetical protein 79% Emu, EHF_0880 52% Eca, 55% Emin, 53% Ech H80F 929685 8 bp up 3-phosphoshikimate 1- 91% Eucl, EHF_0806 carboxyvinyltransferase 95% Emu, 74% Ech, 67% Emin, 67% Eca, 54% Eru, 37% Nlo H81A 751268 Intergenic n/a n/a -1 H81A 897331 EHF_0775 putative membrane protein 65% Eucl, -2 69% Emu, 51% Ech, 53% Emin, 52% Eca, 48% Eru, 25% Ana H81B- 545195 EHF_0497 hypothetical protein 64% Emu, 1 36% Eucl, 30% Ech, 23% Emin

74 H81B- 920774 182 bp up conserved hypothetical protein, n/a 2 EHF_0796, tRNA-Leu 546 bp up EHF_0797 H81C- 1013847 Intergenic, hypothetical protein, conserved n/a 1 160 bp up hypothetical protein EHF_0874 and 109 bp up EHF_0875 H81C- 122477 EHF_0125 peptidase M16 family protein 93% Emu, 2 89% Ech, 85% Emin, 85% Eca, 68% Eru, 50% Nlo, 43% Aph, 40% Ana, 43% Wol H81D 573935 EHF_0515 Chromosome segregation 56% Eucl, protein SMC (structural 56% Emu, maintenance of chromosomes), 44% Ech, archaeal type 34% Emin H81E 1070542 Intergenic n/a n/a H82A 448861 722 bp up n/a n/a -1 EHF_0423 H82A 161191 EHF_0150 conserved hypothetical protein 96% Eucl, -2 94% Emu, 85% Ech, 79% Eca, 78% Emin, 63% Eru, 35% Nlo, 30% Ace H82A 1098537 EHF_0956 octaprenyl-diphosphate 98% Eucl, -3 synthase 96% Emu, 88% Ech, 87% Eca, 86% Emin, 74% Eru, 62% Nlo, 52% Ace, 53% Ama, 51% Aov, 50% Aph, 52% Wo

75 H82B- 509073 343 bp up n/a n/a 1 EHF_0462 H82B- 45484 EHF_0048 major outer membrane protein See H69F-2 2 OMP1-17 H82C 491800 EHF_0446 DUF2460 domain-containing 95% Eucl, protein 95% Emu, 86% Ech, 83% Eca, 82% Emin, 76% Eru, 64% Nlo, 58% Wol, 49% Aph H82D 737087 Intergenic, 87 bifunctional ADP-dependent n/a -1 bp up NAD(P)H- EHF_0656 hydratedehydratase/NAD(P)H- hydrate epimerase H82D 892485 EHF_0772 DNA mismatch repair protein 93% Eucl, -2 MutL 92% Emu, 81% Ech, 76% Eca, 77% Emin, 66% Eru, 59% Nlo, 57% Wol, 51% Aph, 40% Ots H82E- 188165 Intergenic n/a n/a 1 H82E- 753814 EHF_0671 Conserved hypothetical protein See H64F-2 2 H82E- 999937 279 bp up n/a n/a 3 EHF_0861 Abbreviations: up: upstream of ORFs; Ech: E. chaffeensis; Eca: E. canis; Emu: E. muris; Emin: E. minasensis; Eru: E. ruminantium; Eucl: E. muris subsp. Eauclairensis; Eew: E. ewingii;

Nhe: Neorickettsia helminthoeca; Nri: N. risticii; Nhe: Neorickettsia helminthoeca; Nlo:

Candidatus Neoehrlichia lotoris; Nsen: N. sennetsu; Bart: Bartonella species; Ana:

76 Anaplasma species; Aph: A. phagocytophilum; Ace: A. centrale; Aov: A. ovis; Ama: A. marginale; Wol: Wolbachia; Ots: Orientia tsutsugamushi;

77 Figure 2.9 Flank PCRs confirm single insertion population in cloned Himar mutants in DH82 macrophages. MW: GeneRuler 1kb Plus DNA ladder, B or buffer: buffer, labeled experiment number. PCR products were resolved on agarose gel of varying concentration based on the product size.

continued 78 Fig 2.9 continued

79 Figure 2.10 flank PCR showing method sensitivity MW: GeneRuler 1kb Plus DNA ladder, B: buffer, template copy number determined by qPCR before PCR. Products were resolved on 1% agarose gel

80 Table 2 Primers Used Table 2. Primers designed for this study, or used from previous studies.

Primers Locus ID Product size (bp) F: TGGTCTAATTATAGTGATGCTATGG EHF_0231 114 R: AGTTTCTTTCTAAAACCATTACG F: ATGGCATCGGGTTGTTGTTTC EHF_0522 468 R: GACTTTACACAATACGCTTGACTT F: TCCTCCCAGAATTTTCGCACA EHF_RS04100 373 R: GAATGTTGCTTTAATTCACCAGC F: CACAAAGAAAGCATATAGTGGAGGT Up EHF_0151 98 R: ACGCATGTATCGTAAATGCATACT F: TCAATATAGAACAACATACTACAAA EHF_0962 421 R: TCTGCTTCATCAGATTCTACT F: GCACTGATATTATTTGCAGGTACAG EHF_0880 229 R: GCTTTCCTTGTGTTTTGGCTTCAA F: TCTACTGATTTGTAAACAATGGAT EHF_0933 338 R: TGCAAGTAGTGCTCCTGTTA F: ACTGCTATAGCTCTTACATTAGTCT EHF_0332 150 R: GGCATAACCATTTACGAAACACA F: GGATGAAACTGGTAGGCAACTGATA EHF_0150 466 R: AATAGAGCAATCAACCCAACGGCT

F: P32 EHF_0382 549 R: TTCCTGACCATTTTGTCTTGCCCA F: P6 EHF_0135 427 R: ACCGGAACTTCCTGCTGCAACG F: TCCTCCCAGAATTTTCGCACA EHF_RS04100 588 R: P32 F: P6 EHF_0733 329 R: TAGTTTTGTAAGCTGTGCCCCT F: TCAGAGCAACAACAGCTGCAATCC EHF_0758 746 R: P32 F: ACGCATGTATCGTAAATGCATACT EHF_0151 416 R: P32 F: P6 EHF_0522 970 R: GACTTTACACAATACGCTTGACTT F: P6 EHF_0048 347 R: ACCTGGAGTGTCATTCTCTGATCC qPCR primers Purpose Mouse F: GTTGTCTCCTGCGACTTCA GAPDH for GAPDH3 R: GGTGGTCCAGGGTTTCTTA normalizing

81 infected mouse tissue Ehrlichia 16S Quantifying F: CGGGGGAAAGATTTATCGCTATTA rRNA4 Ehrlichia R: CGCTTGCCCCCTCCGTATTA

qRT-PCR primers1 F: CATCTTCTCAAAATTCGAGTGACAA TNF-α TNF-α R: TGGGAGTAGACAAGGTACAACCC expression F: GGGCCTCAAAGGAAAGAATC IL-1β expression IL-1β R: TACCAGTTGGGGAACTCTGC F: GCGTCATTGAATCACACCTG IFN-ϒ IFN-ϒ R: TGAGCTCATTGAATGCTTGG expression F: GAGGATACCACTCCCAACAGACC IL-6 expression IL-6 R: AAGTGCATCATCGTTGTTCATACA F: AAGGAACAGTGGGTGTCCAG IL-12B IL-12B R: CATCTTCTTCAGGCGTGTCA expression F: GGTTGCCAAGCCTTATCGGA IL-10 expression IL-10 R: ACCTGCTCCACTGCCTTGCT Screening primers F: AAGTCGAACGGACAATTACC HF 16S rRNA HF *** R: GTTAGGGGGATACGACCTTC F: ATCAAGCCTTACGGTCACCG aad and mCherry Himar1 R: ATGGGAACGCGTCATGAACT span

ST-PCR Primer Primer sequence Target site

degenerate P22 GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT primer

P5 AGTCACCATTGTTGTGCACGACGAC aad P1PP12 CTCCATCTTTCAGCTTCAGGCG mCherry Degenerate P42 GGCCACGCGTCGACTAGTAC primer nesting P6 AACCGGCAAAATCGCGCCGAA aad nesting mCherry P32 GTCTGTGTGCCTTCATACGGTC nesting 1 (Miura, 2009), 2 (Indukuri, 2013), 3 (Prima, Kaliberova et al. 2017), 4 (Niu, Rikihisa et al. 2006), 5 (Kawahara, Rikihisa et al. 2006)

82

Chapter Three

MUTATED EHF_RS04100 AND EHF_0962 DO NOT AFFECT DH82 NOR ISE6 GROWTH BUT DELAY INFECTION IN MICE

3.1 Abstract

Ehrlichia spp. are emerging tick-borne obligatory intracellular bacteria that infect monocytes-macrophages or granulocytes, and cause febrile diseases with abnormal blood cell counts and signs of hepatitis. Ehrlichia HF strain, which is most closely related to E. muris subsp. eauclairensis subsp. nov., a newly discovered human ehrlichiosis agent, provides an excellent mouse disease model of fatal human ehrlichiosis. The Rikihisa lab recently established stable culture of Ehrlichia HF strain in DH82 cells, and annotated its whole genome sequence. To identify genes required for in vivo virulence of Ehrlichia, I constructed random insertional HF strain mutants by using Himar 1 transposon-based mutagenesis procedure. Using limited dilution methods, nine stable clonal mutants that had no apparent defect for intracellular multiplication in DH82 macrophages and ISE6 tick cells, were obtained from the intergenic mutant pool of 55 mutated ORFs. Mouse virulence of seven mutant clones was similar to that of wild-type HF strain. Two mutant clones showed significantly retarded growth in blood, livers, and spleens; mice inoculated with them lived longer than mice inoculated with wild-type HF strain. One mutant mixture showed significantly delayed clinical signs. The clones contained mutations in genes conserved among Ehrlichia spp, but without known homology to other bacterial genes. Thus, we demonstrate the existence of Ehrlichia genes responsible for non- macrophage infection-related virulence.

83

3.2 Introduction

Once bacteria are mutated, we can test their gene function by testing infection in mammalian and tick in vitro and in vivo systems. In this study due to method optimization, the most work was done in in vitro tick and in vivo mammalian system.

In vitro screening in a tick system is an efficient way to check if mutant clones can infect tick cells. Ixodes scapularis embryonic (ISE6) cells can be cultured and used for Ehrlichia host cells (Munderloh, Jauron et al. 1999) for this purpose. Ixodes cells are desirable for this use because HF Ehrlichia was discovered in and has only been found in

I. ovatus (Shibata, Kawahara et al. 2000). Several genes are likely important to tick infection in HF as E. chaffeensis and Anaplasma genes are differentially expressed in mammalian and tick cells (Unver, Rikihisa et al. 2002, Wang, Kikuchi et al. 2007, Lin,

Daugherty et al. 2013).

Using pooled mutant testing is one way to determine if certain mutants can infect laboratory animals (Cheng, Nair et al. 2013). In this way it can determine if a gene is critical for infection in vivo because if one clone is not recovered from the animal’s tissues, that gene was likely important. However as I am seeking PAMPs, I needed to take a different approach. Inoculating a mixture of mutants would likely result in a normal course of infection since even if one gene important for virulence is inoculated, others in the group would compensate. If the mutated gene was important for virulence but not critical for initial infection, it would still be recovered, and the effect would be obfuscated. For this reason, only testing of cloned mutants as far as we can tell is presented here. Flank PCR is used to confirm clonality throughout the studies. 84 HME is a serious disease, but interestingly many individuals do not develop serious disease or require hospitalization. Patients who do develop organ failure are frequently elderly, have HIV, or are otherwise immunocompromised. Fatal disease also resembles septic shock-like syndrome. This suggests that the disease pathology may stem from immune dysregulation, possibly cytokine storm, rather than simply infection

(Miura, Matsuo et al. 2011). For this reason, studying HME in an immunocompetent host is important. Since E. chaffeensis cannot infect immunocompetent mice, severe combined immunodeficient mice have been used as in vivo small animal models. This has led to many important discoveries such as strain virulence (Miura and Rikihisa 2007, Miura and

Rikihisa 2009) the role of MyD88 (Miura, Matsuo et al. 2011), and confirming the entry mechanism (Mohan Kumar, Yamaguchi et al. 2013). However, since the major pathogenic mechanism of the disease is cytokine storm and immune dysregulation, it is important to have a complete picture of the immune system that, lacking lymphocytes,

SCID mice simply cannot provide. This is a major benefit to using the HF strain. HF strain Ehrlichia and infect immunocompetent mice, causing disease in death in as little as

5 days. Thus, HF strain provides an excellent small animal model to study HME.

Calculating the lethal dose of cultured HF Ehrlichia helped us determine the most effective dose for testing mutants. Previous work with HF has used infected mouse spleen homogenate (Ismail, Soong et al. 2004, Yager, Bitsaktsis et al. 2005, Stevenson, Estes et al. 2010, Yang, Ghose et al. 2013) as ours is unique in our ability to culture the bacteria.

LD50 was calculated in previous work to be 200 organisms inoculated per mouse in aliquoted and frozen mouse spleen. We reasoned that LD50 in cultured HF would be different from fresh culture. On one hand, cultured bacteria may not be expressing the 85 virulence factors it needs to infect mice in cultured cells. On the other hand, freshly cultured bacteria may be more concentrated, healthier, and ready to infect than bacteria in frozen spleen homogenate with a RBC lysis step as described (Bitsaktsis, Huntington et al. 2004).

Calculating LD50 involves experimentally inoculating subjects with a log dilution of substance. The number of subjects who perish are averaged and plotted then subject to regression: response, being died or did not die, is binomial, and regression is sigmoid

(Akcay 2013). A bioinformatics tool generated a traditional sigmoid curve; LD50 is calculated from the center of the curve (AAT Bioquest).

3.3 Materials and Methods

Ehrlichia sp. HF culture and purification

Canine histiocytic leukemia DH82 cells were cultured in DMEM (Dulbecco minimal essential medium; Mediatech, Manassas, VA) supplemented with 5% fetal bovine serum

(FBS; Atlanta Biologicals, Lawrenceville, GA) and 2 mM L-glutamine (L-Gln; GIBCO,

Waltham, MA) at 37°C under 5% CO2 in a humidified atmosphere as described previously (Rikihisa, Stills et al. 1991, Mohan Kumar, Yamaguchi et al. 2013). Ehrlichia sp. HF was cultured in DH82 cells with the addition of 0.1μg/mL cycloheximide

(Millipore Sigma, Burlington, MA) at the same condition. The degree of bacterial infection in host cells was assessed by Diff-Quik staining. Briefly, a drop of infected cells were centrifuged onto a slide in a Cytospin 4 cytocentrifuge (Thermo Fisher, Waltham,

MA), then fixed and stained with HEMA 3 staining solutions (Thermo Fisher).

86 The ISE6 cell line, derived from the Ixodes scapularis tick embryo, was cultured in

L15C300 medium at 34°C as described previously (Munderloh, Jauron et al. 1999).

Confluent Ehrlichia–infected DH82 cells at above 90% infectivity were harvested from three T25 flasks. Host cell–free bacteria was obtained by sonication on ice for 8 sec twice at output setting 3 using a fine tip on a W380 Sonicator (Heat Systems, Newtown, CT).

Lysed cells were centrifuged at 700 × g (Sorvall 6000D, Thermo Fisher) to remove unbroken cells and nuclei, and centrifuged in 40 mL polycarbonate high speed centrifuge tubes (Nalgene Nunc International Corporation, Rochester, NY) at 10,000 × g (Sorvall

RC 5C Plus using SS-34 rotor) to pellet host cell–free bacteria as described previously

(Lin, Liu et al. 2016).

In vitro growth curve

To generate growth curves of wild type, H43B, and H59 mutants of Ehrlichia sp. HF in

DH82 cell cultures, bacteria were isolated as described above. Supernatant was discarded, and host cell-free bacteria were resuspended in DMEM supplemented with 5% FBS, 2 mM L-Gln, and 0.1 μg/mL cycloheximide, and inoculated in triplicate on DH82 monolayers in a 12-well plate. Monolayers were washed three times in media after two hours to remove unbound bacteria. To assess bacterial growth, monolayers were washed three times with PBS to remove debris and dead bacteria, and DNA was extracted from 1 ml of mutant and wild-type cultures of bacteria grown in DH82 cells each day for 4 days beginning with 2 after inoculation. One sample of WT and mutant cultures were evaluated by Diff-Quik staining each day (Chavez, Fairman et al. 2015).

87 Mouse infection

In each experiment, infected cells were resuspended in DMEM medium without FBS and antibiotics, and 0.5 mL per mouse were inoculated using a 1 mL TB syringe with a 26- gauge needle (BD, Franklin Lakes, NJ). Mice were monitored daily for weight loss and moribund condition indicated by hunched posture, squinted eyes, slow movement, reduced response to stimulation, and loss of 20% body weight according to IACUC.

Moribund mice were euthanized by CO2 inhalation and cervical dislocation.

Experiment 1: screening cloned Himar mutants

Male and female C57BL/6 mice (Envigo, Indianapolis, IN) 8-20 weeks old, three or five mice each were intraperitoneally inoculated with 5-15 x 106 (estimated by Diff-Quik % infected cells and cells inoculated) Ehrlichia sp HF mutant bacteria from infected DH82 cells.

Experiment 2: LD50

Female ICR (CD-1) four weeks old were intraperitoneally inoculated in groups of three with serially diluted 100, 10, 1, and 0.1 DH82 cells containing 2500, 250, 25, and 2.5 bacteria.

88 Quantification of Ehrlichia bacterial numbers

DNA was purified from uninfected and Ehrlichia sp. HF-infected DH82 cells and mouse tissues with a QIAamp DNA Mini Kit (Qiagen). To quantify Ehrlichia, an absolute quantification method was used by creating a standard curve of the Ehrlichia 16S rRNA gene copy number by qPCR according to the manufacturer’s protocol (Stratagene,

Waltham, MA) (Liu, Bao et al. 2012) Ehrlichia 16S rDNA was cloned in a pUC19 plasmid as a standard template (Teymournejad, Lin et al. 2017). Tenfold dilutions (1 to

1:1000) of the standard template were prepared, and qPCR analysis were performed to generate a standard curve by plotting the initial template quantity against the threshold cycle (CT) values for the standards. The qPCR mixture (20 μl) included 0.25 μM each primer, and 10 μl of SYBR green qPCR master mix (Thermo Fisher). Primer sequences for the Ehrlichia 16S rRNA gene are shown in Table 2. PCR was performed in the

Mx3000P instrument (Stratagene). The copy number of the targeted gene in DNA samples was calculated by comparing the Ct value with the standard curve. Expression of each gene was normalized against mouse GAPDH levels.

Statistical analysis

Statistical analysis was performed with analysis of variance (ANOVA) followed by

Tukey multiple comparison. P < 0.05 was considered a statistically significant. All statistical analyses were performed using Prism 8 software (GraphPad, La Jolla, CA).

89 Ethics Statement

All animal experiments were performed in accordance with the Ohio State University

Institutional Animal Care and Use Committee guidelines and approved e-protocol. The university program has full continued accreditation by the Association for Assessment and Accreditation of Laboratory Animal Care International under 000028, dated 9 June

2000, and has Public Health Services assurance renewal A3261-01, dated 6 February

2019 through 28 February 2023. The program is licensed by the USDA, number 31-R-

014, and is in full compliance with Animal Welfare Regulations.

3.4 Results

Evaluation of cloned HF mutant infection of ISE6 cultured tick cells

Mutant clones were screened for in vitro tick virulence factors by inoculating

ISE6 cells with purified bacteria. Each clone was able to infect ISE6 cells with the same morphology as wild type (Fig 3.1).

Mouse virulence of cloned HF mutants

We investigated whether insertions into the coding or non-coding regions affected the HF strain's mouse infectivity and pathogenesis. Immunocompetent mice were inoculated intraperitoneally with 9 cloned mutants and WT strain at approximately 5-15 ×

106 bacteria/mouse. With this high dosage, all mice became severely moribund and lost

>20% body weight and euthanized, or died within 15 days post inoculation (pi) (Fig 3.2).

90 However, as mice inoculated with H59 and H43B mutants survived significantly longer, thus, these two mutants were selected for further study in Chapter 4.

H58D was initially inoculated as a mixture containing mutations at two sites i163171 and 871479 (Fig 3.3). These mice survived significantly longer than wild type- inoculated mice until day 9. i163171 was cloned by limiting dilution as described, and inoculated mutants killed mice at the same time as wild type (Fig 3.2).

Confirmation of clonality in ISE6 cells and mouse tissue

To confirm that each mutant was a clone for its given insertion before inoculation and in each ISE6 culture and mouse, flank PCR was performed. Flank PCR uses primers flanking the insertion site; large predicted products indicate the presence of Himar insertion, while small predicted products indicate the presence of a bacterial population with no Himar insertion. The presence of only a large band indicates a clonal population, the presence of only a small band indicates bacteria with no insertion at the tested site, and a small and large band indicates a mixed population.

Each tested clone remained a clone in ISE6 culture. Seven of the nine mutant clones

H19, H34, H43B, H58D, H59, H66A, and H72A tested in mice also remained clones in mice. However, H65D and H66F flank PCR revealed a non-clonal population in mouse tissue. Interestingly, in both of these cases, ISE6 cells were inoculated with the same culture multiple passages later, and this inoculum and ISE6 cultures revealed only a large band. (Fig 3.4)

91 Determination of growth rate in cloned HF mutants

Based on clone screen results in mice, we selected mutants H43B and H59 for growth measurement in vitro. Growth rates were not significantly different between mutants, indicating that EHF_RS04100 and EHF_0962 are not implicated in bacterial infection or growth in cultured macrophages (Fig 3.5A). The appearance of morulae was also identical between wild type and mutant cultures, indicating neither of these gene products affect inclusion structure (Fig 3.5B).

Determination of mouse LD50 of HF strain cultured in DH82 cells

The mouse virulence of the HF strain cultured in DH82 cells has not been determined. Therefore, four 10-fold serially diluted WT HF strain (2,500, 250, 25, and 2.5 bacteria) were intraperitoneally inoculated into 5 mice each to obtain Kaplan-Meier survival curve. Based on the result, LD50 of HF strain in mice determined by Questgraph

LD50 calculator (AAT Bioquest) was 100 bacteria (Fig 3.6).

3.5 Discussion

Since transposon mutants were recovered in mammalian DH82 cells, it is not surprising these mutants were not disabled in growth here. Further testing of mutant clones will reveal genes important for in vitro tick cell growth, though none of the nine genes tested here were critical. These mutants can also be used in future in vivo tick studies by inoculating fed I. scapularis ticks. Not only will this test mutant role in tick infection, but also in tick transmission. 92 The structural homology of EHF_RS04100 to SSL suggests that it may act as an adhesin similar to the mechanism seen in in Aph (Seidman, Hebert et al. 2015). As a conserved hypothetical protein with significant homology to human Ehrlichial pathogens

E. chaffeensis and E. muris ssp. Euclairensis, H59 awaits characterization.

Testing clones one at a time is important to examine the effect of each mutated gene. During this work, a method for separating mutant clones from mixtures resulting from high transformation efficiency was developed. While another group used random transposon mutagenesis to obtain two mutant clones and tested them in deer (Cheng, Nair et al. 2013) and dogs (McGill, Nair et al. 2016), this project resulted in more clones, and was the first to demonstrate clonality with flank PCR. This stringency was carried through in vitro and in vivo testing by performing flank PCR before and after each evaluation. Interestingly, mutants that were evaluated by flank PCR as clones revealed other populations in mouse tissues only. PCR of the same culture used in mouse inoculation repeatedly resulted in only large bands even after small bands were seen in mouse tissues. This led to our defining “clone” as Ehrlichia population in which only one insertion can be identified by PCR in culture. Given the sensitivity of PCR, this implies ability of some Ehrlichia populations to persist at very low concentration in culture, then grow up in mouse tissue. These latent populations could be wild type bacteria that survived antibacterial pressure via unknown mechanisms, or insertions not detected by

ST-PCR in other H65 and H66 transformation experiments.

When H58 was tested initially, it contained a mixture of two mutants: one upstream of type 1 secretion system TolC EHF 0151, and one intragenic insertion in hypothetical protein EHF 0758. Mice inoculated with this mixture lived significantly

93 longer than WT HF-infected mice. EHF 0151 was cloned out and tested in mice, which died in the same timeline as WT HF-infected mice. Mixtures containing EHF 0758 has been subjected to limited dilution several times, but has so far resisted cloning. When a clone is obtained, it will be studied further since it contributed to the delayed clinical course in mice.

This is the first mutagenesis study to combine the interrogative power of random transposon mutagenesis with a feasible small mammal virulence model. While some groups have used ecologically relevant deer and cattle (Cheng, Nair et al. 2013, Crosby,

Brayton et al. 2015), laboratory mice are the best option for studying multiple mutant genes due to their small size and accessibility.

94 Figure 3.1 Infectivity of cloned HF Himar1 mutants in tick cells

Cloned HF Himar1 mutants and WT HF cultured in ISE6 tick cells. HEMA3 staining.

Scale bar, 10 µm

95 Figure 3.2 Kaplan-Meier survival curves for mice inoculated with 9 cloned mutants and one mixture.

A. Wild type, H43B, and

H58D mixture. Compared with WT, H43B and H58D mixture survived significantly longer, P < 0.05 by the Log- rank test (N=5). B. compared to H59, each clone P < 0.05 by the Log-rank test (N=3).

C. compared to H59, each clone P < 0.05 by the Log- rank test (N=3). 5B and 5C were separated for figure clarity.

96 Figure 3.3 insert PCRs and diagrams showing H58 mixture

MW: GeneRuler 1kb Plus DNA ladder, B buffer, H58 mutant-infected mouse DNA, WT and H58 inoc: infected DH82 inoculum DNA, arrows: PCR primers, red rectangle: insert containing mCherry, white arrow: labeled ORF. To scale except primers.

97 Figure 3.4 Flank PCR showing that HF Ehrlichia Himar clones infecting ISE6 and mouse cells contain clones for their respective single insertions; MW molecular weight, B buffer control, WT wild type HF DNA template, labeled mutant, Table 2 lists

PCR product sizes with and without Himar insert. H43B and H59 clone-infected ISE6 cells are shown here while mouse PCR is shown in Figure 4.4 and 4.5.

continued

98 Figure 3.4 continued

continued

99 Figure 3.4 continued

continued

100 Figure 3.4 continued

101 Figure 3.5. Growth curves of H43B and H59 clones

A. DH82 cells were infected with WT HF, H43B, and H59 clones. Representative

HEME3 staining images were shown at day 2, 3, or 4 post infection. White arrows, ehrlichial microcolonies (morulae). Scale bar, 10 µm.

B. Growth curve showing WT HF, H43B, and H59 in DH82 cells. Infection and growth of H59 and H43B mutants in DH82 cells were similar by repeated-measures ANOVA,

P>0.05 (N=3).

A.

continued

102 Figure 3.5 continued B.

103 Figure 3.6 LD50 of the Wild-type (WT) HF strain.

A. Kaplan-Meyer survival curves for WT HF bacteria, number of inoculated bacteria/mouse is shown for each curve, N=3, Log-rank, Gehan-Breslow-Wilcoxon test among each group: P<

0.01.

B. Sigmoidal curve showing the calculation of WT HF culture. LD50 is based on survival with

10-fold dilutions, calculated from AAT Bioquest LD50 calculator, with means and standard error

(N=3).

104

CHAPTER FOUR: MUTATED EHF_RS04100 AND EHF_0962 ALTER IMMUNE RESPONSE IN MICE

4.1 Abstract

Ehrlichia spp. are emerging tick-borne obligatory intracellular bacteria that infect monocytes- macrophages or granulocytes, and cause febrile diseases with abnormal blood cell counts and signs of hepatitis. Ehrlichia HF strain, which is most closely related to E. muris subsp. eauclairensis subsp. nov., a newly discovered human ehrlichiosis agent, provides an excellent mouse disease model of fatal human ehrlichiosis. The Rikihisa lab recently established stable culture of Ehrlichia HF strain in DH82 cells, and annotated its whole genome sequence. To identify genes required for in vivo virulence of Ehrlichia, I constructed random insertional HF strain mutants by using Himar 1 transposon-based mutagenesis procedure. Of total 158 insertional mutants isolated, 74 insertions were in the coding regions of 55 distinct protein coding genes, and nine mutant clones, two mutant clones showed significantly retarded growth in blood, livers, and spleens; mice inoculated with them lived longer than mice inoculated with wild-type HF strain. The clones contained mutations in genes conserved among Ehrlichia spp, but without known homology to other bacterial genes. Th1 cytokine mRNA levels in the liver of mice infected with the two mutants was significantly lower than in mice inoculated with wild- type HF strain. Thus, we demonstrate the existence of Ehrlichia genes responsible for non- macrophage infection-related virulence.

105

4.2 Introduction

HME is a serious disease, but interestingly many individuals do not develop serious disease or require hospitalization. Patients who do develop organ failure are frequently elderly, have HIV, or are otherwise immunocompromised. Fatal disease also resembles septic shock-like syndrome (Fichtenbaum, Peterson et al. 1993). Immunocompromised patients present with less hepatitis, but more cytopenia (Thomas, Hongo et al. 2007). This suggests that the disease pathology may stem partly from immune dysregulation including cytokine storm, rather than simply infection (Miura, Matsuo et al. 2011). However, acute infection should not be discounted since mice depleted of CD1d NKT cells died with higher bacterial loads than undepleted mice, but without signs of toxic shock – they had significantly lower serum TNF-α (Stevenson,

Crossley et al. 2008). The specifics of this toxic shock syndrome and cytokine study has been investigated in one human study: cytokine levels were compared in uninfected human patients with a nonfatal and a fatal case of Ehrlichia.

In fatal HME, TNF-α was highly elevated over uninfected control and elevated over the nonfatal case. IFN-γ was higher in nonfatal HME than in fatal HME, and both cases were higher than the uninfected control. IL-1β and IL-6 were elevated in fatal HME, while these levels were equal to uninfected controls in nonfatal disease. IL-12 was similar to uninfected control in fatal

HME, and decreased in nonfatal HME. Anti-inflammatory IL-10 were highly elevated over uninfected control and elevated over the nonfatal case (Ismail, Walker et al. 2012).

When Ehrlichia can infect and cause disease in immunocompetent mice, this phenomenon can be studied most effectively. HF’s use as a model for fatal HME is highlighted by similarities in mouse immunopathology to fatal HME. Hematological findings such as 106 transient (in nonlethal) and terminal (in lethal) thrombocytopenia and leukocytopenia also support the HF model of HME (Bitsaktsis, Huntington et al. 2004). Several studies focus on the immune reactions of HF in immunocompetent mice, elucidating the roles of TNF-α, IFN-γ,

TGF-β, IL-10, IL-12, and IL-1β.

The classic immunopathology of fatal ehrlichiosis is TNF-α overproduction by CD8+ T cells, and IFN- γ underproduction accompanied by insufficiency of CD4+ T cells (Ismail, Soong et al. 2004, Bitsaktsis and Winslow 2006, Miura and Rikihisa 2007). These studies show that rather than working together and regulating one another to clear infection, CD8+ overtakes

CD4+ T cells in function. This leads to major overproduction of TNF-α, which is the most major source of liver damage (Ismail, Soong et al. 2004, Stevenson, Crossley et al. 2008). As in fatal and nonfatal HME, TNF-α is increased in HF-infected mouse serum, and mice developed hepatitis and died (Ismail, Soong et al. 2004).

When the immune system functions as it should, CD4+ and NKT cells produce IFN-γ which effectively activates macrophages to clear intracellular infection. In HF-infected mice,

IFN-γ-producing CD4+ cells were significantly decreased in the spleen (Ismail, Soong et al.

2004). In contrast, mice inoculated with E. muris, which mimics nonlethal infection, produced a robust IFN-γ-producing CD4+ response in the spleen (Thirumalapura, Crossley et al. 2009). This is underscored by the high spleen levels of IFN-γ found in nonlethal intradermal inoculation of

HF in mice. Interestingly, IFN-γ was much higher in serum of fatally ip inoculated mice than id inoculated (Stevenson, Jordan et al. 2006), meaning the cytokine is still produced to some degree, but is ineffective at clearing the infection before organ damage occurs.

107 IL-12 is a pro-inflammatory cytokine in that it stimulates a cytotoxic T-cell response, but it also stimulates the production of immunomodulatory IL-10. Significantly lower levels are detectable in the serum of HF-infected (fatal) mice than E. muris-infected (non-fatal) mice. This is proposed as a contributing cause to the insufficient CD4+ T cell response. HF-infected mice also had much higher serum IL-1β levels than uninfected mice (Kader, Alaoui-El-Azher et al.

2017).

IL-10 is an anti-inflammatory cytokine that works partially by deactivating macrophages

(de Waal Malefyt, Abrams et al. 1991, Lee and Rikihisa 1996). In HF infected mice, it is produced primarily by NKT cells, with serum levels increased over controls (Stevenson,

Crossley et al. 2008, Stevenson, Estes et al. 2010, Ghose, Ali et al. 2011). While it effectively prevents cytokine damage in Mycobacterium tuberculosis infection, it cannot regulate cytokine storm in fatal Ehrlichia infection, but prevents bacteria clearance instead (Ismail, Stevenson et al.

2006). This phenomenon is mirrored in human infection (Ismail, Walker et al. 2012). Another cytokine that can take a regulatory role is TGF-β. Compared with non-lethal E. muris infected mice, lethal HF-infected mouse spleens produced significantly lower TGF-β (Thirumalapura,

Crossley et al. 2009). This likely led to this cytokine failing to regulate cytokine storm.

Despite the fact that the HF-infected immunocompetent mouse is superior for studying

HME, work with different strains of Ehrlichia in SCID mice has been an invaluable learning tool. Here, it can help explain the phenomena seen in fatal HME and mouse model. Previous studies have shown that despite their lack of lymphocytes, SCID mouse livers upregulate both proinflammatory cytokines TNF-α and IL-1β, and immunosuppressant cytokines IL-10 and

TGF-β1 when exposed to the most virulent E. chaffeensis strain Wakulla (Miura and Rikihisa

108 2007, Miura and Rikihisa 2009). IL-1β and TNF-α were also upregulated in immunocompetent mouse BMDMs. In the same study, these cytokines were not upregulated in MyD88 knockout mice, while they were still upregulated in TRIF, TLR2, and TLR4 mice, meaning proinflammatory cytokines are signaled independently of these components including TLR3, which functions through TRIF. This makes sense as TLR4 normally reacts to LPS, and TLR2 normally reacts to peptidoglycan (Guha and Mackman 2001, Hoffmann, Dittrich-Breiholz et al.

2002). The same study further ruled out intracellular TLR3, TLR7, and TLR9 since these function with endosome acidification: proinflammatory cytokines were still upregulated when

BMDMs treated with acidification inhibitors chloroquine (weak base) and bafilomycin A1

(inhibitor of vacuolar-type H+-ATPase).

While we did not track different immune cell types in our mouse model, previous work can also help explain the cytokine levels seen. Monocyte/macrophages, NK cells, and neutrophils are more abundant in Wakulla-infected SCID mouse livers (Miura and Rikihisa

2009). NK cell maturation is driven by dendritic cells (DCs) and activated macrophages: DCs produce IL-12, IL-15, and IL-18, activating cytotoxic T/NK cells and stimulating their IFN-γ production. This interferon then promotes CD4+ T cell division. NK cells can drive hepatitis in

Ehrlichiosis and viral hepatitis models. While NK cells play a protective role in some viral infections, NK cells cause hepatocyte apoptosis in models of viral hepatitis (Liu, Govindarajan et al. 2000, Dunn, Brunetto et al. 2007, Stevenson, Estes et al. 2010).

Neutrophils are found in the livers of HF-infected mice (Okada, Tajima et al. 2001), as well as Wakulla-infected mice (Miura and Rikihisa 2009). From there, they recruit CD4+ and

CD8+ T cells (Cua and Tato 2010), which in return recruit more neutrophils with IL-8. Since

109 human patients with fatal HME have increased neutrophils and serum IL-8 (Ismail, Walker et al.

2012), neutrophils are likely involved in pathogenic immune dysregulation. CD4+ and CD8+ T cells also activate the neutrophils by secreting IFN-γ (Yang, Ghose et al. 2013). Normal neutrophils commit apoptosis to regulate inflammatory response, but failure to clear these apoptotic cells can contribute to continuous inflammation (Savill, Dransfield et al. 2002,

Stevenson, Jordan et al. 2006, Ismail, Walker et al. 2012). The immunopathogenic role of neutrophils is supported by prolonged survival in mice experimentally depleted of neutrophils.

Otherwise, number of neutrophils peak in the peritoneum of ip-inoculated mice, but the presence of bacteria there persisted, meaning these phagocytes were ineffective at clearing infection.

Furthermore, neutrophil-depleted mice demonstrated a restored balance of CD4+ and CD8+ T cells, contrary to the pathogenic depletion of CD4+ and overgrowth of CD8+, as well as decreasing proinflammatory cytokines IL-1α, IL-1β, and IL-6, as well as IL-10 which is immunosuppressing but associated with pathogenesis (Yang, Ghose et al. 2013).

4.3 Materials and Methods

HF Ehrlichia culture

Canine histiocytic leukemia DH82 cells were cultured in DMEM (Dulbecco minimal essential medium; Mediatech, Manassas, VA) supplemented with 5% fetal bovine serum (FBS; Atlanta

Biologicals, Lawrenceville, GA) and 2 mM L-glutamine (L-Gln; GIBCO, Waltham, MA) at

37°C under 5% CO2 in a humidified atmosphere as described previously (Rikihisa, Stills et al.

1991, Mohan Kumar, Yamaguchi et al. 2013). Ehrlichia sp. HF was cultured in DH82 cells with the addition of 0.1μg/mL cycloheximide (Millipore Sigma, Burlington, MA) at the same

110 condition. The degree of bacterial infection in host cells was assessed by Diff-Quik staining.

Briefly, a drop of infected cells were centrifuged onto a slide in a Cytospin 4 cytocentrifuge

(Thermo Fisher, Waltham, MA), then fixed and stained with HEMA 3 staining solutions

(Thermo Fisher).

Mouse infection

In each experiment, infected cells were resuspended in DMEM medium without FBS and antibiotics, and 0.5 mL per mouse were inoculated using a 1 mL TB syringe with a 26-gauge needle (BD, Franklin Lakes, NJ). Mice were monitored daily for weight loss and moribund condition indicated by hunched posture, squinted eyes, slow movement, reduced response to stimulation, and loss of 20% body weight according to IACUC. Moribund mice were euthanized by CO2 inhalation and cervical dislocation.

Experiment 1: H43B, H59 terminal mortality

Female ICR 10 week (Envigo, Indianapolis, IN), five mice each were intraperitoneally inoculated with 200 WT, H43B or H59-infected DH82 cells for comparative experiments. As bacteria need to be fresh, bacterial number was estimated by counting percent infected cells immediately inoculation, and verified by qPCR later as described above. Mice were inoculated with 42,500 WT bacteria, 28,400 H43B bacteria, and 42,700 H59 bacteria. Tissue samples were frozen for use in DNA extraction.

111 Experiment 2: H43B, H59 day 7 pi infection

Female ICR mice 6 week (Envigo, Indianapolis, IN), five mice each were intraperitoneally mice were inoculated with 200 infected cells as described above containing 1,330 WT bacteria, 16,300

H43B bacteria, and 3,760 H59 bacteria. Mice were euthanized day 7 when WT-infected mice were beginning to show signs of infection (hunched posture, slow movement, weight loss).

Cardiac puncture blood was collected and tissue samples were stored in RNALater (Qiagen) for

RNA and frozen for use in DNA extraction.

Quantification of Ehrlichia bacterial numbers

DNA was purified from uninfected and Ehrlichia sp. HF-infected DH82 cells and mouse tissues with a QIAamp DNA Mini Kit (Qiagen). To quantify Ehrlichia, an absolute quantification method was used by creating a standard curve of the Ehrlichia 16S rRNA gene copy number by qPCR according to the manufacturer’s protocol (Stratagene, Waltham, MA) (Liu, Bao et al.

2012) Ehrlichia 16S rDNA was cloned in a pUC19 plasmid as a standard template

(Teymournejad, Lin et al. 2017). Tenfold dilutions (1 to 1:1000) of the standard template were prepared, and qPCR analysis were performed to generate a standard curve by plotting the initial template quantity against the threshold cycle (CT) values for the standards. The qPCR mixture

(20 μl) included 0.25 μM each primer, and 10 μl of SYBR green qPCR master mix (Thermo

Fisher). Primer sequences for the Ehrlichia 16S rRNA gene are shown in Table 2. PCR was performed in the Mx3000P instrument (Stratagene). The copy number of the targeted gene in

DNA samples was calculated by comparing the Ct value with the standard curve. Expression of each gene was normalized against mouse GAPDH levels.

112

Reverse transcription-quantitative PCR (qRT-PCR)

WT and mutant-infected mouse spleen and liver were preserved in 0.5 cm sections in RNAlater reagent (Thermo Fisher). Total cellular RNA was extracted from 30 mg tissue per sample using

RNeasy kit according to the manufacturer’s instructions (Qiagen, Valencia, CA). RNA concentrations and quality were determined by NanoDrop (Thermo Fisher). Total RNA (0.5 μg) was reverse transcribed using a Maxima H Minus First Strand cDNA Synthesis Kit and oligo dT primers (Thermo Fisher). The qPCR reaction mixture (20 μl) included 5 μl cDNA

(corresponding to 0.1 μg of total RNA), 0.25 μM each primer and 10 μl SYBR Green qPCR master mix (Thermo Fisher). PCR was performed in an Mx3000P instrument. Primer sequences are described in Table 2.

Statistical analysis

Statistical analysis was performed with analysis of variance (ANOVA) followed by Tukey multiple comparison, and with repeated measures analysis of variance (rANOVA) and P < 0.05 was considered a statistically significant. All statistical analyses were performed using Prism 8 software (GraphPad, La Jolla, CA).

Ethics Statement

All animal experiments were performed in accordance with the Ohio State University

Institutional Animal Care and Use Committee guidelines and approved e-protocol. The

113 university program has full continued accreditation by the Association for Assessment and

Accreditation of Laboratory Animal Care International under 000028, dated 9 June 2000, and has Public Health Services assurance renewal A3261-01, dated 6 February 2019 through 28

February 2023. The program is licensed by the USDA, number 31-R-014, and is in full compliance with Animal Welfare Regulations.

4.4 Results

Mouse virulence of cloned HF mutants H43B and H59

H59 has a Himar insertion in EHF_0962 (conserved hypothetical protein, 119 aa) and

H43B has the insertion in EHF_RS04100 (conserved hypothetical protein, 651 aa) (Table 1).

Although no known motif was detected in EHF_0962, staphylococcal superantigen-like (SSL) domain (Fraser and Proft 2008)(aa 429-537, E-value 2.47 e-04) was detected in EHF_RS04100.

Compared with WT, H59 and H43B infection and growth in DH82 macrophage were previously determined to be similar. When ~ 4 × 104 WT bacteria were inoculated per mouse, all 5 mice were severely moribund necessitating euthanasia or died on day 9-10 pi, whereas, mice inoculated with

H43B were euthanized or died from day 12-17 pi. Mice inoculated with H59 were euthanized or died from day 13 to 21 pi, and one mouse appeared recovering from illness on day 22, when the experiment was terminated (Fig 4.4A). Clonality of H43B and H59 in inoculated mice were verified by insertion site-specific flank PCR at euthanasia in the liver samples of inoculated mice

(Fig 4.4B). Thus, H43B and particularly H59 mutants partially lost virulence in mice.

114 Cytokine gene induction by HF WT and mutants

At day 7 pi, slight splenomegaly was detected with WT and H43B but not with H59 (Figure

4.1). In the blood, spleen, and liver, similar levels of bacteria were detected with WT, but dramatically low levels of H43B strain, and no H59 was detected by qPCR (Fig 4.5). In the liver at day 7 pi, WT induced proinflammatory cytokines (TNF-α, IL-1ß, IFN-γ, IL-6), but not IL-12 A

(Fig 4.2); immunosuppressive cytokines IL-10 and TGF-ß1 were also detected (Fig 4.3).

None of these cytokines were detected in the liver of H59-inoculated mice, and except IL-1ß and IFN-γ, H43 induced significantly reduced levels of these cytokines in the liver compared with

WT (Fig 4.2), and clonality was verified (Fig 4.5B) to validate mutation effect on cytokine.

4.5 Discussion

H43B and H59 both affect immune dysregulation. H43B livers expressed significantly less proinflammatory cytokines TNF-α and IL-6. Since fatal HME is characterized by organ damage mediated by excessive TNF-α, decrease in this factor may have contributed to increased survival time. Despite the trending decrease in every other proinflammatory cytokine measured,

IFN-γ was not significantly less expressed in H43B. However, this was still insufficient IFN-γ required to clear infection (Barnewall and Rikihisa 1994). Anti-inflammatory cytokine IL-10 is implicated in failure to clear infection; H43B mutants expressed significantly less, which may partially explain the decrease in infection.

Since H59 mutants matched mock-infected controls in every cytokine measured, it is difficult to determine if this effect resulted from interaction of the mutated gene product

EHF0962, or from lack of detectable infection in mouse tissue. Though infection could not be

115 detected, 80% of mice inoculated with a similar dose of bacteria eventually succumbed to infection. Interestingly, the surviving mouse had similar infection to others in the group and indeed to WT-infected mice (not shown), suggesting that the lengthened clinical course and occasional survival at this dose of H59 is related to toxic shock rather than lack of infection.

H43B and H59 proteins will be cloned and recombinant protein will be used in mouse studies as well. Recombinant protein killing mice will strengthen the link between mutated genes and their effect on mouse immune dysregulation.

Some groups have focused on adaptive immunity and immunizations against HF using E. muris (Yager, Bitsaktsis et al. 2005, Bitsaktsis, Nandi et al. 2007, Thirumalapura, Crossley et al.

2009); we have chosen to focus on innate immunity due to the rapid progression of the disease.

While protective immunity from previous infection is interesting and may lead to vaccine studies, we are most interested in studying the immunopathology leading to acute, ultimately fatal, disease. This will help develop more effective treatment for HME

116 Figure 4.1 Spleen indices in mice infected with two different mutants Spleen index at day 7 pi, *, P < 0.05 with ANOVA and Tukey’s test (N=5).

117 Figure 4.2 Proinflammatory cytokines gene expression in livers of mice inoculated with

H59, H43B, and WT HF strain

Real-time RT-PCR analysis of differentially expressed cytokine-related genes in WT and mutant

HF Ehrlichia mouse liver day 7 pi. The data shown are means and standard deviations, with mRNA levels normalized by GAPDH, *, P < 0.05 using ANOVA followed by Tukey (N=5).

continued

118 Figure 4.2 continued

119 Figure 4.3 Anti-inflammatory cytokine gene expression in livers of mice infected with H59, H43B, and WT HF strain

Real-time RT-PCR analysis of differentially expressed cytokine-related genes in WT and mutant HF Ehrlichia mouse liver day 7 pi. The mean expression level of each gene in liver tissues from mutant-infected mice relative to the mean expression in liver tissues from wild type-infected mice is shown. All data are normalized to glyceraldehyde-3- dehydrogenase (GAPDH) expression. N=5, *P < 0.05

120 Figure 4.4 Kaplan-Meyer survival curves and flank PCR to detect the clonality of H34B and H59

A. Kaplan-Meyer survival curves for two Himar1 mutant clones, P < 0.001 by Log-rank, Gehan-

Breslow-Wilcoxon test (N=5). B. Flank PCR showing that H43B- and H59-infected DH82 and liver tissues of Mouse 3 (M3) and Mouse 4 (M4) died at day 12 and 17, respectively (H43B, top panels), and Mouse 5 (M5) and Mouse 6 (M6) died at day 14 and 21, respectively (H59, bottom panels). For H43B, EHF_RS04100 primers (Table 2) flanking H43B insertion site were used, showing 373 bp and 2,206 bp without and with Himar1 insert, respectively. For H59, EHF_0962 primers (Table 2) flanking H59 insertion site were used, showing 421 bp and 2,254 bp without and with Himar1 insert, respectively.

121 Figure 4.5 Bacterial load in mice inoculated with H59, H43B, and WT HF strain

A. Bacterial load in mouse blood, liver, spleen day 7 pi. 16S rRNA gene was normalized to

GAPDH, *, P < 0.05 using ANOVA (N=5).

B. Flank PCR using primers described in Fig. 7B, showing the clonality of H43B- and H59- infected DH82 cells, and liver tissues of Mouse 3 (M3) and Mouse 4 (M4) for H34B, and Mouse

5 (M5) and Mouse 6 (M6) for H59 at day 7 pi.

A.

continued 122 Figure 4.5 continued

B.

123 CONCLUSION

A random Himar transposon library has been generated in mouse-virulent HF-strain

Ehrlichia. The method has been optimized for future scientists to expand the library efficiently.

A limiting dilution cloning method has also been developed to separate mutant populations. 84 intergenic insertions represent genomic loci candidates for non-knockout genetic manipulation, and 55 gene knockouts represent 55 genes that can be knocked out without disrupting the bacteria’s growth in macrophages.

7 knocked out genes are not important for mouse infection, and 3 genes EHF_RS04100,

EHF_0758, and EHF_0962 are important for mouse infection, but not for growth in vitro.

EHF_RS04100 and EHF_0962 may be important to the immune dysregulation process that characterizes fatal Ehrlichiosis.

124

REFERENCES

AAT Bioquest, I. "Quest Graph™ LD50 Calculator." from https://www.aatbio.com/tools/ld50- calculator.

Akcay, A. (2013). "The Calculation of LD50 Using Probit Analysis." Faseb Journal 27. Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman (1990). "Basic local alignment search tool." J Mol Biol 215(3): 403-410.

Anderson, B. E., J. E. Dawson, D. C. Jones and K. H. Wilson (1991). "Ehrlichia chaffeensis, a new species associated with human ehrlichiosis." J Clin Microbiol 29(12): 2838-2842.

Andersson, M. O., G. Radbea, D. Frangoulidis, H. Tomaso, F. Rubel, S. Nava and L. Chitimia- Dobler (2018). "New records and host associations of the tick Ixodes apronophorus and the first detection of Ehrlichia sp. HF in Romania." Parasitol Res 117(4): 1285-1289.

Ashby, M. N. and P. A. Edwards (1990). "Elucidation of the deficiency in two yeast coenzyme Q mutants. Characterization of the structural gene encoding hexaprenyl pyrophosphate synthetase." J Biol Chem 265(22): 13157-13164.

Bakken, J. S., J. S. Dumler, S. M. Chen, M. R. Eckman, L. L. Van Etta and D. H. Walker (1994). "Human granulocytic ehrlichiosis in the upper Midwest United States. A new species emerging?" Jama 272(3): 212-218.

Barnewall, R. E. and Y. Rikihisa (1994). "Abrogation of gamma interferon-induced inhibition of Ehrlichia chaffeensis infection in human monocytes with iron-transferrin." Infect. Immun. 62(11): 4804-4810.

Bhagavan, N. V. and C.-E. Ha (2015). Essentials of medical biochemistry : with clinical cases. Amsterdam ; Boston, Elsevier/AP, Academic Press is an imprint of Elsevier.

Bitsaktsis, C., J. Huntington and G. Winslow (2004). "Production of IFN-gamma by CD4 T cells is essential for resolving ehrlichia infection." J Immunol 172(11): 6894-6901.

Bitsaktsis, C., B. Nandi, R. Racine, K. C. MacNamara and G. Winslow (2007). "T-Cell- independent humoral immunity is sufficient for protection against fatal intracellular ehrlichia infection." Infect Immun 75(10): 4933-4941.

125 Bitsaktsis, C. and G. Winslow (2006). "Fatal recall responses mediated by CD8 T cells during intracellular bacterial challenge infection." J Immunol 177(7): 4644-4651.

Brown, D. L., K. K. Desai, B. A. Vakili, C. Nouneh, H. M. Lee and L. M. Golub (2004). "Clinical and biochemical results of the metalloproteinase inhibition with subantimicrobial doses of doxycycline to prevent acute coronary syndromes (MIDAS) pilot trial." Arterioscler Thromb Vasc Biol 24(4): 733-738.

Bulla, C., R. Kiomi Takahira, J. Pessoa Araujo, Jr., L. AparecidaTrinca, R. Souza Lopes and C. E. Wiedmeyer (2004). "The relationship between the degree of thrombocytopenia and infection with Ehrlichia canis in an endemic area." Vet Res 35(1): 141-146.

Buller, R. S., M. Arens, S. P. Hmiel, C. D. Paddock, J. W. Sumner, Y. Rikhisa, A. Unver, M. Gaudreault-Keener, F. A. Manian, A. M. Liddell, N. Schmulewitz and G. A. Storch (1999). "Ehrlichia ewingii, a newly recognized agent of human ehrlichiosis." N. Engl. J. Med. 341(3): 148-155.

Cartman, S. T. and N. P. Minton (2010). "A mariner-based transposon system for in vivo random mutagenesis of Clostridium difficile." Appl Environ Microbiol 76(4): 1103-1109.

CDC. (2017). "Doxycycline for Post-Exposure Prophylaxis of Anthrax." 2019, from https://www.cdc.gov/anthrax/medical-care/doxy-eui-hcp.html.

CDC. (2018). "Rocky Mountain Spotted Fever (RMSF) Treatment." 2019, from https://www.cdc.gov/rmsf/healthcare-providers/treatment.html.

CDC. (2019). "Ehrlichiosis Clinical and Laboratory Diagnosis."

CDC. (2019). "Ehrlichiosis Epidemiology and Statistics." from https://www.cdc.gov/ehrlichiosis/stats/index.html.

CDC (2019). "Ehrlichiosis Treatment."

Chavez, A. S. O., J. W. Fairman, R. F. Felsheim, C. M. Nelson, M. J. Herron, L. Higgins, N. Y.

Burkhardt, J. D. Oliver, T. W. Markowski, T. J. Kurtti, T. E. Edwards and U. G. Munderloh (2015). "An O-Methyltransferase Is Required for Infection of Tick Cells by Anaplasma phagocytophilum." Plos Pathogens 11(11).

Cheng, C., A. D. Nair, V. V. Indukuri, S. Gong, R. F. Felsheim, D. Jaworski, U. G. Munderloh and R. R. Ganta (2013). "Targeted and random mutagenesis of Ehrlichia chaffeensis for the identification of genes required for in vivo infection." PLoS Pathog 9(2): e1003171.

126 Cheng, Z., M. Lin and Y. Rikihisa (2014). "Ehrlichia chaffeensis Proliferation Begins with NtrY/NtrX and PutA/GlnA Upregulation and CtrA Degradation Induced by Proline and Glutamine Uptake." MBio 5(6).

Cheng, Z., K. Miura, V. L. Popov, Y. Kumagai and Y. Rikihisa (2011). "Insights into the CtrA regulon in development of stress resistance in obligatory intracellular pathogen Ehrlichia chaffeensis." Mol Microbiol 82: 1217-1234.

Chun, K. T., H. J. Edenberg, M. R. Kelley and M. G. Goebl (1997). "Rapid amplification of uncharacterized transposon-tagged DNA sequences from genomic DNA." Yeast 13(3): 233-240.

Cowdry, E. V. (1925). "Studies on the aetiology of heartwater: I. Observation of a rickettsia, Rickettsia rumminantium (n. sp.) in the tissues of infected animals." J. Exp. Med. 44: 803-814.

Crocquet-Valdes, P. A., N. R. Thirumalapura, N. Ismail, X. Yu, T. B. Saito, H. L. Stevenson, C. A. Pietzsch, S. Thomas and D. H. Walker (2011). "Immunization with Ehrlichia P28 outer membrane proteins confers protection in a mouse model of ehrlichiosis." Clin Vaccine Immunol 18(12): 2018-2025.

Crosby, F. L., K. A. Brayton, F. Magunda, U. G. Munderloh, K. L. Kelley and A. F. Barbet (2015). "Reduced Infectivity in cattle for an outer membrane protein mutant of Anaplasma marginale." Appl Environ Microbiol 81(6): 2206-2214.

Cua, D. J. and C. M. Tato (2010). "Innate IL-17-producing cells: the sentinels of the immune system." Nat Rev Immunol 10(7): 479-489. de Waal Malefyt, R., J. Abrams, B. Bennett, C. G. Figdor and J. E. de Vries (1991). "Interleukin 10(IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes." J Exp Med 174(5): 1209-1220.

Donatien, A. and F. Lestoquard (1935). "Existence en Algerie d'une Rickettsia du chien " Bull. Soc. Pathol. Exot. 28: 418-419.

Dumler, J. S., J. E. Madigan, N. Pusterla and J. S. Bakken (2007). "Ehrlichioses in humans: epidemiology, clinical presentation, diagnosis, and treatment." Clin Infect Dis 45 Suppl 1: S45- 51.

Dunn, C., M. Brunetto, G. Reynolds, T. Christophides, P. T. Kennedy, P. Lampertico, A. Das, A. R. Lopes, P. Borrow, K. Williams, E. Humphreys, S. Afford, D. H. Adams, A. Bertoletti and M. K. Maini (2007). "Cytokines induced during chronic hepatitis B virus infection promote a pathway for NK cell-mediated liver damage." J Exp Med 204(3): 667-680.

Dunphy, P. S., T. Luo and J. W. McBride (2013). "Ehrlichia moonlighting effectors and interkingdom interactions with the mononuclear phagocyte." Microbes Infect 15(14-15): 1005- 1016. 127

Dunphy, P. S., T. Luo and J. W. McBride (2014). "Ehrlichia chaffeensis Exploits Host SUMOylation Pathways To Mediate Effector-Host Interactions and Promote Intracellular Survival." Infect Immun 82(10): 4154-4168.

Ewing, S. A., J. E. Dawson, A. A. Kocan, R. W. Barker, C. K. Warner, R. J. Panciera, J. C. Fox, K. M. Kocan and E. F. Blouin (1995). "Experimental transmission of Ehrlichia chaffeensis (Rickettsiales: Ehrlichieae) among white-tailed deer by Amblyomma americanum (Acari: Ixodidae)." J. Med. Entomol. 32(3): 368-374.

Felsheim, R. F., M. J. Herron, C. M. Nelson, N. Y. Burkhardt, A. F. Barbet, T. J. Kurtti and U. G. Munderloh (2006). "Transformation of Anaplasma phagocytophilum." BMC Biotechnol 6: 42.

Fichtenbaum, C. J., L. R. Peterson and G. J. Weil (1993). "Ehrlichiosis presenting as a life- threatening illness with features of the toxic shock syndrome." Am J Med 95(4): 351-357.

Fraser, J. D. and T. Proft (2008). "The bacterial superantigen and superantigen-like proteins." Immunol Rev 225: 226-243.

Ganta, R. R., C. Cheng, E. C. Miller, B. L. McGuire, L. Peddireddi, K. R. Sirigireddy and S. K. Chapes (2007). "Differential clearance and immune responses to tick cell-derived versus macrophage culture-derived Ehrlichia chaffeensis in mice." Infect Immun 75(1): 135-145.

Gayle, A. and E. Ringdahl (2001). "Tick-borne diseases." Am Fam Physician 64(3): 461-466.

Ghai, R., T. Hain and T. Chakraborty (2004). "GenomeViz: visualizing microbial genomes." BMC Bioinformatics 5: 198.

Ghose, P., A. Q. Ali, R. Fang, D. Forbes, B. Ballard and N. Ismail (2011). "The Interaction between IL-18 and IL-18 Receptor Limits the Magnitude of Protective Immunity and Enhances Pathogenic Responses following Infection with Intracellular Bacteria." Journal of Immunology 187(3): 1333-1346.

Goessling, L. S., B. F. Allan, R. S. Mandelbaum and R. E. Thach (2012). "Development of a mitochondrial 12S rDNA analysis for distinguishing Sciuridae species with potential to transmit Ehrlichia and Borrelia species to feeding Amblyomma americanum (Acari: Ixodidae)." J Med Entomol 49(3): 772-776.

Gondard, M., A. Cabezas-Cruz, R. A. Charles, M. Vayssier-Taussat, E. Albina and S. Moutailler (2017). "Ticks and Tick-Borne Pathogens of the Caribbean: Current Understanding and Future Directions for More Comprehensive Surveillance." Front Cell Infect Microbiol 7: 490.

Guha, M. and N. Mackman (2001). "LPS induction of gene expression in human monocytes." Cell. Signal. 13(2): 85-94.

128

Ha, S. G., K. J. Oh, K. P. Ko, Y. H. Sun, E. Ryoo, H. Tchah, I. S. Jeon, H. J. Kim, J. M. Ahn and H. K. Cho (2018). "Therapeutic Efficacy and Safety of Prolonged Macrolide, Corticosteroid, Doxycycline, and Levofloxacin against Macrolide-Unresponsive Mycoplasma pneumoniae Pneumonia in Children." J Korean Med Sci 33(43): e268.

Harpaz, R., R. M. Dahl and K. L. Dooling (2016). "Prevalence of Immunosuppression Among US Adults, 2013." JAMA 316(23): 2547-2548.

Hewett-Emmett, D. and R. E. Tashian (1996). "Functional diversity, conservation, and convergence in the evolution of the alpha-, beta-, and gamma-carbonic anhydrase gene families." Mol Phylogenet Evol 5(1): 50-77.

Hoffmann, E., O. Dittrich-Breiholz, H. Holtmann and M. Kracht (2002). "Multiple control of interleukin-8 gene expression." J Leukoc Biol 72(5): 847-855.

Huang, H., M. Lin, X. Wang, T. Kikuchi, H. Mottaz, A. Norbeck and Y. Rikihisa (2008). "Proteomic analysis of and immune responses to Ehrlichia chaffeensis lipoproteins." Infect Immun 76(8): 3405-3414.

Hudson, P., T. S. Gorton, L. Papazisi, K. Cecchini, S. Frasca, Jr. and S. J. Geary (2006). "Identification of a virulence-associated determinant, dihydrolipoamide dehydrogenase (lpd), in Mycoplasma gallisepticum through in vivo screening of transposon mutants." Infect Immun 74(2): 931-939.

Indukuri, V. (2013). Transposon based mutagenesis and mapping of transposon insertion sites within the ehrlichia chaffeensis genome using semi random two-step PCR Master of Science Kansas State University

Ismail, N., L. Soong, J. W. McBride, G. Valbuena, J. P. Olano, H. M. Feng and D. H. Walker (2004). "Overproduction of TNF-alpha by CD8+ type 1 cells and down-regulation of IFN- gamma production by CD4+ Th1 cells contribute to toxic shock-like syndrome in an animal model of fatal monocytotropic ehrlichiosis." J Immunol 172(3): 1786-1800.

Ismail, N., H. L. Stevenson and D. H. Walker (2006). "Role of tumor necrosis factor alpha (TNF-alpha) and interleukin-10 in the pathogenesis of severe murine monocytotropic ehrlichiosis: increased resistance of TNF receptor p55- and p75-deficient mice to fatal ehrlichial infection." Infect Immun 74(3): 1846-1856.

Ismail, N., D. H. Walker, P. Ghose and Y. W. Tang (2012). "Immune mediators of protective and pathogenic immune responses in patients with mild and fatal human monocytotropic ehrlichiosis." BMC Immunol 13: 26.

Kader, M., M. Alaoui-El-Azher, J. Vorhauer, B. B. Kode, J. Z. Wells, D. Stolz, G. Michalopoulos, A. Wells, M. Scott and N. Ismail (2017). "MyD88-dependent inflammasome 129 activation and autophagy inhibition contributes to Ehrlichia-induced liver injury and toxic shock." PLoS Pathog 13(10): e1006644.

Kaufman, P. D. and D. C. Rio (1991). "Germline transformation of Drosophila melanogaster by purified P element transposase." Nucleic Acids Res 19(22): 6336.

Kawahara, M., Y. Rikihisa, Q. Lin, E. Isogai, K. Tahara, A. Itagaki, Y. Hiramitsu and T. Tajima (2006). "Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan." Appl Environ Microbiol 72(2): 1102-1109.

Kazimirova, M. and I. Stibraniova (2013). "Tick salivary compounds: their role in modulation of host defences and pathogen transmission." Front Cell Infect Microbiol 3: 43.

Khani, A., N. Popp, B. Kreikemeyer and N. Patenge (2018). "A Glycine Riboswitch in Streptococcus pyogenes Controls Expression of a Sodium:Alanine Symporter Family Protein Gene." Front Microbiol 9: 200.

Kim, Y. R. and J. H. Rhee (2003). "Flagellar basal body flg operon as a virulence determinant of Vibrio vulnificus." Biochemical and Biophysical Research Communications 304(2): 405-410.

Kowalski, T. J., S. Tata, W. Berth, M. A. Mathiason and W. A. Agger (2010). "Antibiotic treatment duration and long-term outcomes of patients with early lyme disease from a lyme disease-hyperendemic area." Clin Infect Dis 50(4): 512-520.

Krakauer, T. and M. Buckley (2003). "Doxycycline is anti-inflammatory and inhibits staphylococcal exotoxin-induced cytokines and chemokines." Antimicrob Agents Chemother 47(11): 3630-3633.

Kumagai, Y., Z. Cheng, M. Lin and Y. Rikihisa (2006). "Biochemical activities of three pairs of Ehrlichia chaffeensis two-component regulatory system proteins involved in inhibition of lysosomal fusion." Infect Immun 74(9): 5014-5022.

Kumagai, Y., H. Huang and Y. Rikihisa (2008). "Expression and porin activity of P28 and OMP- 1F during intracellular Ehrlichia chaffeensis development." J Bacteriol 190(10): 3597-3605.

Lamason, R. L., N. M. Kafai and M. D. Welch (2018). "A streamlined method for transposon mutagenesis of Rickettsia parkeri yields numerous mutations that impact infection." PLoS One 13(5): e0197012.

Lampe, D. J., B. J. Akerley, E. J. Rubin, J. J. Mekalanos and H. M. Robertson (1999). "Hyperactive transposase mutants of the Himar1 mariner transposon." Proc Natl Acad Sci U S A 96(20): 11428-11433.

130 Lampe, D. J., M. E. A. Churchill and H. M. Robertson (1997). "A purified mariner transposase is sufficient to mediate transposition in vitro (vol 15, pg 5470, 1996)." Embo Journal 16(13): 4153- 4153.

Lawhorn, B. G., S. Y. Gerdes and T. P. Begley (2004). "A genetic screen for the identification of thiamin metabolic genes." J Biol Chem 279(42): 43555-43559.

Le Breton, Y., N. P. Mohapatra and W. G. Haldenwang (2006). "In vivo random mutagenesis of Bacillus subtilis by use of TnYLB-1, a mariner-based transposon." Applied and Environmental Microbiology 72(1): 327-333.

Lee, E. H. and Y. Rikihisa (1996). "Absence of tumor necrosis factor alpha, interleukin-6 (IL-6), and granulocyte-macrophage colony-stimulating factor expression but presence of IL-1beta, IL- 8, and IL-10 expression in human monocytes exposed to viable or killed Ehrlichia chaffeensis." Infect. Immun. 64(10): 4211-4219.

Li, J. S., F. Chu, A. Reilly and G. M. Winslow (2002). "Antibodies highly effective in SCID mice during infection by the intracellular bacterium Ehrlichia chaffeensis are of picomolar affinity and exhibit preferential epitope and isotype utilization." J Immunol 169(3): 1419-1425.

Li, J. S., E. Yager, M. Reilly, C. Freeman, G. R. Reddy, A. A. Reilly, F. K. Chu and G. M. Winslow (2001). "Outer membrane protein-specific monoclonal antibodies protect SCID mice from fatal infection by the obligate intracellular bacterial pathogen Ehrlichia chaffeensis." J Immunol 166(3): 1855-1862.

Lin, M., S. C. Daugherty, S. Parankush, N. Kumar, Z. Cheng, Q. Xiong, M. A. Rahman, J. Matsuo, F.-Y. Lin, J. Crabtree, N. Sengamalay, L. Sadzewicz, L. J. Tallon, C. Fraser, J. C. D. Hotopp and Y. Rikihisa (2013). Sequencing and Comparison of Genomes of Ehrlichia Strains and Transcriptome Profiles in Mammalian Host and Tick Cells. ASM 113th General Meeting, Denver, CO, American Society for Microbiology.

Lin, M., H. Liu, Q. Xiong, H. Niu, Z. Cheng, A. Yamamoto and Y. Rikihisa (2016). "Ehrlichia secretes Etf-1 to induce autophagy and capture nutrients for its growth through RAB5 and class III phosphatidylinositol 3-kinase." Autophagy 12(11): 2145-2166.

Lin, Q., N. Zhi, N. Ohashi, H. W. Horowitz, M. E. Aguero-Rosenfeld, J. Raffalli, G. P. Wormser and Y. Rikihisa (2002). "Analysis of sequences and loci of p44 homologs expressed by Anaplasma phagocytophila in acutely infected patients." J Clin Microbiol 40(8): 2981-2988.

Liu, H., W. Bao, M. Lin, H. Niu and Y. Rikihisa (2012). "Ehrlichia type IV secretion effector ECH0825 is translocated to mitochondria and curbs ROS and apoptosis by upregulating host MnSOD." Cell Microbiol 14: 1037-1050.

131 Liu, Z. X., S. Govindarajan, S. Okamoto and G. Dennert (2000). "NK cells cause liver injury and facilitate the induction of T cell-mediated immunity to a viral liver infection." J Immunol 164(12): 6480-6486.

Luo, T., J. A. Kuriakose, B. Zhu, A. Wakeel and J. W. McBride (2011). "Ehrlichia chaffeensis TRP120 interacts with a diverse array of eukaryotic proteins involved in transcription, signaling, and cytoskeleton organization." Infect Immun 79(11): 4382-4391. Lutkenhaus, J. (2012). "The ParA/MinD family puts things in their place." Trends in Microbiology 20(9): 411-418.

Maeda, K., N. Markowitz, R. C. Hawley, M. Ristic, D. Cox and J. E. McDade (1987). "Human infection with Ehrlichia canis, a leukocytic rickettsia." N Engl J Med 316(14): 853-856.

Maglennon, G. A., B. S. Cook, D. Matthews, A. S. Deeney, J. T. Bosse, P. R. Langford, D. J. Maskell, A. W. Tucker, B. W. Wren, A. N. Rycroft and B. R. T. consortium (2013). "Development of a self-replicating plasmid system for Mycoplasma hyopneumoniae." Vet Res 44: 63.

Mahan, S., P. J. Kelly and S. M. Mahan (2005). "A preliminary study to evaluate the immune responses induced by immunization of dogs with inactivated Ehrlichia canis organisms." Onderstepoort J Vet Res 72(2): 119-128.

Maier, T. M., R. Pechous, M. Casey, T. C. Zahrt and D. W. Frank (2006). "In vivo Himar1-based transposon mutagenesis of Francisella tularensis." Applied and Environmental Microbiology 72(3): 1878-1885.

Mansour, C. A., K. M. Doiron and C. G. Cupples (2001). "Characterization of functional interactions among the Escherichia coli mismatch repair proteins using a bacterial two-hybrid assay." Mutat Res 485(4): 331-338.

Matsumoto, K., G. Joncour, P. Lamanda, H. Inokuma and P. Brouqui (2007). "Detection of Anaplasma phagocytophilum and Ehrlichia sp. HF strains in Ixodes ricinus ticks in Brittany, France." Clin Microbiol Infect 13(3): 338-341.

May, J. P., C. A. Walker, D. J. Maskell and J. D. Slater (2004). "Development of an in vivo Himar1 transposon mutagenesis system for use in Streptococcus equi subsp equi." Fems Microbiology Letters 238(2): 401-409.

McGill, J. L., A. D. Nair, C. Cheng, R. A. Rusk, D. C. Jaworski and R. R. Ganta (2016). "Vaccination with an Attenuated Mutant of Ehrlichia chaffeensis Induces Pathogen-Specific CD4+ T Cell Immunity and Protection from Tick-Transmitted Wild-Type Challenge in the Canine Host." PLoS One 11(2): e0148229.

McQuiston, J. H., C. D. Paddock, R. C. Holman and J. E. Childs (1999). "The human ehrlichioses in the United States." Emerg. Infect. Dis. 5(5): 635-642.

132 Miller, K. E. (2006). "Diagnosis and treatment of Chlamydia trachomatis infection." Am Fam Physician 73(8): 1411-1416.

Min, W., H. Li, H. Li, C. Liu and J. Liu (2015). "Characterization of Aspartate Kinase from Corynebacterium pekinense and the Critical Site of Arg169." Int J Mol Sci 16(12): 28270-28284.

Miura, K., J. Matsuo, M. A. Rahman, Y. Kumagai, X. Li and Y. Rikihisa (2011). "Ehrlichia chaffeensis Induces Monocyte Inflammatory Responses through MyD88, ERK, and NF-kappaB but Not through TRIF, Interleukin-1 Receptor 1 (IL-1R1)/IL-18R1, or Toll-Like Receptors." Infect Immun 79(12): 4947-4956.

Miura, K. and Y. Rikihisa (2007). "Virulence potential of Ehrlichia chaffeensis strains of distinct genome sequences." Infect Immun 75(7): 3604-3613.

Miura, K. and Y. Rikihisa (2009). "Liver transcriptome profiles associated with strain-specific Ehrlichia chaffeensis-induced hepatitis in SCID mice." Infect Immun 77(1): 245-254.

Mohan Kumar, D., M. Yamaguchi, K. Miura, M. Lin, M. Los, J. F. Coy and Y. Rikihisa (2013). "Ehrlichia chaffeensis uses its surface protein EtpE to bind GPI-anchored protein DNase X and trigger entry into mammalian cells." PLoS Pathog 9(10): e1003666.

Mohan Kumar, D., M. Lin, Q. Xiong, M. J. Webber, C. Kural and Y. Rikihisa (2015). "EtpE Binding to DNase X Induces Ehrlichial Entry via CD147 and hnRNP-K Recruitment, Followed by Mobilization of N-WASP and Actin." MBio 6(6): e01541-01515.

Morozova, O. V., L. P. Dubytska, I. B. Ivanova, C. X. Moreno, A. V. Bryksin, M. L. Sartakova, E. Y. Dobrikova, H. P. Godfrey and F. C. Cabello (2005). "Genetic and physiological characterization of 23S rRNA and ftsJ mutants of Borrelia burgdorferi isolated by mariner transposition." Gene 357(1): 63-72.

Muffly, T., T. C. McCormick, C. Cook and J. Wall (2008). "Human granulocytic ehrlichiosis complicating early pregnancy." Infect Dis Obstet Gynecol 2008: 359172.

Munderloh, U. G., S. D. Jauron, V. Fingerle, L. Leitritz, S. F. Hayes, J. M. Hautman, C. M. Nelson, B. W. Huberty, T. J. Kurtti, G. G. Ahlstrand, B. Greig, M. A. Mellencamp and J. L. Goodman (1999). "Invasion and intracellular development of the human granulocytic ehrlichiosis agent in tick cell culture." J Clin Microbiol 37(8): 2518-2524.

Nair, A. D., C. Cheng, D. C. Jaworski, S. Ganta, M. W. Sanderson and R. R. Ganta (2015). "Attenuated Mutants of Ehrlichia chaffeensis Induce Protection against Wild-Type Infection Challenge in the Reservoir Host and in an Incidental Host." Infect Immun 83(7): 2827-2835.

Nandi, B., K. Hogle, N. Vitko and G. M. Winslow (2007). "CD4 T-cell epitopes associated with protective immunity induced following vaccination of mice with an ehrlichial variable outer membrane protein." Infect Immun 75(11): 5453-5459. 133

Nebert, D. W. and V. Vasiliou (2004). "Analysis of the glutathione S-transferase (GST) gene family." Hum Genomics 1(6): 460-464.

Nichols Heitman, K., F. S. Dahlgren, N. A. Drexler, R. F. Massung and C. B. Behravesh (2016). "Increasing Incidence of Ehrlichiosis in the United States: A Summary of National Surveillance of Ehrlichia chaffeensis and Ehrlichia ewingii Infections in the United States, 2008-2012." Am J Trop Med Hyg 94(1): 52-60.

NIH. (2016). "World’s older population grows dramatically." from https://www.nih.gov/news- events/news-releases/worlds-older-population-grows-dramatically.

Niu, H., Y. Rikihisa, M. Yamaguchi and N. Ohashi (2006). "Differential expression of VirB9 and VirB6 during the life cycle of Anaplasma phagocytophilum in human leucocytes is associated with differential binding and avoidance of lysosome pathway." Cell Microbiol 8(3): 523-534.

Nosyk, B., X. Zang, E. Krebs, J. E. Min, C. N. Behrends, C. Del Rio, J. Dombrowski, D. J. Feaster, M. Golden, B. D. L. Marshall, S. H. Mehta, L. Metsch, B. R. Schackman, S. Shoptaw and S. A. Strathdee (2019). "Ending the epidemic in America will not happen if the status quo continues: modeled projections for HIV incidence in 6 US cities." Clin Infect Dis.

Nyindo, M., D. L. Huxsoll, M. Ristic, I. Kakoma, J. L. Brown, C. A. Carson and E. H. Stephenson (1980). "Cell-mediated and humoral immune responses of German Shepherd Dogs and Beagles to experimental infection with Ehrlichia canis." Am J Vet Res 41(2): 250-254.

Ohashi, N., A. Unver, N. Zhi and Y. Rikihisa (1998). "Cloning and characterization of multigenes encoding the immunodominant 30-kilodalton major outer membrane proteins of Ehrlichia canis and application of the recombinant protein for serodiagnosis." J. Clin. Microbiol. 36(9): 2671-2680.

Okada, H., T. Tajima, M. Kawahara and Y. Rikihisa (2001). "Ehrlichial proliferation and acute hepatocellular necrosis in immunocompetent mice experimentally infected with the HF strain of Ehrlichia, closely related to Ehrlichia chaffeensis." J. Comp. Pathol. 124(2-3): 165-171.

Olano, J. P., W. Hogrefe, B. Seaton and D. H. Walker (2003). "Clinical manifestations, epidemiology, and laboratory diagnosis of human monocytotropic ehrlichiosis in a commercial laboratory setting." Clin Diagn Lab Immunol 10(5): 891-896.

Oliva Chavez, A. S., J. W. Fairman, R. F. Felsheim, C. M. Nelson, M. J. Herron, L. Higgins, N. Y. Burkhardt, J. D. Oliver, T. W. Markowski, T. J. Kurtti, T. E. Edwards and U. G. Munderloh (2015). "An O-Methyltransferase Is Required for Infection of Tick Cells by Anaplasma phagocytophilum." PLoS Pathog 11(11): e1005248.

134 Oram, D. M., A. Avdalovic and R. K. Holmes (2002). "Construction and characterization of transposon insertion mutations in Corynebacterium diphtheriae that affect expression of the diphtheria toxin repressor (DtxR)." J Bacteriol 184(20): 5723-5732.

Oteo, J. A. and P. Brouqui (2005). "[Ehrlichiosis and human anaplasmosis.]." Enferm Infecc Microbiol Clin 23(6): 375-380.

Otsuka, A. J., M. R. Buoncristiani, P. K. Howard, J. Flamm, C. Johnson, R. Yamamoto, K. Uchida, C. Cook, J. Ruppert and J. Matsuzaki (1988). "The Escherichia-Coli Biotin Biosynthetic Enzyme Sequences Predicted from the Nucleotide-Sequence of the Bio Operon." Journal of Biological Chemistry 263(36): 19577-19585.

Paddock, C. D. and J. E. Childs (2003). "Ehrlichia chaffeensis: a prototypical emerging pathogen." Clin. Microbiol. Rev. 16(1): 37-64.

Pandey, R., R. Kochar, S. Kemp, D. Rotaru and S. V. Shah (2013). "Ehrlichiosis presenting with toxic shock-like syndrome and secondary hemophagocytic lymphohistiocytosis." J Ark Med Soc 109(13): 280-282.

Parameswaran, N. and S. Patial (2010). "Tumor necrosis factor-alpha signaling in macrophages." Crit Rev Eukaryot Gene Expr 20(2): 87-103.

Parola, P., B. Davoust and D. Raoult (2005). "Tick- and flea-borne rickettsial emerging zoonoses." Vet Res 36(3): 469-492.

Perez, M., Y. Rikihisa and B. Wen (1996). "Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization." J. Clin. Microbiol. 34(9): 2133-2139.

Prima, V., L. N. Kaliberova, S. Kaliberov, D. T. Curiel and S. Kusmartsev (2017). "COX2/mPGES1/PGE(2) pathway regulates PD-L1 expression in tumor-associated macrophages and myeloid-derived suppressor cells." Proceedings of the National Academy of Sciences of the United States of America 114(5): 1117-1122.

Pritt, B. S., M. E. J. Allerdice, L. M. Sloan, C. D. Paddock, U. G. Munderloh, Y. Rikihisa, T. Tajima, S. M. Paskewitz, D. F. Neitzel, D. K. Hoang Johnson, E. Schiffman, J. P. Davis, C. S. Goldsmith, C. M. Nelson and S. E. Karpathy (2017). "Proposal to reclassify Ehrlichia muris as Ehrlichia muris subsp. muris subsp. nov. and description of Ehrlichia muris subsp. eauclairensis subsp. nov., a newly recognized tick-borne pathogen of humans." Int J Syst Evol Microbiol 67(7): 2121-2126.

Pritt, B. S., L. M. Sloan, D. K. Johnson, U. G. Munderloh, S. M. Paskewitz, K. M. McElroy, J. D. McFadden, M. J. Binnicker, D. F. Neitzel, G. Liu, W. L. Nicholson, C. M. Nelson, J. J. Franson, S. A. Martin, S. A. Cunningham, C. R. Steward, K. Bogumill, M. E. Bjorgaard, J. P. Davis, J. H. McQuiston, D. M. Warshauer, M. P. Wilhelm, R. Patel, V. A. Trivedi and M. E.

135 Eremeeva (2011). "Emergence of a new pathogenic Ehrlichia species, Wisconsin and Minnesota, 2009." N Engl J Med 365(5): 422-429.

Quistgaard, E. M., C. Low, F. Guettou and P. Nordlund (2016). "Understanding transport by the major facilitator superfamily (MFS): structures pave the way." Nature Reviews Molecular Cell Biology 17(2): 123-132.

Rikihisa, Y. (1991). "The tribe Ehrlichieae and ehrlichial diseases." Clin. Microbiol. Rev. 4(3): 286-308.

Rikihisa, Y. (2003). "Mechanisms to create a safe haven by members of the family Anaplasmataceae." Ann N Y Acad Sci 990: 548-555.

Rikihisa, Y. (2010). "Anaplasma phagocytophilum and Ehrlichia chaffeensis: subversive manipulators of host cells." Nat Rev Microbiol 8(5): 328-339.

Rikihisa, Y. (2015). "Molecular Pathogenesis of Ehrlichia chaffeensis Infection." Annu Rev Microbiol 69: 283-304.

Rikihisa, Y. (2017). "Role and Function of the Type IV Secretion System in Anaplasma and Ehrlichia Species." Curr Top Microbiol Immunol 413: 297-321.

Rikihisa, Y., H. Stills and G. Zimmerman (1991). "Isolation and continuous culture of Neorickettsia helminthoeca in a macrophage cell line." J Clin Microbiol 29(9): 1928-1933.

Ristic, M., C. J. Holland and M. Khondowe (1991). "An overview of research on ehrlichiosis." Eur J Epidemiol 7(3): 246-252.

Rivero, A. L. and M. Whitfeld (2018). "An update on the treatment of rosacea." Aust Prescr 41(1): 20-24.

Rubin, E. J., B. J. Akerley, V. N. Novik, D. J. Lampe, R. N. Husson and J. J. Mekalanos (1999). "In vivo transposition of mariner-based elements in enteric bacteria and mycobacteria." Proc Natl Acad Sci U S A 96(4): 1645-1650. Rudoler, N., G. Baneth, O. Eyal, M. van Straten and S. Harrus (2012). "Evaluation of an attenuated strain of Ehrlichia canis as a vaccine for canine monocytic ehrlichiosis." Vaccine 31(1): 226-233.

Ryan Llera, B., DVM; Ernest Ward, DVM (2018).

Santos, J. M., P. Freire, M. Vicente and C. M. Arraiano (1999). "The stationary-phase morphogene bolA from Escherichia coli is induced by stress during early stages of growth." Mol Microbiol 32(4): 789-798.

136 Savill, J., I. Dransfield, C. Gregory and C. Haslett (2002). "A blast from the past: clearance of apoptotic cells regulates immune responses." Nat Rev Immunol 2(12): 965-975.

Seidman, D., K. S. Hebert, H. K. Truchan, D. P. Miller, B. K. Tegels, R. T. Marconi and J. A. Carlyon (2015). "Essential Domains of Anaplasma phagocytophilum Invasins Utilized to Infect Mammalian Host Cells." PLoS Pathog 11(2): e1004669.

Selles Vidal, L., C. L. Kelly, P. M. Mordaka and J. T. Heap (2018). "Review of NAD(P)H- dependent oxidoreductases: Properties, engineering and application." Biochim Biophys Acta Proteins Proteom 1866(2): 327-347.

Seo, G. M., C. Cheng, J. Tomich and R. R. Ganta (2008). "Total, membrane, and immunogenic proteomes of macrophage- and tick cell-derived Ehrlichia chaffeensis evaluated by liquid chromatography-tandem mass spectrometry and MALDI-TOF methods." Infect Immun 76(11): 4823-4832.

Shao L, Abdel-Motaal H, Chen J, Chen H, Xu T, Meng L, Zhang Z, Meng F, and Jiang J (2018). " Characterization of a Functionally Unknown Arginine–Aspartate–Aspartate Family Protein From Halobacillus andaensis and Functional Analysis of Its Conserved Arginine/Aspartate Residues." Front Microbiol 9(807).

Sharma, P., O. Teymournejad and Y. Rikihisa (2017). "Peptide Nucleic Acid Knockdown and Intra-host Cell Complementation of Ehrlichia Type IV Secretion System Effector." Front Cell Infect Microbiol 7: 228.

Shibata, S., M. Kawahara, Y. Rikihisa, H. Fujita, Y. Watanabe, C. Suto and T. Ito (2000). "New Ehrlichia species closely related to Ehrlichia chaffeensis isolated from Ixodes ovatus ticks in Japan." J. Clin. Microbiol. 38(4): 1331-1338.

Singu, V., H. Liu, C. Cheng and R. R. Ganta (2005). "Ehrlichia chaffeensis expresses macrophage- and tick cell-specific 28-kilodalton outer membrane proteins." Infect. Immun. 73(1): 79-87.

Singu, V., L. Peddireddi, K. R. Sirigireddy, C. Cheng, U. Munderloh and R. R. Ganta (2006). "Unique macrophage and tick cell-specific protein expression from the p28/p30-outer membrane protein multigene locus in Ehrlichia chaffeensis and Ehrlichia canis." Cell Microbiol 8(9): 1475- 1487.

Slupska, M. M., J. H. Chiang, W. M. Luther, J. L. Stewart, L. Amii, A. Conrad and J. H. Miller (2000). "Genes involved in the determination of the rate of inversions at short inverted repeats." Genes Cells 5(6): 425-437.

Small, E., R. Marrington, A. Rodger, D. J. Scott, K. Sloan, D. Roper, T. R. Dafforn and S. G. Addinall (2007). "FtsZ polymer-bundling by the Escherichia coli ZapA orthologue, YgfE, involves a conformational change in bound GTP." J Mol Biol 369(1): 210-221.

137

Stevenson, H. L., E. C. Crossley, N. Thirumalapura, D. H. Walker and N. Ismail (2008). "Regulatory roles of CD1d-restricted NKT cells in the induction of toxic shock-like syndrome in an animal model of fatal ehrlichiosis." Infect Immun 76(4): 1434-1444.

Stevenson, H. L., M. D. Estes, N. R. Thirumalapura, D. H. Walker and N. Ismail (2010). "Natural Killer Cells Promote Tissue Injury and Systemic Inflammatory Responses During Fatal Ehrlichia-Induced Toxic Shock-Like Syndrome." Am J Pathol.

Stevenson, H. L., J. M. Jordan, Z. Peerwani, H. Q. Wang, D. H. Walker and N. Ismail (2006). "An intradermal environment promotes a protective type-1 response against lethal systemic monocytotropic ehrlichial infection." Infect Immun 74(8): 4856-4864.

Straube, J. (2010). Canine Ehrlichiosis – from Acute Infection to Chronic Disease. CVBD Digest, Institute for Animal Hygiene and Veterinary Public Health, University of Leipzig, Germany.

Suhan, M. L., S. Y. Chen and H. A. Thompson (1996). "Transformation of Coxiella burnetii to ampicillin resistance." J Bacteriol 178(9): 2701-2708.

Teymournejad, O., M. Lin and Y. Rikihisa (2017). "Ehrlichia chaffeensis and Its Invasin EtpE Block Reactive Oxygen Species Generation by Macrophages in a DNase X-Dependent Manner." MBio 8(6).

Thirumalapura, N. R., E. C. Crossley, D. H. Walker and N. Ismail (2009). "Persistent Infection Contributes to Heterologous Protective Immunity against Fatal Ehrlichiosis." Infection and Immunity 77(12): 5682-5689.

Thomas, L. D., I. Hongo, K. C. Bloch, Y. W. Tang and S. Dummer (2007). "Human ehrlichiosis in transplant recipients." Am J Transplant 7(6): 1641-1647.

Thomas, S., N. R. Thirumalapura, P. A. Crocquet-Valdes, B. A. Luxon and D. H. Walker (2011). "Structure-based vaccines provide protection in a mouse model of ehrlichiosis." PLoS One 6(11): e27981.

Torrents, E., I. Grinberg, B. Gorovitz-Harris, H. Lundstrom, I. Borovok, Y. Aharonowitz, B. M. Sjoberg and G. Cohen (2007). "NrdR controls differential expression of the Escherichia coli ribonucleotide reductase genes." J Bacteriol 189(14): 5012-5021.

Turkovicova, L., R. Smidak, G. Jung, J. Turna, G. Lubec and J. Aradska (2016). "Proteomic analysis of the TerC interactome: Novel links to tellurite resistance and pathogenicity." J Proteomics 136: 167-173.

138 Unver, A., Y. Rikihisa, R. W. Stich, N. Ohashi and S. Felek (2002). "The omp-1 major outer membrane multigene family of Ehrlichia chaffeensis is differentially expressed in canine and tick hosts." Infect. Immun. 70(8): 4701-4704.

Wang, X., T. Kikuchi and Y. Rikihisa (2007). "Proteomic identification of a novel Anaplasma phagocytophilum DNA binding protein that regulates a putative transcription factor." J Bacteriol 189(13): 4880-4886.

Wang, Y., L. Wei, H. Liu, C. Cheng and R. R. Ganta (2017). "A genetic system for targeted mutations to disrupt and restore genes in the obligate bacterium, Ehrlichia chaffeensis." Sci Rep 7(1): 15801.

Watanabe, M., T. Oikawa, H. Hiraoka, N. Kaneko, K. Itamoto, T. Mizuno, M. Okuda and H. Inokuma (2006). "Experimental inoculation of beagle dogs with Ehrlichia species detected from Ixodes ovatus." Vet Parasitol 136(2): 147-154.

Whitlock, J. E., Q. Q. Fang, L. A. Durden and J. H. Oliver, Jr. (2000). "Prevalence of Ehrlichia chaffeensis (Rickettsiales: Rickettsiaceae) in Amblyomma americanum (Acari: Ixodidae) from the Georgia coast and Barrier Islands." J Med Entomol 37(2): 276-280.

Windsor, R. C. and L. R. Johnson (2006). "Canine chronic inflammatory rhinitis." Clin Tech Small Anim Pract 21(2): 76-81.

Woody, B. J. and J. D. Hoskins (1991). "Ehrlichial diseases of dogs." Vet Clin North Am Small Anim Pract 21(1): 75-98.

Wyatt, M. D., J. M. Allan, A. Y. Lau, T. E. Ellenberger and L. D. Samson (1999). "3- methyladenine DNA glycosylases: structure, function, and biological importance." Bioessays 21(8): 668-676.

Yager, E., C. Bitsaktsis, B. Nandi, J. W. McBride and G. Winslow (2005). "Essential role for humoral immunity during Ehrlichia infection in immunocompetent mice." Infect Immun 73(12): 8009-8016.

Yan, Q., M. Lin, W. Huang, O. Teymournejad, J. M. Johnson, F. A. Hays, Z. Liang, G. Li and Y. Rikihisa (2018). "Ehrlichia type IV secretion system effector Etf-2 binds to active RAB5 and delays endosome maturation." Proc Natl Acad Sci U S A.

Yang, Q., P. Ghose and N. Ismail (2013). "Neutrophils mediate immunopathology and negatively regulate protective immune responses during fatal bacterial infection-induced toxic shock." Infect Immun 81(5): 1751-1763.

Ye, J., G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen and T. L. Madden (2012). "Primer- BLAST: a tool to design target-specific primers for polymerase chain reaction." BMC Bioinformatics 13: 134.

139

Yu, X., J. W. McBride, X. Zhang and D. H. Walker (2000). "Characterization of the complete transcriptionally active ehrlichia chaffeensis 28 kDa outer membrane protein multigene family." Gene 248(1-2): 59-68.

Yu, X. J., J. W. McBride, C. M. Diaz and D. H. Walker (2000). "Molecular cloning and characterization of the 120-kilodalton protein gene of Ehrlichia canis and application of the recombinant 120-kilodalton protein for serodiagnosis of canine ehrlichiosis." J Clin Microbiol 38(1): 369-374.

Zhang, L. N., U. Sankar, D. J. Lampe, H. M. Robertson and F. L. Graham (1998). "The Himar1 mariner transposase cloned in a recombinant adenovirus vector is functional in mammalian cells." Nucleic Acids Research 26(16): 3687-3693.

Zhu, B., J. A. Kuriakose, T. Luo, E. Ballesteros, S. Gupta, Y. Fofanov and J. W. McBride (2011). "Ehrlichia chaffeensis TRP120 binds a G+C-rich motif in host cell DNA and exhibits eukaryotic transcriptional activator function." Infect Immun 79(11): 4370-4381.

140