Proc. Nati. Acad. Sci. USA Vol. 86, pp. 1312-1316, February 1989 Genetics

Anomalous and selective DNA mutations of the Old World monkey a-globin genes (evolution burst/evolution slowdown/molecular evolution/primate evolution) JENG-PYNG SHAW*, JON MARKSt, CHIEN CELIA SHEN, AND CHE-KUN JAMES SHENt Department of Genetics, University of California, Davis, CA 95616 Communicated by G. Ledyard Stebbins, November 21, 1988

ABSTRACT It has been a widely accepted hypothesis that Further testing of the generality of this phenomenon should the molecular clock slows down during evolution of higher help us to understand the underlying mechanism of the primates. By molecular cloning and nucleotide sequence com- "ticking" of the molecular clock. parison of a rhesus macaque a-globin gene to its homologs in The phylogenetic relationships among various primates, man, orangutan, olive baboon, and other mammals, we dem- based on anthropological data, have been extensively docu- onstrate a burst of evolution of the baboon a-globin gene since mented (24-29). The species of Old World monkeys (Cerco- its separation from the rhesus macaque. This mutation burst pithecoidea) diverged from humans (Homo sapiens) =30 Myr has occurred only at the nonsynonymous sites but not the ago (Fig. 1). Polypeptide sequencing studies (30-36) have synonymous sites. Its magnitude is at least 10-fold higher than shown that the a-globin chains ofseveral Old World monkeys the synonymous substitution rates in higher primates and as differ from the human a-globin chain at a wide range ofamino high as the synonymous substitution rates ofthe rodent lineage. acid residues. For some Old World monkeys, the magnitudes On the contrary, the rate of synonymous site substitutions in of the divergence were consistent with the protein molecular the a-globin genes of either the rhesus macaque or the olive clock (2), which predicted "1% of amino acid divergence for baboon is several times slower than that of human. Our data every 10 Myr. For example, the a chains of Presbytis demonstrate an anomalous exception to the slow rates of entellus, Macaca mulatta, Macaca fuscata, and Macaca molecular evolution in higher primates and provide strong nemestrina differ from the human homolog by 3, 4, 4, and 5 evidence for a recently accelerated evolution ofa primate globin amino acids, respectively (30-34). However, the a chains of gene under an as yet unknown selective force(s). other cercopithecoids differ by 7 to as many as 12 amino acids when compared to human (35). In particular, the completely The original molecular clock theories state that the substitu- sequenced a chain of the olive baboon Papio cynocephalus tion rates of amino acids in proteins are approximately (orPapio anubis) differs from its human homolog by 11 amino constant along different lineages (1, 2). Subsequent acid substitutions (36). Surprisingly, it also differs by approx- DNADNA hybridization and nucleotide sequencing studies imately the same number of amino acids, 9-11 amino acids, have supported this hypothesis and found that the rates of from all of the characterized rhesus macaque a chains nucleotide substitutions are also approximately constant mentioned above, despite the much more recent separation of during evolution (for reviews, see refs. 3 and 4). The baboon from rhesus macaque (Fig. 1). This similarity of molecular clock has been extremely useful in the construc- a-chain divergence of the baboon from both humans and tion of phylogenetic relationships among different genes and rhesus macaque and the clustering of amino acid differences organisms (5-12), one well known example being the dating between amino acids 1 and 57 have led to the hypothesis (36) of the human-ape divergence to 4-5 million years (Myr) ago that, besides the evolutionary accumulation of point muta- instead of 20-30 Myr ago (5). tions, a crossing-over event between the a-globin gene more On the other hand, the validity ofthe rate constancy of the conserved in all Old World monkeys and a once-existing, molecular clock has also been questioned as a result of highly diverged, nonallelic a gene has generated a hybrid extensive protein and DNA analysis in certain lineages (13- gene encoding the a chain in the baboons. Alternatively, the 21). For instance, several studies have revealed higher rates high rate of amino acid substitutions in the baboons could be of nucleotide substitutions in rodents, possibly due to their the result of natural selection. shorter generation time (20, 21). Accelerated evolution by The above two possibilities could be differentiated by the positive selection has been hypothesized to occur during comparison of DNA nucleotide sequences of the adult certain evolutionary times (ref. 22 and references therein). a-globin genes among the higher primates, especially be- Statistical analysis of protein sequence data has further tween the rhesus macaque§ and the olive baboon. If the suggested the erratic nature of the molecular clock (23), as baboon a-globin gene is indeed a hybrid gene resulting from opposed to predictions of the neutral allele theory (3). unequal crossing-over events during evolution, we would Despite all these controversies, one hypothesis that seems expect that the apparent rates of both synonymous and to be well accepted is the molecular clock slows down in nonsynonymous substitutions in the baboon lineage are higher primates (13-21). This has been consistently observed higher than in the rhesus macaque and other higher primates, by protein analysis (13, 14), by DNA-DNA hybridization studies (ref. 20 and references therein), or by analysis of Abbreviations: Myr, million year(s); nt, nucleotide(s). nucleotide substitutions ofcoding or noncoding DNA regions *Present address: Department of Pathology, Stanford University among different species (ref. 21 and references therein). School of Medicine, Stanford, CA 94305. tPresent address: Department of Anthropology, Yale University, New Haven, CT 06520. The publication costs of this article were defrayed in part by page charge tTo whom reprint requests should be addressed. payment. This article must therefore be hereby marked "advertisement" §The sequence reported in this paper is being deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. EMBL/GenBank data base (accession no. J04495). 1312 Downloaded by guest on October 1, 2021 Genetics: Shaw et al. Proc. Natl. Acad. Sci. USA 86 (1989) 1313

Myr Human Chimpanzee Orangutan A Iyr1 I a2 a 0e1 H H H H H 6 - 2.3 4- 1.21 4.2 .070 m 7- B 13 - CG + gcgcgctggctgcccggcActcttctggtccccacagactcagaaagaacccacc ATG GTG CTG TCT INI Val Leu Ser Asp Lys His Glu A AA C A CCT GCC GAC AAG AGC AAC GTC AAG GCC GCC TGG GGT AAG GTC GGC GGG CAC GCT Pro Ala Asp Lys Ser Asn Val Lys Ala Ala Trp Gly Lys Val Gly Gly His Ala G GGC GAG TAT GGT GCG GAG GCC CTG GAG AGG tgaggctccctcccctgctccgacccgggct Gly Glu Tyr Gly Ala Glu Ala Leu Glu Arg 30 - FIG. 1. Phylogenetic relationships among five higher primates. The approximate times of divergence for different pairs of lineages gcttctccccgcagg ATG TTC CTG TCC TTC CCC ACC ACC AAG ACC TAC TTC CCC CAC (24-29) that are used in the calculation of nucleotide substitution Met Phe Leu Ser Phe Pro Thr Thr Lys Thr Tyr Phe Pro His rates (see text) are indicated on the scale by numbers of Myr. The Asp Asn Lys as A CAAA numbers of synonymous substitutions per 100 sites, calculated in TTC GAC CTG AGC CAC GGC TCT GCC CAG GTT AAG GGC CAC GGC AAG AAG GTG GCC the text, accumulated during the five lineages are also indicated. The Phe Asp Leu Ser His Cly Ser Ala Gln Val Lys Gly His Gly Lys Lys Val Ala numbers of nonsynonymous substitutions per 100 sites are given in Gln the parentheses. G GAC GCG CTG ACC CTC GCC GTG GGG CAC GTG GAC GAC ATG CCC CAC GCG CTG TCC including man. On the contrary, natural selection would most Asp Ala Leu Thr Leu Ala Val Gly His Val Asp Asp Met Pro His Ala Leu Ser likely have acted only upon the nonsynonymous sites, not the Lys AA synonymous positions. GCG CTG AGC GAC CTG CAC GCG CAC AAG CTT CGG GTG GAC CCG GTC AAC TTC AAG Ala Leu Ser Asp Leu His Ala His Lys Leu Arg Val Asp Pro Val Asn Phe Lys MATERIALS AND METHODS G C gtgagcggcgagccgggagcgatctggggtcgaggggcgagatggcgccttcctcgcagggcagagcatcc

Chromosomal DNA was isolated from primate tissues by G A using proteinase K digestion, ribonuclease treatment, phenol extraction, and ethanol precipitation. The genomic DNA was ag CTC CTG AGC CAC TGC CTG CTG GTG ACT CTG GCC GCT CAC CTC CCC GCC GAG digested with various restriction enzymes and then size- Leu Leu Ser His Cys Leu Leu Val Thr Leu Ala Ala His Leu Pro Ala Glu fractionated on potassium acetate gradients. Fragments were TTC ACC CCT GCG GTG CAC GCC TCC CTG GAC AAG TTC CTG GCT TCT GTG AGC ACC ligated onto the purified arm of phage vector Charon 30 at Phe Thr Pro Ala Val His Ala Ser Leu Asp Lys Phe Leu Ala Ser Val Ser Thr BamHI sites. Recombinant DNA was packaged into Esche- C richia coli strains BHB 2688 and BHB 2690. The inserts for GTG CTG ACC TCC AAA TAC CGT TAA gctggagcctcggtggccatgcttcttgccccttgggcg the rhesus monkey library were derived from complete Val Leu Thr Ser Lys Tyr Arg TER BamHI digestion. One phase clone identified by in situ T C C TA CCC* TG + hybridization, ARaG1, contains the rhesus a2-globin gene tcccgccaggccctcctcccctccttgcaccggcccttgcgtggtctttgaataaagtctgagtgggcggC and its flanking DNA (37). The nucleotide sequence of the FIG. 2. (A) HindIll restriction map of the adult a-globin locus of rhesus a2 gene and its immediate flanking sequences were rhesus macaque. The numbers above the map indicate the lengths of determined by the Maxam and Gilbert method (38). individual HindlIl fragments. The map was derived from blot hybridization of both genomic and cloned DNA (37). Note that only the a2-globin gene and its flanking regions have been isolated without RESULTS DNA rearrangements (10, 37). The genomic region containing the al-globin gene and its 5' flanking sequences underwent significant The adult a-globin loci of all higher primates including rearrangements during cloning by A phage vectors (unpublished humans have the general organization of 5'-a2-al1-1-3' (see results). (B) Sequence comparison of the rhesus macaque and olive ref. 10 and references therein). In humans, the a2 and al baboon a-globin genes. The rhesus macaque a2-globin gene and its genes are both functional and have identical coding se- immediately flanking regions, as shown in A, from phage clone quences (39-41). Restriction mapping analysis (37, 42, 43) ARaGl (10, 37) were sequenced by Maxam and Gilbert method (38) has suggested that the a2- and al-globin genes of other higher and compared to the baboon al-globin gene sequence (47). The primates may also be highly similar, possibly due to efficient nucleotide sequence ofthe rhesus macaque gene is given in full, with gene correction and/or selection. This has been confirmed by the corresponding amino acid translations below the DNA sequence. nucleotide sequencing of the chimpanzee a2- and al-globin Above the macaque gene sequence are the nucleotides and amino acids of the baboon globin gene that differ from the rhesus macaque mRNAs (44), and the orangutan a2 and al genes (45). gene. The asterisks indicate bases that are deleted in the baboon Downstream from the a2 and al genes is 01, a globin gene sequence. The very 5' and 3' nucleotides of the mRNA are repre- transcribed only in erythroid tissues but whose function is sented by capital letters. still unknown (46-49). Old World Monkey Adult a-Globin Gene Sequences. The sequence of the rhesus a polypeptide from our DNA se- adult a-globin locus ofthe rhesus macaque (Macaca mulatta) quence data (Fig. 2B) is consistent with reported protein also has the a2-al-01 linkage similar to human, orangutan, sequencing studies of Macaca mulatta (32) except for a and olive baboon, except for several restriction fragment possible polymorphism at position 78, where the DNA length polymorphisms found within the intergenic DNA (refs. sequence predicts histidine instead of asparagine (Fig. 2B). 10 and 37; Fig. 2A). The a2-globin gene of a rhesus macaque The amino acid differences among the a-globin chains of has been cloned and analyzed by DNA sequencing. The human, orangutan, rhesus, and baboon as predicted by DNA nucleotide sequence of this gene and its immediate flanking sequences are shown in Table 1. Thus, the orangutan and regions are shown in Fig. 2B. The predicted amino acid rhesus differ from humans by 3 and 5 amino acids, respec- Downloaded by guest on October 1, 2021 1314 Genetics: Shaw et al. Proc. Natl. Acad. Sci. USA 86 (1989)

Table 1. Amino acid differences among the a globins of four higher primates Residue number Organism 5 8 9 12 19 23 53 56 57 68 71 78 82 Human Ala Thr Asn Ala Ala Glu Ala Lys Gly Asn Ala Asn Ala Orangutan - - Thr Asp Asp Rhesus Ser Gly - - Leu Gly His Baboon Asp Lys His Glu Asp Asn Lys Leu Gly Gln Lys Amino acid differences among the a-globin chains for four primates. The numbers on the first row are the residue numbers of the amino acids. The second line are the corresponding amino acids in the human adult a globin. The amino acids in the a globins of orangutan, rhesus macaque, and olive baboon that are the same as human are marked (-). The residues different from human are individually specified. Note that the amino acid sequences of the human and chimpanzee (data not shown) a globins are identical. tively. However, consistent with previous protein sequenc- the P value is much lower than 0.01 (data not shown). This ing analysis (30-36), the baboon has an unusually high point is further discussed below. number of amino acid differences when compared to three The numbers and percentages of nucleotide substitutions other primate species: human (11 amino acid differences), among this rhesus a-globin gene and its homologs ofbaboon, orangutan (13 differences), and rhesus (9 differences). human, chimpanzee, orangutan, and mouse have been cal- Sequence comparison of the rhesus and baboon a-globin culated and listed in Table 2. It is apparent from Table 2 that genes (Fig. 2B) indicates that the noncoding regions including there has been an unusually high rate of nucleotide substi- introns differ by -4%. This amount of nucleotide sequence tutions at the nonsynonymous sites of the a-globin genes in difference accumulated during a divergence time of 5-7 Myr the baboon lineage. Thus, the percentages of nonsynony- between the two Old World monkeys is comparable to those mous substitutions between the baboon and the three hom- values obtained from other noncoding DNA or synonymous inoids (human, chimpanzee, and orangutan) range from 5.5% sites ofthe higher primates (11, 12, 20, 21). Within the coding to 6.4% (Table 2). However, the rhesus monkey differs from region, there are a total of 13 nucleotide (nt) differences. Two these hominoids by only 2.0-2.9% (Table 2) even though it interesting things were noted. (i) At 10 out of 13 positions, a shares with baboon the same ancestor that diverged from the cytidine or guanosine in rhesus macaque has been replaced hominoids =30 Myr ago (Fig. 1). Furthermore, although the by adenosine in the olive baboon. The molecular basis ofthis two Old World monkeys separated only 5-7 Myr ago (Fig. 1), phenomenon is not clear. (ii) Almost all of the substitutions their a-globin genes differ by an unusually high percentage of have occurred at nonsynonymous or replacement sites. A nonsynonymous substitution, 4.3% (Table 2). This suggests calculation according to Perler et al. (6) has revealed an that the observed high amounts of nonsynonymous substi- unprecedentedly high ratio of nonsynonymous to synony- tutions between baboon and other primate species are the mous substitutions, 12.5/0.5 = 25, for the rhesus macaque/- result of a rapid accumulation of the mutations in the baboon baboon pair (Table 2). This value is much greater than that of lineage. A quantitative treatment is given below. the human/orangutan pair, which is 3/7 = 0.43. A conserv- Rates of Nonsynonymous Substitutions of the Old World ative x2 test has shown that for the above two species pairs, Monkey a-Globin Genes. The amounts of nonsynonymous substitutions accumulated in the baboon lineage and the Table 2. Numbers and percentages of nonsynonymous and rhesus monkey lineage can be calculated using the values synonymous substitutions among the adult a-globin genes listed in Table 2. The baboon differs from human, chimpan- of human, chimpanzee, orangutan, rhesus macaque, zee, and orangutan by 5.5%, 5.5%, and 6.4%, respectively. olive baboon, and mouse The rhesus monkey differs from the three hominoids by Sustitution sites, 2.0%, 2.0%, and 2.9%, respectively. Thus, all three pairwise Pairwise no. % substitutions comparisons suggest that the baboon lineage, since its sep- comparisons Nonsyn. Syn. Nonsyn. Syn. aration from the rhesus macaque, has accumulated more nonsynonymous substitutions than the rhesus monkey lin- H/C 0 4 0 3.8 eage an amount of 3.5% (5.5% - 2.0% = 3.5%, or 6.4% 1.1 by H/O 3 7 6.6 - 2.9% = 3.5%). This further indicates that, of the amount H/Rh 6 6 2.0 5.8 (4.3%) of nonsynonymous substitutions between the two Old H/B 16.5 6.5 5.5 6.4 World monkeys, 3.9% was accumulated in the baboon H/M 26.5 56.5 8.8 89.0 lineage, and only 0.4% was accumulated in the rhesus C/O 3 7 1.1 7.8 monkey lineage. Taking the average time of divergence C/Rh 6 6 2.0 5.6 between the two Old World monkeys to be 6 Myr, it follows C/B 16.5 5.5 5.5 5.2 that the rates of nonsynonymous substitutions of the baboon C/M 26.5 55.5 8.7 90.0 and rhesus monkey lineages are (3.9/100)/(6 x 106) = 6.5 x O/Rh 9 7 2.9 6.6 10-9 per nt per year, and (0.4/100)/(6 x 106) = 0.67 x 10-9 O/B 18 7 6.4 6.7 per nt per year, respectively, with the baboon 10 times higher O/M 29.5 53.5 9.8 86.0 than the rhesus. Rh/B 12.5 0.5 4.3 0.6 Rates of Synonymous Substitutions of Old World Monkey Rh/M 24.5 56.5 8.1 89.0 a-Globin Genes in Comparison to the Three Hominoids. B/M 36 54 12.0 84.0 Interestingly, contrary to the nonsynonymous sites, the Pairwise evolutionary comparisons of the a-globin genes of hu- apparent rates of accumulation of synonymous substitutions man, chimpanzee, orangutan, rhesus macaque, olive baboon, and along the two Old World monkey lineages are similar, and mouse. Both the numbers of substitution sites and the percentages of both are lower than the lineages leading to the hominoids. substitutions were calculated according to ref. 6. The sources of the The rates during the Old World monkey lineages were various a-globin gene sequences used in the calculation are as the three follows: human a (39-41), chimpanzee al (44), orangutan al (45), calculated as follows. The baboon differs from baboon al (47), mouse a (50), and rhesus macaque a2 (this study) hominoids by 6.4% (human), 5.2% (chimpanzee), and 6.7% genes. Nonsyn., nonsynonymous; Syn., synonymous; H, human; C, (orangutan), respectively. The rhesus monkey differs, on the chimpanzee; 0, orangutan; Rh, rhesus macaque; B, olive baboon; M, other hand, from the hominoids by 5.8%, 5.6%, and 6.6%, mouse. respectively. Thus, the baboon lineage has accumulated Downloaded by guest on October 1, 2021 Genetics: Shaw et al. Proc. Natl. Acad. Sci. USA 86 (1989) 1315

more than the rhesus monkey lineage by the average amount that the rate of synonymous substitutions among cercopith- of [(6.4% - 5.8%) + (5.2% - 5.6%) + (6.7% - 6.6%)]/3 = ecines is slower than among humans, who previously have 0.1%. Since the relative difference between the two Old been regarded as having the slowest rate among primates World monkeys at the synonymous sites is 0.6%, this means (21). The molecular basis of this observation could be the that 0.35% was accumulated during the baboon lineage, and result of either selection or efficient DNA repair and other 0.25% was accumulated during the rhesus lineage. The rates gene correction mechanisms at the a-globin loci of the two of synonymous substitutions during the two Old World Old World monkeys. Sequence comparison of other genomic monkey lineages are thus (0.35/100)/(6 x 106) = 0.58 x 10-9 regions of the two monkeys may provide further clues about per nt per year and (0.25/100)/(6 x 106) = 0.42 x 10-9 per nt this point. per year, respectively. Even more striking is the large number of nonsynonymous The rates of synonymous substitutions in the human, substitutions, particularly in the line leading to the baboon chimpanzee, and orangutan were estimated as follows. First, (Papio). This rate is particularly interesting in view of the fact we use the orangutan as the reference. The human and (25) that since the divergence, both the facial anatomy and the chimpanzee differ from the orangutan by 6.6% and 7.8%, behavior patterns of Papio appear to have diverged much respectively, at the synonymous sites. This means that the more from those of the common ancestor than have those of chimpanzee lineage has accumulated 7.8% - 6.6% = 1.2% macaque (Macaca). Clearly, there has been a burst of more substitutions than the human lineage. Since the human selective evolution in the line leading to the baboon that is and chimpanzee differ by 3.8%, it is concluded that since the reflected in alterations of amino acid sequence in the a-globin separation of human and chimpanzee, the al-globin gene of chain. The rate of this evolution burst is even as high as the human has accumulated 1.3% synonymous substitutions estimated rate of synonymous substitutions in rodents, which whereas the chimpanzee gene has accumulated 2.5% synon- has been thought to have the highest rate of nucleotide ymous substitutions. Similar calculations by using the rhesus substitutions (refs. 20 and 21 and references therein). These macaque as the reference gave the number of 3.7% of data rule out the hypothesis that the higher amino acid synonymous substitutions for the orangutan lineage since its substitutions in the baboon a-globin chain relative to other separation from the human and chimpanzee. These estima- primates is the result of an ancient gene fusion event (36). tions suggest that the rates of synonymous substitutions of Instead, our data are highly suggestive of rapid amino acid the three hominoid lineages are (1.3/100)/(7 x 106) = 1.9 x substitutions, or a burst of substitutions, under positive 10-9 per nt per year for human, (2.5/100)/(7 x 106) = 3.6 x selection force(s) during the evolution of baboons since their 10-9 per nt per year for chimpanzee, and (3.7/100)/(13 x 106) separation from rhesus macaques 5-7 Myr ago. Interestingly, = 2.9 x 10-9 per nt per year for orangutan, respectively. this type of molecular evolution at the gene level has been Although these numbers may vary somewhat depending on predicted by the episodic clock theory of molecular evolution the reference species used, they are of the same order of (23). magnitude as the rates previously obtained by other studies The different residues between the a chains of olive (21). For example, the rates of nucleotide substitutions at baboon and rhesus macaque cause differences in the electric synonymous sites and noncoding DNA of the above three charges of the polypeptides, as well as intrachain salt bridges hominoid lineages as estimated by Li and Tanimura (21) are under physiological conditions (36). Thus, the selection 0.59 x 10-9 per nt per year, 1.3 x 10-9 per nt per year, and force(s) could be environmental change(s) that affected the 1.5 x 10-9 per nt per year, respectively. In any case, for the physiology of the baboons and involved the functioning of the a-globin genes, the synonymous substitution rates of the two hemoglobins. If this is the case, then the adult ,3- and/or fetal Old World monkeys (see above) are several times lower than y-globin genes of the baboons, the sequences of which are the other higher primates including human. still unknown, may also have undergone a rapid accumulation of amino acid changes. It is interesting to note here that the DISCUSSION protein sequence of the langur stomach lysozyme was found to have evolved twice as fast as the other primate lysozymes The sequence analysis of adult a-globin genes reported here (51-53). In that case, it was possible to attribute the fast for Old World monkeys reveals patterns that deviate in a amino acid changes to the adaptive evolution of the enzyme striking fashion from those reported for all other higher by positive darwinian selection (51-53). Accelerated evolu- primates. First, the comparison between rhesus/baboon and tion has also occurred in the reactive centers of rodent serine the hominoids (human/chimpanzee/orangutan), as shown in protease inhibitors, with the most likely selective force being Fig. 1, shows that divergence of the two cercopithecine the extrinsic proteases used by the parasites (54). monkeys was accompanied by a much lower number of Our study indicates that the actual patterns of molecular synonymous substitutions that did not alter the amino acid evolution of the primates are much more complicated than sequence of the a chain and was also accompanied by a much previously thought. Continued analysis of different primate higher number of nonsynonymous substitutions that did alter gene loci is necessary to understand the evolutionary path- amino acid sequence. Ifthe hominoid pattern is recognized as ways and the underlying principles of molecular evolution of a standard, which is a logical assumption because of its the primates. resemblances to patterns of divergence between other pairs of primate species (4, 11, 12, 20, 21, 45), the conclusion is We thank John Gillespie, Allan Wilson, and Ledyard Stebbins for inevitable that synonymous substitutions, which become their encouragements and discussions, and Tina Jones for typing the established by stochastic events, have taken place at a much manuscript. We also thank two anonymous reviewers for helpful slower rate among the cercopithecines than among homi- suggestions. The monkey tissues used in this study were provided by noids or that the rhesus/baboon separation took place only the California Regional Primate Center. This research has been of Health grant (DK 29800) and a one-sixth as many years ago as the human/chimpanzee supported by a National Institutes National Institutes of Health Research Career Development Award separation, or only 1 Myr or less before the present. The latter alternative is in direct conflict with fossil evidence, to C.-K.J.S. since clearly recognizable fossils ofPapio have been found in 1. Zuckerkandl, E. & Pauling, L. (1965) in Evolving Genes and African deposits dated at 3 Myr ago (25). How much earlier Proteins, eds. Bryson, V. & Vogel, H. J. (Academic, New the rhesus/baboon separation took place is not clear from the York), pp. 97-166. fossil record, but it could have been as old as the early 2. Wilson, A. C., Carlson, S. S. & White, T. J. (1977) Annu. Rev. Miocene, 6-7 Myr ago. Thus the conclusion is inescapable Biochem. 46, 573-639. Downloaded by guest on October 1, 2021 1316 Genetics: Shaw et al. Proc. Natl. Acad. Sci. USA 86 (1989)

3. Kimura, M. (1983) The Neutral Theory ofMolecular Evolution 30. Matsuda, G., Maita, T., Ota, H. & Takei, M. (1970) Int. J. Pept. (Cambridge Univ. Press, Cambridge, U.K.). Protein Res. 2, 99-108. 4. Wilson, A. C., Ochman, H. & Prager, E. M. (1987) Trends 31. Matsuda, G., Maita, T., Ota, H., Araya, A., Nakashima, Y., Genet. 3, 241-247. Ishii, U. & Nakashima, M. (1973) Int. J. Pept. Protein Res. 5, 5. Wilson, A. C. & Sarich, V. M. (1969) Proc. Natl. Acad. Sci. 405-418. USA 63, 1088-1092. 32. Matsuda, G., Maita, T., Nakashima, Y., Barnabas, J., Ran- 6. Perler, F., Efstratiadis, A., Lomedico, P., Gilbert, W., Kolod- jekar, P. K. & Gandhi, N. S. (1973) Int. J. Pept. Protein Res. ner, R. & Dodgson, J. (1980) Cell 20, 555-566. 5, 423-425. 7. Efstratiadis, A., Posakony, J. W., 33. Matsuda, G., Maita, T., Watanabe, B., Araya, A., Morokuma, Maniatis, T., Lawn, R. M., K., Goodman, M. & Prychodko, W. (1973) Hoppe-Seyler's Z. O'Connell, C., Spritz, R. A., DeRiel, J. K., Forget, B. G., Physiol. Chem. 354, 1153-1155. Weissman, S. M., Slightom, J. L., Blechl, A. E., Smithies, O., 34. Mahoney, W. C. & Nute, P. E. (1979) Arch. Biochem. Biophys. Baralle, F. E., Shoulders, S. C. & Proudfoot, N. J. (1980) Cell 196, 64-72. 21, 653-668. 35. Hewett-Emmett, D., Cook, C. N. & Barnicot, N. A. (1976) in 8. Czelusniak, J., Goodman, M., Hewett-Emmett, D., Weiss, Molecular Anthropology, eds. Goodman, M. & Tashian, R. E. M. L., Venta, P. J. & Tashian, R. E. (1982) Nature (London) (Plenum, New York), pp. 257-273. 298, 297-300. 36. Mahoney, W.C. & Nute, P. E. (1980) Biochemistry 19, 1529- 9. Sibley, C. G. & Ahlquist, J. E. (1986) Sci. Am. 254, 68-78. 1534. 10. Marks, J., Shaw, J.-P., Perez-Stable, C., Hu, W.-S., Ayres, 37. Shaw, J.-P., Marks, J., Mohandas, T., Sparkes, R. & Shen, T. M., Shen, C. & Shen, C.-K. J. (1986) Cold Spring Harbor C.-K. J. (1987) Prog. Clin. Biol. Res. 251, 65-75. Symp. Quant. Biol. 51, 499-508. 38. Maxam, A. M. & Gilbert, W. (1977) Proc. Natl. Acad. Sci. 11. Miyamoto, M. M., Slightom, J. L. & Goodman, M. (1987) USA 74, 560-564. Science 238, 369-373. 39. Liebhaber, S. A., Goosens, M. J. & Kan, Y. W. (1980) Proc. 12. Maeda, N., Wu, C.-I., Bliska, J. & Reneke, J. (1988) Mol. Biol. Natl. Acad. Sci. USA 77, 7054-7057. Evol. 5, 1-20. 40. Liebhaber, S. A., Goosens, M. J. & Kan, Y. W. (1981) Nature 13. Goodman, M. (1961) Hum. Biol. 131-162. (London) 290, 26-29. 33, 41. Michelson, A. M. & Orkin, S. H. (1983) J. Biol. Chem. 258, 14. Goodman, M., Barnabas, J., Matsuda, G. & Moore, G. N. 15245-15254. (1971) Nature (London) 233, 604-613. 42. Zimmer, E. A., Martin, S. L., Beverley, S. M., Kan, Y. W. & 15. Ohta, T. & Kimura, M. (1971) J. Mol. Evol. 1, 18-25. Wilson, A. C. (1980) Proc. Natl. Acad. Sci. USA 77, 2158- 16. Langley, C. H. & Fitch, W. M. (1974) J. Mol. Evol. 3, 161-177. 2162. 17. Wu, C.-I. & Li, W.-H. (1985) Proc. NatI. Acad. Sci. USA 82, 43. Zimmer, E. A. (1980) Ph.D. Thesis (Univ. ofCalifornia, Berke- 1741-1745. ley). 18. Giebel, L. B., Van Santen, J. L., Slightom, J. L. & Spritz, 44. Liebhaber, S. A. & Begley, K. A. (1983) NucleicAcids Res. 11, R. A. (1985) Proc. Natl. Acad. Sci. USA 82, 6985-6989. 8915-8929. 19. Koop, B. F., Goodman, M., Xu, P. & Slightom, J. L. (1986) 45. Marks, J., Shaw, J.-P. & Shen, C.-K. J. (1986) Proc. Natl. Nature (London) 319, 234-238. Acad. Sci. USA 83, 1413-1417. 20. Britten, R. J. (1986) Science 231, 1393-1398. 46. Marks, J., Shaw, J.-P. & Shen, C.-K. J. (1986) Nature 21. Li, W.-H. & Tanimura, M. (1987) Nature (London) 326, 93-96. (London) 321, 785-788. 22. Goodman, M. (1981) Prog. Biophys. Mol. Biol. 38, 105-164. 47. Shaw, J.-P., Marks, J. & Shen, C.-K. J. (1987) Nature 23. Gillespie, J. H. (1984) Proc. Natl. Acad. Sci. USA 81, 8009- (London) 326, 717-720. 8013. 48. Leung, S.-O., Proudfoot, N. J. & Whitelaw, E. (1987) Nature 24. Gingerich, P. & Schoeninger, M. (1977) J. Hum. Evol. 6, 483- (London) 329, 551-556. 505. 49. Hsu, S.-L., Marks, J., Shaw, J.-P., Tam, M., Higgs, D. R., Shen, C. C. & Shen, C.-K. J. (1988) Nature (London) 331, 94- 25. Szalay, F. & Delson, E. (1979) Evolutionary History of the 96. Primates (Academic, New York). 50. Nishioka, Y. & Leder, P. (1979) Cell 18, 865-873. 26. Pilbeam, D. (1984) Sci. Am. 252, 84-96. 51. Stewart, C.-B., Schilling, I. W. & Wilson, A. C. (1987) Nature 27. Sibley, C. G. & Ahlquist, J. (1984) J. Mol. Evol. 20, 2-15. (London) 330, 401-404. 28. Andrews, P. (1985) Nature (London) 314, 498-499. 52. Brown, A. L. (1987) Nature (London) 330, 315-316. 29. Fleagle, J. (1986) in Major Topics in Primate and Human 53. Stewart, C.-B. & Wilson, A. C. (1987) Cold Spring Harbor Evolution, eds. Wood, B. A., Martin, L. & Andrews, P. Symp. Quant. Biol. 52, 891-899. (Cambridge Univ. Press, New York), pp. 130-149. 54. Hill, R. E. & Hastie, N. D. (1987) Nature (London) 326, 96-99. Downloaded by guest on October 1, 2021