DOCSLIB.ORG

1 Somatic Mutations in Clonally Expanded T-Lymphocytes in Patients with Chronic Graft-Versus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

1 Somatic Mutations in Clonally Expanded T-lymphocytes in Patients with Chronic Graft-Versus- 2 Host Disease 3 4 Giljun Park1,2, Daehong Kim1,2, Jani Huuhtanen1,2, Sofie Lundgren1,2, Rajiv K. Khajuria1, Ana M. 5 Hurtado3, Cecilia Muñoz-Calleja4, Laura Cardeñoso5, Valle Gómez-García de Soria6, Tzu Hua Chen- 6 Liang3, Samuli Eldfors7, Pekka Ellonen7, Sari Hannula7, Oscar Bruck1,2, Anna Kreutzman1,2, Urpu 7 Salmenniemi8, Tapio Lönnberg9, Andres Jerez3, Maija Itälä-Remes8, Mikko A. I. Keränen1,2,10, and 8 Satu Mustjoki, MD1,2 9 10 Supplementary Appendix 11 12 Contents: 13 Supplementary results page 2 14 Supplementary Figure S1 page 3 15 Supplementary Figure S2 page 4, 5 16 Supplementary Figure S3 page 6 17 Supplementary Figure S4 page 7 18 Supplementary Figure S5 page 19 Supplementary Table S1 page 20 Supplementary Table S2 page 21 Supplementary Table S3 page 22 Supplementary Table S4 page 23 Supplementary Table S5 page 24 Supplementary Table S6 page 25 Supplementary Table S7 page 26 Supplementary Table S8 page 27 Supplementary Table S9 page 28 Supplementary Table S10 page 29 Supplementary Table S11 page 30 31 32 33 1 34 Supplementary results 35 Clinical Characteristics of the Index cGvHD Patient 36 The index patient was a 56-year-old male, who was diagnosed with chronic phase chronic myeloid 37 leukemia (CML) in the fall 1999. The clinical status and treatment history are described in detail in 38 Supplemental Figure 1. After short leukocyte reduction with hydroxyurea and the patient received 39 allo-HSCT from his HLA-matched sibling donor after myeloablative conditioning. Double 40 immunosuppression with cyclosporine and methylprednisone was started at the time of the allo- 41 HSCT, and methotrexate was also given on day +1, +3 and +6 after the transplantation. Within the 42 first 100 days the patient had a human herpesvirus 6 (HHV6) infection and the first 43 cytomegalovirus (CMV) reactivation. At the end of that period, the first symptoms of GvHD 44 emerged in the form of elevated transaminases. Since the beginning of 2001, the patient suffered 45 from cGvHD affecting his liver, eyes, nails and skin including sclerodermatous skin lesions that 46 presented with a varying degree of severity over time. Mycophenolate was added to the 47 immunosuppressive regimen in the spring 2001. In the course of the cGvHD, the patient was 48 treated with photopheresis in 2002 as well as with a low-dose irradiation of his lymph nodes in 49 2003. The immunosuppression was continuously adjusted according to the clinical presentation of 50 the cGvHD. In recent years, the patient has mostly received mycophenolate and varying 51 supplementation with methylprednisone and cyclosporine depending on the manifestation of 52 sclerodermatous skin lesions. The patient haven’t had a relapse of CML nor received any donor 53 lymphocyte infusions. He was sampled (blood) for the first time in 2013 and in the disease course 54 thereafter (Supplementary Figure S1). 55 2 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 3 82 Supplementary Figure S2. A Lymphocyte population in peripheral blood CD19+APC CD16/CD56+PE CD45+PerCP CD3+FITC CD3+FITC B Phenotype of donor and index patient’s T cells CD4+ CD8+ 3.60 12.7 5 19.9 15.4 10 4 10 4 10 CCR7 CCR7 3 10 3 10 CCR7+PE Dono CCR7+PE 0 0 3 3 -10 32.4 51.3 -10 59.6 5.00 C Naiv 3 3 4 5 3 3 4 -10 0 10 10 10 -10 0 10 10 CD45RA CD45RA CD45RA+Alexa700 CD45RA+Alexa700 EM TEMRA 6.22 1.38 2.01 2.17 5 5 10 10 4 4 10 10 CCR7 CCR7 Inde 3 3 10 10 CCR7+PE CCR7+PE 0 0 3 3 -10 75.0 17.4 -10 16.0 79.9 3 3 4 5 3 3 4 5 -10 0 10 10 10 -10 0 10 10 10 CD45RA CD45RA CD45RA+Alexa700 CD45RA+Alexa700 4 83 C Gating strategy for flow-assisted cell sorting 84 250K 250K 250K 200K 200K 200K monocytes 4.89 150K 150K CD3- 150K 44.9 SSC-A SSC-A SSC-A 100K 100K 100K CD3+ 50K 50K 50K 53.9 0 0 0 0 50K 100K 150K 200K 250K 3 3 4 5 3 3 4 5 -10 0 10 10 10 -10 0 10 10 10 FSC-A CD3+APC CD3+APC CD8+ 5 5 CD4+CD8+ 10 12.6 10 4 4 10 10 CD4+CD8+ 11.3 3 3 10 10 CD8+PECy7 CD4+ Vb+ 0 59.3 0 57.3 Vb- 3 3 40.0 -10 -10 1 2 3 4 3 3 4 10 10 10 10 -10 0 10 10 CD4+PerCP CFITCAVβ 20+FITC 5 CD4+ 10 4 10 3 10 Vb+ 0 39.5 Vb- 3 55.6 -10 3 3 4 -10 0 10 10 Vβ 20+FITC Supplementary Figure S2. Flow cytometry analysis of the index patient. (A) Basic lymphocyte immunophenotyping was performed to identify T (CD3+), natural killer (NK) (CD3-CD16+CD56+), and B (CD3-CD19+) cells by flow cytometry. (B) Multicolor-flow cytometry was applied to identify the detailed immunophenotype of donor and index patient’s memory T cell subtypes. Central memory (CM), naive, effector memory (EM) and terminal effector-memory (TEMRA) cells. (C) Gating strategy for flow based cell sorting. Monocytes were gated based on morphological features using SSC-A and FSC-A plots. CD3- and CD3+ cells were sorted from lymphocytes based on antibody staining, and CD3+ cells were separated to CD4+, CD4+CD8+ and CD8+ fractions. Finally, TCR Vβ20+ and Vβ20- cells were sorted. 5 85 86 87 Supplementary Figure S3. 88 89 90 91 TLR2 p=0.0054 p=0.0048 20 CD4-GVHD CD4-control 15 CD8-GVHD CD8-control 10 VAF (%) VAF 5 92 0 93 94 95 96 97 98 99 100 101 102 103 Supplementary Figure S3. Variant allele frequencies of TLR2 mutations 104 in cGVHD patients’ and healthy controls’ CD4+ and CD8+ T cells TLR2 mutation analyzed by amplicon sequencing in cGVHD patients (CD4+ T, n=21 and CD8+ T, n=22) and healthy controls (CD4+ T, n=5 and CD8+ T, n=4). Mononuclear cells (MNCs) were separated from whole blood with Ficoll-Paque PLUS (GE Healthcare, UK) followed by magnetic beads sorting of both CD4 and CD8+ T cells. The purity of sorted fractions was evaluated by flow cytometry (FACsVerse) and confirmed to be >98%. The analysis indicated 10-fold higher variant allele frequency in cGVHD patients compared to healthy controls. Unpaired t-test was performed with Welchi's correction to calculate p value using Graphpad Software (San Diego, USA). Error bar present Mean ± SD. 6 105 Supplementary Figure S4. 106 107 108 109 110 111 A B 112 6 p=0.0293 113 100000 114 10000 mock TLR2_WT 115 4 p=0.0020 1000 TLR2_W558L CT) CT) 116 ∆∆ ∆∆ ( 117 100 ( 2 118 10 119 Relative expression level expression Relative 1 120 level expression Relative 0 121 ELK1 FOS 122 123 124 125 Supplementary Figure S4. Functional analysis of wild type and TLR2 mutants in HEK293 cell line To identify the effect of TLR2 mutant on the downstream gene expression, RT-qPCR was performed for (A) TLR2 and (B) ELK1 and FOS1 genes using stably expressed TLR2_WT (n=7) and TLR2_W558L (n=7) in HEK293 cells. TLR2_W558L increased expression level of downstream target genes, ELK1 and FOS1. Unpaired t-test was performed with Welchi's correction to calculate p value (TLR2_WT vs TLR2_W558L) using Graphpad Software (San Diego, USA). Error bar present Mean ± SD. 7 126 Supplementary Figure S5. 127 128 129 130 Supplementary Figure S5. Gene expression fold change within CD4+ T cell clusters between 2015 131 and 2017 132 8 133 Supplementary Table S1. Summary of Study Cohorts 134 135 A. Patients with cGvHD 136 137 Patient characteristics N % 138 Total 135 139 Age at sampling (mean, range) 48 (16-70) 140 Patient sex 141 Female 58 43,0 142 Male 77 57,0 143 Donor sex* 144 Female 53 39,3 145 Male 81 60,0 146 Sex mismatch* 147 No 73 54,1 148 Yes 61 45,2 149 Diagnosis 150 AML, MDS 63 46,7 151 ALL 17 12,6 152 NHL 17 12,6 153 CLL 2 1,5 154 HL 4 3,0 155 MPD 15 11,1 156 MM 11 8,1 157 Other 6 4,4 158 Donor type 159 Sibling 79 58,5 160 MUD 56 41,5 161 Stem Cell Source 162 Peripheral blood 122 90,4 163 Bone marrow 13 9,6 164 HLA match** 165 Match 114 84,4 166 Mismatch 13 9,6 167 Haplo 7 5,2 168 Conditioning* 169 MAC 64 47,4 170 RIC 70 51,9 171 Prophylaxis of acute GVHD 172 Calcineurin-based 125 92,6 173 mTOR-inhibitor based 10 7,4 174 Acute GVHD** 175 No 66 48,9 176 Grade <2 17 12,6 177 Grade >2 50 37,0 178 Chronic GVHD* 179 Mild 28 20,7 180 Moderate-Severe 106 78,5 181 Delay from tx to sampling 182 < 12 m 67 49,6 9 183 12-36 m 53 39,3 184 > 36 m 15 11,1 185 186 B. Patients without cGVHD 187 188 Patient characteristics N % 189 Total 38 190 Age at sampling (mean, range) 48 (16-70) 191 Patient sex 192 Female 23 60,5 193 Male 15 39,5 194 Donor sex* 195 Female 12 31,6 196 Male 26 68,4 197 Sex mismatch* 198 No 20 52,6 199 Yes 18 47,4 200 Diagnosis 201 AML, MDS 23 60,5 202 ALL 6 15,8 203 NHL 2 5,3 204 CLL 2 5,3 205 HL 3 7,9 206 MPD 1 2,6 207 MM 0 0 208 Other 1 2,6 209 Donor type 210 Sibling 23 60,5 211 MUD 15 39,5 212 Stem Cell Source 213 Peripheral blood 33 86,8 214 Bone marrow 5 13,2 215 HLA match* 216 Match 29 76,3 217 Mismatch 2 5,3 218 Haplo 6 15,8 219 Conditioning 220 MAC 20 52,6 221 RIC 18 47,4 222 Prophylaxis of acute GVHD 223 Calcineurin-based 37 97,4 224 mTOR-inhibitor based 1 2,6 225 Acute GVHD 226 No 18 47,4 227 Grade <2 8 21,1 228 Grade >2 12 31,5 229 Delay from tx to sampling 230 < 12 m 14 36,8 231 12-36 m 22 57,9 232 > 36 m 2 5,3 10 233 234 AML; acute myeloid leukemia, MDS; myelodysplastic syndrome, NHL; non-hodgkin lymphoma, 235 CLL; chronic lymphocytic leukemia, HL; Hodgkin’s lymphoma, MPD; myeloproliferative 236 syndrome, MM; multiple myeloma.
Recommended publications
  • Imm Catalog.Pdf

    Imm Catalog.Pdf

    $ Gene Symbol A B 3 C 4 D 9 E 10 F 11 G 12 H 13 I 14 J. K 17 L 18 M 19 N 20 O. P 22 R 26 S 27 T 30 U 32 V. W. X. Y. Z 33 A ® ® Gene Symbol Gene ID Antibody Monoclonal Antibody Polyclonal MaxPab Full-length Protein Partial-length Protein Antibody Pair KIt siRNA/Chimera Gene Symbol Gene ID Antibody Monoclonal Antibody Polyclonal MaxPab Full-length Protein Partial-length Protein Antibody Pair KIt siRNA/Chimera A1CF 29974 ● ● ADAMTS13 11093 ● ● ● ● ● A2M 2 ● ● ● ● ● ● ADAMTS20 80070 ● AACS 65985 ● ● ● ADAMTS5 11096 ● ● ● AANAT 15 ● ● ADAMTS8 11095 ● ● ● ● AATF 26574 ● ● ● ● ● ADAMTSL2 9719 ● AATK 9625 ● ● ● ● ADAMTSL4 54507 ● ● ABCA1 19 ● ● ● ● ● ADAR 103 ● ● ABCA5 23461 ● ● ADARB1 104 ● ● ● ● ABCA7 10347 ● ADARB2 105 ● ABCB9 23457 ● ● ● ● ● ADAT1 23536 ● ● ABCC4 10257 ● ● ● ● ADAT2 134637 ● ● ABCC5 10057 ● ● ● ● ● ADAT3 113179 ● ● ● ABCC8 6833 ● ● ● ● ADCY10 55811 ● ● ABCD2 225 ● ADD1 118 ● ● ● ● ● ● ABCD4 5826 ● ● ● ADD3 120 ● ● ● ABCG1 9619 ● ● ● ● ● ADH5 128 ● ● ● ● ● ● ABL1 25 ● ● ADIPOQ 9370 ● ● ● ● ● ABL2 27 ● ● ● ● ● ADK 132 ● ● ● ● ● ABO 28 ● ● ADM 133 ● ● ● ABP1 26 ● ● ● ● ● ADNP 23394 ● ● ● ● ABR 29 ● ● ● ● ● ADORA1 134 ● ● ACAA2 10449 ● ● ● ● ADORA2A 135 ● ● ● ● ● ● ● ACAN 176 ● ● ● ● ● ● ADORA2B 136 ● ● ACE 1636 ● ● ● ● ADRA1A 148 ● ● ● ● ACE2 59272 ● ● ADRA1B 147 ● ● ACER2 340485 ● ADRA2A 150 ● ● ACHE 43 ● ● ● ● ● ● ADRB1 153 ● ● ACIN1 22985 ● ● ● ADRB2 154 ● ● ● ● ● ACOX1 51 ● ● ● ● ● ADRB3 155 ● ● ● ● ACP5 54 ● ● ● ● ● ● ● ADRBK1 156 ● ● ● ● ACSF2 80221 ● ● ADRM1 11047 ● ● ● ● ACSF3 197322 ● ● AEBP1 165 ● ● ● ● ACSL4 2182 ●
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
  • Cleveland Clinic Laboratories

    Cleveland Clinic Laboratories

    Cleveland Clinic Laboratories Technical Update • May 2014 Cleveland Clinic Laboratories is dedicated to keeping you updated and informed about recent testing changes. That's why we are happy to provide this technical update on a monthly basis. Recently changed tests are bolded, and could include revisions to methodology, reference range, days performed or CPT code. For your convenience, tests are listed alphabetically and the order and billing codes are provided. If you wish to compare the new information with previous test demographics, refer to the Test Directory, which can be accessed at clevelandcliniclabs.com. Deleted tests and new tests are listed separately. Please update your database as necessary. For additional detail, contact Client Services at 216.444.5755 or 800.628.6816 or via email at [email protected]. Days Performed/Reported Specimen Requirement Special InformationComponent Change Test Discontinued Reference Range Test Update Name Change Methodology Order CodeBiling Code New Test Page # Summary of Changes CPT by Test Name 3 5-Hydroxyindolacetic Acid, Urine 3 11-Deoxycorticosterone Qt, Serum / Plasma 3 25-Hydroxyvitamin D2 and D3, Serum 9 Alpha-1 Antitrypsin (SERPINA1) Targeted Genotyping 3 Alpha-1-Antitrypsin Clearance 3 Alpha-1-Antitrypsin, Stool 3 Anti IgA Antibody 3 Anti Mullerian Hormone 3 Beta Galactosidase, Leukocytes 4 Bioavailable Testosterone / SHBG, Female & Child 4 BK Virus Quantitation, Urine 12 Buprenorphine & Metabolite, Confirmation / Quant, Urine 9 Buprenorphine Quant, Urine 4 Carnitine Free & Total,
  • Genes in Eyecare Geneseyedoc 3 W.M

    Genes in Eyecare Geneseyedoc 3 W.M

    Genes in Eyecare geneseyedoc 3 W.M. Lyle and T.D. Williams 15 Mar 04 This information has been gathered from several sources; however, the principal source is V. A. McKusick’s Mendelian Inheritance in Man on CD-ROM. Baltimore, Johns Hopkins University Press, 1998. Other sources include McKusick’s, Mendelian Inheritance in Man. Catalogs of Human Genes and Genetic Disorders. Baltimore. Johns Hopkins University Press 1998 (12th edition). http://www.ncbi.nlm.nih.gov/Omim See also S.P.Daiger, L.S. Sullivan, and B.J.F. Rossiter Ret Net http://www.sph.uth.tmc.edu/Retnet disease.htm/. Also E.I. Traboulsi’s, Genetic Diseases of the Eye, New York, Oxford University Press, 1998. And Genetics in Primary Eyecare and Clinical Medicine by M.R. Seashore and R.S.Wappner, Appleton and Lange 1996. M. Ridley’s book Genome published in 2000 by Perennial provides additional information. Ridley estimates that we have 60,000 to 80,000 genes. See also R.M. Henig’s book The Monk in the Garden: The Lost and Found Genius of Gregor Mendel, published by Houghton Mifflin in 2001 which tells about the Father of Genetics. The 3rd edition of F. H. Roy’s book Ocular Syndromes and Systemic Diseases published by Lippincott Williams & Wilkins in 2002 facilitates differential diagnosis. Additional information is provided in D. Pavan-Langston’s Manual of Ocular Diagnosis and Therapy (5th edition) published by Lippincott Williams & Wilkins in 2002. M.A. Foote wrote Basic Human Genetics for Medical Writers in the AMWA Journal 2002;17:7-17. A compilation such as this might suggest that one gene = one disease.
  • Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion Genes Data Set

    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
  • Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
  • CD Markers Are Routinely Used for the Immunophenotyping of Cells

    CD Markers Are Routinely Used for the Immunophenotyping of Cells

    ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr.
  • Supplementary Table S2

    Supplementary Table S2

    1-high in cerebrotropic Gene P-value patients Definition BCHE 2.00E-04 1 Butyrylcholinesterase PLCB2 2.00E-04 -1 Phospholipase C, beta 2 SF3B1 2.00E-04 -1 Splicing factor 3b, subunit 1 BCHE 0.00022 1 Butyrylcholinesterase ZNF721 0.00028 -1 Zinc finger protein 721 GNAI1 0.00044 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 GNAI1 0.00049 1 Guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1 PDE1B 0.00069 -1 Phosphodiesterase 1B, calmodulin-dependent MCOLN2 0.00085 -1 Mucolipin 2 PGCP 0.00116 1 Plasma glutamate carboxypeptidase TMX4 0.00116 1 Thioredoxin-related transmembrane protein 4 C10orf11 0.00142 1 Chromosome 10 open reading frame 11 TRIM14 0.00156 -1 Tripartite motif-containing 14 APOBEC3D 0.00173 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3D ANXA6 0.00185 -1 Annexin A6 NOS3 0.00209 -1 Nitric oxide synthase 3 SELI 0.00209 -1 Selenoprotein I NYNRIN 0.0023 -1 NYN domain and retroviral integrase containing ANKFY1 0.00253 -1 Ankyrin repeat and FYVE domain containing 1 APOBEC3F 0.00278 -1 Apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F EBI2 0.00278 -1 Epstein-Barr virus induced gene 2 ETHE1 0.00278 1 Ethylmalonic encephalopathy 1 PDE7A 0.00278 -1 Phosphodiesterase 7A HLA-DOA 0.00305 -1 Major histocompatibility complex, class II, DO alpha SOX13 0.00305 1 SRY (sex determining region Y)-box 13 ABHD2 3.34E-03 1 Abhydrolase domain containing 2 MOCS2 0.00334 1 Molybdenum cofactor synthesis 2 TTLL6 0.00365 -1 Tubulin tyrosine ligase-like family, member 6 SHANK3 0.00394 -1 SH3 and multiple ankyrin repeat domains 3 ADCY4 0.004 -1 Adenylate cyclase 4 CD3D 0.004 -1 CD3d molecule, delta (CD3-TCR complex) (CD3D), transcript variant 1, mRNA.
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation

    Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation

    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
  • Construction of an Mirna‑Gene Regulatory Network in Colorectal Cancer Through Integrated Analysis of Mrna and Mirna Microarrays

    Construction of an Mirna‑Gene Regulatory Network in Colorectal Cancer Through Integrated Analysis of Mrna and Mirna Microarrays

    MOLECULAR MEDICINE REPORTS 18: 5109-5116, 2018 Construction of an miRNA‑gene regulatory network in colorectal cancer through integrated analysis of mRNA and miRNA microarrays JUN HU, XIN YUE, JIANZHONG LIU and DALU KONG Department of Colorectal Cancer Surgery, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin's Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, P.R. China Received December 19, 2017; Accepted August 8, 2018 DOI: 10.3892/mmr.2018.9505 Abstract. The aim of the present study was to identify poten- Introduction tial biomarkers associated with colorectal cancer (CRC). The GSE32323 and GSE53592 mRNA and microRNA (miRNA) Colorectal cancer (CRC) is a common malignancy that ranks expression profiles were selected from the Gene Expression as the second leading cause of cancer-associated mortality in Omnibus database. The differentially expressed genes (DEGs) men and women in the USA (1). Despite improvements in CRC and differentially expressed miRNAs (DEMs) in CRC tissue therapy, CRC remains a major public health problem, and it is samples compared with surrounding control tissue samples estimated that there are 1,000,000 individuals suffering from (DEGs-CC), and DEGs in cells treated with 5-aza-2'-de- CRC worldwide, with the mortality rate is as high as ~50% in oxycitidine compared with untreated cells (DEGs-TC) certain developed countries (2). The tumor stage is the most were identified with the Limma package. The Database for important prognostic indicator for CRC. However, the tumors Annotation, Visualization and Integrated Discovery was used are often diagnosed at an intermediate or late stage, and the to conduct the functional and pathways enrichment analysis.
  • Introduction to the Rh Blood Group.Pdf

    Introduction to the Rh Blood Group.Pdf

    Introduction to the Rhesus Blood Group Justin R. Rhees, M.S., MLS(ASCP)CM, SBBCM University of Utah Department of Pathology Medical Laboratory Science Program Objectives 1. Describe the major Rhesus (Rh) blood group antigens in terms of biochemical structure and inheritance. 2. Describe the characteristics of Rh antibodies. 3. Translate the five major Rh antigens, genotypes, and haplotypes from Fisher-Race to Wiener nomenclature. 4. State the purpose of Fisher-Race, Wiener, Rosenfield, and ISBT nomenclatures. Background . How did this blood group get its name? . 1937 Mrs. Seno; Bellevue hospital . Unknown antibody, unrelated to ABO . Philip Levine tested her serum against 54 ABO-compatible blood samples: only 13 were compatible. Rhesus (Rh) blood group 1930s several cases of Hemolytic of the Fetus and Newborn (HDFN) published. Hemolytic transfusion reactions (HTR) were observed in ABO- compatible transfusions. In search of more blood groups, Landsteiner and Wiener immunized rabbits with the Rhesus macaque blood of the Rhesus monkeys. Rhesus (Rh) blood group 1940 Landsteiner and Wiener reported an antibody that reacted with about 85% of human red cell samples. It was supposed that anti-Rh was the specificity causing the “intragroup” incompatibilities observed. 1941 Levine found in over 90% of erythroblastosis fetalis cases, the mother was Rh-negative and the father was Rh-positive. Rhesus macaque Rhesus (Rh) blood group Human anti-Rh and animal anti- Rh are not the same. However, “Rh” was embedded into blood group antigen terminology. The
  • 2021 Code Changes Reference Guide

    2021 Code Changes Reference Guide

    Boston University Medical Group 2021 CPT Code Changes Reference Guide Page 1 of 51 Background Current Procedural Terminology (CPT) was created by the American Medical Association (AMA) in 1966. It is designed to be a means of effective and dependable communication among physicians, patients, and third-party payers. CPT provides a uniform coding scheme that accurately describes medical, surgical, and diagnostic services. CPT is used for public and private reimbursement systems; development of guidelines for medical care review; as a basis for local, regional, and national utilization comparisons; and medical education and research. CPT Category I codes describe procedures and services that are consistent with contemporary medical practice. Category I codes are five-digit numeric codes. CPT Category II codes facilitate data collection for certain services and test results that contribute to positive health outcomes and quality patient care. These codes are optional and used for performance management. They are alphanumeric five-digit codes with the alpha character F in the last position. CPT Category III codes represent emerging technologies. They are alphanumeric five-digit codes with the alpha character T in the last position. The CPT Editorial Panel, appointed by the AMA Board of Trustees, is responsible for maintaining and updating the CPT code set. Purpose The AMA makes annual updates to the CPT code set, effective January 1. These updates include deleted codes, revised codes, and new codes. It’s important for providers to understand the code changes and the impact those changes will have to systems, workflow, reimbursement, and RVUs. This document is meant to assist you with this by providing a summary of the changes; a detailed breakdown of this year’s CPT changes by specialty, and HCPCS Updates for your reference.