Binding of pregnancy-specific 17 to CD9 on

macrophages induces secretion of IL-10, IL-6, PGE2, ␤ and TGF- 1 Cam T. Ha,* Roseann Waterhouse,* Jennifer Wessells,† Julie A. Wu,* and Gabriela S. Dveksler*,1 *Department of Pathology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; and †Laboratory of Dynamics and Signaling, National Cancer Institute-Frederick, Maryland

Abstract: Pregnancy-specific (PSGs) inally isolated from the circulation of pregnant women [1]. are a family of secreted produced by the PSGs are detected in maternal blood as early as 7 days post- placenta, which are believed to have a critical role implantation. The serum levels of these proteins reach up to in pregnancy success. Treatment of monocytes 200–400 ␮g/ml at term, far exceeding the concentration of with three members of the human PSGs induces human chorionic gonadotropin and ␣ fetoprotein [2]. Treatment interleukin (IL)-10, IL-6, and transforming growth of monkeys and mice with anti-PSG antibodies resulted in ␤ ␤ factor- 1 (TGF- 1) secretion. To determine whether spontaneous abortion [3, 4], and abnormally low levels of PSGs human and murine PSGs have similar functions are associated with several serious complications of pregnancy, and use the same , we treated wild-type including fetal hypoxia, fetal growth retardation, pre-eclamp- and CD9-deficient macrophages with murine sia, and spontaneous abortion [5–8]. PSG homologues have PSG17N and human PSG1 and -11. Our data show been identified in mice, rats, and primates [9–11]. that murine PSG17N induced secretion of IL-10, We have previously shown that treatment of human mono- ␤ IL-6, prostaglandin E2, and TGF- 1 and that CD9 cytes with recombinant human (rh)PSG1, PSG6, and PSG11 expression is required for the observed induction induced the production of anti-inflammatory cytokines [12]. It of cytokines. Therefore, the ability of PSG17 to is interesting that activated monocytes from women with recur- induce anti-inflammatory cytokines parallels that of rent spontaneous abortion display a decrease in PSG11-in- members of the human PSG family, albeit human and duced expression of interleukin (IL)-10 [13]. Together, these murine PSGs use different receptors, as CD9-defi- findings suggest that human PSGs are key immune-regulatory cient and wild-type macrophages responded equally factors. to human PSGs. We then proceeded to examine the There are 17 murine PSG (psg 16–32) localized to signaling mechanisms responsible for the CD9-me- 7 in a region syntenic to human diated response to PSG17. Inhibition of cyclooxy- [10]. Murine PSGs are similar to human PSGs in that they genase 2 significantly reduced the PSG17N-medi- contain several immunoglobulin (Ig)-like domains and are ated increase in IL-10 and IL-6. Further charac- heavily glycosylated. Although human PSGs consist of only one terization of the response to PSG17 indicated that Ig-variable-like domain, murine PSGs contain multiple Ig- cyclic adenosine monophosphate-dependent pro- variable-like domains that are preceded by a short hydrophobic tein kinase A (PKA) is involved in the up-regulation leader-like sequence. We have demonstrated for several mu- of IL-10 and IL-6, and it is not required for the rine and human PSGs that the N-terminal Ig-variable-like ␤ induction of TGF- 1. Conversely, treatment of domain is sufficient to elicit biological activity [12, 14]. macrophages with a PKC inhibitor reduced the Previously, we reported that the receptor for PSG17 in ␤ PSG17-mediated induction of TGF- 1, IL-6, and macrophages is the tetraspanin CD9 [15] and that PSG17N IL-10 significantly. The induction of anti-inflam- binds to the large, extracellular loop of this molecule [16]. The matory cytokines by various PSGs supports the identity of the receptor for human PSGs remains unknown. In hypothesis that these glycoproteins have an essen- this study, we investigated the induction of cytokine secretion tial role in the regulation of the maternal immune by murine PSG17N in the murine macrophage cell line RAW response in species with hemochorial placentation. 264.7 and thioglycollate-induced peritoneal macrophages from J. Leukoc. Biol. 77: 948–957; 2005. T helper cell type 1 (Th1)- and Th2-prone mice. In addition, we examined the response to murine PSG17N and human PSG11 Key Words: reproductive immunology ⅐ cytokines in bone marrow-derived macrophages (BMDM) obtained from

INTRODUCTION 1 Correspondence: Department of Pathology, USUHS, 4301 Jones Bridge Rd., Bethesda, MD 20814. E-mail: [email protected] Pregnancy-specific glycoproteins (PSGs) are a family of highly Received August 13, 2004; revised February 15, 2005; accepted February homologous proteins secreted by the placenta. They were orig- 17, 2005; doi: 10.1189/jlb.0804453.

948 Journal of Leukocyte Biology Volume 77, June 2005 0741-5400/05/0077-948 wild-type and CD9-deficient mice. Furthermore, we took the The PCR product was inserted into the pCRII-TOPO vector (Invitrogen). The first steps to elucidate the signaling mechanisms responsible PSG17N cDNA was removed from pCRII-TOPO by digestion with BglII and for the CD9-dependent response to PSG17N, and we examined KpnI and ligated into pcDNA3.1 Myc-His (Invitrogen), resulting in the in- frame addition of the myc-epitope and 6ϫ histidines at the C-terminus. whether the tetraspanin CD81, which is closely related to CD9, PSG17N-Myc-His was then inserted into the NotI- and PstI-digested pFastBac can compensate for the absence of CD9 in macrophages. Our (Invitrogen). Recombinant baculovirus was obtained following the manufactur- results are consistent with a role for human and murine PSGs er’s instructions (Invitrogen) and purified from insect cell supernatant as as inducers of anti-inflammatory cytokines through the engage- described previously for PSG18N-Myc-His [15]. Glutathione S-tranferase ment of different receptors. (GST)-PSG11 and the GST-His-XylE control protein were purified as de- scribed previously [12] using glutathione-sepharose beads (Amersham Phar- macia, Little Chalfont, UK). The initial characterization of the activity of PSG17N in RAW cells and MATERIALS AND METHODS BALB/c peritoneal macrophages was performed using the recombinant protein produced in insect cells. Subsequent studies were performed using PSG17N- Myc-His secreted from CHO cells. To generate PSG17N-Myc-His in CHO Animals and cell culture cells, PSG17N-Myc-His was excised from pcDNA3.1 Myc-His with PmeI and RAW 264.7 cells were obtained from the American Type Culture Collection subcloned into the EcoRV site of the pEAK10 vector which contains the (Manassas, VA) and were cultured in Dulbecco’s modified Eagle’s medium elongation factor 1-alpha promoter (Edge Biosystems, Gaithersburg, MD). (DMEM) with high glucose, 5 mM sodium pyruvate, 100 U/ml penicillin, 100 Dihydrofolate reductase-deficient CHO cells were cotransfected using the ␮g/ml streptomycin, 0.25 ␮g/ml amphotericin B [prostate-specific antigen Fugene 6 reagent (Roche, Indianapolis, IN) with PSG17N-Myc-His in pEAK10 (PSA)], and 10% fetal bovine serum (FBS). Chinese hamster ovary (CHO) cells and pDHIP at a 10:1 molar ratio as described previously [21]. Dr. Gerardo stably expressing PSG17N were maintained in Iscove’s (Cellgro, Mediatech, Kaplan [Center for Biologics Evaluation and Research, U.S. Food and Drug Inc., Herndon, VA), 2% dialyzed FBS, 0.5ϫ PSA, and 1.28 ␮M methotrexate Administration (CBER, FDA), Rockville, MD] provided the pDHIP plasmid, (Calbiochem, La Jolla, CA). The cells were grown in a cellulose 4-kDa which codes for the CHO cell dhfr 2.5-Kb minigene that contains the six exons molecular weight (MW) cutoff cartridge, and the medium was harvested of the but lacks introns 2 to 5 and confers methotrexate resistance. A according to its lactate level (Spectrum Laboratories, Los Angeles, CA). single-cell clone expressing the highest level of PSG17N-Myc-His was se- Five- to 6-week-old BALB/c mice were purchased from the National Cancer lected for amplification and inoculation in a Cell Max cartridge (Spectrum Institute Laboratories (Frederick, MD). C57BL/6 mice deficient in CD9 were Laboratories, Rancho Dominguez, CA). bred from the CD9ϩ/Ϫ breeding pair received from Dr. Claude Boucheix PSG17N-Myc-His, harvested from the supernatant of Sf9 insect cells grown (Hopital Paul Brousse, Villejuif, France) [18], and CD81-deficient mice were in SF900 II media (Invitrogen) with 2% FBS or PSG17N-Myc-His harvested obtained after breeding CD81ϩ/Ϫ received from Dr. Shoshana Levy (Division from the CHO cell medium, was purified using identical conditions. The ϫ of Oncology, Stanford University School of Medicine, CA) [19]. All animals supernatant was first dialyzed in 160 vol 300 mM NaCl and 50 mM NaHPO4, were placed in cages with filter tops and fed standard chow and water ad pH 7.4, overnight at 4°C prior to the incubation with Ni-NTA agarose beads libitum according to National Institutes of Health (NIH) guidelines. Peritoneal (Qiagen, Valencia, CA) followed by washes and a final elution with 250 mM macrophages were harvested and cultured as described previously [14]. imidazole, pH 7.3, as per the manufacturer’s recommendations. The eluted BMDM were isolated from the femur and tibia of wild-type and CD9-deficient proteins were then loaded onto a 10–11% sodium dodecyl sulfate-polyacryl- C57BL/6 mice. The cells were disaggregated by passage through an 18-g amide gel electrophoresis (SDS-PAGE) in a Model 491 Prep Cell apparatus needle and pelleted at 1000 rpm for 5 min, and red blood cells were lysed (Bio-Rad, Hercules, CA), and fractions were collected as they migrated out of the gel and were analyzed by immunoblot. To remove the SDS, fractions were using NH4Cl lysis solution (Sigma Chemical Co., St. Louis, MO). After 5 min, 45 ml phosphate-buffered saline (PBS) containing 2% FBS was added, and the electroeluted using a 2-kDa MW cutoff cellulose acetate membrane in 0.01 M cells were pelleted. To generate an immortalized macrophage cell line, 2 ϫ 107 Tris.HCl, pH 8 (Harvard Apparatus, Holliston, MA). Prep cell fractions that bone marrow cells were resuspended in 5 ml ␺CREJ2 cell supernatant (a reacted with R90 polyclonal antibody (pAb; see Antibodies and reagents) and source of the J2 transforming retrovirus) [20] with 500 ␮lof500␮g/ml anti-myc mAb (Invitrogen) were pooled together, concentrated using a Cen- polybrene (Sigma Chemical Co.) and 5 ␮lof106 U/ml granulocyte macro- triprep 10 (Millipore, Bedford, MA), dialyzed against PBS, and quantitated phage-colony stimulating factor (GM-CSF; Peprotech, Rocky Hill, NJ). After 24 h against bovine serum albumin standards (Pierce, Rockford, IL) after Coom- at 37°C, the supernatant was removed, and the cells were grown in DMEM/10% massie blue staining of the SDS-PAGE-separated proteins. Fractions that FBS containing GM-CSF for 7 days. GM-CSF was then withdrawn, and the cells contained proteins that did not react with R90 and anti-myc were pooled were cultured further in DMEM/10% FBS to establish growth factor-indepen- together as well, their concentration adjusted to match that of the R90 and dent cell lines. These cells were maintained in DMEM supplemented with 5% anti-myc-reactive fractions, and used as a control for the CHO cell-produced heat-inactivated FBS, 200 mM L-glutamine, and PSA. For some experiments, PSG17N-Myc-His. All recombinant proteins were tested for endotoxin con- when lower levels of FBS were desired, the cells were maintained in Advanced tamination using the Limulus amebocyte lysate assay (BioWhittaker, Woburn, D-MEM (Invitrogen, Carlsbad, CA) with 2% heat-inactivated FBS. MA). When endotoxin was detected, the proteins were further incubated with the ActiClean Etox resin (Sterogene Bioseparations, Carlsbad, CA) for its Fluorescein-activated cell sorter (FACS) analysis removal. Only lipopolysaccharide (LPS)-free recombinant proteins were used for all experiments. BMDM from wild-type and CD9-deficient mice were subjected to analysis with an EPICS XL-MCL flow cytometer (Beckman Coulter, Fullerton, CA) using the Antibodies and reagents KMC8.8 phycoerythrin (PE)-labeled anti-CD9 monoclonal antibody (mAb; BD PharMingen, San Diego, CA), PE-labeled mAb target of antiproliferative We generated R90 by immunizing a rabbit with PSG17N-Myc-His produced in antibody 1 (eat2) to detect expression of CD81, and a fluorescein isothiocya- CHO cells using standard methodology (Southern Biotechnology, Birmingham, nate-conjugated anti-F4/80 mAb (Serotec, Raleigh, NC). The data were col- AL). For immunoblot analysis, the following antibodies were used: anti-myc lected for 1 ϫ 104 cells. Prior to incubation with the specific antibodies, the (Invitrogen), anti-cyclooxygenase-2 (COX-2) pAb (Upstate Biotechnology, cells were incubated with 1 ␮g of Fc block (BD PharMingen) per 1 ϫ 106 cells. Lake Placid, NY), and anti-GST mAb (Santa Cruz Biotechnology, CA). The endotoxin-free, azide-free, anti-murine CD9 mAb KMC8.8 was obtained from Generation of recombinant proteins BD PharMingen. The COX-2-specific inhibitor NS-398 (Cayman Chemicals, Ann Arbor, MI) was added to the cells at a concentration of 1 ␮M, 30 min prior To generate the recombinant PSG17N-Myc-His protein, the N-terminal domain to PSG17N or control protein addition. The protein kinase A (PKA) inhibitor of PSG17 was amplified by polymerase chain reaction (PCR) from full-length KT5720 (Calbiochem) was added to the cells at a concentration of 50 nM for PSG17 [8] in pBluescript II KSϩ (Stratagene, La Jolla, CA) with primers 5Ј 6 h before the addition of PSG17N or control protein. The PKC inhibitors GAAGATCTAGAGATATGGAG(T/G)TGTC 3Ј (underlined BglII site) and 5Ј Go6983 and Go6976 (Biomol) or vehicle only [dimethyl sulfoxide (DMSO)] TTGGTACCCTCATTT (A/G)TCACAG(C/T) CAGG 3Ј (underlined KpnI site). were added 60 min prior to PSG17N treatment. Cell viability was monitored

Ha et al. CD9-mediated pregnancy-specific glycoprotein function 949 using trypan blue exclusion and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl observed with concentrations of PSG17N as low as 2.5 (for tetrazolium bromide assay (Promega, Madison, WI). Phorbol 12-myristate RAW 264.7 cells) or 5 ␮g/ml (for primary macrophages) and 13-acetate (PMA) was obtained from LC Laboratories (Woburn, MA) and was observed at 2 h post-PSG17 treatment. The observed added at a 1-␮M final concentration. The neutralizing anti-transforming growth ␤ ␤ increase in secretion of these cytokines was not a result of factor- 1 (TGF- 1)/1.2 polyclonal chicken IgY antibody (R&D Systems, Min- neapolis, MN) and the control antibody of the same isotype were added at 50 earlier macrophage production of proinflammatory cytokines, ␮g/ml for 30 min prior to PSG17N treatment. as supernatants from PSG17N-treated macrophages did not show an increase in tumor necrosis factor ␣ (TNF-␣) or IL-12 Cytokine and prostaglandin E2 (PGE2) enzyme- linked immunosorbent assay (ELISA) measured up to 48 h post-treatment. In addition, we did not observe induction of cytokines (IL-10, IL-6, IL-12 p40) upon RAW 264.7 cells and peritoneal macrophages were seeded in 24-well tissue- treatment of cells with up to 50 ␮g/ml anti-CD9 mAb KMC8.8 6 6 culture plates at 1 ϫ 10 or 1.5 ϫ 10 cells per well, respectively. BMDM were (data not shown), which is in agreement with results obtained ϫ 6 seeded at a density of 1.2 10 cells per well. After 24 h, the cells were by Takeda and coworkers [17] using a different anti-CD9 mAb. treated in triplicate with PSG17N-Myc-His or the control protein for4hat 37°C in 300 ␮l media. When the treatments were for less than 2 h, the volume Induction of IL-10, IL-6, and TGF-␤ by PSG17 was kept to 300 ␮l; after 4 h, the volume was increased to 1 ml in each well 1 by addition of cell culture media. Supernatants were harvested at different is CD9-mediated times post-treatment depending on the cytokine under study, as indicated in We identified the receptor for PSG17 in macrophages as the Results. ELISA was used to measure secreted IL-10, IL-12p40, IL-6 (Pierce- ␤ tetraspanin CD9 by screening an expression library [15]. Our Endogen, Woburn, MA), and TGF- 1 (R&D Systems) in cell supernatants. The limit of detection was 31 pg/ml for IL-10 and 15 pg/ml for IL-6, IL-12p40, and next objective was to determine whether the observed biolog- ␤ TGF- 1. PGE2 secretion was determined using the high-sensitivity (8.26 ical responses to PSG17 treatment were CD9-mediated. In pg/ml) ELISA (Assay Designs, Ann Arbor, MI). Treatment with 0.1–1 ␮g/ml addition, we examined whether the absence of CD81, a tet- LPS was used as a positive control. raspanin known to complex with CD9, could interfere with the Immunoblot analysis ability of PSG17 to stimulate the production of immunoregu- latory molecules in murine macrophages. BMDM lysates were obtained by adding 120 ␮l phosphosafe buffer (Novagen, CD9-deficient mice are of the C57BL/6 background; there- ϫ 6 Madison, WI) with protease inhibitors to cells seeded at a density of 5 10 fore, we repeated the studies performed in the RAW cells and cells/well of a six-well plate the previous day. The protein concentration in each well was determined using the bicinchoninic acid reagent (Pierce), and BALB/c peritoneal macrophages described above in macro- equal amounts (100 ␮g) were loaded per lane of a 4–20% NuPage gel phages isolated from C57BL/6 wild-type and CD9-deficient (Invitrogen). After transferring to a polyvinylidene difluoride membrane and mice. Figure 1 shows that PSG17N induced secretion of blocking, the membranes were incubated overnight at 4°C with the specific ␤ IL-10, IL-6, and TGF- 1 in thioglycollate-elicited macro- antibody at the concentration recommended by the manufacturer. For analysis phages isolated from wild-type mice. However, in macrophages of COX-2 induction, an anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mAb (Research Diagnostics, Flanders, NJ) was used for loading isolated from CD9-deficient mice, the level of all three cyto- normalization. kines was the same in the control and PSG17N-treated cells. Thus, induction of anti-inflammatory cytokines by PSG17N is Data analysis blocked in the absence of CD9. Wild-type and CD9-deficient Data were obtained from at least three independent experiments. Results were macrophages, although responding equally to LPS treatment, evaluated for statistical significance using the unpaired Student’s t-test. Data did not up-regulate IL-12p40 in response to PSG17N treatment were expressed as mean Ϯ SE, and significance was defined at P Ͻ 0.05. (Fig. 1, D and E). CD9-deficient females are infertile [19], and the litter size of CD9ϩ/Ϫ mice is small; therefore, we used the J2 retrovirus RESULTS (myc/raf) to generate immortalized BMDM from wild-type and PSG17 induces secretion of IL-6, IL-10, CD9-deficient mice for further characterization of the PSG17- ␤ CD9-mediated responses. FACS analysis was used to verify the and TGF- 1 in murine macrophages in a dose-dependent manner CD9 phenotype of the immortalized cells and to confirm their macrophage lineage using the anti-CD9 KMC8.8 and the anti- We reported previously that rhPSG1, -6, and -11 induced IL-6, F4/80 mAb, respectively (data not shown). The derivation of ␤ IL-10, and TGF- 1 in human monocytes [12]. In addition, we these cells allowed us to study their responses to PSG17N over reported that murine PSG18N induced IL-10 in RAW 264.7 a range of concentrations and time-points. PSG17N did not ␤ cells [14]. To determine whether murine and human PSGs have induce the expression of IL-6, IL-10, and TGF- 1 in CD9- similar biological effects, RAW 264.7 cells and BALB/c thio- deficient BMDM at any concentration examined. As expected, glycollate peritoneal macrophages were treated with increasing PSG17N did not induce IL-12p40 in wild-type or CD9-defi- concentrations of recombinant PSG17N-Myc-His or a control cient BMDM (Fig. 2). It is important that as primary macro- protein, GST-His-XylE, and cytokines in the supernatant were phages, wild-type and CD9-deficient BMDM secreted an equal measured at 24 h post-treatment for IL-10 and IL-6 and 2 h amount of IL-10, IL-6, and IL-12p40 in response to LPS ␤ post-treatment for TGF- 1. Treatment of the cells with 20–25 treatment (data not shown). ␮g/ml PSG17N resulted in significant secretion of IL-10 These results suggest that other tetraspanin family members, (240Ϯ5 pg/ml) and IL-6 (780Ϯ25 pg/ml) when compared with which are present in complex with CD9, do not compensate for the levels of these cytokines obtained following treatment with the lack of CD9 in macrophages, as high concentrations of the control protein (less than 31 pg/ml for IL-10 and 15Ϯ2 PSG17N were unable to initiate cytokine signaling in these ␤ pg/ml for IL-6). A threefold up-regulation of TGF- 1 was cells. To expand on this observation, we investigated whether

950 Journal of Leukocyte Biology Volume 77, June 2005 http://www.jleukbio.org ␤ Fig. 1. PSG17N induces IL-10, IL-6, and TGF- 1 secretion in C57BL/6 thioglycollate-elicited perito- neal macrophages expressing CD9. Peritoneal mac- rophages isolated from wild-type and CD9-deficient (CD9KO) mice were treated in triplicate with PSG17N-Myc-His (PSG17N), the control protein (GST-His-XylE), or LPS as a control (100 ng/ml) (E). Supernatants were harvested at 24 h post- treatment (A, B, D, and E) or at 2 h post-treatment (C). PSG17N and the control protein were added at a concentration of 25 ␮g/ml for the analysis of ␤ ␮ IL-10, IL-12, and TGF- 1 and 15 g/ml for the analysis of IL-6. For IL-10 quantitation, the cells were cotreated with PSG17N and a suboptimal con- centration of LPS (1 ng/ml) and therefore measured in different supernatants than the other cytokines. The results are expressed as the means Ϯ SEM and are representative of three experiments. *, P Ͻ 0.05, compared with control-treated cells.

the absence of CD81 expression had an effect on the PSG17- PGE2 secretion peaked at 2 h post-treatment and at later mediated expression of anti-inflammatory cytokines. Peritoneal time-points, was no longer significant compared with treatment

macrophages isolated from BALB/c wild-type and CD81-defi- with the control protein (data not shown). When PGE2 levels cient mice responded equally to the treatment with PSG17 were measured in BMDM supernatants, they were up-regulated (data not shown). In of this observation, it is important to in response to PSG17N and reached a maximal concentration

note that BMDM expressed CD81 even in the absence of CD9, at 6 h post-treatment. PGE2 secretion in response to PSG17N as determined by FACS analysis (data not shown). treatment was observed only in CD9 wild-type mice, which correlated with the induction of COX-2 expression, the rate- PSG17 induces PGE2 and up-regulates COX-2 limiting, catalyzing enzyme involved in PGE2 synthesis (Fig. 3, expression B and C). Up-regulation of IL-6 and IL-10 mRNA in RAW 264.7 cells Induction of IL-10 and IL-6 requires induction after treatment with PSG17 requires de novo protein synthesis, of PGE secretion as demonstrated by the significant inhibition in the expression 2 ␮ of these cytokines upon treatment of the cells with 5 g/ml The finding that PGE2 enhances the production of IL-10 and cycloheximide (data not shown). PGE2 has been shown to play IL-6 protein levels by activated murine macrophages suggested a role in regulating the Th1/Th2 balance [22, 23]. This that PGE2 elevation following COX-2 expression could be prompted us to investigate whether PSG17N can induce PGE2 required for the observed induction of IL-10 and IL-6. BMDM secretion and as a result, has the ability to potentially regulate were preincubated with the COX-2-specific inhibitor NS-398 the innate and acquired immune responses. RAW 264.7 cells prior to treatment with PSG17N and the control protein. As ␮ were treated with 10 g/ml PSG17N. In response to PSG17N, shown in Figure 3B, the drug inhibited the production of PGE2 significant levels of PGE2 were produced (Fig. 3A). Superna- in response to PSG17N, and it reduced the induction of IL-10 tants analyzed at 2, 4, and 6 h post-treatment showed that and IL-6 in a significant manner (Fig. 4A).

Ha et al. CD9-mediated pregnancy-specific glycoprotein function 951 Fig. 2. CD9 is required for the dose-dependent ␤ induction of IL-10, IL-6, and TGF- 1 by PSG17 in BMDM. J2-transformed BMDM from C57BL/6 wild-type (WT) and CD9-deficient (CD9KO) mice were treated in triplicate with PSG17N or the con- trol protein, and the cytokines in the supernatants were measured by ELISA. As described in Figure 1, IL-10 production was measured in response to PSG17N and 1 ng/ml LPS treatment. IL-10, IL-6, and IL-12 were analyzed in the supernatants at 24 h ␤ post-treatment, and TGF- 1 was measured at 2 h post-treatment. All data are representative of three experiments. *, P Ͻ 0.05, compared with control- treated cells.

Binding of PGE2 to its specific G-protein-coupled receptors, ure 4B, the introduction of this inhibitor reduced the induction i.e., EP2 and EP4, generates intracellular cAMP, a molecule of IL-10 and IL-6 significantly. Conversely, treatment of cells absolutely required for the activation of PKA [24, 25]. Phos- with NS-398 or KT5720 had no effect in the induction of ␤ phorylation of PKA on its downstream transcriptional factors, TGF- 1 (data not shown). ␤ such as cAMP response element-binding protein (CREB), in- TGF- 1 has been reported to induce IL-6 production in duces the expression of target genes [26–28]. To study the peripheral blood mononuclear cells and up-regulate IL-10 involvement of the cAMP-dependent PKA pathway in production in murine macrophages, which may explain the PSG17N-mediated cytokine production, the effect of PSG17N significance of early production of this cytokine by activated on BMDM was evaluated in the presence or absence of macrophages [29, 30]. We, therefore, investigated whether ␤ KT5720, a cAMP-dependent PKA inhibitor. As shown in Fig- neutralization of TGF- 1 had an effect on IL-6 and IL-10

Fig. 3. The PSG17-CD9-mediated induction of COX-2 results in the

secretion of PGE2. (A). RAW cells were treated with PSG17N or the control protein in triplicate, and the supernatants were harvested at 2 h

for the analysis of PGE2 by ELISA. (B). Wild-type (WT) and CD9- deficient (CD9KO) BMDM were treated with control protein or PSG17N

in the presence or absence of NS-398. At 6 h post-treatment, PGE2 was measured in the supernatants by ELISA. *, P Ͻ 0.05, compared with control-treated cells. (C) BMDM from wild-type and CD9-deficient mice were treated with 20 ␮g/ml PSG17N, control protein, or LPS (1 ␮g/ml) for 6 h. Cell lysates were analyzed for the expression of COX-2 and GAPDH by Western blot.

952 Journal of Leukocyte Biology Volume 77, June 2005 http://www.jleukbio.org Fig. 4. PSG17N-induced IL-10 and IL-6 secretion requires induction of COX-2 and activation of PKA. BMDM were treated in triplicate with 20 ␮g/ml PSG17N or control protein in the presence or absence of the COX-2 inhibitor NS-398 (A) and the cyclic adenosine monophosphate (cAMP)-dependent PKA in- hibitor KT5720 (B). The supernatants were harvested at 24 h post-treatment for IL-10 and IL-6 ELISA analysis. For IL-10, the supernatants were concentrated eightfold prior to the ELISA. All data are representative of three experiments. *, P Ͻ 0.05, compared with PSG17N and inhibitor-cotreated cells.

induction. No difference in the levels of PSG17N-mediated reduced to baseline level (data not shown). In accordance with IL-6 and IL-10 was observed in BMDM cotreated with anti- these results, Go6983 (10, 100, and 1000 nM) added prior to TGF-␤ antibody or with an isotype-matched antibody control or PSG17N treatment resulted in a significant inhibition of IL-6 in the cells treated with PSG17N only (data not shown). (Fig. 5B) and IL-10 induction (data not shown) when compared with PSG17N-treated cells in the absence of inhibitor. Similar PKC regulates macrophage production of TGF- ␤ results were obtained upon treatment of primary peritoneal 1 and COX-2 in response to PSG17 treatment macrophages (data not shown). ␤ ␤ Two regions in the TGF- 1 promoter are responsive to TGF- 1 Human PSG11 and PSG1d do not use CD9 autoinduction and to the induction by phorbol ester. Treatment as receptor of RAW 264.7 cells and primary macrophages with PMA ␤ resulted in the up-regulation of TGF- 1 secretion (data not Binding studies, including pull-down assays and FACS anal- shown). Because of this observation and the reported interac- ysis performed in our laboratory failed to demonstrate an tion of CD9 with PKC, we pretreated RAW 264.7 cells with association between human PSG1d and PSG11 and human or Go6983, which inhibits the conventional PKC-␣,-␤, and -␥ murine CD9. Conversely, PSG17 binding to cells expressing and the nonconventional PKC-␦. Treatment with Go6983 in- human CD9 was detected, albeit we did not determine whether ␤ hibited the PSG17-induced secretion of TGF- 1 at all concen- PSG17 binds to human CD9 with the same affinity as it binds trations tested in RAW 264.7 cells (Fig. 5A) and primary to mouse CD9 (data not shown). There is 89% homology at the macrophages (data not shown). In addition, Go6983 resulted in amino acid level between human and mouse CD9, and 19 out a significant reduction of the PSG17-mediated induction of of the 24 amino acid differences are located in the second COX-2. Treatment of RAW 264.7 cells with 10 nM Go6983 extracellular loop, which we have determined is where PSG17 resulted in a significant reduction of the PSG17N-mediated binds to CD9 [16]. As human PSGs induce cytokines in murine induction of COX-2 (twofold induction over control-treated macrophages [12], we evaluated whether CD9-deficient BMDM cells in the presence of 10 nM Go6983 vs. 3.15-fold induction responded to human PSG11 and PSG1d treatment. Represen- observed without the inhibitor). When the cells were treated tative experiments are shown in Figure 6, which shows that with 100 or 1000 nM Go6983 prior to PSG17N, COX-2 was there was no difference in the PSG11-mediated induction of

Ha et al. CD9-mediated pregnancy-specific glycoprotein function 953 Fig. 5. PKC is required for the PSG17N-mediated induction ␤ of TGF- 1 IL-6, and IL-10. RAW 264.7 cells were treated in triplicate with the indicated concentrations of Go6983 or ve- hicle (DMSO) for 1 h before the addition of PSG17N or control protein. The supernatants were harvested at 3 h post-treatment ␤ for quantitation of TGF- 1 (A) or 24 h post-treatment for quantitation of IL-6 (B) and IL-10 (C) by ELISA. For IL-10, the supernatants were concentrated eightfold prior to the ELISA. All data are representative of three experiments. *, P Ͻ 0.05, compared with PSG17N and inhibitor-cotreated cells.

␤ IL-6 and the PSG1d-mediated induction of TGF- 1 between leukocyte subpopulation following implantation and the devel- BMDM obtained from wild-type and CD9-deficient mice. opment of human and mouse decidua [35, 36]. These cells are affected by various circulating factors and are important reg- ulatory cells during pregnancy [36–38]. In this study, murine DISCUSSION macrophages isolated from wild-type and CD9- or CD81-defi- cient mice were treated with highly purified recombinant Experimental evidence indicates that various mechanisms, not PSG17N. Our results show that PSG17N induced the secretion ␤ mutually exclusive, are potentially responsible for fetal toler- of IL-6, IL-10, TGF- 1, and the eicosanoid PGE2 and that the ance [31]. The mechanism most relevant to the data we present induction of these cytokines by PSG17 required CD9 expres- here is the development, by the maternal immune response sion. Cotreatment with a suboptimal dose of LPS was needed to during pregnancy and post-implantation, of a bias toward a Th2 observe the up-regulation of IL-10 secretion in peritoneal or anti-inflammatory environment [32]. A Th2 immune envi- macrophages, and it was not required for RAW 264.7 cells. ronment is characterized by the presence of specific cytokines Tetraspanins are expressed together as part of a multimo- ␤ including IL-10, TGF- 1, and IL-4. These cytokines reduce lecular complex on the cell surface [39]. In some instances, one the expression of proinflammatory cytokines, which are known tetraspanin could compensate for the lack of expression of the to be detrimental to pregnancy [33]. The concept of a Th2 over other. This is the case for CD81, which has been shown to Th1 bias implies that a steady-state balance occurs between compensate for the deficiency of CD9 in egg-sperm fusion [40]. proinflammatory and anti-inflammatory cytokines during preg- In other cases, the specific function of some members of the nancy; however, evidence now suggests that inflammatory cy- family has been revealed [41]. In this investigation, we dem- tokines play key roles in important events during pregnancy onstrated that this seems to be the case for CD9, being the (i.e., promoting successful embryo implantation and aiding in unique receptor for PSG17. In previous studies, we were un- the events leading up to and during parturition) [34]. Macro- able to detect binding of PSG17 to any of the other tetraspanins phages and uterine natural killer cells are the most prominent tested [15], and here, we confirmed that the lack of the CD9

954 Journal of Leukocyte Biology Volume 77, June 2005 http://www.jleukbio.org reported to express IL-6 during implantation and throughout pregnancy in mice [44–46]. In addition to its role during the immune response, IL-6 induces production of human chorionic gonadotropin from first-trimester human trophoblasts in culture [47].

PGE2 has been reported to regulate IL-6 and IL-10 produc- tion by activated macrophages and to regulate T cell differen- tiation, favoring Th2 cell development, through induction of IL-10 [23, 48]. In BMDM, COX-2 induction was observed starting at 2 h post-PSG17N treatment followed by an increase

of PGE2 secretion detected at 6 h post-treatment. Inhibition of COX-2 resulted in a significant reduction in the PSG17N- mediated up-regulation of IL-6 and in a less-significant man- ner, inhibited the induction of IL-10, which could be regulated to some extent by TGF-␤ secretion, which is not affected by COX-2 inhibition. We next studied the involvement of the cAMP-dependent PKA pathway in the PSG17N-mediated induction of IL-10 and IL-6. We found that the introduction of the cAMP/PKA-selec- tive inhibitor KT5720 reduced the secretion of IL-10 and IL-6 significantly. Most of the genes regulated by cAMP/PKA con- tain a cis-acting DNA sequence, CRE, which is the binding site for the transcriptional factor CREB. It is interesting that the COX-2, IL-10, and IL-6 genes have CRE sites in their 5Ј flanking promoter region [49–52]. Preliminary experiments to examine the effect of PSG17N on CREB phosphorylation showed that phosphorylated CREB could be detected 15 min post-PSG17N treatment only in wild-type but not in CD9- deficient BMDM. Future studies are needed to determine the duration and magnitude of the phosphorylation of CREB and Fig. 6. Induction of cytokines by human PSGs is independent of the expres- the regulation of other transcription factors in response to sion of CD9. BMDM isolated from wild-type or CD9-deficient (CD9KO) mice ␮ PSG17N. were treated in triplicate with 7 g/ml recombinant GST-PSG11 (A), GST- ␤ PSG1d (B) or control protein (GST-XylE), and the supernatants were harvested It has been reported that TGF- up-regulates IL-10 and IL-6 24 h post-treatment for the analysis of IL-6 (A) or at 2 h post-treatment for in various cell lines [53–55]. Hence, we decided to investigate ␤ ␤ TGF- 1 (B) by ELISA. All data are representative of three experiments. *, P the effect of PSG17N-mediated secretion of TGF- 1 on IL-10 Ͻ 0.05, compared with control-treated cells. and IL-6 production. However, we were unable, via neutral- ␤ ization of TGF- 1 during PSG17N treatment, to demonstrate a ␤ relationship between TGF- 1 secretion and the up-regulation ␤ partner CD81 does not alter the response of macrophages to of IL-10 and IL-6. Autoinduction of TGF- 1 has been reported, ␤ PSG17N. and treatment with neutralizing anti-TGF- 1 antibodies may Although kinetics and fold induction of IL-10, IL-6, PGE2, not be efficient for its complete neutralization (John Letterio, ␤ and TGF- 1 in response to PSG17N treatment were different in (NCI, NIH, Bethesda, MD) personal communication). There- RAW 264.7 cells, thioglycollate-induced BALB/c and fore, at this point, we cannot conclusively rule out the involve- ␤ C57BL/6 peritoneal macrophages, and BMDM, it is clear that ment of TGF- 1 in the up-regulation of IL-10 or IL-6 in our these cytokines were induced by PSG17N in all the macro- system. ␣ ␤ phages studied. The lack of induction of IL-12 and TNF- by Our data indicate that induction of TGF- 1 as well as of PSG17 concurs with our previous data on macrophage treat- COX-2, IL-6, and IL-10 is significantly inhibited in the pres- ment with human PSG1, -6, and -11 and murine PSG18, none ence of the conventional and nonconventional PKC inhibitor of which increased secretion of inflammatory cytokines at the Go6983. As observed in the COX-2 and PKA inhibition ex- RNA or protein level. periments, although PSG17N-mediated induction of IL-10 and Through induction of IL-10, PSGs may contribute to the IL-6 was reduced significantly in the presence of the PKC down-regulation of inflammatory Th1 cytokines, locally at the inhibitor when compared with PSG17N-treated cells in the fetal maternal junction and/or systemically. Increased concen- absence of inhibitor, IL-10 and IL-6 were not reduced to basal trations of IL-10 have been reported at the fetal-maternal levels. This suggests that an additional pathway is involved in interface in normal pregnancies in mice and humans [42]. IL-6 the PSG17 up-regulation of these cytokines. In an attempt to is a multifunctional cytokine with the ability to stimulate a better identify the PKC isozyme implicated in the response to variety of different cells and has been demonstrated to function PSG17, we pretreated the cells with 0.1–2 ␮M Go6976, which ␣ ␤ as an important anti-inflammatory cytokine locally and system- inhibits the conventional PKC- and - 1 and PKD. Although ically [43]. Uterine decidual cells and macrophages have been Go6976 significantly reduced the secretion of cytokines,

Ha et al. CD9-mediated pregnancy-specific glycoprotein function 955 Go6976 treatment resulted in reduced cell viability at all Urology, University Clinic Grosshadern, Ludwig Maximilian concentrations. Therefore, although our data suggest that con- University, Munich, Germany) for providing us with the PSG17 ventional PKCs might be implicated in the PSG17-mediated cDNA. induction of cytokines, further experiments are required to better identify the PKC isozyme(s) involved. We propose that PKC activation could be one of the initial REFERENCES steps following binding of PSG17 to CD9 in the cascade of 1. Bohn, H. (1971) Detection and characterization of pregnancy proteins in signaling events, resulting in the secretion of cytokines. CD9 the human placenta and their quantitative immunochemical determination has been shown to associate with conventional PKC isoforms in in sera from pregnant women. Arch. Gynakol. 210, 440–457. 2. Lin, T. M., Halbert, S. P., Spellacy, W. N. (1974) Measurement of multiple adherent and nonadherent cell lines, and Giroux and pregnancy-associated plasma proteins during human gestation. J. Clin. Descoteaux [56] reported that PKC-␣ modulates COX-2 ex- Invest. 54, 576–582. pression in macrophages exposed to LPS and inteferon-␥ [57]. 3. Bohn, H., Weinmann, E. (1976) Antifertility effect of an active immuni- zation of monkeys with human pregnancy-specific ␤ 1-glycoprotein (SP1) In addition, in some cell types, activation of PKC has been (author’s transl). Arch. Gynakol. 221, 305–312. ␤ implicated in the up-regulation of TGF- 1 [58]. In light of 4. Hau, J., Gidley-Baird, A. A., Westergaard, J. G., Teisner, B. (1985) The these findings, the relationship among individual PKC iso- effect on pregnancy of intrauterine administration of antibodies against two pregnancy-associated murine proteins: murine pregnancy-specific ␤ forms, the mitogen-activated protein kinase family, and PSG- 1-glycoprotein and murine pregnancy-associated ␣ 2-glycoprotein. mediated cytokine secretion merits further investigation. Biomed. Biochim. Acta 44, 1255–1259. In conclusion, our results indicate that the biological effect 5. Tamsen, L. (1984) Pregnancy-specific ␤ 1-glycoprotein (SP1) levels mea- sured by nephelometry in serum from women with vaginal bleeding in the of murine PSG17 is similar to that of three human PSG family first half of pregnancy. Acta Obstet. Gynecol. Scand. 63, 311–315. members in macrophages isolated from Th1-dominant 6. MacDonald, D. J., Scott, J. M., Gemmell, R. S., Mack, D. S. (1983) A (C57BL/6) and Th2-dominant (BALB/c) mice. It is important prospective study of three biochemical fetoplacental tests: serum human placental lactogen, pregnancy-specific ␤ 1-glycoprotein, and urinary es- that the tetraspanin CD9 is required for the PSG17-mediated trogens, and their relationship to placental insufficiency. Am. J. Obstet. cytokine induction, which raises the possibility that all murine Gynecol. 147, 430–436. PSGs share the same receptor. PSG19, like PSG17, induces 7. Silver, R. M., Heyborne, K. D., Leslie, K. K. (1993) Pregnancy-specific ␤ 1 glycoprotein (SP-1) in maternal serum and amniotic fluid; pre-eclamp- the secretion of the same cytokines in macrophages, and sia, small for gestational age fetus and fetal distress. Placenta 14, PSG19 uses CD9 as its receptor (unpublished results). In 583–589. contrast, human PSG1d and -11 and most likely other human 8. Hertz, J. B., Schultz-Larsen, P. (1983) Human placental lactogen, preg- nancy-specific ␤-1-glycoprotein and ␣-fetoprotein in serum in threatened PSGs do not use CD9 as their receptor. In this respect, it is abortion. Int. J. Gynaecol. Obstet. 21, 111–117. important to note that members of the human and murine PSG 9. Chan, W. Y., Tease, L. A., Bates Jr., J. M., Borjigin, J., Shupert, W. L. family have only 60% homology in the N-terminal domain, (1988) Pregnancy-specific ␤ 1 glycoprotein in rat: tissue distribution of the mRNA and identification of testicular cDNA clones. Hum. Reprod. 3, which we have shown is sufficient for the ability of these 687–692. proteins to induce cytokines. Conversely, the homology be- 10. McLellan, A. S., Fischer, B., Hameister, H., Dveksler, G., Hori, T., tween human PSGs is greater than 85%, which suggests that Wynne, F., Ball, M., Okumura, K., Moore, T., Zimmermann, W. (2005) Structure and evolution of the mouse pregnancy-specific glycoprotein they might use the same receptor. Through binding to different (Psg) gene Locus. BMC Genomics 6, 4. receptors, human and murine PSGs may use identical signaling 11. Zhou, G. Q., Hammarstrom, S. (2001) Pregnancy-specific glycoprotein mechanisms that result in the secretion of the same cytokines. (PSG) in baboon (Papio hamadryas): family size, domain structure, and prediction of a functional region in primate PSGs. Biol. Reprod. 64, The identity of the receptor for human PSGs as well as the 90–99. signaling molecules involved remain to be elucidated. 12. Snyder, S. K., Wessner, D. H., Wessells, J. L., Waterhouse, R. M., Wahl, High levels of PSG expression in human pregnancy and L. M., Zimmermann, W., Dveksler, G. S. (2001) Pregnancy-specific gly- coproteins function as immunomodulators by inducing secretion of IL-10, decreased production in fetal pathologies imply a critical role IL-6 and TGF-␤1 by human monocytes. Am. J. Reprod. Immunol. 45, for these proteins in pregnancy. We suggest that the induction 205–216. of anti-inflammatory mediators in macrophages by placentally 13. Arnold, L. L., Doherty, T. M., Flor, A. W., Simon, J. A., Chou, J. Y., Chan, W. Y., Mansfield, B. C. (1999) Pregnancy-specific glycoprotein gene produced PSGs plays a role in the generation of an immune expression in recurrent aborters: a potential correlation to interleukin-10 environment compatible with successful pregnancy. expression. Am. J. Reprod. Immunol. 41, 174–182. 14. Wessells, J., Wessner, D., Parsells, R., White, K., Finkenzeller, D., Zimmermann, W., Dveksler, G. S. (2000) Pregnancy specific glycoprotein 18 induces IL-10 expression in murine macrophages. Eur. J. Immunol. ACKNOWLEDGMENTS 30, 1830–1840. 15. Waterhouse, R., Ha, C., Dveksler, G. S. (2002) Murine CD9 is the receptor for pregnancy-specific glycoprotein 17. J. Exp. Med. 195, 277–282. This work was supported by Grant HD35832 from the NIH. We 16. Ellerman, D. A., Ha, C., Primakoff, P., Myles, D. G., Dveksler, G. S. are grateful to Kimberly White, Carolyn Zalepa, and Karen (2003) Direct binding of the ligand PSG17 to CD9 requires a CD9 site Wolcott for technical assistance and to Dr. G. Kaplan (CBER, essential for sperm-egg fusion. Mol. Biol. Cell 14, 5098–5103. 17. Takeda, Y., Tachibana, I., Miyado, K., Kobayashi, M., Miyazaki, T., FDA) for providing us with the pDHIP vector. In addition, we Funakoshi, T., Kimura, H., Yamane, H., Saito, Y., Goto, H., Yoneda, T., are most grateful to Dr. Boucheix and Dr. Rubinstein (Hopital Yoshida, M., Kumagai, T., Osaki, T., Hayashi, S., Kawase, I., Mekada, E. Paul Brousse, Villejuif, France) for providing us with the (2003) Tetraspanins CD9 and CD81 function to prevent the fusion of ϩ Ϫ mononuclear phagocytes. J. Cell Biol. 161, 945–956. CD9 / mice and for sharing their expertise in tetraspanins. 18. Le Naour, F., Rubinstein, E., Jasmin, C., Prenant, M., Boucheix, C. (2000) We thank Dr. Shoshana Levy (Division of Oncology, Stanford Severely reduced female fertility in CD9-deficient mice. Science 287, University School of Medicine, CA) for providing us with 319–321. ϩ Ϫ 19. Maecker, H. T., Levy, S. (1997) Normal lymphocyte development but CD81 / mice and critical comments. We thank Dr. Wolf- delayed humoral immune response in CD81-null mice. J. Exp. Med. 185, gang Zimmerman (Tumor Immunology Group, Department of 1505–1510.

956 Journal of Leukocyte Biology Volume 77, June 2005 http://www.jleukbio.org 20. Cox, G. W., Mathieson, B. J., Gandino, L., Blasi, E., Radzioch, D., 41. Pileri, P., Uematsu, Y., Campagnoli, S., Galli, G., Falugi, F., Petracca, R., Varesio, L. (1989) Heterogeneity of hematopoietic cells immortalized by Weiner, A. J., Houghton, M., Rosa, D., Grandi, G., Abrignani, S. (1998) v-myc/v-raf recombinant retrovirus infection of bone marrow or fetal liver. Binding of hepatitis C virus to CD81. Science 282, 938–941. J. Natl. Cancer Inst. 81, 1492–1496. 42. Chaouat, G., Cayol, V., Mairovitz, V., Dubanchet, S. (1999) Localization of 21. Silberstein, E., Dveksler, G. S., Kaplan, G. G. (2001) Neutralization of the Th2 cytokines IL-3, IL-4, IL-10 at the fetomaternal interface during hepatitis A virus (HAV) by an immunoadhesin containing the cysteine- human and murine pregnancy and lack of requirement for Fas/ rich region of HAV cellular receptor-1. J. Virol. 75, 717–725. interaction for a successful allogeneic pregnancy. Am. J. Reprod. Immunol. 22. Van der Pouw Kraan, T. C., Boeije, L. C., Smeenk, R. J., Wijdenes, J., 42, 1–13. Aarden, L. A. (1995) Prostaglandin-E2 is a potent inhibitor of human 43. Xing, Z., Gauldie, J., Cox, G., Baumann, H., Jordana, M., Lei, X. F., interleukin 12 production. J. Exp. Med. 181, 775–779. Achong, M. K. (1998) IL-6 is an antiinflammatory cytokine required for 23. Demeure, C. E., Yang, L. P., Desjardins, C., Raynauld, P., Delespesse, G. controlling local or systemic acute inflammatory responses. J. Clin. Invest. (1997) Prostaglandin E2 primes naive T cells for the production of 101, 311–320. anti-inflammatory cytokines. Eur. J. Immunol. 27, 3526–3531. 44. De, M., Sanford, T. R., Wood, G. W. (1993) Expression of interleukin 1, 24. Hinz, B., Brune, K., Pahl, A. (2000) Prostaglandin E(2) upregulates interleukin 6 and tumor necrosis factor ␣ in mouse uterus during the cyclooxygenase-2 expression in lipopolysaccharide-stimulated RAW peri-implantation period of pregnancy. J. Reprod. Fertil. 97, 83–89. 264.7 macrophages. Biochem. Biophys. Res. Commun. 272, 744–748. 45. Robertson, S. A., Mayrhofer, G., Seamark, R. F. (1992) Uterine epithelial 25. Breyer, R. M., Bagdassarian, C. K., Myers, S. A., Breyer, M. D. (2001) cells synthesize granulocyte-macrophage colony-stimulating factor and Prostanoid receptors: subtypes and signaling. Annu. Rev. Pharmacol. interleukin-6 in pregnant and nonpregnant mice. Biol. Reprod. 46, 1069– Toxicol. 41, 661–690. 1079. 26. Misra, U. K., Akabani, G., Pizzo, S. V. (2002) The role of cAMP- 46. Liang, L., Kover, K., Dey, S. K., Andrews, G. K. (1996) Regulation of dependent signaling in receptor-recognized forms of ␣ 2-macroglobulin- interleukin-6 and interleukin-1 ␤ gene expression in the mouse deciduum. induced cellular proliferation. J. Biol. Chem. 277, 36509–36520. J. Reprod. Immunol. 30, 29–52. 27. Gross, A., Bouaboula, M., Casellas, P., Liautard, J. P., Dornand, J. (2003) 47. Nishino, E., Matsuzaki, N., Masuhiro, K., Kameda, T., Taniguchi, T., Subversion and utilization of the host cell cyclic adenosine 5Ј-monophos- Takagi, T., Saji, F., Tanizawa, O. (1990) Trophoblast-derived interleu- phate/protein kinase A pathway by Brucella during macrophage infection. kin-6 (IL-6) regulates human chorionic gonadotropin release through IL-6 J. Immunol. 170, 5607–5614. receptor on human trophoblasts. J. Clin. Endocrinol. Metab. 71, 436– 28. Uchiya, K., Groisman, E. A., Nikai, T. (2004) Involvement of Salmonella 441. pathogenicity island 2 in the up-regulation of interleukin-10 expression in 48. Williams, J. A., Pontzer, C. H., Shacter, E. (2000) Regulation of macro- macrophages: role of protein kinase A signal pathway. Infect. Immun. 72, phage interleukin-6 (IL-6) and IL-10 expression by prostaglandin E2: the 1964–1973. role of p38 mitogen-activated protein kinase. J. Interferon Cytokine Res. 29. Turner, M., Chantry, D., Feldmann, M. (1990) Transforming growth factor 20, 291–298. ␤ induces the production of interleukin 6 by human peripheral blood 49. Mestre, J. R., Mackrell, P. J., Rivadeneira, D. E., Stapleton, P. P., Tanabe, mononuclear cells. Cytokine 2, 211–216. T., Daly, J. M. (2001) Redundancy in the signaling pathways and promoter 30. Kitani, A., Fuss, I., Nakamura, K., Kumaki, F., Usui, T., Strober, W. elements regulating cyclooxygenase-2 gene expression in endotoxin- (2003) Transforming growth factor (TGF)-␤1-producing regulatory T cells treated macrophage/monocytic cells. J. Biol. Chem. 276, 3977–3982. induce Smad-mediated interleukin 10 secretion that facilitates coordi- 50. Uchiya, K., Groisman, E. A., Nikai, T. (2004) Involvement of Salmonella nated immunoregulatory activity and amelioration of TGF-␤1-mediated pathogenicity island 2 in the up-regulation of interleukin-10 expression in fibrosis. J. Exp. Med. 198, 1179–1188. macrophages: role of protein kinase A signal pathway. Infect. Immun. 72, 31. Thellin, O., Coumans, B., Zorzi, W., Igout, A., Heinen, E. (2000) Toler- 1964–1973. ance to the foeto-placental ‘graft’: ten ways to support a child for nine 51. Platzer, C., Meisel, C., Vogt, K., Platzer, M., Volk, H. D. (1995) Up- months. Curr. Opin. Immunol. 12, 731–737. regulation of monocytic IL-10 by tumor necrosis factor-␣ and cAMP 32. Wegmann, T. G., Lin, H., Guilbert, L., Mosmann, T. R. (1993) Bidirec- elevating drugs. Int. Immunol. 7, 517–523. tional cytokine interactions in the maternal-fetal relationship: is success- 52. Platzer, C., Fritsch, E., Elsner, T., Lehmann, M. H., Volk, H. D., Prosch, ful pregnancy a TH2 phenomenon? Immunol. Today 14, 353–356. S. (1999) Cyclic adenosine monophosphate-responsive elements are in- 33. Raghupathy, R. (1997) Th1-type immunity is incompatible with successful volved in the transcriptional activation of the human IL-10 gene in pregnancy. Immunol. Today 18, 478–482. monocytic cells. Eur. J. Immunol. 29, 3098–3104. 34. Chaouat, G., Ledee-Bataille, N., Dubanchet, S., Zourbas, S., Sandra, O., 53. Turner, M., Chantry, D., Feldmann, M. (1990) Transforming growth factor Martal, J. (2004) Reproductive immunology 2003: reassessing the Th1/ ␤ induces the production of interleukin 6 by human peripheral blood Th2 paradigm? Immunol. Lett. 92, 207–214. mononuclear cells. Cytokine 2, 211–216. 35. Mackler, A. M., Iezza, G., Akin, M. R., McMillan, P., Yellon, S. M. (1999) 54. Maeda, H., Kuwahara, H., Ichimura, Y., Ohtsuki, M., Kurakata, S., Macrophage trafficking in the uterus and cervix precedes parturition in the Shiraishi, A. (1995) TGF-␤ enhances macrophage ability to produce IL-10 mouse. Biol. Reprod. 61, 879–883. in normal and tumor-bearing mice. J. Immunol. 155, 4926–4932. 36. Croy, B. A., Chantakru, S., Esadeg, S., Ashkar, A. A., Wei, Q. (2002) 55. Kitani, A., Fuss, I., Nakamura, K., Kumaki, F., Usui, T., Strober, W. Decidual natural killer cells: key regulators of placental development (a (2003) Transforming growth factor (TGF)-␤1-producing regulatory T cells review). J. Reprod. Immunol. 57, 151–168. induce Smad-mediated interleukin 10 secretion that facilitates coordi- 37. Hunt, J. S. (1989) Cytokine networks in the uteroplacental unit: macro- nated immunoregulatory activity and amelioration of TGF-␤1-mediated phages as pivotal regulatory cells. J. Reprod. Immunol. 16, 1–17. fibrosis. J. Exp. Med. 198, 1179–1188. 38. Hunt, J. S., Roberson, S. A. (1996) Uterine macrophages and environ- 56. Giroux, M., Descoteaux, A. (2000) Cyclooxygenase-2 expression in mac- mental programming for pregnancy success. J. Reprod. Immunol. 32, rophages: modulation by protein kinase C-␣. J. Immunol. 165, 3985– 1–25. 3991. 39. Boucheix, C., Rubinstein, E. (2001) Tetraspanins. Cell. Mol. Life Sci. 58, 57. Zhang, X. A., Bontrager, A. L., Hemler, M. E. (2001) Transmembrane-4 1189–1205. superfamily proteins associate with activated protein kinase C (PKC) and 40. Kaji, K., Oda, S., Miyazaki, S., Kudo, A. (2002) Infertility of CD9-deficient link PKC to specific ␤(1) integrins. J. Biol. Chem. 276, 25005–25013. mouse eggs is reversed by mouse CD9, human CD9, or mouse CD81; 58. Taniguchi, H., Kato, N., Otsuka, M., Goto, T., Yoshida, H., Shiratori, Y., polyadenylated mRNA injection developed for molecular analysis of Omata, M. (2004) Hepatitis C virus core protein upregulates transforming sperm-egg fusion. Dev. Biol. 247, 327–334. growth factor-␤ 1 transcription. J. Med. Virol. 72, 52–59.

Ha et al. CD9-mediated pregnancy-specific glycoprotein function 957