DOCSLIB.ORG

Studying Gene Function Analysis in 3D Tumor Microtissue Models

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Studying Gene Function Analysis in 3D Tumor Microtissue Models Studying gene function analysis in 3D tumor microtissue models Jens M. Kelm, CSO and Co-founder InSphero AG March 2014 Image provided by ELRIG 2014, Telford PerkinElmer www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 1 "Target validation is one of the most pressing problems in pharmaceutical R&D. Many industry experts believe that without additional well-validated targets, pharmaceutical companies are unlikely to be able to maintain current levels of profitability." From the executive summary of Post-Genomic Target Validation: Next Generation Approaches and Tools for Optimizing Target Selection. www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 2 Target discovery and validation is a tricky business Prinz et al. Nature Reviews drug discovery 2011 www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 3 However, there are still some targets to be discovered Whole genome Druggable genome Drug Targets Disease modifying genes ~3’000 600-1’500 ~3’000 www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 4 Why using a 3D model for target discovery/validation • 3D environment reflects more closely the in vivo situation • Differential gene expression in 3D models • Long term effects can be monitored • Co-culture systems with selective knock down combinations can be evaluated www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 5 Increasing complexity of 3D models Drug – Cell response Drug – Tissue response Drug – human response Physiological drug response Drug – Organ response www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 6 Advancing cell-based assays Better in vitro Biology for better compound de-risking Resembling native-like cell functionality to improve predictive power of cell-based assays. www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 7 A vast variety of cell types impact tumor progression Thoma et al. 2014, ADDR www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 8 The tumor microenvironment Thoma et al. 2014, ADDR www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 9 Environment determined cell phenotype Cell-cell ECM contacts Shape Tension Behavior Differentiation Cellular signalling Morphology Apoptosis Drug metabolism Response to stimuli Viability Gene expression Proliferation www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 10 Fibrosarcoma 3D vs. 2D: 1000 Genes were differentially expressed CRH CCL20 ARV1 LTBP2 L3MBTL2 SLC40A1 PRDM16 WWOX PADI2 LOC160313 BDH1 ALCAM FLJ32363 THC2455353 ENST00000372066 LOH3CR2A KBTBD4 CHODL LMNB1 SLC22A3 SETBP1 GGTLA1 PLK2 CLEC3B LRRC17 ARRDC4 STAT4 ZMAT4 PER1 LOC124220 MFAP5 ENST00000381889 KIAA1324L CSPG2 SLC2A12 ZBTB26 GABRA1 CTDSP1 KY SH3TC2 ZNF659 LOC399818 PVRL4 LMOD1 MICALCL ENST00000267857 BARX1 CHRM2 ALOX15B SLC16A6 XYLB PEG3 FMO3 PLXNA4A NPR3 KYNU SETBP1 ZNF541 SHROOM3 CHDH LGALS2 MTHFD2L GPC3 BAPX1 AQP1 SOLH WISP2 PALM2 ENST00000382496 PSCDBP DMKN FLJ23577 SPINT2 ZNF396 SERPINB9 CLIC3 LAYN KLF17 ENST00000351050 MTHFD2L GALP FABP3 ENST00000374465 PLEKHA6 CTGF CHID1 KIF6 APLN SBEM SPINT1 ZNF365 OXTR SERPINB7 FBLN5 EXTL1 LDHD WSB1 MARS2 PDGFRA CHN1 KIF26B ZFP36L2 GLT8D2 GENX-3414 MYLK BIRC5 ANXA10 FLJ25076 SEMA6D GIMAP7 PTN ARHGAP29 MSRB3 LPPR4 CCBP2 KLF4 FBLN2 ABCC2 KIF26A MGC23985 ZFP28 ARHGAP29 ENST00000297812 ETNK2 SEMA6D THC2410279 MT1F PSAT1 CXCL3 KLF4 ANKRD38 OVGP1 GAL CFHR1 EPB49 KIF20A SCUBE3 WFDC8 ZNF192 ARHGAP29 PLCE1 CXCL12 SEPP1 MPPED2 FBLN1 DCAMKL1 KM-HN-1 ANLN SCUBE2 PLEKHN1 CFH EPB41L4B KLRA1 MAF ZSCAN2 ARHGAP29 PLA2G4A CXCL12 SLIC1 PRR16 GLT25D2 DKFZP434K028 SHOX MAF DEPDC6 EBI2 CCRL1 KIF5A KRT33B ANGPTL5 WWC1 OSAP ARHGAP26 GPR56 PDE9A SHOX SFRP4 MN1 DENND2A EPGN KRTAP1-5 MAF PDE5A MYL4 CCL28 KIAA1706 ANGPT1 WNK4 OLFML2A ARHGAP20 FNDC1 SH3MD4 SFRP1 VGLL3 EREG CCL26 MPP7 GLDC THC2283106 PDE5A CFD KIAA1576 KRTAP1-1 SHANK2 VGCNL1 DKFZP586H2123 EDN1 CCL2 AMOTL2 SSPO VAV3 PGBD3 MAGI1 GPR15 PDE4B JPH3 MYBL1 C5AR1 KIAA1189 SHANK2 THC2266401 THC2341407 C9orf47 FIGF SCIN KCND2 FLRT3 PDE2A IQCD AR OCRL MCAM DENND2D STAC UACA VIT THC2355280 BC040293 EDG1 CENPM KIAA0367 STMN2 FGFR2 PDE2A ITGA8 ALS2CR19 SH2D4A MMP7 MYH7B CRABP2 GALNTL1 VDR PHKG1 THC2441058 GPR126 ESM1 KRT7 RUNX1T1 THC2249196 PIGW ITGA7 SAA1 VIL2 MMP13 CSF1R EFEMP1 CDCA7 AOC3 UGCG NCF2 THC2290974 GDPD5 PPAP2B KRT16 SPINK5L3 RSPO3 CDC42EP3 CDON ITGA6 UBE2A UBE2C MMP12 FGF9 DNER ENPP2 ACCN2 THC2405019 PTHLH CABLES1 KRT19 SPINK6 RGNEF SLC8A1 STARD5 ITGA4 USP36 TNFAIP6 MMP1 LOC653579 MYLIP AUTS2 SPINK4 THC2279505 PNMA2 CD86 ALPK2 RDH5 TNFRSF11B PHGDH GPR124 ENPP1 KARCA1 IER3 TPM1 MGP CATSPER3 PALMD COL24A1 CD36 AX721193 ENST00000254846 GK KCNRG TNFRSF10D ENTPD3 KATNAL2 HAPLN1 A2M SEMA7A TPM1 NTF3 MATN2 CEACAM3 PCAF COL11A1 CD36 KCNJ8 THC2284074 FGF18 ENC1 RMND5A OSBPL10 CITED2 KALRN HCFC1R1 SEMA5A TRIM64 GPR1 DLL1 GJE1 TRIB2 SLC4A1 THC2381954 MAN1C1 THC2317149 E2F7 CITED2 AL050204 SPP2 RGS16 TRIM63 SPBC25 OGFRL1 MYPN JAM2 TMEM16B BC040628 MASP1 DMD ALPL Similar to LOC166173 ENST00000374279 OLFML3 CTSH RFPL3S SCARA3 RIMS1 TREM1 FGF12 ABCA13 IL24 TMEM136 BC042064 ME3 DUSP6 CTNNAL1 AKR1C1 SCARA3 NMU GK THC2364375 OLFML1 C16orf74 ROR1 TRPC4 TMPRSS2 DLC1 DOC1 KIAA0101 IL11 S100A7 BC031013 C6orf134 FRY OSR1 BCAN ENST00000375486 ROR1 TAGLN TRPM6 SLC2A5 THC2442727 COL11A1 DSCR1L1 CPM IL1B RBMS3 BC018597 MFSD2 FGF1 NR3C2 BMPY TGFBR3 DKFZP564J102 CPE AKR1C1 RBMS3 RRAD TAGLN3 PDE1C SAT1 THC2364604 NR2F2 COL7A1 IFIT2 ENST00000308537 MEF2B HOXA13 KCNJ2 TLE2 ABCC9 CPA4 RNF43 RASD1 GFPT2 THC2282719 NEK10 DHRS3 IFIT1 AKR1B10 TTRAP NXPH3 ENST00000381498 MAB21L2 DAAM2 CPA2 HCG18 RGMB RASEF TRAPPC6A FGF1 UNQ6975 COL5A1 ENST00000313624 SHROOM2 CAP2 ITGBL1 AKR1B1 TLR5 SLC1A6 LOX FZD4 DLG7 HDAC9 RECK RORA TOP2A NEXN DEFB103A CT45-5 TNIP3 SERPINB2 FGL2 DDAH1 ITGA2 HSPG2 AOX1 RECK LEF1 THC2279115 ELN RALGPS2 TLL2 PITPNC1 COL4A4 CAMKK1 RARRES1 TK1 ENST00000374334 SMOC2 DDAH1 HMCN1 LHCGR THC2281591 HNT CAMK2B ITGA11 LOC652408 AI094165 THY1 TOX NXPH3 GAD1 COL4A2 DPYD RGS4 ENST00000278934 HNT HHIP THBS2 LUM THC2278340 CACNB4 IGFBP4 REEP2 PCP4 THSD4 FHL1 DAPK1 DPCR1 ALDH7A1 SLC1A7 ENST00000252773 NPAS1 CACNA1E HECW2 THBS2 AIM1 FBN2 IGFBP3 RCSD1 PTPRB THSD4 THC2314434 COL4A1 DKK3 PPARGC1B PXMP2 THC2305303 NMB CDH23 HECW2 KCNK10 THBS1 LUM FST IGFBP3 RHOJ PPP1R3C COL4A1 DKK2 CDH4 THC2375853 SMOC1 THC2314177 NEUROG1 HSPB6 ADH6 RHOH TXNIP THBD CNN2 LUM DKK1 NEF3 CCBE1 CDH4 IGFBP2 PRSS35 TXNIP THC2340803 GCNT3 THC2439806 HSPB7 RASSF2 TSPAN18 DIAPH3 CDH18 AGC1 SCN3A ACTA2 FRMD4B NFASC CCDC3 IGF2 PRSS23 TSGA10 THC2438709 HSPB3 P2RY6 TIAM2 THC2363646 DFNB31 CDH13 ADM2 LHFP FRMD4A NCALD CCDC11 INPP4B PRPF18 PRSS23 TES ADAMTSL4 THC2440554 DDX10 CADPS HPR TBC1D22B FLJ35934 THC2337721 NRXN3 TAF5 LIN7A COPZ2 ADM PCDHB15 PRSS12 ENST00000375855 ABCA6 C1QTNF7 INHBB H1F0 MGAM SLIT3 GCNT1 NEDD9 PRG1 SYTL2 ABLIM1 BU537617 ATP5J C1QTNF3 PTGS2 THC2378571 SP5 DPF3 IGKC HFKH4 ADRA2A SNTB1 SLIT3 NTN4 PRSS7 STS LSAMP THC2275252 F2RL2 BCAS1 PSG2 ENST00000372493 HSPA6 NTN1 CRLF1 HSD11B1 CCDC13 SAMD3 SNTB1 ADRA1B PTGIS SLIT2 ABI3BP BRCA2 PSG4 FLJ34870 ADAMTS5 F2R CYP27B1 GNGT1 ST6GALNAC5 THC2429183 NAPG BDNF HAS1 PTGDS STXBP3 FBXO25 AK5 SLIT2 LDB2 NOV CLPB CYB5A GNG4 PCSK1N PSG9 SOX17 PSORS1C2 ADAMTS2 BDKRB1 surfactant associated protein F SYNPO2L GLI1 CRIM1 ADAMTSL1 PCSK1 LMO7 MRVI1 AF052152 BMP2 GNG3 PSG1 SPHK1 SYNGR1 LOC728215 THC2251316 SSTR1 ADAMTS1 HSPC159 CST6 PPBPL2 SYNE2 LMCD1 MEGF6 BF803942 BST1 GNB5 ADAMTSL1 PSG8 SNED1 LOC123688 PPP1R14A FBXW2 CDKN3 THC2411387 MUC16 BMPER HGD PRELP SYNE2 LINCR GINS2 U79293 GDF15 PSG6 SUSD2 THC2400121 CNNM4 ADAMTS14 PRRG4 LOC399947 ATF6 MOP-1 BHMT AF086187 SPANXD LIG4 SLC8A1 CLDN14 GAS6 PSG3 SRXN1 ENST00000311208 CCNI BZRAP1 ACVRL1 OKL38 SPANXA1 FADS1 MKX H19 LOC399947 CDC42EP3 CLDN11 GADD45B PRDM1 HLA-DRB1 LTC4S CUTL1 BCL7A PSG11 SORT1 SULF2 GSG1 MAP2K6 ASNS DIAPH3 ZCCHC12 ENST00000327469 LIF ENST00000328043 ABCA4 BCL2 GREM2 PBEF1 KCNS1 SLC7A11 STMN2 THC2270231 THC2379364 MITF ARNT2 ADRA2C ARC LPAAT-THETA PBEF1 SLC7A14 LOC388503 KCTD16 AVLL5809 STMN1 HTR2B GATA6 LRRC2 LIMS2 Kelm et al. 2010 J Biotechnol. www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 11 Automation-compatible 3D Microtissue culture in hanging drops Seeding After 1 hour After 2-4 days Tumor tissue Medium/air interface Cells Medium www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 12 From single to multi-cell type tumor microtissues Cell line-derived colon cancer microtissue HCT116 HCT116:Fibroblasts HCT116:Fibroblasts:EC EGFR Vimentin CD31 www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 13 GravityTRAP: Tissue Receiver and Assay Plate www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 14 Long term effects: tumor reoccurrence 1.1 Gem+Doc-100+10 Gem-100 Doc-10 1 0 5 10 15 20 Time [d] 0.9 0.8 0.7 Relatie Diameter to CTR (um/um)) CTR to Diameter Relatie 0.6 0.5 In collaboration with Physiomics www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 15 Endpoints for phenotypic target validation Automation CompatibilityAutomation Qualitative and Gross morphology quantitative Multiplate reader Quantitative (requires reporter) Qualitative, High content quantitative and spatial information Qualitative and spatial Histology Information information www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 16 Reporter systems TRANSFECTION OF MICROTISSUES www.insphero.com | ELRIG 2014, Telford | Gene Function Analysis 17 Transduction of microtissues effects only outer cell rim Monolayer Microtissue 0.5 0.4 Microtissue U/cell) 0.3 m 0.2 Monolayer SAMY ( SAMY 0.1 0.0
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • CD Markers Are Routinely Used for the Immunophenotyping of Cells
    ptglab.com 1 CD MARKER ANTIBODIES www.ptglab.com Introduction The cluster of differentiation (abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules. So-called CD markers are routinely used for the immunophenotyping of cells. Despite this use, they are not limited to roles in the immune system and perform a variety of roles in cell differentiation, adhesion, migration, blood clotting, gamete fertilization, amino acid transport and apoptosis, among many others. As such, Proteintech’s mini catalog featuring its antibodies targeting CD markers is applicable to a wide range of research disciplines. PRODUCT FOCUS PECAM1 Platelet endothelial cell adhesion of blood vessels – making up a large portion molecule-1 (PECAM1), also known as cluster of its intracellular junctions. PECAM-1 is also CD Number of differentiation 31 (CD31), is a member of present on the surface of hematopoietic the immunoglobulin gene superfamily of cell cells and immune cells including platelets, CD31 adhesion molecules. It is highly expressed monocytes, neutrophils, natural killer cells, on the surface of the endothelium – the thin megakaryocytes and some types of T-cell. Catalog Number layer of endothelial cells lining the interior 11256-1-AP Type Rabbit Polyclonal Applications ELISA, FC, IF, IHC, IP, WB 16 Publications Immunohistochemical of paraffin-embedded Figure 1: Immunofluorescence staining human hepatocirrhosis using PECAM1, CD31 of PECAM1 (11256-1-AP), Alexa 488 goat antibody (11265-1-AP) at a dilution of 1:50 anti-rabbit (green), and smooth muscle KD/KO Validated (40x objective). alpha-actin (red), courtesy of Nicola Smart. PECAM1: Customer Testimonial Nicola Smart, a cardiovascular researcher “As you can see [the immunostaining] is and a group leader at the University of extremely clean and specific [and] displays Oxford, has said of the PECAM1 antibody strong intercellular junction expression, (11265-1-AP) that it “worked beautifully as expected for a cell adhesion molecule.” on every occasion I’ve tried it.” Proteintech thanks Dr.
    [Show full text]
  • Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
    Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase
    [Show full text]
  • Construction of an Mirna‑Gene Regulatory Network in Colorectal Cancer Through Integrated Analysis of Mrna and Mirna Microarrays
    MOLECULAR MEDICINE REPORTS 18: 5109-5116, 2018 Construction of an miRNA‑gene regulatory network in colorectal cancer through integrated analysis of mRNA and miRNA microarrays JUN HU, XIN YUE, JIANZHONG LIU and DALU KONG Department of Colorectal Cancer Surgery, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy of Tianjin, Tianjin's Clinical Research Center for Cancer, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, P.R. China Received December 19, 2017; Accepted August 8, 2018 DOI: 10.3892/mmr.2018.9505 Abstract. The aim of the present study was to identify poten- Introduction tial biomarkers associated with colorectal cancer (CRC). The GSE32323 and GSE53592 mRNA and microRNA (miRNA) Colorectal cancer (CRC) is a common malignancy that ranks expression profiles were selected from the Gene Expression as the second leading cause of cancer-associated mortality in Omnibus database. The differentially expressed genes (DEGs) men and women in the USA (1). Despite improvements in CRC and differentially expressed miRNAs (DEMs) in CRC tissue therapy, CRC remains a major public health problem, and it is samples compared with surrounding control tissue samples estimated that there are 1,000,000 individuals suffering from (DEGs-CC), and DEGs in cells treated with 5-aza-2'-de- CRC worldwide, with the mortality rate is as high as ~50% in oxycitidine compared with untreated cells (DEGs-TC) certain developed countries (2). The tumor stage is the most were identified with the Limma package. The Database for important prognostic indicator for CRC. However, the tumors Annotation, Visualization and Integrated Discovery was used are often diagnosed at an intermediate or late stage, and the to conduct the functional and pathways enrichment analysis.
    [Show full text]
  • Association of Imputed Prostate Cancer Transcriptome with Disease Risk Reveals Novel Mechanisms
    Corrected: Author Correction ARTICLE https://doi.org/10.1038/s41467-019-10808-7 OPEN Association of imputed prostate cancer transcriptome with disease risk reveals novel mechanisms Nima C. Emami1,2, Linda Kachuri2, Travis J. Meyers2, Rajdeep Das3,4, Joshua D. Hoffman2, Thomas J. Hoffmann 2,5, Donglei Hu 5,6,7, Jun Shan8, Felix Y. Feng3,4,7, Elad Ziv5,6,7, Stephen K. Van Den Eeden 3,8 & John S. Witte1,2,3,5,7 1234567890():,; Here we train cis-regulatory models of prostate tissue gene expression and impute expression transcriptome-wide for 233,955 European ancestry men (14,616 prostate cancer (PrCa) cases, 219,339 controls) from two large cohorts. Among 12,014 genes evaluated in the UK Biobank, we identify 38 associated with PrCa, many replicating in the Kaiser Permanente RPGEH. We report the association of elevated TMPRSS2 expression with increased PrCa risk (independent of a previously-reported risk variant) and with increased tumoral expression of the TMPRSS2:ERG fusion-oncogene in The Cancer Genome Atlas, suggesting a novel germline-somatic interaction mechanism. Three novel genes, HOXA4, KLK1, and TIMM23, additionally replicate in the RPGEH cohort. Furthermore, 4 genes, MSMB, NCOA4, PCAT1, and PPP1R14A, are associated with PrCa in a trans-ethnic meta-analysis (N = 9117). Many genes exhibit evidence for allele-specific transcriptional activation by PrCa master-regulators (including androgen receptor) in Position Weight Matrix, Chip-Seq, and Hi-C experimental data, suggesting common regulatory mechanisms for the associated genes. 1 Program in Biological and Medical Informatics, University of California San Francisco, San Francisco, CA 94158, USA.
    [Show full text]
  • Disease-Induced Modulation of Drug Transporters at the Blood–Brain Barrier Level
    International Journal of Molecular Sciences Review Disease-Induced Modulation of Drug Transporters at the Blood–Brain Barrier Level Sweilem B. Al Rihani 1 , Lucy I. Darakjian 1, Malavika Deodhar 1 , Pamela Dow 1 , Jacques Turgeon 1,2 and Veronique Michaud 1,2,* 1 Tabula Rasa HealthCare, Precision Pharmacotherapy Research and Development Institute, Orlando, FL 32827, USA; [email protected] (S.B.A.R.); [email protected] (L.I.D.); [email protected] (M.D.); [email protected] (P.D.); [email protected] (J.T.) 2 Faculty of Pharmacy, Université de Montréal, Montreal, QC H3C 3J7, Canada * Correspondence: [email protected]; Tel.: +1-856-938-8697 Abstract: The blood–brain barrier (BBB) is a highly selective and restrictive semipermeable network of cells and blood vessel constituents. All components of the neurovascular unit give to the BBB its crucial and protective function, i.e., to regulate homeostasis in the central nervous system (CNS) by removing substances from the endothelial compartment and supplying the brain with nutrients and other endogenous compounds. Many transporters have been identified that play a role in maintaining BBB integrity and homeostasis. As such, the restrictive nature of the BBB provides an obstacle for drug delivery to the CNS. Nevertheless, according to their physicochemical or pharmacological properties, drugs may reach the CNS by passive diffusion or be subjected to putative influx and/or efflux through BBB membrane transporters, allowing or limiting their distribution to the CNS. Drug transporters functionally expressed on various compartments of the BBB involve numerous proteins from either the ATP-binding cassette (ABC) or the solute carrier (SLC) superfamilies.
    [Show full text]
  • Identification of GLUT12/SLC2A12 As a Urate Transporter That
    Identification of GLUT12/SLC2A12 as a urate BRIEF REPORT transporter that regulates the blood urate level in hyperuricemia model mice Yu Toyodaa,1, Tappei Takadaa,1,2, Hiroshi Miyataa,1, Hirotaka Matsuob, Hidetoshi Kassaic, Kazuki Nakaoc, Masahiro Nakatochid, Yusuke Kawamurab, Seiko Shimizub, Nariyoshi Shinomiyab, Kimiyoshi Ichidae, Makoto Hosoyamadaf, Atsu Aibac, and Hiroshi Suzukia aDepartment of Pharmacy, The University of Tokyo Hospital, Bunkyo-ku, 113-8655 Tokyo, Japan; bDepartment of Integrative Physiology and Bio-Nano Medicine, National Defense Medical College, Tokorozawa, 359-8513 Saitama, Japan; cLaboratory of Animal Resources, Center for Disease Biology and Integrative Medicine, Graduate School of Medicine, The University of Tokyo, Bunkyo-ku, 113-0033 Tokyo, Japan; dDivision of Public Health Informatics, Department of Integrative Health Science, Nagoya University Graduate School of Medicine, 461-8673 Nagoya, Japan; eDepartment of Pathophysiology, Tokyo University of Pharmacy and Life Sciences, Hachioji, 192-0392 Tokyo, Japan; and fDepartment of Human Physiology and Pathology, Faculty of Pharma-Sciences, Teikyo University, Itabashi-ku, 173-8605 Tokyo, Japan Edited by Francisco Bezanilla, The University of Chicago, Chicago, IL, and approved June 29, 2020 (received for review April 14, 2020) Recent genome-wide association studies have revealed some ge- affected the urate transport activity of GLUT12 (Fig. 1D); netic loci associated with serum uric acid levels and susceptibility GLUT12 is more active at lower pH (Fig. 1E). As GLUT12- to gout/hyperuricemia which contain potential candidates of mediated urate uptake increased linearly with time over physiologically important urate transporters. One of these novel 10 min (Fig. 1F), uptake at 5 min was evaluated in subsequent loci is located upstream of SGK1 and SLC2A12, suggesting that kinetic analysis.
    [Show full text]
  • Binding of Pregnancy-Specific Glycoprotein 17 to CD9 On
    Binding of pregnancy-specific glycoprotein 17 to CD9 on macrophages induces secretion of IL-10, IL-6, PGE2, ␤ and TGF- 1 Cam T. Ha,* Roseann Waterhouse,* Jennifer Wessells,† Julie A. Wu,* and Gabriela S. Dveksler*,1 *Department of Pathology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; and †Laboratory of Protein Dynamics and Signaling, National Cancer Institute-Frederick, Maryland Abstract: Pregnancy-specific glycoproteins (PSGs) inally isolated from the circulation of pregnant women [1]. are a family of secreted proteins produced by the PSGs are detected in maternal blood as early as 7 days post- placenta, which are believed to have a critical role implantation. The serum levels of these proteins reach up to in pregnancy success. Treatment of monocytes 200–400 ␮g/ml at term, far exceeding the concentration of with three members of the human PSGs induces human chorionic gonadotropin and ␣ fetoprotein [2]. Treatment interleukin (IL)-10, IL-6, and transforming growth of monkeys and mice with anti-PSG antibodies resulted in ␤ ␤ factor- 1 (TGF- 1) secretion. To determine whether spontaneous abortion [3, 4], and abnormally low levels of PSGs human and murine PSGs have similar functions are associated with several serious complications of pregnancy, and use the same receptor, we treated wild-type including fetal hypoxia, fetal growth retardation, pre-eclamp- and CD9-deficient macrophages with murine sia, and spontaneous abortion [5–8]. PSG homologues have PSG17N and human PSG1 and -11. Our data show been identified in mice, rats, and primates [9–11]. that murine PSG17N induced secretion of IL-10, We have previously shown that treatment of human mono- ␤ IL-6, prostaglandin E2, and TGF- 1 and that CD9 cytes with recombinant human (rh)PSG1, PSG6, and PSG11 expression is required for the observed induction induced the production of anti-inflammatory cytokines [12].
    [Show full text]
  • Roles for the Uptake 2 Transporter OCT3 in Regulation Of
    Marquette University e-Publications@Marquette Biomedical Sciences Faculty Research and Publications Biomedical Sciences, Department of 2-2019 Roles for the Uptake2 Transporter OCT3 in Regulation of Dopaminergic Neurotransmission and Behavior Paul J. Gasser Marquette University, [email protected] Follow this and additional works at: https://epublications.marquette.edu/biomedsci_fac Part of the Neurosciences Commons Recommended Citation Gasser, Paul J., "Roles for the Uptake2 Transporter OCT3 in Regulation of Dopaminergic Neurotransmission and Behavior" (2019). Biomedical Sciences Faculty Research and Publications. 191. https://epublications.marquette.edu/biomedsci_fac/191 Marquette University e-Publications@Marquette Biomedical Sciences Faculty Research and Publications/College of Health Sciences This paper is NOT THE PUBLISHED VERSION; but the author’s final, peer-reviewed manuscript. The published version may be accessed by following the link in the citation below. Neurochemistry International, Vol. 123, (February 2019): 46-49. DOI. This article is © Elsevier and permission has been granted for this version to appear in e-Publications@Marquette. Elsevier does not grant permission for this article to be further copied/distributed or hosted elsewhere without the express permission from Elsevier. Roles for the Uptake2 Transporter OCT3 in Regulation of Dopaminergic Neurotransmission and Behavior Paul J. Gasser Department of Biomedical Sciences, Marquette University, Milwaukee, WI Abstract Transporter-mediated uptake determines the
    [Show full text]