A Gathering of Nobel Laureates: Science for the 21st Century

Foreword

As you turn the pages this Curriculum Guide today, look up for a moment and consider that somewhere, in a laboratory or at a blackboard or computer keyboard, a young person is hard at work pursuing the path that may lead eventually to one of the highest honors civilization can bestow—a Nobel Prize.

The path that this young man or woman will travel is both difficult and long. Over the course of the journey, the rapid advance of science will most likely transform the world again and again. Like the Laureates, who have accepted the invitation to come and talk with Mecklenburg students, our bright young scientist will be inspired by the giants of science and by the wonders of the natural world. This shooting star will be steered in its trajectory by the encouragement and influence of family, the impact of war and other world events, by school experiences and probably by the powerful guidance and support of a mentor who is equipped and determined to discern the spark of brilliance and fan it into a flame of discovery.

Those flames shine bright among our guests. By studying fruit-fly genes, Christiane Nüsslein-Volhard and her colleagues (Edward Lewis and Eric Wiechaus) helped us understand a critical step in early embryonic development that helps explain how birth defects happen. Douglas Osheroff, Robert Richardson and David Lee devised ingenious experiments at near-absolute-zero temperatures, revealing phase transitions that connect the micro- and macroscopic worlds. Edmond Fischer (with Edwin Krebs) spent years burrowing down into the complex chemical processes of the cell to isolate a fundamental step called reversible protein phosphorylation, which is crucial to medical challenges from cancer treatment to keeping the body from rejecting transplanted organs. Günter Blobel, arriving at Rockefeller University just as a new phase of work on cell structure and function was beginning, managed to sort out both how large proteins cross intracellular membranes and how they get to the right location in the cell.

But the lives of our visiting Laureates and of physicist Anders Bárány, keeper of the great Nobel traditions, remind us that this is only a part of the story. Science is driven by curiosity, but a great scientist is driven to persevere along the difficult path to discovery by a commitment to humanity, a sense of the ennobling power of science and a vision of the great potential for service that lies in scientific breakthrough. The Nobel Prize does not crown a scientific career; rather, the Prize challenges its recipients to work still harder—to find ways to use science to improve our understanding of our world and one another, solve the world’s critical problems and expand our vision of the human potential.

Science is a search for the understanding that comes from knowledge. Nobelists know that how we use that knowledge is what determines science’s contribution to the good of humankind and the planet we inhabit. They bring us not simply knowledge but a sense of its power, not just wisdom, but a reminder that the responsibility for thoughtful, just and humane use of our expanding knowledge is shared by us all.

Scientific Committee Co-Chairs The Honorable Jim Martin, Carolinas Health Care, Chemist and Former Governor of North Carolina Rosalind Reid, Editor, Sigma Xi, The Scientific Research Society, Editor, American Scientist

Scientific Steering Committee Dr. Cindy Moss, Charlotte Mecklenburg Schools, K-12 Science Curriculum Specialist Dr. David Royster, University of North Carolina at Charlotte, Center for Mathematics, Science and Technology Education Dr. Jack Sommer, Charlotte Area Science Network, Board of Directors

A Gathering of Nobel Laureates: Science for the 21st Century -1- Special thanks to our Scientific Committee

Co-Chairs The Honorable Jim Martin, Carolinas Health Care, Chemist, Former Governor of North Carolina, Rosalind Reid, Sigma Xi, The Scientific Research Society, Editor, American Scientist

Scientific Steering Committee Dr. Cindy Moss, Charlotte Mecklenburg Schools, K-12 Science Curriculum Specialist Dr. David Royster, University of North Carolina at Charlotte, Center for Mathematics, Science and Technology Education Dr. Jack Sommer, Charlotte Area Science Network, Board of Directors

Dr. Jimmie Agnew, Elon University Martin Baucom, Sigma Xi Debbie Beam, CMS, Berry Academy Robert Corbin, CMS, EE Waddell HS Jennifer Day, CMS, Butler HS Wayne Fisher, CMS, Myers Park HS Susan Foxx, CMS, Science Content Coach Mona Hedrick, CMS, East Mecklenburg HS Dr. Yvette Huet-Hudson, UNCC Dr. Francis Hughes, UNCC Fred Marsh, retired chemist Dr. Thomas Mathews, Sigma Xi Linda Mayfield, CMS, Science Content Coach Dr. Kimberly McKinney, Carolinas Medical Center Katherine Niemiec, CMS, EE Waddell HS Heather Plichta, CMS, EE Waddell HS Dr. Lowell Rayburn, Carolinas Medical Center Linda Simpson, UNCC, retired Jeff Steinmetz, Queens University Dr. Rosemarie Tong, UNCC Andrew Winter, UNCC graduate student

CMS – Charlotte Mecklenburg Schools

A Gathering of Nobel Laureates: Science for the 21st Century -2- The Echo Foundation 2004-2005

“A Gathering of Nobel Laureates: Science for the 21st Century”

Curriculum Guide Table of Contents Page

Project Timeline 5

Alfred Nobel, The Nobel Prize and Anders Bárány 7 School Partnership Team 10 Pre and Post Test 44

Günter Blobel 45 School Partnership Team 48 Pre and Post Test 97

Edmond Fischer 99 School Partnership Team 102 Pre and Post Test 122

Christiane Nüsslein-Volhard 123 School Partnership Team 126 Pre and Post Test 163

Douglas Osheroff & Robert Richardson 165 Douglas Osheroff School Partnership Teams 170 Robert Richardson School Partnership Teams 176 Pre and Post Test 210

Appendices The Light Factory 212 Contest Guidelines 216 Art Contest Entry Form 217 Photography Contest Entry Form 218 Essay Contest Entry Form 219 Poetry Contest Entry Form 220 About The Echo Foundation 221

A Gathering of Nobel Laureates: Science for the 21st Century -3- A Gathering of Nobel Laureates: Science for the 21st Century -4-

“A Gathering of Nobel Laureates: Science for the 21st Century”

Project Timeline

• School Partnership Workshop and Curriculum Orientation January 6, 2005 Curriculum Guides will be distributed to teachers and School Partnership Teams at Discovery Place.

• Tolerance Week – January 31 – February 7 – at six schools Tolerance Day at each school serves as a precursor to Student Dialogue Day. There will be both large and small breakout sessions with students in their School Partnership Teams. Students will be introduced to the work of their future Laureate Guest, The Echo Foundation and the activities involved in Student Dialogue Day.

TOLERANCE DAY HOST SCHOOLS LAUREATE GUEST Waddell High School Günter Blobel Harding University High School Edmond Fischer Butler High School Christiane Nüsslein-Volhard North Mecklenburg High School Douglas Osheroff Charlotte Country Day School Robert Richardson Providence High School Anders Bárány

• Student Dialogue Day – February 28, 2005 Students come to hear a presentation by their Laureate Guest followed by a Question and Answer session. Students are encouraged to have two well-considered questions written on note cards to ask the Laureate Guests.

STUDENT DIALOGUE DAY HOST SCHOOLS LAUREATE GUEST Myers Park High School Günter Blobel Hopewell High School Edmond Fischer Providence Day School Christiane Nüsslein-Volhard Vance High School Douglas Osheroff East Mecklenburg Robert Richardson Charlotte Latin School Anders Bárány

• LAUREATE HOST SCHOOLS LAUREATE GUEST Durham Academy Günter Blobel Berry Academy Edmond Fischer North Carolina School of Science & Mathematics Christiane Nüsslein-Volhard Independence High School Douglas Osheroff West Mecklenburg Robert Richardson Olympic High School Anders Bárány

Lee Bierer Project Manager The Echo Foundation

A Gathering of Nobel Laureates: Science for the 21st Century -5- A Gathering of Nobel Laureates: Science for the 21st Century -6- The Echo Foundation presents

“A Gathering of Nobel Laureates: Science for the 21st Century”

Alfred Nobel, The Nobel Prize and Anders Bárány

Senior Curator Nobel Museum

Stockholm, Sweden

Dr. Anders Bárány

Professor of Physics at Stockholm University and Senior Curator at the Nobel Museum. He has acted as Scientific Secretary to the Nobel Committee for Physics since 1990.

A Gathering of Nobel Laureates: Science for the 21st Century -7- A Gathering of Nobel Laureates: Science for the 21st Century -8- Alfred Nobel, The Nobel Prize and Anders Bárány Curriculum

Table of Contents Page

Bárány School Partnership Team 10

Anders Bárány – The Person 11

Alfred Nobel – The Man Behind the Prize 12 Classroom Connections 15

WebQuest – The Nobel Prize 15

Mock Debate – Nobel Prize Selection Profile A- Radiation 19 Profile B- Fission 20 Profile C- Nuclear Fusion 21

“The Nobel Prize and Einstein's Ghost” Article 25 Reading Questions 27 Discussion Questions 28

“A Nobel Too Far?” Article 29 Discussion Questions 30

“The Daily Yomiuri” Article 31 Discussion Questions 34

“The Role of Science and Technology in Future Design” Article 35 Reading & Discussion Questions 42

Pre and Post Test for Alfred Nobel, The Nobel Prize and Anders Bárány 44

A Gathering of Nobel Laureates: Science for the 21st Century -9- The Echo Foundation

Presents

2004-2005 Project A Gathering of Nobel Laureates: Science for the 21st Century

Laureate Guest

Dr. Anders Bárány

School Partnership Team Charlotte Latin School Olympic High School Providence High School

School Facilitators Mary Beth Harris Charlotte Latin School Emily Dulde Olympic High School Marva Hambacher Providence High School

Science Liaisons Ken Kneidel Charlotte Latin School Emily Dulde Olympic High School Dave Clark Providence High School

Curriculum Team Thomas Mathews*, Ph.D, Charleston Chapter Sigma Xi, South Carolina Department of Natural Resources, Associate Marine Biologist Emeritus Martin Baucom, Sigma Xi, The Scientific Research Society, Manager, Public Understanding of Science Program Jennifer Day, Charlotte Mecklenburg Schools, National Board Certification, Butler High School, Biology Teacher

* Curriculum Team Leader

A Gathering of Nobel Laureates: Science for the 21st Century -10- Anders Bárány – The Person

Biographical Sketch of Dr. Anders Bárány:

Dr. Bárány, born in 1942, received a Ph.D. in theoretical physics from Uppsala University in 1973. He was lecturer in physics at Uppsala from 1973-1987. During the 1980s he worked in Stockholm with the CRYRING project, a facility for low-energy atomic collisions with highly charged ions, which later became the Manne Siegbahn Laboratory, one of Sweden's four National Laboratories. At the Royal Swedish Academy of Sciences, Dr. Bárány was Executive Editor of the journal Physica Scripta 1988-96 and Scientific Secretary of the Nobel Committee for Physics 1989-2003. On leave of absence from his position as professor of Physics (since 1997) at Stockholm University, he has been Senior Curator of the Nobel Museum since 1999 and Deputy Museum Director since 2005.

The Manne Siegbahn Laboratory (MSL) is a research facility, hosted by Stockholm University. The laboratory is performing research and development in accelerator physics and is running the CRYRING facility for experiments in atomic and molecular physics. The activities at the laboratory also include the design and construction of the double electrostatic storage ring DESIREE.1

The Nobel Museum is a permanent home illustrating a century of Nobel Prize creativity. It has traveling exhibits, school programs, publications, and a highly-trained staff.

In an interesting twist, Dr. Bárány has even been the subject of comic book art. He is referenced in an on- line discussion of science comics.2 The author of Two-Fisted Science was contacted by Dr. Bárány after he discovered science comics existed, hence the reference to Dr. Bárány.

Dr. Bárány’s research interests include the following:

• The theory of atomic collisions • The theory of quasi-molecular ion-atom collisions • Charge transfer in slow collisions of highly-charged ions with atoms • Charge transfer in slow collisions of highly-charged ions with fullerenes • Charge transfer in slow collisions of highly-charged ions with surfaces.

1 http://www.msi.se/ 2 http://www.comicartville.com/sciencecomics.html

Recent publications: U. Thumm, A. Bárány, and H. Cederquist, Energy Gain in Collisions of Highly Charged Ions with C60, manuscript 1997

A. Bárány and C.J. Setterlind, Interaction of Slow Highly Charged Ions with 407, (1995)

A. Bárány and C.J. Setterlind, Interaction of slow highly charged ions with atoms, clusters and solids: a unified classical barrier approach, Nucl. Instrum. Meth. B 98, 184, (1995)

Anders Bárány, Theoretical collision physics of highly charged ions, AIP Conf. Proc. 205(1) 246 (01 Jun 1990).Surfaces, APH N.S., Heavy Ion Physics 1, 115, (1995)

C.J. Setterlind and A. Bárány, Theoretical study of image charge acceleration of highly charged ions in front of a metal surface, Nucl. Instrum. Meth. B 98,

A Gathering of Nobel Laureates: Science for the 21st Century -11-

Alfred Nobel – The Man Behind the Prize www.nobelprize.org

Alfred Nobel was born in 1833 in Stockholm, Sweden. His family was descended from Olof Rudbeck, the best-known technical genius of Sweden's 17th century era as a great power in northern Europe.Nobel invented dynamite in 1866 and later built up companies and laboratories in more than 20 countries all over the world. On November 27, 1895, Nobel signed his last will providing for the establishment of the Nobel Prize. He died of cerebral hemorrhage in his home in San Remo, Italy on December 10, 1896.

Alfred Nobel was born in Stockholm on October 21, 1833. His father Immanuel Nobel was an engineer and inventor who built bridges and buildings in Stockholm. In connection with his construction work Immanuel Nobel also experimented with different techniques for blasting rocks.

Alfred Nobel

Alfred's mother, born Andriette Ahlsell, came from a wealthy family. Due to misfortunes in his construction work caused by the loss of some barges of building material, Immanuel Nobel was forced into bankruptcy the same year Alfred Nobel was born. In 1837 Immanuel Nobel left Stockholm and his family to start a new career in Finland and in Russia. To support the family, Andriette Nobel started a grocery store, which provided a modest income. Meanwhile Immanuel Nobel was successful in his new enterprise in St. Petersburg, Russia. He started a mechanical workshop which provided equipment for the Russian army and he also convinced the Tsar and his generals that naval mines could be used to block enemy naval ships from threatening the city. The naval mines designed by Immanuel Nobel were simple devices consisting of submerged wooden casks filled with gunpowder. Anchored below the surface of the Gulf of Finland, they effectively deterred the British Royal Navy from moving into firing range of St. Petersburg during the Crimean war (1853-1856). Immanuel Nobel was also a pioneer in arms manufacture and in designing steam engines.

Successful in his industrial and business ventures, Immanuel Nobel was able, in 1842, to bring his family to St. Petersburg. There, his sons were given a first class education by private teachers. The training included natural sciences, languages and literature. By the age of 17 Alfred Nobel was fluent in Swedish, Russian, French, English and German. His primary interests were in English literature and poetry as well as in chemistry and physics. Alfred's father, who wanted his sons to join his enterprise as engineers, disliked Alfred's interest in poetry and found his son rather introverted. In order to widen Alfred's

A Gathering of Nobel Laureates: Science for the 21st Century -12- horizons his father sent him abroad for further training in chemical engineering. During a two year period Alfred Nobel visited Sweden, Germany, France and the United States. In Paris, the city he came to like best, he worked in the private laboratory of Professor T. J. Pelouze, a famous chemist. There he met the young Italian chemist Ascanio Sobrero who, three years earlier, had invented nitroglycerine, a highly explosive liquid. Nitroglycerine was produced by mixing glycerine with sulfuric and nitric acid. It was considered too dangerous to be of any practical use. Although its explosive power greatly exceeded that of gunpowder, the liquid would explode in a very unpredictable manner if subjected to heat and pressure. Alfred Nobel became very interested in nitroglycerine and how it could be put to practical use in construction work. He also realized that the safety problems had to be solved and a method had to be developed for the controlled detonation of nitroglycerine. In the United States he visited John Ericsson, the Swedish-American engineer who had developed the screw propeller for ships. In 1852 Alfred Nobel was asked to come back and work in the family enterprise which was booming because of its deliveries to the Russian army. Together with his father he performed experiments to develop nitroglycerine as a commercially and technically useful explosive. As the war ended and conditions changed, Immanuel Nobel was again forced into bankruptcy. Immanuel and two of his sons, Alfred and Emil, left St. Petersburg together and returned to Stockholm. His other two sons, Robert and Ludvig, remained in St. Petersburg. With some difficulties they managed to salvage the family enterprise and then went on to develop the oil industry in the southern part of the Russian empire. They were very successful and became some of the wealthiest persons of their time.

After his return to Sweden in 1863, Alfred Nobel concentrated on developing nitroglycerine as an explosive. Several explosions, including one (1864) in which his brother Emil and several other persons were killed, convinced the authorities that nitroglycerine production was exceedingly dangerous. They forbade further experimentation with nitroglycerine within the Stockholm city limits and Alfred Nobel had to move his experimentation to a barge anchored on Lake Mälaren. Alfred was not discouraged and in 1864 he was able to start mass production of nitroglycerine. To make the handling of nitroglycerine safer Alfred Nobel experimented with different additives. He soon found that mixing nitroglycerine with silica would turn the liquid into a paste which could be shaped into rods of a size and form suitable for insertion into drilling holes. In 1867 he patented this material under the name of dynamite. To be able to detonate the dynamite rods he also invented a detonator (blasting cap) which could be ignited by lighting a fuse. These inventions were made at the same time as the diamond drilling crown and the pneumatic drill came into general use. Together these inventions drastically reduced the cost of blasting rock, drilling tunnels, building canals and many other forms of construction work.

A Gathering of Nobel Laureates: Science for the 21st Century -13-

The market for dynamite and detonating caps grew very rapidly and Alfred Nobel also proved himself to be a very skillful entrepreneur and businessman. By 1865 his factory in Krümmel near Hamburg, Germany, was exporting nitroglycerine explosives to other countries in Europe, America and Australia. Over the years he founded factories and laboratories in some 90 different places in more than 20 countries. Although he lived in Paris much of his life he was constantly traveling. Victor Hugo at one time described him as "Europe's richest vagabond". When he was not traveling or engaging in business activities Nobel himself worked intensively in his various laboratories, first in Stockholm and later in Hamburg (Germany), Ardeer (Scotland), Paris and Sevran (France), Karlskoga (Sweden) and San Remo (Italy). He focused on the development of explosives technology as well as other chemical inventions, including such materials as synthetic rubber and leather, artificial silk, etc. By the time of his death in 1896 he had 355 patents.

Intensive work and travel did not leave much time for a private life. At the age of 43 he was feeling like an old man. At this time he advertised in a newspaper "Wealthy, highly-educated elderly gentleman seeks lady of mature age, versed in languages, as secretary and supervisor of household." The most qualified applicant turned out to be an Austrian woman, Countess Bertha Kinsky. After working a very short time for Nobel she decided to return to Austria to marry Count Arthur von Suttner. In spite of this Alfred Nobel and Bertha von Suttner remained friends and kept writing letters to each other for decades. Over the years Bertha von Suttner became increasingly critical of the arms race. She wrote a famous book, Lay Down Your Arms and became a prominent figure in the peace movement. No doubt this influenced Alfred Nobel when he wrote his final will which was to include a Prize for persons or organizations who promoted peace. Several years after the death of Alfred Nobel, the Norwegian Storting (Parliament) decided to award the 1905 Nobel Peace Prize to Bertha von Suttner. Alfred Nobel's greatness lay in his ability to combine the penetrating mind of the scientist and inventor with the forward-looking dynamism of the industrialist. Nobel was very interested in social and peace- related issues and held what were considered radical views in his era. He had a great interest in literature and wrote his own poetry and dramatic works. The Nobel Prizes became an extension and a fulfillment of his lifetime interests. Many of the companies founded by Nobel have developed into industrial enterprises that still play a prominent role in the world economy, for example Imperial Chemical Industries (ICI), Great Britain; Société Centrale de Dynamite, France; and Dyno Industries in Norway. Toward the end of his life, he acquired the company AB Bofors in Karlskoga, where Björkborn Manor became his Swedish home. Alfred Nobel died in San Remo, Italy, on December 10, 1896. When his will was opened it came as a surprise that his fortune was to be used for Prizes in Physics, Chemistry, Physiology or Medicine, Literature and Peace. The executors of his will were two young engineers, Ragnar Sohlman and Rudolf Lilljequist. They set about forming the Nobel Foundation as an organization to take care of the financial assets left by Nobel for this purpose and to coordinate the work of the Prize-Awarding Institutions. This was not without its difficulties since the will was contested by relatives and questioned by authorities in various countries.

A Gathering of Nobel Laureates: Science for the 21st Century -14-

Classroom Connections

1. Create a Power Point Presentation about Anders Bárány, the Nobel Prizes, the selection process and the Nobel Museum.

2. Anders Bárány has research interests in the theory of atomic collision, the theory of quasi- molecular ion-atom collisions, and charge transfer in slow collisions. Design a WebQuest, a Power Point, or a Tri-Board explaining the theory of atomic collisions.

3. Anders Bárány is the Senior Curator of the Nobel Museum, which means he has responsibilities including the conceptualization and organization of exhibitions. Create a 3-dimensional model or a Flip Book (each page of the book would show a drawing of a “wall” of the exhibit) of a Nobel Museum Exhibition based on one of the topics from http://nobelprize.org/physics/educational/index.html. Examples include Structure of Matter, Energy from Matter, X-Rays, Accelerators, Particles and Vacuum Tubes.

4. Anders Bárány played a very important role in the selection process as the Scientific Secretary of the Nobel Committee for Physics. Research a past selection awarded in the area of physics. Write a short skit that tells the story of this selection.

5. Read one of the following books and write a book report containing: the main themes and ideas of the book, your favorite parts of the book, and your response to the book. a. Politics of Excellence: Behind the Nobel Prize in Science by Robert Marc Friedman b. The Nobel Prize: A History of Genius, Controversy, and Prestige by Burton Feldman c. The Road to Stockholm: Nobel Prizes, Science, and Scientists by Istvan Hargittai

WebQuest – The Nobel Prize

Dr. Anders Bárány is responsible for conceiving and organizing exhibitions for the Nobel Museum. He has also served as the Scientific Secretary of the Nobel Committee for Physics (1989-2003), making him an important part of the selection process.

Use the websites listed below, or other internet resources, to answer the following questions in order to learn more about the Nobel Prizes, the selection process, and the Nobel Museum.

Note – questions that are relevant to the subtopic but not easily found on the current web page are identified as FreeSearch questions. This means you may need to explore other sites using a search engine.

Begin at http://nobelprize.org

A Gathering of Nobel Laureates: Science for the 21st Century -15-

Main Page

1. In what areas are the Nobel Prizes awarded?

2. What prizes accompany the award?

3. Who were the most recent prizewinners? (List the area and name).

4. Select one winner of the prize (choose an area of interest). Briefly, for what work did they receive Nobel recognition?

Alfred Nobel

5. What did Nobel invent?

6. Do you think his invention would have been worthy of a Nobel Prize? Why or why not?

7. (FreeSearch) Why did Alfred Nobel establish the Prize?

Nobel Museum

8. Where is the Nobel Museum?

9. What position does Dr. Anders Bárány hold at the museum?

10. The Nobel Museum currently has an exhibition exploring the creativity of the discovery process. What, according to the reading, are some characteristics of creativity?

11. (FreeSearch) What is the general purpose of museums?

12. In your opinion and based on information from this site, what role does the museum play in the Nobel Prize process? What important contributions can the museum provide?

A Gathering of Nobel Laureates: Science for the 21st Century -16- Nomination and Selection Process

13. Go to the www.nobelprize.org Physics page. Using the link “Nomination and Selection of Physics Laureates” in the upper right-hand corner, read about the selection process for physics. How are Nobel Prize Winners nominated and selected in Physics?

14. In what ways is this process similar or different from the Peace Prize nomination process?

http://www.britannica.com/nobel/nobelprizes.html

15. Can an individual be nominated posthumously? Why do you think this clause exists?

16. What happens if a prize is declined?

17. For what reasons are prizes declined?

18. Is a Nobel Prize awarded in each category each year? Why or why not?

http://www.pbs.org/kqed/nobel/stimeline.html

19. Choose the “controversy” listed in the timeline that you find most interesting. Briefly describe the controversy and your response. (Do you think the right thing occurred? Why or why not?”)

A Gathering of Nobel Laureates: Science for the 21st Century -17- WebQuest Assessment 20. Imagine that you are in charge of planning an exhibit for the Nobel Museum. You may want to further explore the work of one Nobel Prize Winner, a group of Prize Winners, or a theme concerning the Nobel Prizes themselves. Using the sites you have explored and/or other resources, describe the following about your chosen exhibit:

Name of the Exhibit - ______

Purpose (i.e. what you hope to teach others using the exhibit) –

Artifacts/Displays (i.e. items that will be on display in the exhibit) –

Extra Credit: Draw your exhibit as it would appear or create a brochure that would both publicize your exhibit and guide learners through the exhibit.

A Gathering of Nobel Laureates: Science for the 21st Century -18- Mock Debate – Nobel Prize Nomination and Selection

RADIATION (Profile A - Radiation)

Maxime and Anne Justaine started work on radioactive materials in the 1890s in Paris in a small, poorly- equipped laboratory. The German scientist, Wilhelm Roentgen, discovered radioactivity in 1895 in the form of powerful x-rays, while a few months later Henri Becquerel, a French scientist found that uranium gave off similar rays of weaker intensity or strength. The Justaines decided to pursue the French discovery, since most researchers largely ignored those rays. Anne struggled to get a laboratory and enough space to perform suitable experiments. Even though Maxime had been promoted at the Paris Municipal School of Industrial Physics and Chemistry and had earned his doctorate, they had access only to very poor research facilities.

Despite the lack of support for their studies they discovered both polonium and radium through a series of careful experiments. Countless hours were spent performing tedious chemical reactions to separate the radioactive components of pitchblende, a naturally occurring radioactive mineral. During this period Anne coined the term, “radioactivity,” although she, of course, did not discover it. Although they had discovered the two new radioactive elements, many people did not believe in their work. Consequently they were forced to extract radium and polonium from other substances to prove their work was correct. In addition, they needed to obtain larger amounts than they previously had been able to extract. At first the Justaines had only enough material to detect the radioactivity, not to see the actual substance itself.

Once enough radium had been extracted and isolated, its many uses became evident, especially in the field of medicine. Since it could destroy tissue, it had immediate applications in treating cancer and other diseases. Of course, other uses arose as simple as providing glowing hands on watches. Even with all of the backbreaking work, raising a family, and teaching, Anne managed to earn her doctorate in 1903, the first woman in France to do so. It was doubly significant, since she was an immigrant from Rumania, not a native of France.

After all of the hard work and ultimate success, tragedy struck when Maxime was killed by a wagon after slipping down on a wet street. Anne was left to carry on their work alone. In Maxime’s memory she founded the Radium Institute to perform medical and other research. With the outbreak of World War I Anne sought ways to use radioactivity to benefit mankind, in particular soldiers on the front. She developed x-ray machines to help doctors find and remove bullets and shrapnel from the wounded. She even got wealthy Parisians to provide their cars to carry the machines to the front.

Anne did research up (largely medical) until her death in 1934, when she died from a blood disease usually caused by getting too much radiation. The lives of the Justaines were an inspiration to all. Despite all of their successes, their work was sadly one of mixed blessings. Many of the early workers died from being exposed to large doses of radiation without proper protection due to a lack of understanding of the consequences. Also, while radiation can be used to combat cancer, it can cause cancer and other diseases. Scientists continue to debate the relative benefits of radiation for humankind, although almost everyone agrees that it has been primarily beneficial.

A Gathering of Nobel Laureates: Science for the 21st Century -19- SUSTAINED FISSION NUCLEAR REACTION (Profile B - Fission)

The first controlled fission reaction, i.e. one in which atoms are split, was achieved on December 2, 1942, in an abandoned squash court under a football stadium at the University of Chicago. The work was done in great secrecy, since World War II was raging, and the outcome was far from certain. The research group was composed of top scientists including Enrique Batista from Spain, Harold Rosenblum from the US, and many other renowned scientists from around the world.

Although theoretical calculations and educated guesses predicted that a controlled chain reaction should be possible with fissionable material, e.g. uranium 235, no one had ever managed to produce one. Many reasons existed to preclude this from happening, one of which was a lack of enriched uranium. Uranium occurs predominately as the 238 isotope, which cannot be split. Uranium 235 is very scarce in nature and must be concentrated to sustain a fission reaction. To do so required a laborious separation process of the 235 isotope from the natural material. In order to achieve the enrichment, the uranium had to be converted into the only gaseous form, uranium hexafluoride (UF6), and run through a series of molecular sieves many times to produce a slight enrichment.

The neutrons necessary for fission were so-called thermal neutrons, which meant some attenuating material was needed to slow down the naturally occurring fast ones. Graphite was the substance of choice, but it had to be extremely pure to work. It was supposed to slow the neutrons, not absorb them, so other atoms had to be excluded. Also, impurities might become radioactive themselves, thereby making the graphitic material unsafe for personnel working on the project near the pile. In fact, all materials chosen for the pile were required to be as pure as possible to prevent secondary radiation.

Another more serious consideration was that it might not be a contained reaction; it might result in an uncontrolled nuclear explosion (a bomb). The very real possibility existed that the fission or chain reaction would begin and get out of control (go critical) before it could be slowed down to a safe rate or stopped. To prevent this from happening, control rods called SCRAM rods were employed to stop the chain reaction the instant it went critical. A SCRAM rod, having elements in it that absorbed neutrons effectively, was inserted into the center of the pile quickly to quench the chain reaction.

Although the team of scientists was working on developing an atom bomb, the concept of a controlled chain reaction was used after World War II in nuclear power plants and nuclear ships. Research is also performed using nuclear reactors in a wide variety of fields from material science to medicine. The benefits appear to outweigh the harmful aspects, but the downside is that used fuel rods contain highly- radioactive isotopes that need to be stored for thousands of years.

A Gathering of Nobel Laureates: Science for the 21st Century -20- NUCLEAR FUSION (Profile C - Nuclear Fusion)

Fusion research effectively began after the pioneering work with fission or chain reactions during the 1930s and World War II. However, work as early as 1929 by Adelmann and Hoskins predicted that fusion could produce large amounts of energy. Many pioneers in nuclear research were involved over the years, including Arne Sundstrom, Alfred Keller, and Martin Stephens.

Unlike fission reactions that split atoms, fusion combines or fuses atoms together with the release of much more energy. In terms of potential energy produced the amount from fusion far exceeds that achieved with fission reactions, whether measured in terms of bombs or power production. Fission is limited by the fact that a critical mass is necessary to cause a chain reaction. For all practical purposes that amount and only that amount can be used, hence restricting the amount of starting material and ultimately the total quantity of energy produced.

While fission can occur at relatively low temperatures (ambient), fusion only occurs at millions of degrees as in stars. Controlled fission reactors produce power safely and can be in standard reactor vessels placed in specially-designed buildings that can be located most anywhere. Fusion has a special problem: To produce a plasma, made of nuclei with all the electrons removed, it can only take place at extremely high temperatures that would exclude containment by any materials currently available. In order to overcome this limitation, a device known as the Tokamak contains the fusion reaction or plasma in a magnetic field instead of a steel, titanium, or similar structure. Although controlled fusion is demonstrated in Spiderman II, it is not that easy to do, plus that fictitious reaction went out of control quite rapidly.

Fusion has many beneficial advantages over fission besides the tremendous power differential. (The enormous power from a thermonuclear bomb is probably not beneficial overall.) One true advantage is that it is a relatively clean, non-polluting source of energy with an almost unlimited source of fuels. Another is that it is inherently safer than fission, since it tends to shut down rapidly in the event of a problem. It also does not require storage of radioactive materials for geological time like spent fuel rods from fission reactors. Although medical benefits of fusion are still largely to be determined, the uses will likely arise as the knowledge of the technology broadens and applications are developed.

With the known amounts of fuels currently available fusion could be a viable source of energy for at least 1000 years. If practical limitations concerning containment and other problems like alternative fusion fuels can be overcome, the future of fusion for producing clean power is virtually unlimited. Directions: 1. In small groups of three, you will decide who is going to receive the Nobel Prize in Physics using the three, enclosed profiles. (Each one is fictional but based on actual research.) 2. First, as a small group, develop 5 questions that will guide you in your nomination and selection. Remember, the Nobel Prize is intended to reward discoveries that benefit mankind! Therefore, an example of a question may be, “How does this discovery benefit mankind?” Write your questions below. 3. Next, each person will choose a profile. In this role-play, you should “favor” your profile and try to convince the other members that your profile deserves the Nobel Prize. 4. Then, as a group, examine each profile and answer your nomination/selection questions. 5. Next, as a group, debate the merits of each profile. You must reach a decision concerning which one profile will win the prize. Remember, there will be no appeals. 6. Finally, answer the analysis questions.

A Gathering of Nobel Laureates: Science for the 21st Century -21- Mock Debate – Nobel Prize Nomination and Selection

Create Nomination/Selection Questions: 1.

2.

3.

4.

5.

Profile Analysis: For each profile, answer the questions above that you create. For example, if one of your questions was “How does this discovery benefit mankind?” and your profile states that the discovery will help to diagnose tumors, the benefit may be “Early detection of cancer will increase opportunities for successful treatment.”

Profile A - Radiation 1.

2.

3.

4.

5.

Profile B - Fission

1.

2.

3.

4.

5.

A Gathering of Nobel Laureates: Science for the 21st Century -22-

Profile C - Nuclear Fusion 1.

2.

3.

4.

5.

Results: 1. Who will be awarded the Nobel Prize? ______2. List your reasons for this choice:

Analysis: 1. Was it difficult to make your decision? Why or why not?

2. What factors were most important in your decision-making process?

3. Nominees are researched by special investigators, who are experts in each particular field of science. Was any information missing from the profiles that you needed? Do you think this could happen in an actual selection? What influence might the investigators have on the selection process?

4. Did the possibility of negative impacts of any of the discoveries play a role in your decision? Why or why not?

5. Should a scientist be held responsible for the possible negative impacts of their discovery on mankind?

6. Did having a “favorite” make the decision process more or less difficult?

A Gathering of Nobel Laureates: Science for the 21st Century -23-

7. Do you think personal preferences play a role in the actual selection process of the Nobel Prize? If so, can you think of any way to control this bias in the process?

8. If you discovered that the person or people you chose to award the Nobel Prize were members of a group such as the Nazis, would this change your decision? Why or why not?

9. Should personal information be included as part of the criteria for nomination and selection for the Nobel Prize? Why or why not?

10. Should preference be given to scientists who are from a certain background, ethnic group, who have had to overcome obstacles such as poverty, or are researching a particular field? If so, what characteristics should be included? If not, how can you make sure that the selection process is fair and does not favor scientists who have many advantages, such as wealth or government backing?

A Gathering of Nobel Laureates: Science for the 21st Century -24- “The Nobel Prize and Einstein's Ghost” by Dr. Anders Bárány

This December 10th marks the one hundredth anniversary of when the first Nobel Prizes were awarded. Ever since, they have been a subject of great interest and debate.

Alfred Nobel died on 10 December 1896. When his will was opened it was found that he had donated his considerable wealth to creating the prizes that bear his name. Five prizes were mentioned: physics, chemistry, physiology or medicine, literature and peace; and four prize-awarding institutions named: the Royal Swedish Academy of Sciences (for physics and chemistry), the Karolinska Institutet (for physiology or medicine), the Swedish Academy (for literature) and a group appointed by the Norwegian Parliament, later called ``The Norwegian Nobel Committee'' (for peace). Sweden and Norway were then tied together in a union.

Since the creation of the Nobel prizes, more than 650 medals and diplomas have been given away in the original prize areas. A prize in economic sciences in memory of Alfred Nobel was established by the Bank of Sweden in 1968. Most of these prizes are connected with scientific breakthroughs, literary masterpieces and attempts to make peace in a violent century.

The thread running though all the stories of the prize winners is the concept of creativity: both individual creativity and creative environments. One story - that of a Nobel Laureate in Physics, Albert Einstein - is particularly explicative of the process. Perhaps the most common question about the Nobel Prize in Physics is this: ``Why didn't Einstein get the prize for his theory of relativity?''

At the age of 26, during his ``annus mirabulis'' of 1905, Einstein published three papers that were to influence the entire 20th century, not only in physics. One of these papers concerned the special theory of relativity, which describes how space and time, or mass and energy, are mixed at high speeds. One paper describes the ``Brownian motion,'' the irregular motion performed by small particles in a liquid as a result of their collisions with the liquid molecules. The third paper, finally, explains the photo-electric effect, why light can make electricity leave metal surfaces, something we apply in ordinary photocells.

Of the three theories, the theory of relativity became the most written about and discussed. When the Royal Swedish Academy of Sciences year after year asked scientists for their nominations, many answered that Einstein deserved the Nobel Prize in Physics for his special theory of relativity. But the Nobel Committee for Physics didn't agree, and for years no prize was awarded to Einstein!

At first the Nobel Committee argued that the theory might be wrong and wrote that it would be best to wait for experimental evidence that confirmed Einstein's theory. When Einstein managed to generalise his theory and introduced the curved space-time, in which light bends around heavy astronomical bodies, the number of nominations increased even more.

A Gathering of Nobel Laureates: Science for the 21st Century - 25 - But the Nobel Committee for Physics had a powerful member, Allvar Gullstrand, professor at Uppsala University and Nobel Laureate in Physiology or Medicine 1911 for his work on how the light bends in the eye. In his opinion, Einstein was wrong, and he tried to prove it by making his own calculations. Today, we know that Gullstrand was wrong, but his opposition was enough to block the prize-awarding process.

In Uppsala, however, another professor, Carl Wilhelm Oseen, a specialist on mathematical physics, understood Einstein's theories and had also understood the power balance in the Nobel Committee for Physics. As a newly elected member of the Academy, in 1921 he was the first to propose giving to Einstein a Nobel Prize for his work on the photoelectric effect. This single nomination made the wheels begin to turn in Einstein's favor.

Oseen was made a member of the Nobel Committee and wrote a positive report on the theory of the photoelectric effect. The very next year, Albert Einstein was awarded the 1921 Nobel Prize in Physics ``for his services to Theoretical Physics, and especially for his discovery of the law of the photoelectric effect.''

So was the Royal Academy of Sciences mistaken in not giving its award of a Nobel Prize to Einstein for what most people would consider his most important intellectual discovery? Many have argued that this is the case. But one has to study a little bit more history of physics before making the final judgment.

In this history it is clear that Einstein's paper from 1905 not only explained the photoelectric effect, but also initiated something of a greater magnitude, something revolutionary: it introduced the concept of the photon, the wave-particle which not only lies at the heart of our understanding of both micro- and macrocosmos, but which led to technical applications such as medical laser scalpels and the laser diodes of the Internet. With regard to the text of Alfred Nobel's will, which requires that a Nobel Laureate confer the greatest benefit on mankind, Einstein's introduction of the photon by far surpasses the theory of relativity!

Today the work of the five Nobel Committees goes on, mainly along the same lines as at the beginning of the 20th century. The big difference is the number of nominations, which today tend to run in the several hundreds. If a new Albert Einstein is hidden somewhere among the hundreds of candidates, only the future will tell!

Anders Bárány is Professor of physics at Stockholm University and Senior Curator at the Nobel Museum. He has acted as Scientific Secretary to the Nobel Committee for Physics since 1990.

Copyright: Project Syndicate, December 2001 Reprinting material from this website without written consent from Project Syndicate is a violation of international copyright law. To secure permission, please contact [email protected]

A Gathering of Nobel Laureates: Science for the 21st Century - 26 - “The Nobel Prize and Einstein's Ghost” Reading Questions

1. To what are most of the Nobel Prizes connected?

2. What is the “thread running through all the stories of the prize winners”?

3. What is the most common question about the Nobel Prize in Physics?

4. What does the special theory of relativity describe?

5. What were the other two papers that Einstein published?

6. Why was no Nobel Prize awarded to Einstein for years?

7. What was the role of Allvar Gullstrand in the decision process concerning Albert Einstein?

8. What was the role of Carl Hilhelm Oseen in the decision process concerning Albert Einstein?

9. For which of his discoveries was Albert Einstein awarded the Nobel Prize?

10. What does Alfred Nobel’s will dictate concerning the Nobel Prize selection process?

A Gathering of Nobel Laureates: Science for the 21st Century - 27 - “The Nobel Prize and Einstein's Ghost”

Discussion Questions

1. Why didn’t Einstein get the prize for his theory of relativity?

2. What role should politics and personal opinion play in the selection process for the Nobel Prize? What role do they play?

3. Why did Einstein’s paper that introduced the concept of the photon surpass the theory of relativity in terms of Nobel Prize consideration?

4. Was the Royal Academy of Sciences mistaken in not giving its award of a Nobel Prize to Einstein for the theory of relativity?

5. What factors do you think should be of highest importance in the awarding of a Nobel Prize for science? How could these particular factors be determined and enforced? (For example, if you believe the potential benefit to mankind is an important factor, how could you “rate” the benefit when comparing discoveries?)

6. Some discoveries can be both beneficial and harmful to humans. For example, radiation helps us cure cancer but can also cause cancer. Should the Nobel Prize committees consider possible harm or misuse of a discovery when considering to whom to award the Nobel Prize?

A Gathering of Nobel Laureates: Science for the 21st Century - 28 - “A Nobel Too Far?” America's scientific dominance could have serious repercussions.

Robin McKie Sunday October 10, 2004

The Observer

There is a terrible joke much loved by scientists, but not many others. A man spots a farmer standing in a field in the rain. 'Why?' he asks. The farmer replies: 'I am trying to win a Nobel Prize. You get one for being out standing in your field.'

If only it was that easy. As researchers will tell you, the real thing requires decades of commitment, hard graft, luck, and some grey matter - although these days you will need another key qualification: a US passport, or at least a US chequebook.

Just take a look at last week's batch of Nobels in chemistry, physics and medicine. Medicine went to American smell researchers Richard Axel and Linda Buck; physics went to a trio of US quark physicists, David Gross, David Politzer and Frank Wilczek; while chemistry was awarded to cell researchers Dr Irwin Rose (from California) and two Israeli researchers, Prof Avram Hershko and Prof Aaron Ciechanover. The Israeli pair, it should be noted, were backed by generous US research funds, and have spent a great deal of time working in America (though it should be acknowledged that they carried out some key research in their home country).

Americans have dominated the world's three most prestigious science prizes for more than two decades, but now things seem to be getting out of hand. All the 2004 science Nobels were backed and directed by American cash, a point noted by UK cancer researcher Tim Hunt, winner of the 2001 Nobel medicine prize. 'It is certainly startling and worrying. Nobel destinations fluctuate a fair bit. Britain did quite well in 2003, and who knows what might happen next year. However, Nobels are just tips of a science iceberg. The more tips, the bigger must be the iceberg underneath. All this preponderance of Nobels really shows is how vast is the US science hegemony.'

But what does this near monopoly mean for the rest of the world, and how, exactly, has the US managed to achieve it? The second question is the easier to answer: because America commits such a large percentage of its vast wealth to science. The $27 billion budget of the National Institutes of Health dwarfs that of any other organization in the world, and US backing for other sciences is equally lavish.

But this begs a subsidiary question: why the largesse? That is trickier to answer though observers agree it reflects a deep American interest in the universe, a lack of the anti-science snobbery that pervades Europe, and a justified belief that discoveries can be exploited to improve life and make money.

Which takes us to the global implications? 'Numbers of prizes don't matter,' says UK Nobel chemistry winner Sir Harry Kroto. 'What is important is America's commitment to turning discoveries into products. Here, they are also utterly dominant. Technologically, they are far more vigorous and aggressive.'

A Gathering of Nobel Laureates: Science for the 21st Century - 29 - British scientists will doubtless argue we still do well Nobel-wise. Since 1990, Americans have won 24 physics Nobels, 19 for chemistry and 21 for medicine. No other country has got more than three in any category except for Britain, which has won, very creditably, six for medicine. It is still no contest, of course. Today, if you want to do science, America is the only destination. Once young US researchers headed to Europe to learn basic research. Now the direction is reversed. Forty per cent of scientists in the US were born in Europe. Few are expected to return.

The black hole of US science is simply sucking in money and talent, leaving Britain more and more isolated. We are trying hard but if we are not careful our best Nobel chances may one day be restricted to joining farmers in their fields. http://observer.guardian.co.uk/print/0,3858,5035687-102273,00.html

(Formulate questions about the importance of U.S. dominance over Nobels? What’s the difference between basic and applied research, and how does that play into the committee’s considerations?)

“A Nobel Too Far?” By Robin McKie

Discussion Questions: 1. With what issues was the author of this article, Robin McKie, concerned?

2. “Hegemony” means domination of one state over its allies. What is the driving force of “US science hegemony” according to the article? Do you agree or disagree? Are there other possible reasons?

3. Why does America spend so much money in the field of science research?

4. The article quotes Sir Harry Kroto as saying, “Number of prizes don’t matter.” Consider the event that led to this article, and the information the author chose to include. Do you think the Robin McKie agrees? Do you agree? Why or why not?

5. The author characterizes US science as a “black hole”. What do you think McKie meant by this? Is it a positive or negative characterization? Justify your response.

6. The subtitle implies that US domination of science research could have serious repercussions. What are the possible repercussions?

A Gathering of Nobel Laureates: Science for the 21st Century - 30 -

“The Daily Yomiuri”

By Takeshi Kuroiwa

March 26, 2002

"What is creativity?" It is not surprising for people to ask this question in regular conversation. But when the same question is raised among Nobel Prize laureates or those involved in the selection process of the prize, the discussion takes on special significance given that one of the main focuses of the prestigious prize is creativity itself.

The International Forum Commemoration the Centennial of the Nobel Prize was held March 16 and 17 at Tokyo University, and on March 20 at the Kyoto International Conference Hall. Five Nobel laureates and executive members of the various selection committees participated in the event, which was sponsored by the Science Council of Japan and supported by The Yomiuri Shimbun.

"Humankind is facing problems that we have not encountered before, such as environmental issues," said Hiroyuki Yoshikawa, president of the council. "Thus, there is a huge need for creativity."

In a panel discussion focusing on creativity, Anders Bárány, scientific secretary of the Nobel Committee for Physics, emphasized the influences of "external factors" such as family, society and parents for fostering creativity in young children.

Hans Jornvall, secretary of the Nobel Committee for Physiology or Medicine, agreed but he also stressed the importance of a "broad education system" to provide children with knowledge.

Kjell Espmark, chairman of the Nobel Committee for Literature, meanwhile, mentioned "serendipity" as the "common denominator for creativity." Espmark defined serendipity as the ability to come up with the unexpected.

Prof. Tyoji Noyori of Nagoya University, winner of the 2001 Nobel Prize in Chemistry, made a similar remark in a speech delivered earlier on. "Scientists must be skillful enough to grab a lucky break whenever they get the chance," he said.

Obviously, though, these opportunities must be recognized for what they are.

"There must have been hundreds of physicists who saw falling apples before (Issac) Newton came up with the law of gravitation after seeing an apple fall," said Kiyoshi Kurokawa, vice president of Science Council of Japan, who coordinated the panel discussion.

Susumu Tonegawa, director of the Center for learning and Memory of Massachusetts Institute of Technology and winner of the 1987 Nobel Prize in Physiology or Medicine, said in the panel discussion that no scientist had ever been able to give physiological explanations on creativity. "There is no scientific answer," he said.

A Gathering of Nobel Laureates: Science for the 21st Century - 31 - However, he offered his opinion on creativity based on his experience. "Imagination starts from copying," Tonegawa said. "Creative people attract creative people." Thus, he said it was crucial for parents or teachers to be creative.

Bárány said autobiographies written by Nobel laureates revealed the important role that teachers and professors had played in the progress of many laureates when they were young.

In a panel discussion, Professor F. Sherwood Rowland of University of California, Irvine, said: "Look for something new to do. Keep yourself fresh."

Rowland, who shared the 1995 Nobel Prize in Chemistry with two other scientists for his "work in atmospheric chemistry, particularly concerning the formation and decomposition of ozone," made a reference to a saying commonly used to describe Japanese society. "The nail that sticks up gets hammered down."

In this respect, he stressed the importance of individuality. "People have to start making decisions by themselves at an early age," he said. Tonegawa explained the differences between the education systems of Japan and the United States.

He mentioned an essay that was written by his son, who studied during the week at a American school and at the weekend at a Japanese school in the United States. His son wrote that when the subject of slavery was raised in the United States, the teachers would ask why slavery had to be abolished, expecting a broad range of answers. But in Japan, according to the essay, teachers would merely ask for the date when slaves were first brought to the United States in the hope of generating a single answer. Tonegawa emphasized the importance of having children think for themselves.

In a speech, Leo Esaki, president of Shibaura Institute of Technology and winner of the 1973 Nobel Prize in Physics, said, "You have to determine what you are good at and foster that talent by yourself." He raised the importance of three notions: "autonomy, a creative mind and a judicious mind."

The event also offered an opportunity for the audience to participate in the discussion.

A high school student asked about how the Japanese education system could be reformed to foster creativity.

Rowland replied, "You have to make your own list of what needs to be done."

A medical student asked how researchers could maintain their enthusiasm for research.

Espmark said it was a "question of keeping your curiosity alive." The event also discussed the history of the Nobel Prize. The prize enjoys its current reputation in part because it was the first international prize, said Michael Sohlman, executive director of the Nobel Foundation.

A Gathering of Nobel Laureates: Science for the 21st Century - 32 -

Sohlman mentioned a line in Alfred Nobel's testament: "No consideration whatever shall be given to the nationality of the candidates," as a basic principle of the prize that he said had been "truly independent" from any government.

Geir Lundestad, secretary of the Norwegian Nobel Committee, pointed to the "historical record" of the prize as a major reason for its elevated status. Lundestad said, however, that this did not mean the prize has been free from mistakes and oversights.

"In my opinion, the most serious mistake is the omission of Mahatma Gandhi (1869-1948)," Lundestad said. But he said "there are remarkably few major omissions."

Lundestad admitted that certain countries were infuriated when the Nobel Peace Prize was awarded to such people as Andrei Sakarov in 1975 and the Dalai Lama in 1989. Nevertheless, he said, "the point is to stand up for a certain principle."

After the speech, a company employee asked Lundestad, about what could be done to achieve world peace. He replied: "Stand up, be courageous. Then, you can make a difference." Copyright © 1999, 2000 The Regents of the University of California

http://www.physsci.uci.edu/news/entries/2002326.html

A Gathering of Nobel Laureates: Science for the 21st Century - 33 - “The Daily Yomiuri” by Takeshi Kuroiwa

Discussion Questions

1. Why is there a need for creativity in science, according to Hiroyuki Yoshikawa? What other world issues do you think will need creative solutions?

2. What influences does Anders Bárány feel contribute to creativity? Do you agree or disagree? Why?

3. What other factors, according to the article, contribute to the development of creativity?

4. How do you define creativity? Justify your definition.

5. Tonegawa and Bárány both cite the importance of parents and teachers to the development of creativity. Why do you think they feel this way? Do you agree? Why?

6. In what ways does the article suggest you can seek to develop creativity?

7. In Alfred Nobel’s testament, he stated, “No consideration whatever shall be given to the nationality of the candidates.” In light of the earlier article, do you feel this wish is being carried out? Defend your response.

8. Consider the comparison of the work at the Japanese school and the American school. Then consider the points made in the first article and the importance the panelists place on creativity. What conclusions can you draw from these ideas?

9. Science and creativity may seem antithetical to most people. How are they actually intertwined? How can museums and science centers help to defuse this notion that science is all rote learning of rules, devoid of creativity and fun?)

A Gathering of Nobel Laureates: Science for the 21st Century - 34 - The Role of Science and Technology in Future Design by Jerome Karle 1985 Nobel Laureate in Chemistry

Introduction The role of science and technology in future design will be discussed from the perspective of someone who has lived all his life in the United States and whose scientific experience has spanned the years since the late 1930s. It is likely that the reader will find in my discussion characteristics that apply to many developed countries and developing ones. Inasmuch as scientific progress is highly dependent on financial support and, in modern times, on general societal support, it is appropriate to discuss the interaction of science and society. Using the United States as an example, some of the topics to be discussed are the views of public officials who influence the distribution of research funds, the response of funding agencies and the views of scientists. Finally, we shall look at the co-evolution of science and society and attempt to draw some conclusions concerning their related future and the implications for the future of technology. Views of Public Officials Public officials who are involved in setting or influencing science policy have expressed opinions that indicate that they intend to change the basis for supporting research and development. They speak in terms of a "paradigm shift" based on some new perception of the role of science in society. The word paradigm has several meanings, but in the way it is used here the words "pattern" or "model" may be good substitutes. In other words, the public officials wish to alter somewhat the pattern of funding for science. Their motivation is to orient research more toward programs that, for example, ensure a stronger economy and improvements in the environment. It is becoming increasingly apparent that those public officials who control public funds, will be reluctant to fund research programs that they consider unrelated to national needs.

An example of priority-setting by public officials was the vote in the House of Representatives against further construction of the high energy accelerator known as the superconducting super collider. This shift in spending priorities implies that nuclear physics may receive less support in the future if it continues to be viewed as less related to the new national priorities than other scientific disciplines.

Views of Funding Agencies The effect of the intention of federal officials to shift public research funds toward research programs that serve the national priorities has already affected the nature of the funding available at the funding agencies. For example, at the National Science Foundation, a small increase in funding for the chemistry division is directed toward so-called strategic research initiatives that involve, for example, advanced materials and processing, biotechnology, environmental chemistry and high-performance computing. It is likely that this trend will continue. The Federal Coordinating Council on Science, Engineering and Technology identified the current national priority areas as high-performance computing, advanced materials, manufacturing research and education, biotechnology and global change. The expressed intention is to get more effort into those areas, but not to have them be entirely exclusive.

A Gathering of Nobel Laureates: Science for the 21st Century - 35 - Views of Scientists Many questions arose in the scientific community as a consequence of the use of words such as "new paradigm," "strategic areas", "priorities," and "national competitiveness" in statements concerning the future funding of science. The questions concerned many aspects of the support of science, such as, is the paradigm really new, who decides which areas are strategic and who sets the priorities, and are the important contributions of curiosity-driven basic research to be largely sacrificed.

The indications so far are quite clear that the government expects to shift publicly funded research activity into the areas that are deemed strategic. Is this a new paradigm or merely a shift in emphasis? Quite apparently there has been over the years heavy funding and much research in the strategic (priority) areas. There also has been in the United States, a major Industry-University cooperative research program conducted by the National Science Foundation. It celebrated its 20th year of operation in January, 1994. An account of this very successful and extensive program has been presented in the January 24, 1994 issue of Chemical and Engineering News published by the American Chemical Society. The motivation of this cooperative program is to develop and transfer industrially relevant technologies from the university into practice. There are currently more than 50 active centers involving about 1,000 faculty members, about 1,000 graduate students and 78 universities. More than 700 organizations sponsor the centers, including government agencies, national laboratories and about 500 industrial firms. A table in the article lists 55 research topics covering a broad array of technologies. It is pointed out that the success rate is very high, namely only 6% of the centers have failed. Major investments have been made by sponsor organizations, based on center technologies. There are also many other industry-university collaborations that are not part of the National Science Foundation program.

Do we really have a "new paradigm" and, if so, what is it? Performing research in the interest of national needs is not new. Cooperating with industry is not new. Setting priorities is not new. What could be new? It is indicated that what is new is that by control of public funds curiosity driven research is to be curtailed to some unspecified degree in favor of research perceived to be in the national interest. This, I believe is the source of the apprehension among scientists. The major developments in science and technology generally derive from curiosity driven research and these developments have had over time great impact on the national interest, enriching the country with whole new industries and making contributions to the health, welfare, comfort and security of society. Is curtailing curiosity driven research in the national interest?

The Impact of Curiosity Driven Basic Research Many scientific groups have produced literature that describes, in terms of many examples, how curiosity driven research has led to important developments in the interest of society. The October, 1993 issue of Physics Today celebrated the one hundredth anniversary of the journal, Physical Review. A major part of this issue was devoted to the matter of basic research. An article by Robert K. Adair and Ernest M. Henley pointed out that "a century of fundamental physics research has appeared in the Physical Review. Such research is the seed corn of the technological harvest that sustains modern society." In an article on the laser, Nicolaas Bloembergen points out that "the first paper reporting an operating laser was rejected by Physical Review Letters in 1960. Now lasers are a huge and growing industry, but the pioneers' chief motivation was the physics." In an article on fiber optics, Alister M. Glass notes that "fundamental research in glass science, optics and quantum mechanics has matured into a technology that is now driving a communications revolution." In an article on superconductivity, Theodore H. Geballe, states "it took half a century to understand Kamerlingh Onnes' discovery, and another quarter-century to make it useful. Presumably we won't have to wait that long to make practical use of the new high-temperature A Gathering of Nobel Laureates: Science for the 21st Century - 36 - superconductors." Other articles concerned nuclear magnetic resonance, semiconductors, nanostructures and medical cyclotrons, all subjects of great technological and medical importance that originated in basic physical research.

In a preface for a publication of the American Chemical Society, Science and Serendipity, the President of the ACS in 1992, Ernest L. Eliel, writes about "The Importance of Basic Research." He writes that, "many people believe - having read about the life of Thomas Edison - that useful products are the result of targeted research, that is, of research specifically designed to produce a desired product. But the examples given in this booklet show that progress is often made in a different way. Like the princes of Serendip, researchers often find different, sometimes greater, riches than the ones they are seeking. For example, the tetrafluoroethylene cylinder that gave rise to Teflon, was meant to be used in the preparation of new refrigerants. And the anti-AIDS drug AZT was designed as a remedy for cancer." He goes on to say that "most research stories are of a different kind, however. The investigators were interested in some natural phenomenon, sometimes evident, sometimes conjectured, sometimes predicted by theory. Thus, Rosenberg's research on the potential effects of electric fields on cell division led to the discovery of an important cancer drug; Kendall's work on the hormones of the adrenal gland led to an anti-inflammatory substance; Carothers' work on giant molecules led to the invention of Nylon; Bloch and Purcell's fundamental work in the absorption of radio frequency by atomic nuclei in a magnetic field led to MRI. Development of gene splicing by Cohen and Boyer produced, among other products, better insulin. Haagen-Smit's work on air pollutants spawned the catalytic converter. Reinitzer's discovery of liquid crystals is about to revolutionize computer and flat-panel television screens, and the discovery of the laser - initially a laboratory curiosity - is used in such diverse applications as the reattachment of a detached retina and the reading of barcodes in supermarkets. All of these discoveries are detailed in this booklet (Science and Serendipity). Ernest Eliel goes on to point, out that "the road from fundamental discovery to practical application is often quite long, ranging from about 10 years in the example of Nylon to some 80 years in the case of liquid crystals." He concludes that, "if we stop doing fundamental research now, the 'well' that supplies the applications will eventually run dry. In other words, without continuing fundamental research, the opportunities for new technology are eventually going to shrink."

Some of the other topics in the brochure on Science and Serendipity, that were included to document further the importance of basic research, concerned several examples of the impact of chemistry on medicine. There are, in fact, countless such examples. The Federation of American Societies for Experimental Biology (FASEB) in their Newsletter of May, 1993 considered basic biomedical research and its benefits to society. I quote from the FASEB Public Affairs Bulletin of May 1993. "There have been recent suggestions that tighter linkage between basic research and national goals should become a criterion for research support. Concerns also have been raised that science is being practiced for its own sake, and that it would be better for the nation if research were oriented more toward specific industrial applications." They go on to point out that "the available evidence, however, clearly indicates that the desired linkage already exists. Indeed, a majority of scientists are intimately involved in the study and treatment of common human diseases and collaborate closely with clinical scientists. Industries involved in biomedical development have been remarkably efficient in commercial application of treatment modalities based on discoveries resulting from fundamental research funded primarily by the federal government.

"A critical factor in sustaining the competitive position of biomedical-based industries is for basic research to continue to provide a stream of ideas and discoveries that can be translated into new products. It is essential to provide adequate federal support for a broad base of fundamental research, rather than shifting to a major emphasis on directed research, because the paths to success are unpredictable and subject to rapid change. A Gathering of Nobel Laureates: Science for the 21st Century - 37 -

"History has repeatedly demonstrated that it is not possible to predict which efforts in fundamental research will lead to critical insights about how to prevent and treat disease; it is therefore essential to support a sufficient number of meritorious projects in basic research so that opportunities do not go unrealized. Although its primary aim is to fill the gaps in our understanding of how life processes work, basic research has borne enormous fruit in terms of its practical applications. We recognize that during a time when resources are constrained, it may be tempting to direct funding to projects that appear likely to provide early practical returns, but we emphasize that support for a wide-ranging portfolio of untargeted research has proven to be the better investment. This provides the broader base of knowledge from which all new medical applications arise. Decisions regarding what research to fund must be based on informed judgments about which projects represent the most meritorious ideas."

FASEB continues with a discussion of economic benefits and a number of examples of basic research- driven medical breakthroughs. "Society reaps substantial benefit from basic research. Technologies derived from basic research have saved millions of lives and billions of dollars in health care costs. According to an estimate by the National Institutes of Health on the economic benefits of 26 recent advances in the diagnosis and treatment of disease, some $6 billion in medical costs are saved annually by those innovations alone. The significance of these basic research-derived developments, however, transcends the lowering of medical costs: the lives of children as well as adults are saved, and our citizens are spared prolonged illness or permanent disability. Fuller, more productive lives impact positively on the nation's economic and social progress."

FASEB continues with thirteen examples of contributions by basic research to the diagnosis and treatment of numerous diseases, most of them very serious. Also noted in this Public Affairs Bulletin is that "our ability to know in advance all that is relevant is very poor" (Robert Frosch) and that, in suggesting new ideas for the management of funding for science, never considered were "the serious consequences of harming the system."

Technology

Up to this point, we have been concerned with basic science and its support by government funds in a modern society. Although there is also some support by private institutions established for that purpose and also some industrial investment in generally product-oriented basic research, the greatest amount of support by far comes from public funds. One of the ways that the public is repaid for their support is through the technology that fundamental research generates. I suspect that the economic return from technology alone more than compensates for the monies expended for the entire basic research effort. I have no estimate, however, of whether my suspicion is true or not. It should be noted that the public gains much more than the economic value of technology. It gains culture, comfort, convenience, security, recreation, health and the extension of life. What monetary value can be put on the triumphs of health over debilitating or fatal disease? The monetary value has to be higher than the purely economic savings that were noted above in the 26 examples referred to in the FASEB Bulletin.

The word "technology" means industrial science and is usually associated with major activities such as manufacturing, transportation and communication. Technology has been, in fact, closely associated with the evolution of man starting with tools, clothing, fire, shelter and various other basic survival items. The co-evolution persists and, since basic science is now very much a part of developing technologies, the term co-evolution of science and society which is used at times very much implies the co-evolution of both basic science and industrial science with society. Advances in technology are generally accompanied by social changes as a consequence of changing economies and ways of carrying out life's various A Gathering of Nobel Laureates: Science for the 21st Century - 38 - activities. An important question arises concerning how basic scientific discoveries eventually lead to new technologies and what that may mean to the rational support of basic research and the future of science and technology in the developed and developing world.

There are great uncertainties in the process that starts with basic research and ends with an economically successful technology. The successful discovery of a new development in research that appears to have technological significance does not ensure the economic success of technologies that may be based on it.

Nathan Rosenberg of Stanford University, in a speech, "Uncertainty and Technological Change", before the National Academy of Sciences (April, 1994), pointed out that there are great uncertainties regarding economic success even in research that is generally directed toward a specific technological goal. He notes that uncertainties derive from many sources, for example, failure to appreciate the extent to which a market may expand from future improvement of the technology, the fact that technologies arise with characteristics that are not immediately appreciated, and failure to comprehend the significance of improvements in complementary inventions, that is inventions that enhance the potential of the original technology. Rosenberg also points out that many new technological regimes take many years before they replace an established technology and that technological revolutions are never completed overnight. They require a long gestation period. Initially it is very difficult to conceptualize the nature of entirely new systems that develop by evolving over time. Rosenberg goes on to note that major or "breakthrough" innovations induce other innovationsand their "ultimate impact depends on identifying certain specific categories of human needs and catering to them in novel or more cost effective ways. New technologies need to pass an economic test, not just a technological one."

What does this mean with regard to government managed research? I quote from Rosenberg's speech.

"I become distinctly nervous when I hear it urged upon the research community that it should unfurl the flag of 'relevance' to social and economic needs. The burden of much of what I said is that we frequently simply do not know what new findings may turn out to be relevant, or to what particular realm of human activity that relevance may eventually apply. Indeed, I have been staking the broad claim that a pervasive uncertainty characterizes, not just basic research, where it is generally acknowledged, but the realm of product design and new product development as well - i.e., the D of R&D. Consequently, early precommitment to any specific, large-scale technology project, as opposed to a more limited, sequential decision-making approach, is likely to be hazardous - i.e., unnecessarily costly. Evidence for this assertion abounds in such fields as weapons procurement, the space program, research on the development of an artificial heart, and synthetic fuels.

"The pervasiveness of uncertainty suggests that the government should ordinarily resist the temptation to play the role of a champion of any one technological alternative, such as nuclear power, or any narrowly concentrated focus of research support, such as the War on Cancer. Rather, it would seem to make a great deal of sense to manage a deliberately diversified research portfolio, a portfolio that will illuminate a range of alternatives in the event of a reordering of social or economic priorities. My criticism of the federal government's postwar energy policy is not that it made a major commitment to nuclear power that subsequently turned out to be problem-ridden. Rather, the criticism is aimed at the single-mindedness of the focus on nuclear power that led to a comparative neglect of many other alternatives, including not only alternative energy sources but improvements in the efficiency of energy utilization."

A Gathering of Nobel Laureates: Science for the 21st Century - 39 - To these words, I add those (noted by FASEB) of Bruce Ferguson, Executive Vice President of Orbital Sciences Corporation, a space technology firm. Ferguson said, "The federal government should focus its research and development spending on those areas for which the benefits are diffuse and likely to be realized over many years, rather than areas for which benefits are concentrated on particular products or firms over a few years. These areas are not well covered by corporate investment, yet are vital to the long- term economic strength of the country."

Some reactions to "strategic" research are recounted in an article in Nature of February 10, 1994 (Vol. 367, pp. 495-496) from which I quote some passages. The concept of strategic research "is not an unfamiliar cry, witness last year's debate in Britain about harnessing of research to 'wealth creation.' Nor, of course, is the objective in any way disreputable; what scientist would not be cheered to know that his or her research won practical benefits for the wider world as well as a modicum of understanding? The difficulties are those of telling in advance which particular pieces of research will lead to 'new technologies' and then to 'jobs'.

"The recent past is littered with examples of adventurous goal-directed programs of research and development which have failed for intrinsic reasons or which, alternatively, have been technically successful, but unusable for economic or other reasons."

The article goes on to say that the affection for strategic research in the United States may prove short- lived. "In Britain, much the same seems to be happening. Having pinned its reorganization of research on the doctrine of science for wealth-creation, the government appears now to be more conscious of the problems it has undertaken to solve. Indeed, the prime minister, John Major, seemed to be suggesting in a speech last week that the British part of the research enterprise deserves respect of the kind accorded to other social institutions at the heart of his 'back to basics' rhetoric. After more than a decade of needless damage-doing, that would be only prudent."

As a final remark, the article ends with the statement: "On the grander questions, on both sides of the Atlantic, it seems likely that the first flush of enthusiasm for turning research into prosperity will be abated by the reality of the difficulties of doing so. When governments discover in the course of seeking radical reorganization that the best they can do with their parts of the research enterprise is to cherish them, the lessons are likely to be remembered. If the outcome in the research community is a more vivid awareness of how much the world at large looks to research for its improvement, so much the better."

The Future of Science, Technology and Society In discussing the future of science (including industrial science) and society, it is valuable to recount some of the important points that emerged from the previous discussion.

1. As a consequence of recognizing the economic benefits that derive from the development of novel, successful technologies, governments have been attempting to direct research, supported with public funds, toward subjects that are perceived as national priorities. This contrasts with broad-based "curiosity" oriented basic research.

2. The views of scientists, a distinguished economist, some industrial leaders and an editorial comment in a distinguished science journal provide very strong indications that governmental management of goal- oriented research is replete with uncertainties and pitfalls and, although well-motivated, may cause serious damage to the scientific culture. This, of course, would defeat the original purpose, since the co- evolution of science and society is a very-well documented and irrefutable phenomenon. A Gathering of Nobel Laureates: Science for the 21st Century - 40 -

3. Strong arguments are presented in this article by individuals and groups that support the current system of governmental funding of a very broad range of scientific efforts as probably being as close to optimal with regard to national priorities as is possible. No one can predict with any certainty what the most successful inventions and technologies will be in the future. The economic return on federally supported funding was the subject of a report by the Council of Economic Advisors to President Clinton. This report was released in November 1995. It documents high returns to the economy and the importance of governmental involvement. 1

4. By any measure, basic scientific research has made monumental contributions to technology and national priorities. The bond between basic research and the development of both novel and current technologies has been and is well in place.

There is no question that science and society will continue to co-evolve. The nature of this evolution will certainly be affected by the extent to which governments set funding priorities. Societies whose governments recognize the dependence of the development of successful novel technologies on broadly supported basic research are more likely to be healthier and economically prosperous in the future than those that do not. Because of the unpredictability of the details of the new science and technology that will evolve, the details of social evolution are also unpredictable.

1 The CEA Report on Economic Returns from R&D is available on the World Wide Web at http://www.whitehouse.gov

A Gathering of Nobel Laureates: Science for the 21st Century - 41 -

Reading & Discussion Questions

1. Why is it appropriate to discuss the interaction of science and society?

2. What do the public officials wish to do in terms of funding science? What is their motivation?

3. What is one example of this priority-setting?

4. What did the Federal Coordinating Council identify as the current national priority areas?

5. What are some of the questions in the scientific community concerning this “new paradigm”?

6. What is actually “new” about this paradigm?

7. Defend the following statement using the article, “Curiosity driven research has led to important developments in the interest of society.”

8. Name three of the examples given by Ernest L. Eliel of scientific progress that is NOT the result of targeted research:

9. What does Eliel predict will happen if we “stop doing fundamental research now”?

10. Why is it essential, according to the article, to “provide adequate federal support for a broad use of fundamental research”?

11. What, according to the author, does the public receive in return for public funds given to support science? (Note – there are eight benefits listed.)

A Gathering of Nobel Laureates: Science for the 21st Century - 42 - 12. What does the term “technology” mean? How has it guided the advancement of humankind?

13. What does Rosenberg mean when he states, “The pervasiveness of uncertainty suggests that the government should ordinarily resist the temptation to play the role of a champion of any one technological alternative … or any narrowly concentrated focus of research support …”? Do you agree or disagree with his position? Why?

14. What does the author predict about societies who do NOT support “basic research”?

15. The Nobel Museum, for which Anders Bárány is the Senior Curator, currently has an exhibition about the necessity of creativity for scientific progress. What role does creativity play in the type of basic research described by Jerome Karle in this article?

16. One of the questions in the article is “Who decides which areas are strategic and who sets the priorities” of scientific research. Who do you think should be in charge of deciding what areas science should research? Why do you feel this way?

17. Imagine that you are running for political office. During a debate, you are asked the question, “Is curtailing curiosity driven research in the national interest?” Formulate a response. Make sure you defend your position.

18. What possible impact could the Nobel Prizes have on this debate of targeted scientific research versus curiosity-driven research?

A Gathering of Nobel Laureates: Science for the 21st Century - 43 - Pre and Post Test for Alfred Nobel, The Nobel Prize and Anders Bárány

1. What are Bárány’s roles and responsibilities at the Nobel Museum?

2. How are Nobel Prize winners nominated and selected?

3. Why was no prize awarded to Einstein for years?

4. What is the history of the Nobel Prize? How are people nominated for a Nobel Prize? How many different types of Nobel Prizes are awarded each year?

5. What type of character traits do you think are needed to do the type of research that may lead to a Nobel Prize?

6. Why is there a need for creativity in science?

7. What does the public receive in return for public funds given to support science?

8. What possible impact could the Nobel Prizes have on this debate of targeted scientific research versus curiosity-driven research?

9. What do you think Laureates Guests visiting the Charlotte area want people to know, understand and appreciate about science?

10. Why do you think basic scientific research is important? How does science differ from technology? How are they related?

A Gathering of Nobel Laureates: Science for the 21st Century - 44 - The Echo Foundation presents

“A Gathering of Nobel Laureates: Science for the 21st Century”

Dr.Günter Blobel

©Peter Badge/Typos1 in coop with Foundation Lindau Nobelprizewinner Meetings at Lake Constance

The Nobel Prize in Physiology or

Medicine 1999

"for the discovery that proteins have intrinsic signals that govern their transport and localization in the cell"

Dr. Günter Blobel Rockefeller University New York, NY Howard Hughes Medical Institute

A Gathering of Nobel Laureates: Science for the 21st Century - 45 - A Gathering of Nobel Laureates: Science for the 21st Century - 46 - Günter Blobel Curriculum

Table of Contents Page

Blobel School Partnership Team 48

Günter Blobel – The Person 49

Günter Blobel – Autobiography 51

Günter Blobel – Interview 53 Classroom Connection 54

Exciting interview: Sir Harold Kroto with Günter Blobel, 57 Edmond Fischer and Christiane Nüsslein-Volhard

Günter Blobel: The Work 58

A Conversation with Günter Blobel; Here's the Nobel. Now explain 60 it to your Grandmother.

The Nobel Prize in Physiology or Medicine 1999 63

Cell Organization 64

Protein synthesis 65

Signal sequences 66

Press Release: The 1999 Nobel Prize in Physiology or Medicine 67

ZIP Codes in Proteins 71 Classroom Connections 72 Analysis Questions 74

Implications of the Work 75 Cystic Fibrosis 76

Industrial Synthesis 90 Classroom Connections 91

Sample Concept Map Rubric 93

Future Directions 94

Pre and Post Test for Günter Blobel 97

A Gathering of Nobel Laureates: Science for the 21st Century - 47 - The Echo Foundation

Presents

2004-2005 Project A Gathering of Nobel Laureates: Science for the 21st Century

Laureate Guest

Dr. Günter Blobel

School Partnership Team Durham Academy Myers Park High School Waddell High School

School Facilitators David Gould Durham Academy Ron Thomas Myers Park High School Jane Kinney Waddell High School

Science Liaisons David Gould Durham Academy Kathleen Koch Myers Park High School Robert Corbin Waddell High School

Curriculum Team Francis M. Hughes, Jr.*, Ph.D., University of North Carolina at Charlotte, Associate Professor of Biology Robert Corbin, MA Natural Science, National Board Certification, Charlotte Mecklenburg Schools, Waddell High School, Earth Science Teacher Katherine Niemiec, Charlotte Mecklenburg Schools, Waddell High School, Biology Teacher

* Curriculum Team Leader

A Gathering of Nobel Laureates: Science for the 21st Century - 48 - Günter Blobel – The Person

An introduction

The Echo Foundation is extremely pleased to have Günter Blobel, the 1999 winner of the Nobel Prize In Physiology or Medicine as part of our 2005 program "A Gathering of Nobel Laureates: Science for the 21st Century". Born the son of a veterinarian, Dr. Blobel grew up in Waltersdorf, Germany and lived an idyllic childhood until his family was forced to flee the advancing Russian Red Army during World War II. During their flight, Dr. Blobel witnessed the catastrophic bombing of Dresden and this event had such a lasting impression on him that over 50 years later he donated the money he received for the Nobel prize (nearly 1 million dollars!) to help with reconstruction of that city. After high school, Dr. Blobel eventually graduated with a medical degree from the University of Tübingen (Germany) but soon decided he was more interested in the unsolved mysteries of science than in simply treating patients. His brother, Hans, a veterinarian like his father but also interested in the basic problems of biology, was at the University of Wisconsin at Madison and helped get Dr. Blobel a graduate fellowship there to work on his Ph.D. degree. After getting his doctorate, Dr. Blobel moved to New York City and went to work at the prestigious Rockefeller University as a post-doc with a Dr. Palade. This position is similar to a residency for a physician and is the doctorate-level equivalent of on-the-job- training. Through hard work and diligence, Dr. Blobel managed to secure a permanent job at Rockefeller with his own independent lab. Working his way up through the ranks to full professor, it was here that he performed the ground-breaking work that lead to his world-wide recognition and eventually the ultimate reward, the Nobel prize. It is worthwhile to mention that in most years the Nobel prize is shared between two or three individuals, but in 1999 Dr. Blobel was the sole recipient of this coveted honor.

So what did Dr. Blobel do that was so good to warrant this accolade? As you may know, all living organisms are made up of cells and each cell is an individual living entity, even though different cells do different things and they all communicate with each other. Each individual cell is made up of many different compartments that do different things. To help envision this, think of the cell as one big city and each of the compartments as different businesses. For the city to function correctly, all the business must to be working. Therefore, each business needs the proper tools to do their particular type of work (for example, the plumbers need water pipes, the bakers need flour and the schools need books). In the cell most of these tools are made of a type of molecule known as proteins and these proteins are made only by a large machine known as the ribosome. The trouble is, the ribosome performs its manufacturing job in only one of the compartments of the cell. So…how do all the tools it makes get to the right businesses? In a city a business that makes tools would simply ship them out to the proper places by putting the correct address on each package. That is exactly what Dr. Blobel discovered, that each protein tool made by the ribosome has an specific address (called a signal sequence) built into it, and that the cell can read that address and send the tool to the right place.

The cellular “city” envisioned above could not function if the baker’s flour was sent to the plumber and the water pipes to the baker. Likewise, if the protein tools produced by the ribosome are not addressed correctly, disease can result. One of the most famous is Cystic Fibrosis. In about 70-80% of the cases of this devastating disease, there is a mistake in the address of a single protein that helps chloride molecules cross the cell membrane. This “tool” is made, and it actually works, but it is sent to the wrong place in the cell. Because it is useless there, the cell simply breaks it down like the plumber might throw away the flour that was accidentally sent to them. The result is chloride can not pass out of the cell. In normal

A Gathering of Nobel Laureates: Science for the 21st Century - 49 - tissues that must be kept wet with mucus (such as the inside lining of the lung, the gut and other pathways (called ducts) that move fluids), chloride moves out of the cell through this transport tool. Chloride also brings water along with it and so the mucus outside the cell stays nice and wet and therefore thinned out. During cystic fibrosis, when the transport tool is in the wrong place, chloride and water does not move out of the cell and the mucus becomes very thick. The thick mucus in the lungs causes congestion and prevents proper oxygen transport to the blood. In the gut and other tissues the thick mucus plugs up the ducts and prevents proper delivery of fluids. The result is a devastating disease that shows many symptoms even though there is one single cause. There are several other diseases in which the addresses for a protein appear to be dysfunctional resulting in proteins that do not go where they are supposed to. These include Alzheimer’s and primary hyperoxaluria (a rare kidney disease). Finally, many drug companies have taken advantage of Blobel’s work and designed therapeutic proteins with addresses that cause them to be secreted from the cell. In this way the drugs can be harvested in large quantities from the medium in which these cells are cultured. This can greatly improve the purity of such drugs and help bring down their cost.

Since receiving the Nobel prize, Dr. Blobel has continued to pursue this award-winning line of research at Rockefeller University and has begun to branch out to understand the many different types of protein addresses, including those that move proteins into the cell’s nucleus.

In this curriculum guide for Dr. Blobel you will articles that elaborate and explain each of these areas including a riveting autobiography by Dr. Blobel himself, brief descriptions of his work and the implications of his studies. Included are also several “Classroom Connections” to help you further understand the life and work of this outstanding scientist.

Francis M. Hughes, Jr. Associate Professor of Biology University of North Carolina at Charlotte

A Gathering of Nobel Laureates: Science for the 21st Century - 50 -

Günter Blobel – Autobiography http://nobelprize.org In 1936, when I was born in the small Silesian village of Waltersdorf in the county of Sprottau in the then eastern part of Germany, now part of Poland, the fine structure of the cell was still an enigma. After 300 years of staring through light microscopes, essentially all that biologists had learned was that the cell was delimited by a plasma membrane and contained a nucleus. Staining procedures had revealed other distinct territories in the cytoplasm and in the nucleus, but their fine structure remained unknown. A dramatic revolution occurred in 1945, when Keith Porter, Ernest Fullam and Albert Claude at the then Rockefeller Institute for Medical Research in New York City introduced the electron microscope to look at cells. The first structure they saw was a lace-like network in the cytoplasm that they termed the endoplasmic reticulum. This discovery formed the foundation for my future scientific career. 1945 was also a turning point in my life. Until then my childhood was a perfect 19th century idyll. In the cold and snow-rich Silesian winters there were hour-long rides on Sundays in horse-drawn sleighs to my maternal grandparent's farm to have lunch and to spend the afternoon. The house was a magnificent 18th century manor house in the nearby Altgabel with a great hall that was decorated with hunting trophies. In the summer, of course, horse-drawn landauers were used as means of transportation. The way to school was a long one. We went there on foot and as a pack, usually consisting of one or two of my seven brothers and sisters and of children from neighboring houses. At the end of January 1945, we had to flee from the advancing Russian Red Army. My father, a veterinarian stayed behind for a few more days and left only hours before the Red Army moved in. My fourteen year-old brother, Reiner, drove my mother, my youngest brother, an older brother, the two younger sisters and me in a small automobile to relatives west of Dresden in Saxony. On the way there we drove through Dresden. We entered the city from the eastern hills. Its many spires and the magnificent cupola of the Frauenkirche (die Steinerne Glocke, the Stone Bell) were a magnificent sight even for the untrained eye of a child. Driving through Dresden, I still remember the many palaces, happily decorated with cherubs and other symbols of the baroque era. The city made an indelible impression on me. Only a few days, later, on February 13, 1945, we saw from a distance of about 30 kilometers a fire-lit, red night sky reflecting the raging firestorm that destroyed this great jewel of a city in one of the most catastrophic bombing attacks of World War II. It was a very sad and unforgettable day for me. The months before and after the end of World War II were chaotic and miserable. None of my relatives had enough space to accommodate our large family leaving us divided among several relatives in different villages. There was no communication and little food. On September 9, 1945, we learned of the death of my beautiful oldest sister Ruth who, at age 19, was killed in an air raid on a train she was travelling in on April 10, 1945. She was buried in a mass grave near the site of the attack in Schwandorf, Bavaria. Ruth was born when my mother was just 20. The two had a sisterly relationship. My mother grieved over Ruth's death until the end of her own life. Fortunately, things took a turn for the better, when my father was able to continue his veterinarian practice in the charming medieval Saxon town of Freiberg. Most members of our family were reunited there by 1947. We lived in a nice villa surrounded by a large garden on the edge of town. My way to school was along the old medieval city wall. For only 40,000 inhabitants, Freiberg had a rich cultural life with a 175 year old theater. Most impressive were the musical performances in the magnificent gothic cathedral, the Dom, with the splendid great Silbermann organ. Each week Bach cantatas were performed. The great choral works of Bach, Mozart and Haydn were regularly performed and at the highest artistic A Gathering of Nobel Laureates: Science for the 21st Century - 51 - level at the major religious holidays. I even participated in singing in the cantus firmus of Bach's Matthäus Passion. So, it was almost like a 19th century idyll again, this time in a small medieval town instead of a country village. However, there was now the ever more oppressive regime of East Germany to deal with on a daily basis. When I graduated from high school in 1954 I was not allowed to continue my education at a university because I was considered a member of the "capitalist" classes. Fortunately, at that time, i.e., before the Berlin Wall, it was possible to escape and to travel freely to West Germany. So, on August 28, Goethe's birthday, I left Freiberg for Frankfurt on the Main in West Germany. The train left in the morning and in the afternoon it passed Weimar, where Goethe spent most of his life, and then Eisenach, where Bach was born and in the evening it arrived in Frankfurt, Goethe's birthplace. I studied medicine, beginning in Frankfurt and then in Kiel, München and Tübingen, graduating in 1960 from the University of Tübingen. Although I completed two years of internship in various small hospitals, I decided against continuing my medical training. I was much more fascinated by the unsolved problems of medicine than by practicing it. Fortunately, my oldest brother Hans had a similar experience in his field of study, veterinary medicine. He had obtained the prestigious Fulbright Fellowship to study in the U.S., continued his training there in microbiology and rapidly achieved the rank of full professor at the University of Wisconsin in Madison. He was extremely sympathetic to my dilemma and helped me to secure a graduate fellowship to study either with Khorana or with Van R. Potter. So, in 1962, I sailed to Montreal on a German steel freighter, and from there drove to Madison to arrive on a beautiful late day in May. Potter was a marvellous mentor, witty, energetic and stimulating. I graduated in November 1966, and decided to join George Palade's Laboratory of Cell Biology at the Rockefeller University (formerly the Rockefeller Institute). The revolution that began there in 1945, and that led to the discovery of all the major structures of the cell continued in the realm of relating cellular structures to specific cellular functions. My arrival coincided with the end of this second phase and the exciting beginnings of a third phase, the molecular analysis of cellular functions (see below). I was fortunate enough in helping to initiate this third phase of analysis, which is still in full swing. George Palade has been my most influential mentor, a good friend and a wonderful colleague. He taught me how to conceptualize a collection of disparate facts, to formulate working hypotheses and to design experiments to test these hypotheses. I am greatly indebted to him. In New York, I married Laura Maioglio. Laura studied art history and, at her father's death, took over Barbetta Restaurant founded by her father in 1906. Laura has introduced me to many artistic pleasures that I had not experienced before. She greatly encouraged me in my work and never complained about the many hours I spent in the laboratory. In 1994, I founded Friends of Dresden, Inc., a charitable organization, with the goal to raise funds in the U.S. to help rebuild the Frauenkirche in Dresden. The rebuilding of many of the historic monuments of Dresden is one of the most exciting consequences of German reunification and the liberation from communism. It is a childhood dream come true.

A Gathering of Nobel Laureates: Science for the 21st Century - 52 - It was one of the great pleasures of my life to donate the entire sum of the Nobel Prize, in memory of my sister Ruth Blobel, to the restoration of Dresden, to the rebuilding of the Frauenkirche and the building of a new synagogue. This donation also serves to express my gratitude to my fellow Saxons. They received us with open arms when we had to flee Silesia. I spent a wonderful period of my life there and they gave me a thorough and valuable education. A few thousand dollars will also be donated for the restoration of an old baroque church in Fubine/Piemonte/ltaly, the hometown of my wife's father, Sebastanio Maioglio. We have spent many happy summers there in the parental home of my wife. From Les Prix Nobel 1999.

Helpful Resources:

Günter Blobel – Interview http://nobelprize.org/medicine/laureates/1999/blobel-interview.html Professor Blobel talks about the necessity of inspiring teachers, the importance of mentorship (1:45), his move from Germany to the USA and Rockefeller University (2:47), new opportunities in medicine research (5:25), different aspects of his discovery (7:25), driving forces for his work (13:44) and consequences of receiving the Nobel Prize (14:45).

A Gathering of Nobel Laureates: Science for the 21st Century - 53 - Classroom Connections

Objective: To allow students to become familiar with the achievements of Günter Blobel and to widen their knowledge about the Nobel Prize given each year.

Lesson Components Description of Activities and Settings Materials and Time Supplies 1. Focus and Introduction Questions: What are the names Questions on 10-15 Review of some famous scientists? How did they separate sheet min become famous? How are these scientists of paper rewarded for their work? (or read aloud (Have students in groups of 3-4 come up the question) with a list of answers for each questions and then share with the whole class)

2. Statement of See objective above Objectives/De sired Student Outcomes

3. Primary Key Questions: Instructional 1. What is the Nobel Prize? Content 2. Who is Günter Blobel? /Strategy

4. Guided a) Based on student responses, introduce (if a) see site: 10-15 Practice not already mentioned) the Nobel Prize. http://nobelprize. min Inform about its rewards and its nomination org/medicine/slid eshow/part40smal process, which can be viewed via the computer. l.ram b) Have a

student(s) list the 5 min b) Ask for names of scientists students responses on the believe might have been recognized as a board for all to Nobel Prize Winner. (Verify the name see. Have teacher through the site – http://nobelprize.org) mention Günter Blobel. c) Provide some information about Günter c) Various 20 min Blobel. (Play 20 Questions with the class – information about have students ask specific questions about Günter Blobel Blobel and the teacher play the expert. Or (see attached information for have teacher ‘dressed’ as Blobel) Limit the background questions to ask about the man and not about knowledge) his work.

A Gathering of Nobel Laureates: Science for the 21st Century - 54 - 5. Independent d) Have students watch the interview that Computer 30 min Practice was recorded shortly after his receipt of the hookup Nobel Prize – via the computer at :: connected to http://nobelprize.org/medicine/laureates/199 television 9/blobel-interview.html and then respond to the following questions: (ex: Avery Key) 1) If you were the actually interviewer, what or projector would you want to know? (Needed to 2) Blobel mentioned that both his teachers broadcast and mentors inspired him. Tell me about a interview) time when you were inspired from a teacher. 3) How has receiving the Nobel prize changed his attitude toward his work and his life? 4) What qualifications of a scientist did Blobel have to possess to become a successful scientist? Showcase the qualifications with specific examples through the interview or what you learned about him today. 6. Check for Student responses, responses to questions, Understanding observation of students, and completion of critical thinking questions.

7. Homework

A Gathering of Nobel Laureates: Science for the 21st Century - 55 -

Not many companies can boast that they have a Nobel Prize winner on their Board of Directors, but IFF can. Dr. Günter Blobel, who has served as a Director since 2000, received the Nobel Prize in Physiology or Medicine in 1999 for his groundbreaking research on the inner workings of the cell.

Blobel’s research explained the process that enables each of the approximately one billion protein molecules in a single cell to be distributed to the right location within the cell. Proteins do most of the work. With time, they suffer damage and therefore they need to be continuously replaced by new synthesis. Each protein needs to be directed to a specific area in the cell to properly function. What Blobel discovered is a “zip code” system for protein distribution: each protein carries a signal that is recognized by other specific proteins that help in targeting the protein to the correct address within the cell.

“Many proteins also have to be woven into a cellular membrane. For instance, the receptors for smell and taste are membrane proteins. The millions of copies of a given smell or taste receptor protein have to be integrated into the membrane, each in a specific way,” Blobel said. “This occurs by similar mechanism: signals in the protein specify the precise orientation by which each of these proteins is woven into the membrane. Blobel’s study of what he calls “this huge research area” continues today. “Our knowledge is by no means complete; there are always new surprises. They don’t change the general concept, but they are interesting variations to the theme.”

Understanding how a normal cell works is the crucial first step in identifying the underlying causes of a disease. Several diseases are caused by defects in the zip code system. Proteins are not sent to their proper cellular locations or are improperly woven into the membrane.

Blobel’s research is also being used by the biotechnology industry to help produce proteins in large quantities in bacteria and other cells. Insulin or erythropoietin or growth hormone are proteins that are produced in this way and that are injected into patients that do not make enough of these proteins. Zip codes steer the proteins to the outside of the cell. This facilitates their purification away from the many proteins of the producing cells.

Choosing a Life of Research Blobel has been a professor at The Rockefeller University since 1976 and an Investigator at the Howard Hughes Medical Institute since 1986. He has received countless awards and honors during his distinguished career, yet he remains at heart a dedicated scientist who considers himself lucky to have chosen this area of research. It is a path he started down as a medical student in his native Germany.

As a young intern in a hospital, Blobel realized that the treatment of many diseases often focused on merely relieving symptoms rather than addressing the causes of the disease. That realization prompted Blobel to get his Ph.D. and focus on research. But in 1962 when he finished medical school and internship, Germany was still recovering from the war and there weren’t many research institutions and universities that could offer him the kind of education and training he needed. Blobel’s brother, a professor at the University of Wisconsin in Madison, recommended he come to the U.S. to study.

Blobel received his Ph.D. in oncology from the University of Wisconsin in 1967 and shortly after, became a post- doctoral fellow at The Rockefeller University, where he moved consistently up through the ranks, becoming John D. Rockefeller, Jr. Professor in 1992.

A Gathering of Nobel Laureates: Science for the 21st Century - 56 - A Promise Fulfilled In addition to his scientific pursuits, Blobel has always been interested in architecture and the arts. He founded Friends of Dresden in 1994 to raise money to restore some of the city’s important monuments that were destroyed during World War II and he has used his elevated public profile since receiving the Nobel Prize as a platform to continue fighting for restoration of that once beautiful city. The nearly $1 million he received for the Nobel Prize was donated to rebuild the most important church in Dresden, the Frauenkirche, and to reconstruct the synagogue.

“I was nine years old when we became refugees. My family moved from the eastern part of Germany via Dresden to the center of Germany. I had never before seen a big city and for me, Dresden was a wonderful place,” Blobel said. “It appealed to a child because of the tremendous number of statues which decorated each building. Many cherubs were playfully looking from their lofty heights. It was a very happy city, a light-hearted city, and I instantly fell in love.

“A few days later we witnessed the bombardment of Dresden from 40 miles away. We saw the fire shine in the night sky and heard on the radio it was Dresden. A couple months later, after the end of the war, we saw the city again as we tried to make our way back to Silesia [where his family is from] and the city was in rubble. I decided then that if ever there should be a chance in my life, I would like to help in the reconstruction. It has given me great pleasure to be able to do that.”

Interview Watch a taped interview with Sir Harold Kroto, Günter Blobel, Edmond Fischer, and Christiane Nüsslein- Volhard at www.vega.org.uk.

A Gathering of Nobel Laureates: Science for the 21st Century - 57 - Günter Blobel: The Work

Proteins are needed in the cell so that the cell can function and create wonderful organisms. Without proteins in the cell, cells would not be able to create membranes, channels, or allow for your body to function. Proteins are made up of amino acids, which are like codes for a specific protein. When these codes are put together, they create a specific protein with a very specific function. Proteins are created through a process called translation, which is when your cells create proteins through another set of codes located in your DNA. Once proteins are made, they need to be moved to specific sites within your cell, moved to the cells membrane to become protein channels, or moved out of the cell to help your body out. But, how do these proteins get to where they need to be? Günter Blobel discovered that proteins use ZIP codes, which are much like the ZIP codes you put on a letter to have it shipped to the correct location. Without these ZIP codes, proteins would not get to the correct places and a variety of complications may occur. But, let’s start at the beginning, with transcription and translation so that we can understand how Dr. Blobel’s work is beneficial.

Transcription is the process by which DNA creates mRNA so that the mRNA can move to the ribosomes of the cell where translation occurs, where mRNA creates proteins. Remember that during transcription, DNA needs to unzip along the nitrogen base backbone and RNA polymerase needs to add the mRNA bases. Also remember that in mRNA adenine binds with uracil and cytosine binds with guanine. Once RNA polymerases binds the new nitrogen bases together, the mRNA strand is removed from the DNA strand and moves out of the ribosomes and into the cytoplasm. mRNA then travels to the ribosomes where proteins are made. Now, if you remember from our study of cell organelles, the rough endoplasmic reticulum is the exact location in the cell where proteins are made. The mRNA that was made in the nucleus of the cell has 3 letter codes on it called codons. These codons attach to anticodons on tRNA which have specific amino acids linked to them. During translations, the codons on mRNA link together with the anticodons on tRNA, which bring amino acids with them. Amino acids are added together when more codons and anticodons attach. When the ribosome hits the stop codon on the mRNA, the final protein product has been created and released into the cell to complete its assigned task. But was that all there was to it? Proteins are just released into the cytoplasm of the cell and just wind up where they are supposed to be? Dr. Günter Blobel didn’t think that was the end of the protein story and he set out to determine how proteins get to the right places.

In the 1970s, Dr. Blobel began his work, which eventually won him a Nobel Peace Prize in Medicine in 1999, which was on protein trafficking and signaling in the cell. Dr. Blobel discovered that proteins that were created in the rough endoplasmic reticulum in the cell had tags attached to them, which directed them to where they were supposed to go. When proteins are translated, a specific protein code is attached to the beginning of each protein which acts like a ZIP code on an envelope that helps the protein find its eventual correct location in the cell. The protein ZIP code is approximately 20-30 amino acids long on the front of the protein chain. This ZIP code is specific to either a part of the cell where the protein needs to move, to the cell membrane for the protein to become a channel, or to move out of the cell. Once the protein exits the ribosome with its ZIP code attached, a signal recognition protein (SRP) binds to the ZIP code and brings the protein to its correct location. You can think of the SRP as being your local post office. You’ll put a ZIP code on a letter and then drop your letter in the mail. The ZIP code tells the post office where the letter needs to go, but it’s actually the post office that has to move the letter to its correct location. In cells, the SRPs are the post office - they deliver the protein to its correct address. But wait, sometimes letters get delivered incorrect - doesn’t this ever happen in the cell? Yes, it does. Sometimes the ZIP code is incorrect or the SRPs do not deliver the protein to the correct location and this can cause a variety of disorders, like cystic fibrosis or hyperoxaluria. A Gathering of Nobel Laureates: Science for the 21st Century - 58 -

Cystic fibrosis is a recessive autosomal genetic disorder in which thick and dry mucous lines the respiratory system - mainly the lungs. This causes the cilia, which normally help the lungs to clean out bacteria, to not be able to function properly. If the cilia are not functioning properly, the lungs cannot remove bacteria and infections can occur, which can ultimately cause death. Hyperoxaluria, on the other hand, is another autosomal recessive disorder, which causes children to have kidney stones. These kidney stones can eventually lead to kidney failure in children. Both of these disorders can be linked to mutations in the protein ZIP code. Without the correct ZIP code, the protein can wind up in the incorrect location in the cell, mistakenly embedded in the cell membrane, or outside of the cell when it is needed to be in the cell. These two diseases are examples of when the ZIP code mutation may cause a life threatening disorder.

If there is anything that you should remember from Dr. Blobel’s work is to “not forget the ZIP code!” (Science News) Just remember to think of proteins like letters. If the ZIP code is not correct on your envelope, the post office will not be able to deliver the letter to the correct person. If your cells translated proteins do not have the correct signal, the signal recognition protein cannot deliver the protein to the correct location, which may cause a life threatening disorder.

A Gathering of Nobel Laureates: Science for the 21st Century - 59 -

A CONVERSATION WITH GÜNTER BLOBEL; Here's the Nobel. Now Explain It to Your Grandmother. By CLAUDIA DREIFUS (New York Times) 1230 words Published: December 7, 2004

Life, and how it functions, is at the center of Dr. Günter Blobel's research.

Specifically, he studies proteins and the mechanisms that permit them to move within the cells of living organisms. For his efforts, he was chosen as the sole recipient of the Nobel Prize in Physiology or Medicine in 1999.

A cellular biologist, Dr. Blobel enjoys lively companionship in the confines of his laboratory office at the Rockefeller University in Manhattan; each day he arrives at work accompanied by his three English setters.

Throughout the interview, the dogs rooted about Dr. Blobel's office. But it seems that was all part of their training.

In his nonlaboratory life, Dr. Blobel, 68, is married to Laura Maioglio, the proprietor of Barbetta's, a Northern Italian restaurant in the theater district known for its truffled risotto.

So when the dogs are not serving as Dr. Blobel's muses, they are working as truffle hounds.

Q. Your good friend Richard Axel will be leaving for Stockholm shortly to accept his half of the 2004 Nobel Prize in Medicine. He'll be sharing the award with the biologist Linda Buck. As a laureate yourself, have you offered him any advice?

A. I advised him to go early so that he could enjoy it all better and really get into the mood. If you go early, you don't have so much jet lag, and you can enjoy the musical performances, the beautiful steel blue sky of Stockholm. But Richard doesn't have the time. He will only go for three or four days. I told him it is a mistake.

Q. When you received the 1999 Nobel, you announced that you would give your prize money for the reconstruction of a church and to build a new synagogue in Dresden. The old synagogue was destroyed by the Nazis in 1938, and the church, the Frauenkirche, collapsed after the Allies firebombed the city. Why such a generous gesture?

A. As soon as I heard there were people in Germany who wanted to restore the old part of Dresden, I wanted to help. Even before the Nobel, I had started this group, the Friends of Dresden. The destruction of Dresden made a big impression on me when I was a child, and I wanted to do this.

Since I did it, others have started giving their money away, too. My colleague Paul Greengard has set up a prize with his Nobel to recognize the work of women scientists.

Richard Axel says he will do something also. I asked him, ''Have you decided yet what?'' He says, ''No, it's very difficult to pick.''

Back in 1999, I hoped my gesture would be an example, particularly in Germany, where people can be very stingy about charity. In the United States, the wealthy have a tradition of charity. But in Germany, the rich say: ''We pay taxes. It's enough.'' Once I did this, many rich Germans called me saying they wanted to meet this crazy man who gave away $1 million. And so, the Friends of Dresden raised much, much more.

A Gathering of Nobel Laureates: Science for the 21st Century - 60 - Q. What was it about Dresden that so affected you?

A. I saw the old city before it was bombed. I was 8 years old in the spring of 1945, when my family fled Silesia to escape the Russian army. On our way, we passed through Dresden. A few days later, it was firebombed. The fire was so bright that night that one could read a newspaper from the light, though we were many kilometers away.

After the war ended, we passed through Dresden twice, and I saw the incredible destruction. I said at the time, ''If there ever is a chance I can do something to resurrect this whole thing, I will.'' But, you know, these are the pledges of a child.

Q. A lot of scientists say that their work gets ruined after the Nobel, that there's no time left for science. Was that true of you?

A. After I got the prize, someone said to me, ''Noblesse oblige.'' He meant that the prize is an obligation, and it gives you a platform. I used it to talk about the need for scientists to communicate their work to the public, a passion of mine.

I'm always telling my students that if they can't explain what they are doing to their grandmothers then they probably don't understand it themselves.

Q. O.K. then, can you explain, in terms that my late grandmother would understand, what you won your Nobel for?

A. It was for the basic science where we learned how, within a cell, proteins move from where they are made to the place where they perform their function.

A cell contains about a billion protein molecules, which live on the average for about a week. Therefore, the cell has to continuously make more proteins to replace the degraded ones, and they have to go to the right place within that cell to function properly.

To greatly simplify, we found that proteins contain built-in ''ZIP codes'' that help them move to specific cellular addresses. Because of the ZIP coding, the proteins can traverse membranes by moving through channels to get to the areas where they are needed.

Q. Was there a moment when you felt you understood this process?

A. I think by the beginning of the 1980's, I had the feeling that there was this mechanism in the cells, the ZIP code.

Even then, not all of the details of that mechanism were known. We had hypothesized about it. That's why some people at the time criticized me, because I had made a lot of hypotheses. Later, they were probably angry because we obtained data that confirmed the hypotheses.

There was a 50-50 chance I was right. But the idea about the ZIP codes was also intuition. I kept asking myself, ''If I were to design a system, how would I do it?''

The thing that people criticized me for most was the idea that proteins can go through a channel in the membrane that consists of proteins itself. Even friends criticized this. They said, ''I like your idea with the ZIP code, but I wish you wouldn't have proposed a channel, because it's so foolish.''

A Gathering of Nobel Laureates: Science for the 21st Century - 61 -

Q. Was there a specific moment when you finally felt you had the complete answer?

A. There was no one moment. With every couple of years in the lab came another little peak of information, and each one added to the basic idea that there is a ZIP code that is being recognized and then targeted to a membrane, and then the ZIP code opens a channel through which the protein can traverse the membrane.

By 1991, I felt, we had compiled enough evidence to prove our hypothesis.

Q. While your colleagues were doubting you, what gave you the confidence to keep plugging on?

A. I've never cared about being judged. There is an internal revolt in me against conforming.

After the war, my family lived in East Germany and that taught me that truth is the most holy and important thing in life. I thought my ideas were reasonable. So why not propose them?

Dr. Günter Blobel contributed his 1999 Nobel Prize money to Dresden, which he remembers from 1945.

A Gathering of Nobel Laureates: Science for the 21st Century - 62 -

The Nobel Prize in Physiology or Medicine 1999 http://nobelprize.org

The Nobel Assembly at Karolinska Institutet in Stockholm, Sweden, has awarded the Nobel Prize in Physiology or Medicine for 1999 to Günter Blobel, for the discovery that "proteins have intrinsic signals that govern their transport and localization in the cell."

Günter Blobel, born in 1936, works at the Laboratory of Cell Biology, The Rockefeller University, New York

All living organisms are made up of cells. The eukaryotic cell contains a number of different types of organelles each of which is surrounded by a tightly sealed membrane.

A Gathering of Nobel Laureates: Science for the 21st Century - 63 -

Cell Organization The organization of a cell can be compared to that of a big city such as New York. In order to reach its correct destination, a letter has to be provided with an address label and a zip code, similar to the address tags on proteins.

A Gathering of Nobel Laureates: Science for the 21st Century - 64 -

Protein synthesis How do newly synthesized proteins find their correct destinations within a cell, and how are they able to pass across the tightly sealed intracellular membranes? These were the central questions that Günter Blobel began to address in the late 1960s. He started by analyzing how newly synthesized secretory proteins are first targeted to and then translocated across the membrane of the endoplasmic reticulum (ER). These two steps are prerequisites for secretion of proteins out of the cell.

Present view of protein translocation across the ER membrane. The signal Electron peptide, emerging from the ribosome, binds to the signal-recognition micrograph of particle (SRP). The SRP-ribosome complex then docks to the SRP-receptor the protein and channel ("translocon"). SRP dissociates from the receptor and the translocating nascent polypeptide chain is translocated through the channel into the ER channel (the lumen. The signal peptide is finally cleaved and the protein is secreted out "translocon"). of the cell.

A Gathering of Nobel Laureates: Science for the 21st Century - 65 - Signal sequences In 1980 Blobel proposed that newly made proteins are targeted to and imported into the various organelles within the cell by built-in signal sequences. The signals are short stretches of amino acids encoded by the gene specifying the protein. They can be located at either end of the protein, or somewhere internally.

A Gathering of Nobel Laureates: Science for the 21st Century - 66 -

Press Release: The 1999 Nobel Prize in Physiology or Medicine http://nobelprize.org NOBELFÖRSAMLINGEN KAROLINSKA INSTITUTET THE NOBEL ASSEMBLY AT THE KAROLINSKA INSTITUTE 11 October 1999 The Nobel Assembly at Karolinska Institutet has today decided to award the Nobel Prize in Physiology or Medicine for 1999 to Günter Blobel for the discovery that

"proteins have intrinsic signals that govern their transport and localization in the cell"

Summary A large number of proteins carrying out essential functions are constantly being made within our cells. These proteins have to be transported either out of the cell, or to the different compartments - the organelles - within the cell. How are newly made proteins transported across the membrane surrounding the organelles, and how are they directed to their correct location? These questions have been answered through the work of this year’s Nobel Laureate in Physiology or Medicine, Dr Günter Blobel, a cell and molecular biologist at the Rockefeller University in New York. Already at the beginning of the 1970s he discovered that newly synthesized proteins have an intrinsic signal that is essential for governing them to and across the membrane of the endoplasmic reticulum, one of the cell’s organelles. During the next twenty years Blobel characterized in detail the molecular mechanisms underlying these processes. He also showed that similar "address tags", or "zip codes", direct proteins to other intracellular organelles. The principles discovered and described by Günter Blobel turned out to be universal, operating similarly in yeast, plant, and animal cells. A number of human hereditary diseases are caused by errors in these signals and transport mechanisms. Blobel’s research has also contributed to the development of a more effective use of cells as "protein factories" for the production of important drugs. Several important functions An adult human being is made up of approximately 100,000 billion cells. A cell contains many different compartments, organelles, each surrounded by a membrane. The organelles are specialized to carry out different tasks. The cell nucleus, for instance, contains the genetic material (DNA) and thus governs all functions of the cell. The mitochondria are the "power plants" producing energy needed by the cell, and the endoplasmic reticulum is, together with the ribosomes, responsible for synthesizing proteins. Every cell contains approximately one billion protein molecules. The different proteins have a large number of important functions. Some constitute the building blocks for constructing the cell while others function as enzymes catalyzing thousands of specific chemical reactions. The proteins within a cell are constantly degraded and resynthesized. The number of amino acids - the building blocks making up all proteins - may in a single protein range from about 50 to several thousands, forming long, folded chains. How do proteins cross the barriers? Thus, it was for a long time a puzzle how large proteins could traverse the tightly sealed, lipid-containing, membranes surrounding the organelles. Some decades ago, it was also unknown how newly made proteins were directed to their correct locations in the cell.

A Gathering of Nobel Laureates: Science for the 21st Century - 67 - Günter Blobel was going to solve both of these puzzles. At the end of the 1960s he joined the famous cell biology laboratory of George Palade at the Rockefeller Institute in New York. Here, during two decades, scientists had studied the structure of the cell and the principles for the transport of newly synthesized proteins out of the cell. This work earned George Palade the Nobel Prize in Physiology or Medicine in 1974 (which he shared with the Belgian scientists Albert Claude and Christian de Duve). "The signal hypothesis" Günter Blobel’s research was built on the traditions of Palade´s laboratory. In particular, Blobel studied how a newly made protein, destined to become transported out of the cell, is targeted to a specialized intracellular membrane system, the endoplasmic reticulum. In 1971 he formulated a first version of the "signal hypothesis". He postulated that proteins secreted out of the cell contain an intrinsic signal that governs them to and across membranes. Based on elegant biochemical experiments, Blobel described in 1975 the various steps in these processes. The signal consists of a peptide, i.e. a sequence of amino acids in a particular order that form an integral part of the protein. He also suggested that the protein traverses the membrane of the endoplasmic reticulum through a channel (Fig. 1). During the next twenty years, Blobel and coworkers step by step characterized the molecular details of these processes. Eventually it was shown that the signal hypothesis was both correct and universal, since the processes operate in the same way in yeast, plant, and animal cells. "Address tags" for organelle localization In collaboration with other research groups, Günter Blobel was soon able to show that similar intrinsic signals target the transport of proteins also to other intracellular organelles. On the basis of his results, Günter Blobel formulated in 1980 general principles for the sorting and targeting of proteins to particular cell compartments. Each protein carries in its structure the information needed to specify its proper location in the cell. Specific amino acid sequences (topogenic signals) determine whether a protein will pass through a membrane into a particular organelle, become integrated into the membrane, or be exported out of the cell. A range of signals that govern proteins to the different parts of the cell have now been identified (Fig. 2), showing that the principles formulated by Blobel are correct. These signals can be compared to address tags or zip codes which ensure that a traveler's luggage arrives at the correct destination, or a letter reaches its correct addressee. These signal sequences are in fact a chain of different amino acids present either as a short "tail" at one end of the protein, or sometimes located within the protein. Significance of Blobel's discovery Günter Blobel's discovery has had an immense impact on modern cell biological research. When a cell divides, large amounts of proteins are being made and new organelles are formed. If the cell is to function correctly, the proteins have to be targeted to their proper locations. Blobel´s research has substantially increased our understanding of the molecular mechanisms governing these processes. Furthermore, knowledge about the topogenic signals has increased our understanding of many medically important mechanisms. For example, our immune system uses topogenic signals, e.g. in the production of antibodies. Blobel's research has helped explain the molecular mechanisms behind several genetic diseases. If a sorting signal in a protein is changed, the protein could end up in a wrong location in the cell. One example is the hereditary disease primary hyperoxaluria, which causes kidney stones already at an early age. In some forms of familial hypercholesterolemia, a very high level of cholesterol in the blood is due to deficient transport signals. Other hereditary diseases, e.g. cystic fibrosis, are caused by the fact that proteins do not reach their proper destination.

A Gathering of Nobel Laureates: Science for the 21st Century - 68 - Future applications In the near future the entire human genome will be mapped. As a result one can also deduce the structure and topogenic signals of the proteins. This knowledge will increase our understanding of processes leading to disease and can be used to develop new therapeutic strategies. Already today drugs are produced in the form of proteins, e.g. insulin, growth hormone, erythropoetin and interferon. Usually bacteria are used for the production of the drug, but in order to be functional certain human proteins need to be synthesized in more complex cells, such as yeast cells. With the help of gene technology the genes of the desired proteins are provided with sequences coding for transport signals. The cells with the modified genes can then be efficiently used as protein factories. Increased knowledge about the process by which proteins are being directed to different parts of the cell also makes it possible to construct new drugs that are targeted to a particular organelle to correct a specific defect. The ability to reprogram cells in a specific way will also be important for future cell and gene therapy.

Fig. 1. "The signal hypothesis". Proteins, which are to be exported out of the cell, are synthesized by ribosomes, associated with the endoplasmic reticulum. The genetic information from DNA is transferred via messenger RNA (mRNA). This information determines how the amino acids build up the proteins. First, a signal peptide is formed as a part of the protein. With the help of binding proteins, the signal peptide directs the ribosome to a channel in the endoplasmic reticulum. The growing protein chain penetrates the channel, the signal peptide is cleaved, and the completed protein is released into the lumen of the endoplasmic reticulum. The protein is subsequently transported out of the cell.

A Gathering of Nobel Laureates: Science for the 21st Century - 69 -

Fig. 2. Examples of directed transport mediated by topogenic signals. The figure shows a schematic cell with some of its compartments, the organelles. (A chloroplast is an organelle that is present in plant cells but not in animal cells). The organelles have special functions and are surrounded by membranes. Newly synthesized proteins are provided with special "address tags", signal sequences or topogenic signals, which direct the proteins to a correct place within the cell and allow them to cross the membranes of the organelles. The signal itself consists of a chain of amino acids. It is an integral part of the protein, and it is often located at one end of the protein.

A Gathering of Nobel Laureates: Science for the 21st Century - 70 - ZIP Codes in Proteins

Now it’s your turn to use protein ZIP codes. In this activity, you will be responsible for creating a protein from DNA, utilizing your knowledge of transcription and translation, and then moving that protein, using the signal recognition protein (SRP), to its specific location. You will also be responsible for identifying which protein has been mutated and will not be delivered to the correct location. Please use all information given to help you in this process.

Transcription Remember that during transcription, DNA is made into mRNA. Remember that in mRNA, adenine binds to uracil and guanine binds to cytosine! Using this information, please make the mRNA molecules for the following four DNA strands.

Strand 1: ATGTATAAGTGTATTGCGTTTGATGGCCGTATACGTAACACCTAG

Strand 2: ATGTGTGGCGTACCTTGGGGTGACCGTAATGGTGACGAGTACTAG

Strand 3: ATGTATAAGTGGATTGCGGGCGATGAACCCTGAAACTTTGGGTAG

Strand 4: ATGGGCTGTCATGATACCCCAATTGTGATGATACTCTCGATGCTAG

A Gathering of Nobel Laureates: Science for the 21st Century - 71 - Classroom Connections

Translation: Remember that during translation, mRNA binds with tRNA, which will eventually leave an amino acid chain. Using the mRNA strands that you have made during Transcription, convert the mRNA to the tRNA anticodon. Once you have completed the tRNA anticodon, use the chart below to figure out the amino acid sequence. Remember that codons and anticodons are the three letter codes for amino acids.

First Letter Second Third Letter Letter U C A G U Phenylalanine Serinc Tyrosine Cysteine U (UUU) (UCU) (UAU) (UGU) Phenylalanine Serine Tyrosine Cysteine C (UUC) (UCC) (UAC) (UGC) Leucine Serine Stop (UAA) Stop (UGA) A (UUA) (UCA) Leucine Serine Stop (UAG) Tryptophan G (UUG) (UCG) (UGG) C Leucine Proilne Histadine Arginine U (CUU) (CCU) (CAU) (CGU) Leucine Proline Histadine Arginine C (CUC) (CCC) (CAC) (CGC) Leucine Proline Glutamine Arginine A (CUA) (CCA) (CAA) (CGA) Leucine Proline Glutamine Arginine G (CUG) (CCG) (CAG) (CGG) A Isoleucine Threonine Asparagine Serine U (AUU) (ACU) (AAU) (AGU) Isoleucine Threonine Asparagine Serine C (AUC) (ACC) (AAC) (AGC) Isoleucine Threonine Lysine Arginine A (AUA) (ACA) (AAA) (AGA) Methionine; Threonine Lysine Arginine G Start (AUG) (ACG) (AAG) (AGG) G Valine Alanine Aspartate Glycine U (GUU) (GCU) (GAU) (GGU) Valine Alanine Aspartate Glycine C (GUC) (GCC) (CAC) (GGC) Valine Alanine Glutamate Glycine A (GUA) (GCA) (GAA) (GGA) Valine Alanine Glutamate Glycine G (GUG) (GCG) (GAG) (GGG)

A Gathering of Nobel Laureates: Science for the 21st Century - 72 - Strand 1:

Strand 2:

Strand 3:

Strand 4:

Protein ZIP Codes We have learned from Dr. Bloble’s work that protein ZIP codes are in the beginning of each protein strand and can be 20-30 amino acids long. However, in this activity, we are going to use 5 amino acid ZIP codes to determine where a protein is supposed to go. Utilizing the amino acids that you have figured out during transcription, use the following chart to determine where each protein strand is supposed to be moved to. Please remember that each protein strand needs to start with a start codon and then have a ZIP code. Remember that you have one strand that has been mutated!

ZIP Code Location Tyrosine-Lysine-Cysteine-Isoleucine- mitochondria Alanine Tyrosine-Serine-Arginine-Tyrosine- nucleus Threonine Serine-Cysteine-Histadine-Aspartate- Move out of the cell Threonine Alanine-Glutamate-Glycine-Serine-Serine Cell membrane protein

Cysteine-Glycine-Valine-Proline- Cell membrane protein Tryptophan Cysteine-Valine-Proline-Asparate-Serine Move out of the cell

Strand 1:

Strand 2:

A Gathering of Nobel Laureates: Science for the 21st Century - 73 -

Strand 3:

Strand 4:

Analysis Questions:

1. Which strand was mutated? Where do you think that strand was supposed to go? ______2. What protein is used as the post office in the cell? How does this protein know where the proteins it carries are supposed to go? ______3. Are the ZIP codes originally part of the DNA, mRNA, or tRNA? How do you know? ______4. Do ZIP codes play an important role in cell functioning? Why or why not? ______5. Describe what may occur if a protein does not wind up where it is supposed to be.

A Gathering of Nobel Laureates: Science for the 21st Century - 74 - Implications of the Work Diseases http://nobelprize.org In many inherited diseases, proteins are mislocalized in the cell due to errors in targeting signals and transport. One example is "primary hyperoxaluria," a rare disease, which results in kidney stones already at an early age. A signal in the enzyme alanine:glyoxylate aminotransferase normally directs it to the peroxisome. In patients, this signal is altered and the protein is mislocalized to the mitochondrion where it is unable to perform its normal function.

Cystic Fibrosis is a common and very devastating disease, believed to be caused by a mistargeting of a protein.

A Gathering of Nobel Laureates: Science for the 21st Century - 75 -

A Gathering of Nobel Laureates: Science for the 21st Century - 76 -

A Gathering of Nobel Laureates: Science for the 21st Century - 77 -

A Gathering of Nobel Laureates: Science for the 21st Century - 78 -

A Gathering of Nobel Laureates: Science for the 21st Century - 79 -

A Gathering of Nobel Laureates: Science for the 21st Century - 80 -

A Gathering of Nobel Laureates: Science for the 21st Century - 81 -

A Gathering of Nobel Laureates: Science for the 21st Century - 82 -

A Gathering of Nobel Laureates: Science for the 21st Century - 83 -

A Gathering of Nobel Laureates: Science for the 21st Century - 84 -

A Gathering of Nobel Laureates: Science for the 21st Century - 85 -

A Gathering of Nobel Laureates: Science for the 21st Century - 86 -

A Gathering of Nobel Laureates: Science for the 21st Century - 87 - A Gathering of Nobel Laureates: Science for the 21st Century - 88 -

A Gathering of Nobel Laureates: Science for the 21st Century - 89 - Industrial Synthesis http://nobelprize.org

Today many important protein drugs (e.g. growth hormone, erythropoetin, insulin) are produced in living cells. To facilitate easy purification, the proteins are provided with a signal peptide causing them to be secreted out of the cell.

For scale-up production, cells are grown in bioreactors.

A Gathering of Nobel Laureates: Science for the 21st Century - 90 - Classroom Connections:

Günter Blobel Concept Maps

Activity Overview: This lesson helps establish how the work of Günter Blobel is interrelated with cellular biology. In this lesson students will use technology to locate, evaluate, and collect information from a variety of sources in order to create concept maps. Concept maps are simply graphical representations to show relationships between information. Major concepts are linked by words that describe their relationship. Research shows that concept maps improve understanding by helping students organize and enhance their knowledge on any topic. They are ideal for measuring growth of student learning because they reveal previous knowledge and deficits in knowledge. Improper links or wrong connections alert educators to what students do not understand, providing an accurate, objective way to evaluate areas in which students do not yet grasp concepts fully.

Objective: By completing this lesson, students will: • Use technology to locate, evaluate, and collect information on the work of Nobel Laureate Günter Blobel from a variety of sources. • Link ideas and concepts associated with proteins in cells and the work of Günter Blobel through constructing concept maps.

Desired Outcomes: After completing the lesson, students will: Develop research skills by employing technology. Recognize that people construct knowledge in different ways. Analyze and evaluate subconcepts to determine where they belong within a larger concept.

Class Time: Concept mapping 120 minutes

Materials Needed: • Index cards or other scraps of paper • Sample concept map • Sample rubric • Steps in constructing a concept map

Background: Students will research different aspects of Günter Blobel’s life and work in order to construct concept maps. Students can present their working concept maps to the teacher and/or peers for feedback. Concept maps may be drawn or built using note cards. Building them allows students to arrange and rearrange the layout of their concept maps before deciding on a final version. Students can present their concept maps to the class, each presentation serving as a way to teach classmates about a different aspect of water quality.

A Gathering of Nobel Laureates: Science for the 21st Century - 91 -

Activity Steps: After students locate, evaluate, and collect information from a variety of sources the following steps may be used to create water quality concept maps. 1. Select Focus on a theme and then identify related key words or phrases. 2. Rank Rank the concepts (key words) from the most abstract and inclusive to the most concrete and specific. 3. Cluster Cluster concepts that function at similar level of abstraction and those that interrelate closely. 4. Arrange Arrange concepts in to a diagrammatic representation. 5. Link and add proposition Link concepts with linking lines and label each line with a proposition.

A Gathering of Nobel Laureates: Science for the 21st Century - 92 -

Sample Concept Map Rubric:

Student:______Superficial links Substantive links, Links are Concept Map Rubric and concepts. some correct and topic:______"Top of the head" misconceptions substantive; choices. evident. controversial Accuracy Mostly correct. ones Are the links correct according 1 2 documented. to current state of science? 3 4 5 6 Completeness Major concepts Some major links are Map gives a Have the major concepts been missing missing complete included and linked? Does map or links ignored. but most concepts picture of leave gaps in understanding concepts? Large present. important gaps in system linkages

1 3 5 2 4 6

Systems Only 1 system in 2+ subsystems but Links at least 3 To what extent are relationships among focus. does not subsystems. earth subsystems identified? Many links identify links, or all All Are connections labeled? without are the same connections are identifiers. labeled. 1 2 3 4 Style No arrows on Some connectors All connectors Do connections have a defensible connectors, without are arrows; direction? Is arrangement or some wrong direction; inefficient concepts not efficient? Is it a web or straight path? directions; linear placement duplicated; path for most (duplicates). Little information webbing. webbed 1 2 3 4

Resources: To view some examples of concept maps, go to any of the following websites: http://www.inspiration.com/; http://cmap.ihmc.us/; http://www.smarttech.com/products/smartideas/smartideasdownload.asp

A Gathering of Nobel Laureates: Science for the 21st Century - 93 - Future Directions http://www.rockefeller.edu/pubinfo/032703.php March 7, 2003

The protein is in the mail New findings from Blobel lab enhance understanding of "ZIP Code" protein transport system

A busy urban post office daily sorts thousands of letters and parcels, guiding each to a particular mailbox somewhere in the city. Each day, every cell of the human body manufactures millions of proteins which it also must continually sort and route to their final destinations within the cell. Only when a protein has reached its destination can it do its assigned work.

But just how do the proteins get where they need to go? Rockefeller University professor Günter Blobel, an investigator at the Howard Hughes Medical Institute, won the 1999 Nobel Prize in Physiology or Medicine for discovering that each cell uses a "ZIP Code"-like system to shuttle proteins to their intended destinations. Now, new research from Blobel's Laboratory of Cell Biology, reported in the March 21 issue of Cell, provides a more detailed picture of the "sorting" mechanism used in the cell's "post office."

Using a technique known as X-ray crystallography, Thomas Schwartz, postdoctoral associate in the Blobel lab and first author of the Cell,paper, has solved the structure of the SRP (for Signal Recognition Particle) receptor. "This structure illuminates the mechanics of an important sorting mechanism, whose role has up to now been poorly understood, in the eukaryotic cell," says Blobel, senior author of the paper.

The SRP receptor is a heterodimer or functional complex formed when two molecular switches are bound together. (A molecular switch, like a light switch, is a molecule whose "on" and "off" positions correspond to different respective effects on cell function.) Schwartz's structure demonstrates for the first time that two switches, called SR alpha and SR beta, exist independent of one another in the cell. They come together and form the SRP receptor only as needed to shuttle certain kinds of proteins to their destinations, separating again afterwards.

These findings, which furnish scientists who focus on protein transport with a more precise understanding of the ZIP Code system, are relevant to understanding the origins of many inherited diseases — including, for example, cystic fibrosis — that arise when proteins are "mislocalized" (sent to the wrong location in the cell) as a result of errors in the cell signaling that routes proteins to their intended destinations.

At an even more fundamental level, misfirings in the protein-transport system, known as protein secretion, "are intolerable to the cell," says Schwartz. "It is essentially impossible for the cell to survive major errors in this process, which occurs at the most basic level necessary for survival."

Switch campaign

The life of a protein begins in a tiny cellular factory called a ribosome. There, a protein — a chain of amino acids linked together in a specific configuration — is manufactured on a cellular "assembly line." Once synthesized the new protein must be shipped to the "address" where it is needed.

A Gathering of Nobel Laureates: Science for the 21st Century - 94 - One of the major protein transport systems in eukaryotic organisms (organisms whose cells feature a structurally discrete nucleus and other well-developed subcellular compartments) has long been known to principally involve three molecular switches, called GTPases. One of these GTPases, known as SRP 54 — part of a larger complex called the Signal Recognition Particle, composed of six proteins and an RNA molecule — works in concert with GTPases SR alpha and SR beta, the subunits of the two-part SRP receptor.

Schwartz's structure, formed when the two molecular subunits are bound, establishes that SR beta must be switched on in order to be bound by the other subunit, SR alpha, and form the heterodimer. This new information clears up a widely held misconception in the field of protein transport, according to Schwartz.

Schwartz explains that, without a clear understanding of SR beta's function, most scientists who study protein transport in cells incorrectly believed that SR alpha and beta were always (and only) in complex — that is, joined as one functional unit — in the cell.

"The function of the two subunits of the SRP receptor was a mystery," adds Blobel. "Until now, no one really knew what the SR beta switch was good for."

Neither rain, nor sleet keeps GTPases from appointed rounds

Depending upon their individual functions, freshly manufactured proteins are transported to different destinations as they exit the ribosome. Some stay in the cell; some, such as insulin and other hormones, leave the cell; others must make their way into a cell organelle called the endoplasmic reticulum (ER), where they may end their journey or continue on toward a role in one of the eukaryotic cell's several other membranes.

Like postal workers at different checkpoints along a delivery route, SRP 54, SR alpha and SR beta work together to ensure delivery to the proper "address" of proteins destined to be exported out of the cell or to do jobs in the cell's membrane. This address is a channel, located in the ER, through which the proteins travel. Cells to be exported out of the cell are further processed and packed into membrane vesicles that eventually fuse with the cell membrane to release the protein outside the cell. Proteins with jobs to do in the membrane itself enter the channel, and from there are inserted into the membrane — probably through a side opening in the channel, Schwartz and Blobel hypothesize.

Blobel's Nobel research showed that exported and membrane proteins come out of the ribosome tagged with a characteristic signal peptide (the ZIP Code) comprising the first 20 to 30 amino acids in the chain. As this signal peptide emerges from the ribosome at the head of the nascent chain, SRP 54 recognizes and binds to it. Once this is accomplished, SRP 54, now bound to the ribosome, must somehow find the membrane channel and deposit the nascent protein it has collected. This is done with the aid of the SRP receptor: SR beta anchors the subunit in the membrane; SR alpha signals the channel's location to SRP.

A Gathering of Nobel Laureates: Science for the 21st Century - 95 - Alpha-beta soup

Schwartz's research primarily focuses on SR beta, the anchoring subunit of the SRP receptor. Using X-ray crystallography, he set out to understand how SR beta interacts with SR alpha.

Characterized by two separate domains — SRX and NG — at its opposite ends, SR alpha (signaling subunit of the SRP receptor) serves as the middleman between SRP 54 and SR beta. Along with SR beta, Schwartz crystallized the SRX domain, located at SR alpha's tail end; this is the domain that binds SR beta. The NG domain, localized at SR alpha's front end, interacts with the SRP 54-ribosome complex, guiding it to the membrane channel.

"The NG domain is like a flag SR alpha waves around, signaling SRP 54 with the location of the channel," says Schwartz. It is not yet known whether the SRP receptor first anchors to the membrane, and waves its "flag" from this stationary position; or conversely, waves the flag from a free-floating position in the cell, inducing the SRP 54-ribosome complex to follow it to the membrane channel.

Once the SRP 54-ribosome complex has been signaled by the SRP receptor, with all three molecular switches in the "on" position, a "molecular handshake" occurs between the SRP 54-ribosome complex and the membrane channel. Through a process currently poorly understood, the "ZIP Code" signal peptide is detached from the SRP 54-ribosome complex, and the protein inserted into the channel. Finally, all three GTPases revert to their "off" positions.

What's next for the researchers? "Now that we understand what SR beta is doing in the cell," Blobel says, "the question becomes: Why is there regulated assembly of the heterodimeric SRP receptor?" Schwartz adds that he is particularly interested in investigating why the complex, regulated assembly of the heterodimer occurs only in eukaryotes, not in simpler organisms such as bacteria.

A Gathering of Nobel Laureates: Science for the 21st Century - 96 -

Pre and Post Test for Günter Blobel

1. For what discovery in science did Günter Blobel win the 1999 Nobel Prize in Physiology or Medicine?

2. Where did Blobel do his research that led to his award of a Nobel Prize?

3. What is the significance of his discovery? List at least three applications of his discovery that affect our lives everyday. Explain your answer.

4. What is the history of the Nobel Prize? How are people nominated for a Nobel Prize? How many different types of Nobel Prizes are awarded each year?

5. What type of character traits do you think are needed to do the type of research that may lead to a Nobel Prize? Use examples from Blobel’s autobiography to support your answer?

6. Why are scientists so interested in conducting experiments about cells and proteins?

7. Why is the “Zip Code” of your cells so important?

8. What are some of Blobel’s current hobbies and interests?

9. What do you think Nobel Laureates visiting the Charlotte area want people to know, understand and appreciate about science?

10. Why do you think basic scientific research is important? How does science differ from technology? How are they related?

A Gathering of Nobel Laureates: Science for the 21st Century - 97 - A Gathering of Nobel Laureates: Science for the 21st Century - 98 - The Echo Foundation presents

“A Gathering of Nobel Laureates: Science for the 21st Century”

Dr. Edmond H. Fischer

©Peter Badge/Typos1 in coop with Foundation Lindau Nobelprizewinner Meetings at Lake Constance

The Nobel Prize in Physiology or Medicine 1992

With Edwin G. Krebs

"for their discoveries concerning reversible protein phosphorylation as a biological regulatory mechanism"

Dr. Edmond H. Fischer Professor Emeritus Department of Biochemistry University of Washington, Seattle, WA.

A Gathering of Nobel Laureates: Science for the 21st Century - 99 -

A Gathering of Nobel Laureates: Science for the 21st Century - 100 - Edmond H. Fischer Curriculum

Table of Contents Page

Fischer School Partnership Team 102

Edmond H. Fischer – The Person 103 Classroom Connections 105

Edmond H Fischer: Fact or Fiction? 106

Exciting interview: Sir Harold Kroto with Günter Blobel, 106 Edmond Fischer and Christiane Nüsslein-Volhard

The Regulation of the Function of the Tumor Suppressor Protein p53 107 The Experiment 107 Multiple Completion 107 Experiment Analysis 109 Four-choice Association 109 Correct Answers 110 Explanations 110

The 1992 Nobel Prize in Physiology or Medicine 111

The Discoveries of Fischer and Krebs 112 Classroom Connections 115

Gene Therapy Postpones Lou Gehrig’s Disease 116 Classroom Connections 117

The Key to Cell Motility 119 Classroom Connections 121

Pre and Post Test for Edmond Fischer 122

A Gathering of Nobel Laureates: Science for the 21st Century - 101 - The Echo Foundation

Presents

2004-2005 Project A Gathering of Nobel Laureates: Science for the 21st Century

Laureate Guest

Dr. Edmond H. Fischer

School Partnership Team Harding University High School Hopewell High School Philip O. Berry Technical Academy

School Facilitators Lezlie Pearson Berry Academy Deborah McRae Harding University High School Tammy Simons Hopewell High School

Science Liaisons Lezlie Pearson Berry Academy Tim Guilfoyle Harding University High School Renee Brice Hopewell High School

Curriculum Team Yvette Huet-Hudson*, Ph.D., University of North Carolina at Charlotte, Associate Professor of Biology Debbie Beam, BS Nursing, Charlotte Mecklenburg Schools, Medical Sciences Teacher, Berry Academy Susan Foxx, Charlotte Mecklenburg Schools, Science Content Coach Linda Simpson, MS, University of North Carolina at Charlotte, Lecturer, Retired

* Curriculum Team Leader

A Gathering of Nobel Laureates: Science for the 21st Century - 102 - Edmond H. Fischer – The Person

Autobiography

Memories of my early childhood are clouded with uncertainties because I was essentially separated from my parents since the early age of seven. I was born in Shanghai, China on April 6, 1920. My father had come there from Vienna, Austria after earning doctorates in law and business. My mother, born Renée Tapernoux, had arrived from France with her parents via Hanoi. Her father had left Switzerland as a young man to become a journalist for L'Aurore. This journal published the letter by Emile Zola entitled "J'accuse" in which he denounced the government cover-up during the Affaire Dreyfus which tore France apart at the turn of the century. When the case against Dreyfus collapsed in the early 1900s my grandfather left for French Indochina, then called le Tonkin. He later went to Shanghai where he founded the "Courrier de Chine", the first French newspaper published in China. He also helped to establish "l'Ecole Municipale Française" where I first went to school.

At age 7, my parents sent my two older brothers and me to La Châtaigneraie, a large Swiss boarding school overlooking Lake Geneva. My oldest brother, Raoul, was the first to leave to attend the ETH, the Swiss Federal Polytechnical Institute in Zürich where he was awarded a degree in engineering. My brother Georges went to Oxford and read law.

In 1935, I entered Geneva's all boys Collège de Calvin from which I obtained my Maturité Fédérale four years later, even as the specter of World War II loomed evermore menacing. While in school, I formed a lifelong friendship with my classmate Wilfried Haudenschild who dazzled me with his tinkering abilities, off-the-wall ideas and mechanical inventiveness. Together we decided that one of us should go into the Sciences and the other into Medicine so that we could cure all the ills of the world.

Another important event marked my High School days: I was admitted to the Geneva Conservatory of Music. I had heard Johnny Aubert give an unforgettable rendition of Beethoven's 5th Piano Concerto. I decided on the spot that I wanted to study with him. After an audition in which I nervously presented Mendelssohn's Rondo Capriccioso and Chopin's A-major, Polonaise, he took me on, and that spelled the beginning of many enthralling years. Music had always played an important part in my life, to such an extent that I even wondered whether I should not make a career of it. But finally I thought it better to keep music purely for pleasure.

It was my goal to become a microbiologist but Fernand Chodat, the Professeur of Bacteriology, argued that there was little future in that field, which was probably the case in Switzerland at that time. He advised me to get a diploma in Chemistry saying that, in any case, test tubes were of more use than a microscope to modern microbiologists.

I therefore entered the School of Chemistry just at the start of World War II. Two years of quantitative inorganic analyses seemed endless. Organic chemistry finally arrived like a breath of fresh air, if not a reprieve on life. I earned two Licences ès Sciences, one in Biology, the other in Chemistry and, two years later, the Diploma of "Ingénieur Chimiste". For my thesis, I elected to work with Prof. Kurt H. Meyer, Head of the Department of Organic Chemistry. "Le Patron" as we affectionately called him, was a most impressive person. At the time when most scientists showed little understanding of natural high polymers, Kurt Meyer had already authored several books on the subject, starting with the epochal "Meyer-Mark: Der Aufbau der hochpolymeren organischen Naturstoffe" and "Makromolekulare Chemie". His main interest lay in the

A Gathering of Nobel Laureates: Science for the 21st Century - 103 - structure of polysaccharides, particularly starch and glycogen. To unravel the structure of these molecules, enzymes were needed: alpha- and beta-amylases, phosphorylase, etc. Therefore, the lab was divided into two groups: the enzymologists under the guidance of Peter Bernfeld and carbohydrate chemists under Roger Jeanloz. I decided to work on the purification of hog pancreas amylase. Within a couple of years, we succeeded in crystallizing alpha-amylase from pork pancreas and soon after that, from a variety of other sources including human pancreas and saliva, two strains of A. oryzae, B. subtilis and P. saccharophila. It is at that time that Eric A. Stein joined the laboratory, beginning a marvelous 15-year collaboration and a lifelong friendship.

It had always been my intention to go to the United States to pursue my studies in Biochemistry. In those days, that field was in its infancy in most European universities to such an extent that I was asked to present the very first course in Enzymology as a Privat Docent at the University of Geneva in 1950. Two events hastened my departure for the USA: the untimely death of Kurt Meyer following an asthma attack and my being abruptly issued a US immigration visa. Apparently, the US consulates abroad were clearing their files before the complicated McCarran Act would come into effect. I had decided to go to CalTech on a Swiss Post-doctoral Fellowship that Professor Paul Karrer succeeded in securing for me on a moment's notice. Some friends who knew of my arrival in New York had arranged for me to give some seminars on my way to Pasadena: Maria Fuld at Pittsburgh and Henry Lardy at Madison. To my utter surprise, I was offered a job in both places. Then, upon my arrival at CalTech I found a letter from Hans Neurath, Chairman of the Department of Biochemistry at the University of Washington, inviting me to come to Seattle, apparently for the same purpose. I thought that the Americans had to be crazy since at that time, academic positions in Europe were one-in-a-million. I visited Seattle with my wife and thought that the surrounding mountains, forests and lakes were beautiful, reminiscent of Switzerland. The Medical School was brand-new and when I was offered an Assistant Professorship, I accepted and have never regretted that decision.

There were only seven of us on the faculty and we quickly became close friends. I remember the amused expressions of my colleagues seated in the back row of the class listening to my fractured English when lecturing the medical students. I also remember Ed Krebs' broad smile whenever I lapsed into French. What Ed didn't realize, though, is that within two years, while my English didn't improve very much, his deteriorated completely! Within six months of my arrival, Ed Krebs and I started to work together on glycogen phosphorylase. He had been a student of the Cori's in St. Louis. They believed that AMP had to serve some kind of co-factor function for that enzyme. In Geneva, on the other hand, we had purified potato phosphorylase for which there was no AMP requirement. Even though essentially no information existed at that time on the evolutionary relationship of proteins, we knew that enzymes, whatever their origin, used the same co-enzymes to catalyze identical reactions. It seemed unlikely, therefore, that muscle phosphorylase would require AMP as a co-factor but not potato phosphorylase. We decided to try to elucidate the role of this nucleotide in the phosphorylase reaction. Of course, we never found out what AMP was doing: that problem was solved 6-7 years later when Jacques Monod proposed his allosteric model for the regulation of enzymes. But what we stumbled on was another quite unexpected reaction: i.e. that muscle phosphorylase was regulated by phosphorylation-dephosphorylation. This is yet another example of what makes fundamental research so attractive: one knows where one takes off but one never knows where one will end up. These were very exciting years when just about every experiment revealed something new and unexpected. At first we worked alone in a small, single laboratory with stone sinks. Experiments were planned the night before and carried out the next day. We worked so closely together that whenever one of us had to leave the laboratory in the middle of an experiment, the other would carry on without a word of explanation. Ed Krebs had a small group that continued his original work, determining the structure

A Gathering of Nobel Laureates: Science for the 21st Century - 104 - and function of DPNH-X, a derivative of NADH. I was still studying the alpha-amylases with Eric Stein. In collaboration with Bert Vallee, we were able to demonstrate that these enzymes were in reality calcium-containing metalloproteins.

In those days, we waited all year for the next Federation Meeting or Gordon Conference. It was an occasion for me to get together with my friends on the East Coast: Herb and Eva Sober and Chris and Flossie Anfinsen from NIH, Bill and Inge Harrington from Johns Hopkins, Bert and Kuggie Vallee from the Brigham and Al and Lee Meister, then at Tufts and later at Cornell, and many others. I have forgotten much about the meetings themselves. There was the excitement of hearing about the latest breakthroughs, the frantic preparations for talks that had to be given, and the numerous notebooks filled with information, questions and problems that had to be solved. I will never forget, though, the marvelous time we had together speaking far into the night about anything and everything. Some of these friends are gone today but their memory is still vivid.

I have two sons, François and Henri, from my first wife Nelly Gagnaux, a Swiss National who died in 1961. I married my present wife Beverley née Bullock from Eureka, California, in 1963. She has a daughter Paula from a first marriage. All three of our children are now married and my two sons each have a son.I received the Werner Medal from the Swiss Chemical Society, the Lederle Medical Faculty Award; the Prix Jaubert from the University of Geneva and, jointly with Ed Krebs, the Senior Passano Award and the Steven C. Beering Award from Indiana University. I received Doctorates Honoris Causa from the University of Montpellier, France and the University of Basel, Switzerland and was elected to the American Academy of Arts and Sciences in 1972 and to the National Academy of Sciences in 1973.

From Les Prix Nobel 1992. http://nobelprize.org/medicine/laureates/1992/fischer-autobio.html

Classroom Connections:

1. Consider information you know about Dr. Fischer and other scientists and discuss why there might be a connection between musical ability and scientific success? Is this specific to one type of music?

2. What roadblocks did Dr. Fischer encounter throughout his life that could have served to block his progress toward his scientific achievements?

3. What personality attributes allowed Dr. Fischer to succeed throughout his life?

A Gathering of Nobel Laureates: Science for the 21st Century - 105 - Name: ______Date: ______

Edmond H. Fischer: Fact or Fiction?

After reading Edmond Fischer’s autobiography, fill in the blank with “Fact” if the statement is true about Edmond Fisher, or “Fiction” if the statement is NOT true. Be prepared to share the “true story” for the statements you mark as fiction.

_____ 1. Fischer originally considered a career in music and was accepted to the Geneva Conservatory of Music.

_____ 2. At age thirteen, Fischer was basically separated from his parents when they sent him to a Swiss boarding school.

_____ 3. Fischer discovery that muscle phosphorylase was regulated by phosphorylation-dephosphorylation was not the hypothesis he was trying to prove.

______4. Fischer had planned to study microbiology but when he was told there was no future in that field, he decided to major in chemistry.

_____ 5. Fischer was born in the United States on April 6, 1920.

_____ 6. Fischer studied the structure of proteins under the guidance of his mentor Kurt Meyer in Geneva.

______7. Fischer accepted a teaching position in Seattle because the mountains and lakes reminded him of Switzerland..

______8. Fischer began his study of enzymes when he worked on the purification of hog pancreas amylase in Geneva.

_____ 9. When he made his discovery, Fischer was trying to reveal the role of AMP in the phosphorylase reaction.

______10. Fischer made his discovery with his friend, Wilfried Haudenschild, while working on glycogen phosphorylase.

Interview Watch a taped interview with Günter Blobel, Edmond Fischer, and Christiane Nüsslein-Volhard at www.vega.org.uk.

A Gathering of Nobel Laureates: Science for the 21st Century - 106 - Problem-based Learning The Regulation of the Function of the Tumor Suppressor Protein p53 Jozsef Szeberenyi From the Department of Medical Biology, School of Medicine, University of Pe´ cs, Hungary

Terms to be familiar with before you start to solve the test: Tumor suppressor proteins; p53 protein; p53-positive and p53-negative tumors; transcription factors; protein phosphorylation; retinoblastoma protein; Go phase; apoptosis; chaperone; transfection; expression plasmid; cDNA; papillomavirus; Western blot analysis; -irradiation; mitotic index; [3H]thymidine labeling.

The Experiment The p53 tumor suppressor protein is an important regulator of cell fate.

Multiple Completion A question or incomplete statement is followed by four numbered completions, one or more of which are correct. Select A if 1, 2, and 3 are correct; B if 1 and 3 are correct; C if 2 and 4 are correct; D if only 4 is correct; E if all four are correct.

1. Which of the following statements describes the features of p53? 1. It is a transcription factor. 2. Its main function is to phosphorylate the retinoblastoma protein. 3. Cells enter the Go phase upon p53 action. 4. It has anti-apoptotic effects.

Tumors often carry p53 mutations, whereas in normal cells the level of p53 protein is under tight control exertedb y several mechanisms. The following test deals with the role of two proteins in this process. The enzyme NAD(P)H: quinone oxido-reductase (NQO)11 is involved in the redox regulation of the cells, whereas heat shock protein (Hsp)90 is a chaperone; both are important p53 regulators. p53-Negative human colon carcinoma cells were transfected with expression plasmids carrying the cDNAs of p53, NQO1, or the papillomavirus E6 gene. Twenty-four hours after transfection, protein extracts were prepared from the cells and Western blot analyses were performed using the appropriate antibodies. cDNA combinations used for transfection and the results of

A Gathering of Nobel Laureates: Science for the 21st Century - 107 - Western blotting are shown in Fig. 1. In the second experiment, two inhibitors were tested for their effects on -irradiated myeloid leukemia cells: the NQO1 inhibitor dicoumarol and the Hsp90 inhibitor radicicol. Western blots using anti-p53 and anti-actin antibodies are shown in Fig. 2. Study the figures and solve the following multiple-choice questions.

FIG. 1. Western blot analysis of human colon carcinoma cells transfected with p53, NQO1, and E6 cDNAs (for details

FIG. 2. The effect of -irradiation, dicoumarol, and radicicol treatment on myeloid leukemia cells (details in the text).

A Gathering of Nobel Laureates: Science for the 21st Century - 108 -

Experiment Analysis 1.The following statements are related to the information presented in the description of the experiment. Based on the information given, select A if the statement is supported by the information given; B if the statement is contradirected by the information given; C if the statement is neither supported nor contradicted by the information given.

2. The expression of actin gene is under p53 regulation. 3. Papillomavirus E6 oncoprotein induces apoptosis of human colon carcinoma cells transfected with p53 cDNA. 4. NQO1 forms a complex with the E6 protein in colon carcinoma cells.

Four-choice Association In this type of question, a set of lettered headings is followed by a list of numbered words or phrases. Select A if the word or phrase is associated with A only; B if the word or phrase is associated with B only; C if the word or phrase is associated with A and B; D if the word or phrase is associated with neither A nor B.

A: NQO1 enzyme B: Hsp90 protein C: Both of them D: Neither of them

5. Its activation stimulates p53 breakdown.

The following problems [6–9] were not studied in this experiment, but correct conclusions can be drawn from knowing the mechanism of action of the p53 protein. 6. It causes the accumulation of DNA damage in the cells. 7. Enhanced activity of this enzyme increases the mitotic index of the cell population. 8. It stimulates the phosphorylation of retinoblastoma protein. 9. Stimulates [3H]thymidine labeling of the nuclei of leukemia cells.

Reference [1] G. Asher, J. Lotem, R. Kama, L. Sachs, J. Shaul (2002) NQO1 stabilizes p53 through a distinct pathway, Proc. Natl. Acad. Sci. U.S.A. 99, 3099–3104. 436 BAMBED, Vol. 31, No. 6, pp. 435–436, 2003

The abbreviations used are: NQO, NAD(P)H:quinone oxidoreductase; Hsp90, heat shock protein 90 kDa; MCQ, multiplechoice question. BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Printed in U.S.A. Vol. 31, No. 6, pp. 435–436, 2003 This paper is available on line at http://www.bambed.org 435 © 2003 by The International Union of Biochemistry and Molecular Biology

A Gathering of Nobel Laureates: Science for the 21st Century - 109 - Correct Answers 1. B 6. D 2. B 7. D 3. B 8. D 4. C 9. D 5. D

Explanations The p53 protein is a transcription factor that is able to suppress malignant transformation of cells by several mechanisms. It induces 1) proteins involved in DNA repair to eliminate DNA damage; 2) cyclin- dependent kinase (Cdk) inhibitors to evoke quiescence (Go phase); and 3) pro-apoptotic proteins to kill cells with unrepairable DNA damage (MCQ1: B). The actin gene is not among those genes regulated by p53 (compare samples 2 to 5 in Fig. 1; MCQ2: B). The E6 oncoprotein is able to down-regulate p53 (compare samples 2 and 4 in Fig. 1), and this antiapoptotic effect contributes to the oncogenic action of papillomaviruses (MCQ3: B). NQ01 prevents the effect of E6 (compare samples 3, 4, and 5 in Fig. 1), but possible complex formation between these two proteins was not analyzed in this experiment (MCQ4: C). -Irradiation causes DNA damage and thereby increases the level of p53 in p53-positive cells (compare samples 1 and 4 in Fig. 2). The effect of dicoumarol and radicicol indicates that both NQ01 and Hsp90 is involved in the mediation of this effect (compare samples 4, 5, and 6 in Fig. 2). Both proteins are, thus, involved in DNAdamage-stimulated signaling processes leading to p53 induction (MCQ5: D). DNA repair (MCQ6: D) and inhibition of the cell cycle by blocking the phosphorylation of retinoblastoma protein by cyclin-dependent kinases (MCQ7: D, MCQ8: D, MCQ9: D). These experiments suggest that the inhibition of Hsp90 is unlikely to stop malignant cell proliferation in p53-positive myeloid leukemia patients (MCQ10: E).

A Gathering of Nobel Laureates: Science for the 21st Century - 110 - Press Release: The 1992 Nobel Prize in Physiology or Medicine

NOBELFÖRSAMLINGEN KAROLINSKA INSTITUTET THE NOBEL ASSEMBLY AT THE KAROLINSKA INSTITUTE 12 October 1992

The Nobel Assembly at the Karolinska Institute has today decided to award the Nobel Prize in Physiology or Medicine for 1992 jointly to Edmond H. Fischer and Edwin G. Krebs – for their discoveries concerning "reversible protein phosphorylation as a biological regulatory mechanism".

Summary Thousands of proteins participate in a complex interplay in a cell. They are the tools of the living organism, regulating its reactions and activities. For example, proteins maintain the metabolic flux, dictate growth and cellular division, release hormones, and mediate muscular work.

Protein interactions are strictly controlled. One of the most important regulatory mechanisms is reversible protein phosphorylation. This means that enzymes phosphorylate and dephosphorylate proteins. Both these enzymatic processes are in turn regulated, often in several steps, allowing amplification and fine control. The 1992 Nobel Prize in Physiology or Medicine is awarded to the American biochemists Edmond Fischer and Edwin Krebs. They purified and characterized the first enzyme of this type. Their fundamental finding initiated a research area which today is one of the most active and wide-ranging.

Reversible protein phosphorylation is responsible for regulation of processes as diverse as mobilization of glucose from glycogen, prevention of transplant rejection by cyclosporin, and development of a cancer form like chronic myeloic leukemia.

Reversible protein phosphorylation Thousands of proteins participate in the complex interplay in a cell. They constitute the tools of the living organism, regulating all its reactions and activities. For example, proteins maintain the metabolic flux, dictate growth and cellular division, release hormones, and mediate muscular work. Proteins are composed of amino acid residues and have a defined three-dimensional structure. It is this form that dictates the molecular functions. The interactions are strictly regulated. One of the most important mechanisms is phosphorylation of proteins. This means covalent attachment of one or several phosphate groups to the protein.

Reversible protein phosphorylation. A protein kinase moves a phosphate group (P) from ATP (ADP(P)) to the protein. The biological properties of the protein are thereby altered. There is also a protein phosphatase that is able to remove the phosphate group. The amount of phosphate that is associated with the protein is thus determined by the relative activities of the kinase and the phosphatase.

The phosphorylation influences the conformation and charge of the protein, thereby also its activity. In this manner, the biological function of a protein can be set at different levels. However, the phosphate groups can also be removed from the protein in a regulated fashion dephosphorylation. This fact constitutes the basis for the designation reversible protein phosphorylation.

A Gathering of Nobel Laureates: Science for the 21st Century - 111 -

The Discoveries of Fischer and Krebs Edmond Fischer and Edwin Krebs characterized the first protein, which revealed a novel mechanism for enzyme control through reversible protein phosphorylation. The basic discoveries were made in the mid 1950's through studies of a special muscle system.

Muscles are composed of a large number of cells capable of contraction or relaxation. For a resting muscle to contract, it has to get energy in the form of sugar, glucose. The glucose is released from glycogen, which is the body storage form of sugar. Glycogen is stored in the liver, and also in muscle cells. When they are told to initiate contractile work, they quickly mobilize their glycogen deposits, converting them to the glucose fuel. In order to achieve this, the organism utilizes a specific glycogen catabolizing protein, termed phosphorylase. This enzyme was discovered by the biochemists Carl and Gerti Cori, bestowing them with the Nobel Prize in Physiology or Medicine in 1947. Enzymes are proteins with the specific role of making biological reactions possible, in short, they are catalysts.

It was known that the enzyme phosphorylase can be regulated by small molecules. Edmond Fischer and Edwin Krebs detected that phosphorylase could be converted from an inactive to an active form by a principally novel mechanism. This is carried through by transfer of a phosphate group from the energy- rich compound ATP to the protein. They also showed that this process is catalyzed by an enzyme, a protein kinase.

Enzymes do not only catalyze the attachment of phosphate groups but also their removal. Such enzymes are named phosphatases. In this manner, the glycogen catabolizing phosphorylase is regulated by two enzymes working in opposing directions in a reversible process, one kinase and one phosphatase. Fischer and Krebs, in their fundamental biochemical studies, showed how proteins in the muscle cell rapidly make the energy supply accessible for muscular work.

A mechanism of biological amplification Step by step, it has become evident that protein phosphorylation constitutes a fundamental mechanism, influencing all cellular functions. For example, Edwin Krebs showed that the effects of cyclic AMP are mediated through a specific protein kinase. Cyclic AMP was discovered by Earl Sutherland (Nobel laureate 1971). It is formed in response to a large number of hormones and molecular signals. The stress hormone, adrenalin (epinephrine), mediates catabolism of glycogen stored in the liver. This liberates glucose into the blood, giving the muscle and heart energy to combat stress.

The fact that cyclic AMP mediates its effects via stimulation of a protein kinase activating the enzyme phosphorylase explains how a hormone signal can lead to quick mobilization of sugar. The serial protein phosphorylations then work as a biological amplifying system.

Protein phosphorylation reactions that are coupled in series can act as a biological amplifier. We are dealing with a controlled chain reaction. When the level of glucose in blood is lowered the amount of the hormone adrenaline rises. This elevates the cyclic AMP content in the liver cell. This activates a cyclic AMP dependent protein kinase, which phosphorylates a kinase that in turn switches on the glycogen degrading enzyme phosphorylase. Hence glycogen is converted to glucose, which can enter the blood stream. When the blood glucose rises, the adrenaline level in blood goes down. The stimulation is turned off and the phosphatase reactions take over turning the glucose production down. In muscle cells a rise in calcium is the signal for muscular work. Calcium ions also switch on the phosphorylation reactions so that the muscle is provided with the required energy.

A Gathering of Nobel Laureates: Science for the 21st Century - 112 -

Subsequent to these findings of Fischer and Krebs, novel protein kinases are continuously found. We now estimate that perhaps, one percent of the genes in the entire genome encode protein kinases. These kinases regulate the function of a large proportion of the thousands of proteins in a cell. In addition, the system includes a large number of phosphatases, which in an opposite manner regulate the removal of the protein phosphate groups from proteins.

Inhibitors and activators Some of the innumerable cellular processes regulated by reversible protein phosphorylation. They concern almost all processes important to life. Imbalance between kinases and phosphatases can cause disease and nondesirable tissue reactions. Blood pressure, the inflammatory reaction, and brain signal transduction - just to name a few examples - are being regulated through different hormonal interactions and these interactions in turn are mediated through kinases and phosphatases. We therefore expect the development of drugs, which make it possible to influence imbalances by supplying inhibitors and activators directed against the phosphorylation/dephosphorylation components.

How the cell is affected by protein phosphorylation. 1. Hormone receptors (e.g. the adrenaline receptor) are phosphorylated by specific kinases, which prevent over-stimulation. 2. Phosphorylation can control cell shape and motility. It can even lead to the outgrowth of long processes 3. Phosphorylation of ribosomes, affect protein synthesis. 4. Proteins that regulate genes can be reversibly phosphorylated, causing an adapted expression of the genomic information. 5. Hormones and neurotransmitters are contained in storage vesicles. Phosphorylation reactions regulate their release. 6. The proteins that control muscle contraction can be phosphorylated by kinases. Reversible protein phosphorylation thereby affects e.g. blood pressure and respiration. 7. Phosphorylation regulates the enzymes that govern metabolism.

Phosphorylation stimulates cellular growth The wide-ranging importance of reversible protein phosphorylation makes it difficult to select a single, representative example when so many could be chosen with equal right. However, the activation of the immune response constitutes a suitable model. It illustrates how a series of protein phosphorylations in a cascade amplifies the strength of the initial signal. It further shows how phosphorylation and dephosphorylation intimately interact. The model also gives an insight into work performed by Fischer and Krebs in recent years. The example also shows how drugs that influence phosphorylations are used to save transplants threatened by rejection.

In infections, our immune system is activated by non-self compounds, the antigens. They are consumed by macrophages which transport the antigenic constituents to defined surface structures (Nobel Prize 1980 to Benacerraf, Dausset and Snell). The antigens are then recognized by specialized lymphocytes. The lymphocytes get into contact with the macrophages via a special surface protein. Edmond Fischer showed that this protein works as a phosphatase, removing a phosphate group from an enzyme. This constitutes the start of a chain reaction where a whole cascade of novel phosphorylating enzymes (including several detected by Edwin Krebs) are activated. Their counterparts, the phosphatases, are equally essential in the extended cascade. In the end, an elevated number of specific lymphocytes have been recruited to combat the infection.

However, sometimes the immune defense causes problems, for example following organ transplantations. The recipient's immune response then attacks the transplanted kidney, liver or pancreas, trying to reject it. Cyclosporin is a drug used with great success in prevention of such graft rejection. It works by intervention of a phosphorylation reaction - it inactivates the phosphatase calcineurin. This enzyme is necessary for development and growth of the specific lymphocytes that attack the transplant. A Gathering of Nobel Laureates: Science for the 21st Century - 113 -

Under certain conditions, protein phosphorylation can also be of importance for development of cancer. The nuclear DNA of the cell contains one hundred-odd oncogenes. Normally, they produce proteins participating in the regulation of cellular growth. However, should alterations in the oncogenes, mutations, develop, this can lead to formation of products that give abnormal cellular growth, cancer. In several instances an erroneously regulated protein kinase activity is responsible. Chronic myeloic leukemia constitutes such an example.

References

Alberts et al. The Molecular Biology of the Cell. Garland Press, 1990, 2nd edition.

Phosphorylation-dephosphorylation cycle of proteins pp. 129-131, 710-712, 736-737, 777-778.

Fredholm, B. Molekylär farmakologi - vägen till selektiv farmakoterapi. Läkartidningen 1991, 88: 320- 421.

A Gathering of Nobel Laureates: Science for the 21st Century - 114 - Classroom Connections: Use Your Brain To Investigate

What do you think the following words mean? If you are not sure, use the creative part of your brain and GUESS! Then research the real definition of the word and see how well you did. Defining these words will help you understand Edmond Fischer’s discovery and its impact on medicine.

Term My Definition The REAL Definition

Phosphorylation

Kinase

Proteins

Phosphatase

Dephosphorylation

Glycogen

ADP

Catabolism

Enzymes

Transduction

Antigens

Laureate

A Gathering of Nobel Laureates: Science for the 21st Century - 115 - THE PRESIDENT’S REPORT OF THE SALK INSTITUTE FOR BIOLOGICAL STUDIES

Gene Therapy Postpones Lou Gehrig’s Disease

Salk professor Fred H. Gage and his team have developed a unique gene therapy method that postpones the symptoms and nearly doubles life span in a mouse model of Lou Gehrig’s disease, which affects more than 30,000 Americans. Lou Gehrig’s disease, or amyotrophic lateral sclerosis (ALS), is marked by the degradation of nerve cells that control muscle movement. It quickly attacks motor nerve cells in the brain and spinal cord, resulting eventually in paralysis and death. Its cause is unknown. While the disease was first identified in the 19th century, it gained international attention in 1939 when baseball great Lou Gehrig announced he had ALS and retired from the New York Yankees. He died two years later. The findings are the first to show a significant degree of recovery after the crippling nervous system disorder begins and may lead eventually to a new, gene-based treatment for the disease. The study appeared in the August 8 issue of the journal Science. Gage, Salk researcher Brian Kaspar, Jeffrey Rothstein, professor of neurology at Johns Hopkins University and their colleagues found that injecting a virus into muscles containing a gene that produces the nerve cell growth-stimulating protein called insulin-like growth factor-1 (IGF-1) resulted in longer life spans, preserved nerve cells and reduced muscle wasting. “IGF-1 protein has been used in clinical trials for a while, with marginal results,” said Gage. “The biggest challenge has been to deliver the protein across the blood-brain barrier into the central nervous system. By injecting the virus containing the IGF-1 gene into muscles, the gene for IGF-1 reached nerve cells that controlled the muscle, resulting in the preservation of those nerve cells that would otherwise have succumbed to ALS.” Gage and his colleagues found that delivery of gene therapy into muscle delayed the disease’s onset by 31 days and expanded the mice’s life span up to 265 days, compared to 140 days for the untreated mice. In addition to extending survival, the gene therapy treatment improved physical movement for the mice and increased their muscle mass by 20 percent. The researchers demonstrated that IGF-1 triggers a molecular pathway that appears to preserve motor nerve function. When the receptor for IGF-1 is activated, an enzyme called Akt has a phosphate molecule added to it (a process called phosphorylation). The Akt enzyme is then activated and helps block the process of apoptosis, or programmed cell death. While this research is still in the experimental animal stage and a number of steps need to be taken before any possible therapy is deemed safe and effective enough for use, researchers are in the planning stages of human trials for this gene therapy method.

www.salk.edu/news/publications/InsideSalk_09_03.pdf

A Gathering of Nobel Laureates: Science for the 21st Century - 116 - Classroom Connections: WebQuest Relating Disease to Edmund Fischer’s Research

Introduction: Phosphorylation is the chemical addition of a phosphate group (phosphate and oxygen) to a protein or another compound (www.health-discovery.com). Protein phosphorylation regulates almost all aspects of cell life (Cohen, 2004). It is a reversible process. As scientists recognized the implications of this discovery by Edmund Fischer and Gerhard Krebs, it became increasingly important to reward them for their accomplishment! In 1992, they were awarded the Nobel Prize in physiology for their work.

Phosphorylation, when malfunctioning such as in hyperphosphorylation contributing in a series of events to Alzheimer's disease, can contribute to or cause disease (Lu et al, 2003).

The pharmaceutical industry is harnessing knowledge based upon the proper functioning of phosphorylation in the body to create drugs to treat many of these disorders. As many as one-third of drug discoveries in the world are concentrating on targeting protein kinases and phosphatase (Cohen, 2004).

Task: • Form groups of three to four students. • Choose a disease from the list below. Alzheimer’s disease Parkinson’s disease Diabetes Cancer Rheumatoid arthritis • Use a Search Engine such as www.google.com or www.askjeeves.com to research your disease. • Determine the following information about your disease. BE SURE TO CITE YOUR SOURCES! What causes this disease? Is this disease more prevalent in one area of the world or a particular group of people? If so, what area and/or what group of people? Why? How does this disease manifest itself? How is the disease diagnosed? How is the disease currently treated? Are there any promising cures that may be available in the future? If so, what? What is the prognosis (or outlook) for people with the disease? How is this disease related to Edmund Fischer’s research on phosphorylation? • Create a poster with the information neatly summarized. Include graphics such as tables, concept maps, geographic maps, pictures and/or charts that are relevant to your research. Be certain that your information credits the sources that you used to find the information and/or graphics. • Present the information as directed by your teacher.

A Gathering of Nobel Laureates: Science for the 21st Century - 117 - Rubric for Relating Disease to Edmund Fischer’s Research:

Unsatisfactory Satisfactory Good Excellent Mechanics Four or more Three spelling No more than No spelling or spelling and/or and/or grammar two spelling grammar errors grammatical errors in text on and/or grammar found errors in text on poster errors in text on poster poster Organization No attempt is An attempt is Content is Content is made to made to organized by organized by organize the organize subtitles on subtitles on content and content and poster. Content poster. visuals on the visuals on the relates to Subtitles are poster. poster. subtitle. Content Content failed Content Content Content to address answers many answers all answers and questions posed questions posed questions posed exceeds in task. in task. Little in task. Some questions posed attempt is made attempt to link in task. Direct to link phosphorylation link is made phosphorylation is made. between with the disease phosphorylation and disease. Visuals No visual is One visual that Two different Three or more present. is directly types visuals different types related to and that are directly visuals that are enhance content related to and directly related is present on enhance content to and enhance poster. are present on content are poster. present on poster. Presentation Little or no Some Most content Content and sequential sequential and visuals are visuals are organization is organization is organized organized present. Poster evident. Poster sequentially sequentially is not neat. is generally and neatly. and neatly on neat. the poster Works cited No works are An attempt is Most visuals All visuals and cited. made to cite and content content some sources. includes source includes source cited. cited.

A Gathering of Nobel Laureates: Science for the 21st Century - 118 - The Scripps Research Institutes News and Views

The Key to Cell Motility By Jason Socrates Bardi

Scientists at The Scripps Research Institute have described the regulatory mechanism of an important human protein called Rac that controls a number of biological processes and is directly implicated in several human diseases.

Rac is involved in tumor growth and metastasis in cancer; it is important for the proper functioning of immune cells and is necessary for the innate immune response; it is required for neuronal function and has been implicated in neurological diseases and mental retardation.

"Understanding the basic mechanism of how Rac activation is regulated," says Professor Gary Bokoch, "is a key to understanding [these sorts of diseases]."

In an article appearing in the latest issue of the journal Molecular Cell, Bokoch and his colleagues Celine DerMardirossian and Andreas Schnelzer at Scripps Research have described the molecular mechanism whereby Rac activation is regulated by a molecule called Pak.

The Rac-Pak Connection and Its Relevance to Disease

Rac is one of the most important members of a family of proteins known as the Rho GTPases. This family of proteins binds to a small metabolic product called GTP, which acts as a critical regulator of Rho GTPase activity. This enables Rac to regulate a wide variety of cellular functions that span the entire gamut of a cell's life, from its initial growth and differentiation, to its movement and division, and finally to its death. They are important for gene expression, and they play crucial roles in the ability of innate immune cells to make lethal responses to bacterial infections, of skin cells to cover wounds during the healing process, of vascular cells to make new blood vessels, of cancer cells to metastasize, and of neurons to develop and make proper connections in the brain.

Two years ago Bokoch and his Scripps Research colleagues discovered that Rac is one of the master regulators of cell motility—the molecules driving the process that places the cell's "hands" on the steering wheels and "feet" on the gas pedals. They discovered that Rac is spatially and temporally regulated during leading-edge extension and tail contraction during the movement of human neutrophils—the phagocytic blood cells that chase down, engulf, and destroy bacterial pathogens as part of the body's innate immune response.

One of the big questions that remained unanswered, however, was how Rac was regulated to become active in the first place. What were the master switches that control the activity of Rac and the fundamental cell processes it controls?

All that was known until recently was that inside cells, Rac is controlled by a protein known as RhoGDI, which is in the cell's cytosol. Rac is inactive in resting cells because it is bound to RhoGDI. This keeps the Rac in the cytosol and away from the cellular membrane, where Rac's molecular targets reside. When the cell receives activation signals, the Rac GTPases will dissociate from the RhoGDI in the cytosol and move to the ruffles at the edges of the cell where they are needed. Thus, Rac must be released from RhoGDI for Rac to become active.

A Gathering of Nobel Laureates: Science for the 21st Century - 119 -

"Nobody had any idea how this happened," says DerMardirossian.

Now Bokoch, DerMardirossian, and Schnelzer have discovered the mechanism whereby Rac is released from RhoGDI. In their current study, they show in vitro and in vivo that Rac is released from RhoGDI by an enzyme called p21-activated kinase (Pak). Pak is a kinase enzyme. Its job in the cell is phosphorylation—to attach phosphate groups to other molecules inside the cells in order to modify their function.

Pak attaches its phosphate to two serine residues within the portion of RhoGDI that Rac normally binds to. These bulky and negatively charged phosphates disrupt the normally cozy bond Rac shares with RhoGDI. Freed from the RhoGDI, Rac can then become activated and move about the cell to act on its target molecules and regulate cell function.

Interestingly, one of the targets of active Rac is the enzyme Pak itself. This suggests that Pak and Rac can participate in a positive feedback loop whereby active Rac stimulates Pak, and the active Pak then induces more Rac activation. Such regulation may be important for maintaining continuous cell movement.

The article, "Phosphorylation of RhoGDI by Pak1 mediates dissociation of Rac GTPase" by Celine DerMardirossian, Andreas Schnelzer, and Gary M. Bokoch appears in the July 2, 2004 issue of the journal Molecular Cell. See http://www.molecule.org.

This work was funded through a grant from the National Institutes of Health, by a German Academic Exchange fellowship, and by an American Heart Association—Western affiliate fellowship

http://www.scripps.edu/newsandviews/e_20040706/bokoch.html

A Gathering of Nobel Laureates: Science for the 21st Century - 120 - Classroom Connections:

Overview Discussion Question:

Discussions concerning the direction and role of scientific research frequently center around the question of basic research vs. applied research. To roughly define these terms we can think of basic research as being "curiosity and question-driven", while applied research is more "demand or problem driven", sometimes with a commercial application. In light of what you have learned as you study about Dr. Fischer and his work, how might you argue for the importance of supporting basic research to those who propose that the majority of research funding should go primarily to those areas that have a direct application?

A Gathering of Nobel Laureates: Science for the 21st Century - 121 -

Pre and Post Test for Edmond Fischer

1. For what discovery in science did Edmond Fischer win the 1992 Nobel Prize in Physiology or Medicine with Edwin Krebs?

2. Where did Fischer do his research that led to his award of a Nobel Prize?

3. What is the significance of their discovery? List at least five applications of their discovery that affect our lives everyday. Explain your answer.

4. What is the history of the Nobel Prize? How are people nominated for a Nobel Prize? How many different types of Nobel Prizes are awarded each year?

5. What type of character traits do you think are needed to do the type of research that may lead to a Nobel Prize? Use examples from the autobiography of Fischer to support your answer?

6. Why are scientists so interested in conducting experiments about proteins?

7. How does protein phosphorylation influence cellular functions?

8. What are some of his current hobbies and interests?

9. What do you think Nobel Laureates visiting the Charlotte area want people to know, understand and appreciate about science?

10. Why do you think basic scientific research is important? How does science differ from technology? How are they related?

A Gathering of Nobel Laureates: Science for the 21st Century - 122 - The Echo Foundation presents

“A Gathering of Nobel Laureates: Science for the 21st Century”

Dr. Christiane Nüsslein-Volhard

©Peter Badge/Typos1 in coop with Foundation Lindau Nobelprizewinner Meetings at Lake Constance

The Nobel Prize in Physiology or

Medicine 1995

With Edward B. Lewis and Eric F. Wieschaus

"for their discoveries concerning the genetic control of early embryonic development"

Dr. Christiane Nüsslein-Volhard Scientific Member of the Max-Planck Society Director at the Max-Planck Institute Professor of Biology, Genetics Division, University of Tübingen

A Gathering of Nobel Laureates: Science for the 21st Century - 123 - A Gathering of Nobel Laureates: Science for the 21st Century - 124 - Christiane Nüsslein-Volhard Curriculum

Table of Contents Page

Nüsslein-Volhard School Partnership Team 126

Christiane Nüsslein-Volhard – The Person 127 Classroom Connections 134

Exciting interview: Sir Harold Kroto with Günter Blobel, 135 Edmond Fischer and Christiane Nüsslein-Volhard

Current Interests - Christiane Nüsslein-Volhard 136

The Nobel Assembly at the Karolinska Institute 138

Overview of Discovery of the Genetic Control of Early Embryonic Development 142

Implications Of Nüsslein-Volhard’s Work 150

“A Turning Point in the History of Developmental Genetics” Article 153 Discussion Questions 158

Classroom Connections 159

Discussion Questions 160

Case Studies 161

Pre and Post Test Questions for Christiane Nüsslein-Volhard 163

A Gathering of Nobel Laureates: Science for the 21st Century - 125 - The Echo Foundation

Presents

2004-2005 Project A Gathering of Nobel Laureates: Science for the 21st Century

Laureate Guest

Dr. Christiane Nüsslein-Volhard

School Partnership Team Butler High School North Carolina School of Science and Mathematics Northwest School of the Arts Providence Day School

School Facilitators Jennifer Day Butler High School Beverly Eury Northwest School of the Arts Anna Wilbanks Providence Day School

Science Liaisons Cindy Kendrick Butler High School Thomas Booker Northwest School of the Arts Michelle Sivy Providence Day School

Curriculum Team David Royster*, Ph.D, University of North Carolina at Charlotte, Center for Mathematics, Science and Technology Education Fred Marsh, retired Chemist Linda Mayfield, Charlotte Mecklenburg Schools, Science Content Coach Rosie Tong, Ph.D, University of North Carolina at Charlotte, Distinguished Professor of Health Care Ethics, Department of Philosophy, Director of Center for Professional and Applied Ethics

* Curriculum Team Leader A Gathering of Nobel Laureates: Science for the 21st Century - 126 -

Christiane Nüsslein-Volhard – The Person Autobiography I was born during the war, on October 20, 1942, as the second of five children. My father, Rolf Volhard, was an architect. He was the eighth of ten children of Franz Volhard, a professor of medicine in Frankfurt, and specialist for heart and kidney. My mother's mother, Lies Haas-Möllmann, was a painter but had given up her career for her family. I remember her well, because I visited her frequently during Easter vacation in her apartment in Heidelberg. She was a remarkable woman of strong discipline and character, who interested me very much. Her paintings and drawings are very beautiful, impressionist style, and show a great eye. I do not remember my other grandparents. Both my father and mother were from families with many children, and I once counted and found that I have 33 cousins! Most of my relatives lived rather close to us in Frankfurt, or Heidelberg, so I know most of them reasonably well, with some I am good friends. We lived in a flat in the south of Frankfurt, with a rather large garden, close to the forest. I had a happy childhood, with many stimulations and support from my parents who, in postwar times, when it was difficult to buy things, made children's books and toys for us. We had much freedom and were encouraged by our parents to do interesting things. I remember that my father showed much interest in what we did, and thereby had a great influence in our performances, without being particularly ambitious (although good grades at school were more or less a matter of course). I tried to explain to him what we did in mathematics, and we discussed Goethe's scientific papers. My mother had great social talents and a very good way of taking care of children, and other people who needed help, in an unassuming and practical way. Both my parents were good musicians, and painted, so we kids did that too, with much pleasure and support. I learned to play the flute, but, although I tried hard, I never drew as well as my sisters and my brother. When we grew up we did not have much money, so we learned to sew our own dresses, and generally were educated to make things we could make ourselves, rather than buying them, or finding other people to make them for us. One sister and my brother are architects, another sister studied music, and the youngest sister studied to be an arts teacher. We have been and are still very close. I remember that already as a child I was often intensely interested in things, obsessed by ideas and projects in many areas, and in these topics I learned much on my own, reading books. Early on I was interested in plants and animals. I think I knew at the age of twelve at the latest that I wanted to be a biologist. As a small child I had spent several vacations on a farm in a little village, the refuge of my grandparents in the last year of the war. I have very fond memories of these visits, the people were very kind and allowed me to help with the animals and with harvesting, and the food was wonderful. I loved our garden and kept some pets, but I missed having someone knowledgeable in plants and animals, who could explain things to me, so I tried to find out much by myself, and from books. Within my family I was the only one with lasting interests in sciences. This was supported by my parents by giving me the right books, and by my brother and sisters by listening to my tales and theories. I enjoyed high school where I learned a lot from excellent teachers. As I was lazy and rarely did my homework, I finished high school with a rather mediocre exam. I almost did not pass in English language. Recently, my previous teachers allowed me to see their report on my high school performances, which included the following statements: Despite the fact that her talents are rather equally spread among many areas of knowledge, her performances are rather different depending on the distribution of her interests. Thus, with her strong display of self will she can be decidedly lazy in some topics over years, while in her areas of interests she performs to a degree far extending that required for normal school purposes. Thereby she gets into increasing difficulties and a certain nervosity, because she simply cannot cope with everything she would and should like to perform, and then loses stamina. On the other hand, the statement

A Gathering of Nobel Laureates: Science for the 21st Century - 127 - also acknowledges that she is gifted above average, has a critical and qualified judgement, and the talent for independent scientific work. Luckily, school education was good and interesting, particularly German literature, mathematics and biology. We had very engaged teachers, mostly women. In the final class our biology teacher discussed many modern topics with us such as genetics, evolution, and animal behavior. I remember that I tried to develop a new theory about evolution, when we discussed Darwin at school. For the celebration of our Abitur, at the end of high school, I gave a speech "On language of animals" (Sprache bei Tieren). This speech was the result of reading of Konrad Lorenz and other German biologists on animal behavior that interested and still interests me much. My father died suddenly on the day of my high school exam, on the 26th of February 1962. At the time I finished high school, I was determined to study biology, deeply convinced to eventually be a researcher. I had briefly considered studying medicine, because of its relevance to mankind. To find out whether I could be attracted to studying medicine, I did a one month course as a nurse in a hospital. This experience greatly supported my conviction not to become a doctor. Initially I was disappointed by the university and missed school, and my friends at school. I also was rather shy and found it quite difficult to design my curriculum on my own and get to know fellow students. The courses in biology in Frankfurt University were quite dull at the time, it seemed that I knew the more exciting things already, and what was new was boring, although there was one course in botany which I enjoyed. Soon I discovered physics, by an excellent series of lectures by Martienssen, a professor of experimental physics in Frankfurt. I also did courses in mathematics and theoretical mechanics, which fascinated me for a year, until I found these topics too difficult. Via the class in chemistry I got reminded of my true interests in biology. At that time (Summer 1964) a new curriculum for biochemistry, the only one of its kind in Germany, was started in Tübingen, and I made up my mind quickly, and went there to study biochemistry, leaving family and friends behind. Being a student in Tübingen, a very lovely old town, was fun. I lived close to the market place, right across from the best movie theater. Rather primitive, but pretty, no shower, cold water, no central heating, but everybody I knew lived like that and it was quite romantic. My friends were largely language students, studying Latin, and Rumanian, and English language. I did not like the biochemistry curriculum very much, too much organic chemistry, too little biology. But on the whole it was a good thing to do, because it provided a very solid training in many basic courses, such as physical chemistry with thermodynamics, and stereochemistry, which I liked. In the final year two new professors taught microbiology and genetics, which I liked very much, and I also had a chance to attend seminars and lectures from scientists of the Max-Planck-Institut für Virusforschung, Gerhard Schramm, Alfred Gierer, Friedrich Bonhoeffer, Heinz Schaller, and others. They were teaching very modern things such as protein biosynthesis and DNA replication. This excited me much although I hardly understood the lectures at the time. I did my exams for the Diploma in biochemistry in 1969, as usual for me, with rather mediocre grades because I had not always paid attention, and often had lost interest. From Heinz Schaller with whom I did my Diploma work I got my first real training in a laboratory. I was his first graduate student and very keen. Heinz is a chemist, and taught me to think in quantitative terms, yields, completeness of reactions, he is an excellent experimenter. My first thesis project on the comparison of DNA sequences of small phages by RNA-DNA hybridization was given up, after the realization that it would involve predominantly the refinement of techniques, with uncertain success. I finally developed a new method for large-scale purification of very clean RNA polymerase, and, in collaboration with another graduate student and friend, Bertold Heyden, isolated RNA polymerase binding sites from fd Phage in order to understand the structure of a promoter. We determined the composition of the strongest binding site and found it to be rather different from that of other sites such as the strongest of ØX 174 and the second strongest from fd. At the time DNA sequencing was not easily

A Gathering of Nobel Laureates: Science for the 21st Century - 128 - possible, so we characterized the sequences by their oligopyrimidine pattern, for which we had developed a new and simple method. It was a quite interesting story, which got published as a letter to NATURE. Although I was an experienced molecular biologist, I got bored with my projects at the end of my thesis (1973). The prospect of continuing the study of transcriptional control via the structure of promoter regions meant developing new methods for DNA sequencing. The field of recombinant DNA technology was growing and a fellow student and good friend, Peter Seeburg, argued strongly for it. I was sceptical, and at that early time, like most other people in Tübingen, did not foresee its powers. At that time, the Max-Planck-Institutes in Tübingen were interesting places. Wolfgang Beermann and Alfred Gierer taught courses in cell and molecular biology. The Friedrich-Miescher-Laboratory was founded, with Friedrich Bonhoeffer, Günther Gerisch and Rolf Knippers as first group leaders. In the laboratory of Alfred Gierer, people were studying regeneration processes in Hydra. Gierer and Hans Meinhardt, a theoretician, developed their gradient model explaining self organisation of polarity from initial fluctuations by lateral inhibition. Although I was far from understanding the model, I realized how interesting the problem of pattern formation was. I looked around and sought advise from two of the hydra people, the American postdocs Hans Bode and Charles David. I also started reading textbooks such as the lectures on developmental biology by Alfred Kühn. Another strong influence came from the work of Friedrich Bonhoeffer in molecular genetics. Friedrich studied DNA replication in E.coli at the time. He performed a genetic screen for mutations affecting replication, using quite sophisticated and elegant methods to make it work with large numbers and high efficiency. His work, which resulted in the identification of the gene encoding the replicating DNA polymerase and a number of other novel genes, convinced me of the powers of genetics in analysing complex processes. I looked around for an organism in which genetics could be applied to developmental problems, and found the descriptions of the early Drosophila mutants, including bicaudal, in a review by Ted Wright (1971). Further, the description of the first rescue experiments of a maternal mutant, was published by Garen and Gehring in 1972. I read and thought and discussed, and finally decided as a postdoctoral project to score for mutations affecting the informational content of the egg cell, with the aim of using them to isolate and identify morphogens in injection assays, in which the rescue of a mutant phenotype was indicative of the presence of an activity lacking in the mutant embryo, possibly the gene product. The only interesting maternal mutant known at that time was bicaudal, which had been discovered by Alice Bull, and described in 1966. Mutant embryos display mirror image duplications of the abdomen, a spectacular and very puzzling phenomenon, which however showed little penetrance. I met Walter Gehring at a meeting in 1973 in Freiburg, and had the courage to ask him about bicaudal, and whether he would let me work in his laboratory in Basel. I went there at the beginning of 1975, supported by a long term EMBO fellowship. I immediately loved working with flies. They fascinated me, and followed me around in my dreams. Basel and the Biozentrum was a very good place to spend ones postdoctoral times. I met Eric Wieschaus who just had finished his thesis in Walter Gehring's lab. His thesis project on the origin of imaginal disc cells in the blastoderm interested me very much. I learned a great deal about the use of genetics to study development in discussions with Eric. I also learned to have conversations with my fellow postdocs in English, and enjoyed the Swiss language and the lovely old town. It was difficult to be a beginner in everything, after having been an expert in almost everything in the previous lab. Soon after I started as a postdoc, most people in the Gehring lab began to work on recombinant DNA and molecular biology with the aim to clone developmentally interesting genes. Spyros Artavanis, Paul Schedl and David Ish Horowicz were postdocs at the same time. Eric, soon after I came, left for Zurich to do a postdoc in the lab of Rolf Nöthiger, but continued his collaboration with two postdocs in the lab on the transplantation of pole cells in order to investigate the female germline in chimeras. Jeanette Holden, an excellent geneticist who had done her thesis with David Suzuki on dominant temperature sensitive mutations taught me genetics of Drosophila. The problem of studying embryonic mutants at the time was that the methods for A Gathering of Nobel Laureates: Science for the 21st Century - 129 - collecting eggs and inspecting embryos were both tedious and unsatisfactory. It was hard to see structures, segments, and their polarity in the living embryo, and fixation and clearing methods were not available. With the help and support of Jeanette Holden and David Ish Horowicz, we developed some tricks which proved helpful in scoring mutant embryos from many lines. The most important of them, the block system for egg collection and replica plating in flies is my first Drosophila publication, in Drosophila Information Service, 1977. With Jitse van der Meer, we developed a fixation and clearing technique which enabled the scoring of the larval cuticle in great detail. Using these techniques, I recovered and investigated the original bicaudal mutant. I also did a small screen for maternal mutants which was successful in that it taught me how difficult such a screen was to do on a large scale. In this screen of 100 chromosomes, a maternal mutant which later was found to be immensely interesting, C79, later called dorsal, was isolated. I did a detailed study of bicaudal, the most difficult mutant I ever studied, with unbelievable patience and in retrospect little reward. I published a paper on bicaudal, but I did not easily find a job. With a fellowship from the DFG I went for a year (1977) to work in Freiburg in the lab of the famous insect embryologist Klaus Sander. Klaus Sander had been the first to describe gradients in the insect egg. He had done elegant experiments in which he translocated a symbiont ball localized to the posterior pole in a leaf hopper embryo and thereby changed the polarity and pattern over large distances of the egg. In Freiburg, with Margit Schardin, we did a fate map for the larval cuticle using laser ablations of Drosophila blastoderm cells. This experiment was important in showing that the primordia of individual segments in the blastoderm stage were no more than three cells wide. It also led to a very detailed examination and description of the segmental pattern of the Drosophila larva which we later used in our screens. I continued the work on dorsal, discovered the recessive phenotype and interpreted the phenotype postulating a gradient determining the dorsoventral axis. At that time, gradients were not widely accepted as mechanisms, in particular biochemists were highly sceptical, however the Tübingen influence made such models attractive to me. I presented this and the bicaudal work at the annual symposium of the American Society of Developmental Biology in Madison in 1978, my first trip to the US. Pedro Santamaria, a postdoc with whom I shared the lab in Freiburg, was a skillful transplantation person, he did some attempts to rescue the dorsal phenotype by transplantation of wildtype cytoplasm. We could not see much of an effect, but later in Heidelberg I looked at the preps again with a better microscope and found that there was some rescue! Unfortunately by that time Pedro was back in Paris and I had lots of other things to do - so this story had to wait - it finally got published 5 years later. Both Eric and I got a job offer from John Kendrew, the director general of the European Molecular Biology Laboratory in Heidelberg, that was newly founded and recruiting in many areas. We both accepted and worked there for three years, 1978-1980. I had applied to the EMBL earlier, but at that time they did not think I could establish a fly group alone. When our joint offer came, we were very pleased, because we could imagine that it would be fun to share a lab, and at least I did not have another option. Eric and I always had kept in touch, while I was in Basel and Freiburg and he in Zurich, and we used to discuss our experiments together. I felt at the time that Eric was much more successful than I, he was extremely productive during his time in Zurich, and worked on many very original projects, germ line, cell lineage, sex determination, where not many people could follow him. I also had the impression that I was dependent on him because he had more fly experience and without him I would not have gotten the job. This made our start in Heidelberg a little difficult, until we sorted things out, and from then on we thoroughly enjoyed working in the same lab. It was tiny - we, although both group leaders, shared a technician, Hildegard Kluding, and a stock keeper who also did cuticle preps for us. Initially we both had our own projects which we tried to pursue independently (while discussing them all the time). Soon we realised that the problems of close proximity and in sharing a technician would be eased if we let Hildegard do projects that interested us both. One of our first joint projects was the analysis of Krüppel, a segmentation mutant which we found published in a textbook by Alfred Kühn. It had originally been A Gathering of Nobel Laureates: Science for the 21st Century - 130 - described in1950 by Hans Gloor, who, in Geneva, still kept the stock and sent it to us. We let Hildegard do most of the Krüppel experiments. Our collection of mutants affecting segment number increased, tempting us to do a "shelf" screen. In the cuticle preps of embryos produced by our stock collection (we took from the shelf) we found a number of interesting and novel phenotypes. Gary Struhl, then a graduate student with Peter Lawrence in Cambridge, showed us homozygous Antennapedia, and wingless embryo preparations, which were very exciting. We realized that the screening for embryonic mutants would be very rewarding, and that we were the only people in the world who could do it. In contrast, the screen for maternals, which I was trying to work out at that time, was much more difficult, because it requires an additional generation and selection system. We invented some more tricks such as the little nets to fix and clear embryos from 7 mutants at the same time, and did the first screen, for zygotic mutants on the second chromosome, just Eric and I, supported by Hildegard and a second technician. The screen of 4200 second chromosomes took no more than three months (autumn 1979). It was extremely exciting - no major disasters, hard work, and great fun. Early on it was already evident that the screen was a success, and early on we realized the pair rule, the strange skipping of portions from every other segment ("2-4-6-8- type"). We had seen the mirror images displayed by the segment polarity mutants ("gooseberry type") before, also the "notch type" - the neuralized mutants. As a side project we grew up the homozygous flies from the 1000 or so non-lethal lines and tested their fertility, and the fertility of their daughters (to screen for grandchildless mutants). We recovered torso, gurken and tudor, three very valuable maternal mutants in this screen. We also, by chance, found the first Toll, BicD and easter allele. At the end of the screen Gary Struhl, and somewhat later Gerd Jürgens joined us, very stimulating, critical and knowledgeable discussants. We sorted things out, owing to the very competent help of Hildegard and the stock keepers, in a very short time, and decided, after some debates whether to wait until the screens of the other two chromosomes had been done as well, to try to publish the essential conclusions on the segmentation genes in an article in Nature. Although there were not many people working close enough to be competing with us, people started to get interested in this type of mutants, and although we certainly had the most complete collection, reports on individual mutants where probably able to spoil much of the fun for us. The paper was published in October 1980, with a very pretty cover picture, in NATURE. We continued with the screens of the two other chromosomes, with Gerd Jürgens who, as a very skillful and experienced geneticist, organized the third chromosomal screen. We even got a little bit more space and an extra "Denkzimmer" (office space), but on the whole the EMBL of that time, with its strong emphasis on expensive high tech experimental set ups, was not the best place for us, and sometimes it struck us how strange it was to discover very exciting things and know at the same time that there was not a single person in the entire institute outside of our lab who would appreciate it. There was one other laboratory working with Drosophila, they tried to develop cloning techniques and finally cloned an eye colour gene, white. Admittedly, we also did not have great interest in what other people were doing at the EMBL, it was so far from our work and we had so little time, but we enjoyed the international atmosphere and were good citizens of the place. We had very good working conditions, as people at the EMBL had them, and we used our great chance - we could not have been more successful - but the people who had given us this chance were unable to realize this. Eric even before finishing the first screen started to apply for jobs in the US, and got an offer in Princeton for work he had done before the screen. I got an extension to my contract for another three years, but felt uncomfortable to stay at the EMBL without Eric. Luckily I got an offer for a junior position at the Friedrich-Miescher-Laboratory of the Max-Planck-Society in Tübingen and moved there in spring 1981. The FML consists of four groups, the group leaders stay for not longer than six years, and are entirely free in their research topics. They have a generous budget, enough space and no teaching obligations. Great conditions and a great challenge. At the time I was there, I much enjoyed the interactions with the groups of Rolf Kemler and Walter Birchmeier, and, in the last year, Peter Ekblom. I was lucky because Gerd Jürgens came along and soon we were joined by Kathryn Anderson as a postdoc. Kathryn wanted to work A Gathering of Nobel Laureates: Science for the 21st Century - 131 - on dorsal and pursue the rescue experiments. Both Gerd and Kathryn are excellent geneticists with whom it was an intellectual challenge and pleasure to collaborate. In 1982 we did the large scale screen for maternal mutants on the third chromosome in which many of the genes involved in axis determination, including bicoid, and oskar and most of the dorsal-group genes were identified. Gerd, whose interest was to look for maternal homeotic mutations, prepared the screen that involved an elegant crossing scheme proposed by Gary Struhl. As students, Hans Georg Frohnhöfer and Ruth Lehmann started during the first year. Hans Georg, initially did pole cell transplantations to investigate the maternal contribution of several zygotic mutants, he later worked on bicoid. Ruth had worked with Campos Ortega before on the neurogenic genes, she already had much knowledge on fly embryology. All were very enthusiastic and made a great team. However, the technicians in Tübingen enjoyed the fly work decidedly less than those in Heidelberg, and we had some difficult times getting food and keeping the stocks, owing to that. But soon we got efficient help from undergraduate students, some of whom came to us via lab courses we taught during the university vacations. The maternal screen was much harder than the screens we had done before. It was also a difficult task to divide up the work between the people, as the importance of the individual mutants only became clear following rather detailed studies. The obvious groups of phenotypes were readily analyzed, what was more difficult was to take care of all the other mutants (more than 300 total) we had collected. After several attempts to sort those out, we decided to concentrate on the maternal mutants involved in axis determination, and not complete the genetical and phenotypical characterisation of the entire collection. Gerd and I still had to finish some of the projects on segmentation mutants, including the papers on the zygotic screens done in Heidelberg, which finally got published in three papers in Roux archives in 1984. For the phenotypical and genetical analysis, the maternal mutants, soon including the ones on the second chromosome Trudi Schüpbach and Eric Wieschaus had isolated, were divided into phenotypic groups, which roughly corresponded to the four systems of axis determination defined later. Kathryn Anderson, later Siegfried Roth and Dave Stein, studied the dorsal group genes including cactus, Ruth Lehmann concentrated on the posterior group, and Hans Georg Frohnhöfer on the anterior mutants. Initially, he also worked on the genes torso and torsolike. He recognized as acting independently of the anterior group of genes. Martin Klingler concentrated, later, on this terminal group. An important method to analyse the function of the genes we used in my laboratory was cytoplasmic transplantation. These experiments were very successful. Kathryn Anderson showed that among the dorsal-group genes in many cases the RNA was the rescuing principle. Hans Georg and Ruth discovered localisation of activities with long range effects at the anterior and posterior pole of the egg. These studies were started with the mutants bicoid and oskar, but also extended to wildtype embryos. A first model describing the three independent systems involved in establishing the anteroposterior axis was presented in an article in SCIENCE, with Frohnhöfer and Lehmann, in 1987. At the time the first Drosophila segmentation genes had been cloned and found to encode transcription factors. The first gap gene, Krüppel, was cloned in the group of Herbert Jäckle, who had a small independent research group in the neighboring Max-Planck-Institut für Entwicklungsbiologie (formerly Virusforschung, the institute in which I had done my PhD). In my lab, molecular analysis was begun rather late, as we felt it important to investigate the properties of the individual genes as carefully as possible before embarking in tedious molecular cloning that was not easy at the time. In the meantime, I was appointed as director of an independent division at the Max-Planck-Institut für Entwicklungsbiologie, the position I am still holding. We moved across the yard in 1986. The institute has four more directors, working on cell biology, with frog (Peter Hausen) and neuroembryology, with chick embryos (Alfred Gierer, Friedrich Bonhoeffer and Uli Schwarz). My group got larger, and we started doing molecular work, with the analysis of the localization of the RNA of bicoid (cloned in the lab of Marcus Noll in Basel). Wolfgang Driever as a graduate student made an antibody against the bicoid protein and discovered the bicoid protein gradient that determines, in a concentration dependent manner, A Gathering of Nobel Laureates: Science for the 21st Century - 132 - the expression pattern of other segmentation genes. Wolfgang established many molecular methods in my lab, and subsequently Frank Sprenger and Leslie Stevens cloned torso, followed by Daniel St Johnston with the cloning of staufen, and Robert Geisler's cloning of cactus. The improvements in the techniques of visualisation of the gene products by in situ hybridisation and antibody stainings complemented the transplantation studies done earlier, resulting in several exciting discoveries concerning the establishment of gradients in the extracellular space and by nuclear localisation by Dave Stein and Siegfried Roth. These investigations gradually lead to a more comprehensive understanding of the principles of axis determination in the embryo, presented first in a review in DEVELOPMENT in 1990. Already in 1984 or so - I got excited about the 1982 paper of George Streisinger on Zebrafish, and at the side explored whether zebrafish could eventually be established as a system for the genetic analysis of vertebrate development. The basis for this interest was the problem of generalisation, the question to what extent our results could be applied to an understanding of vertebrates including man. These early intentions to investigate zebrafish were retarded significantly by the subsequent demanding molecular studies on Drosophila, with the success that I had not expected when, as early as 1986, I brought the first fish tanks into the lab. Two graduate students, Stefan Schulte-Merker, who started in 1988 and Matthias Hammerschmidt, were the first fish people in the lab, and Nancy Hopkins from MIT spent a sabbatical year with our fish and us. They and others who joined later were very helpful in developing the tools for breeding and keeping many stocks of fish with safety and efficiency. These efforts resulted in the building of a fish house, with 7000 aquaria of our design, inaugurated in September 1992. Almost to the day three years later we submitted for publication the manuscripts describing 1200 zebrafish mutants, which a group of twelve scientists, with a number of technicians and students, had isolated in a large scale screen. In my lab, we will continue working on the investigation of the molecular mechanisms involved in the establishment of polarity in the Drosophila embryo, as well as continue the exploration of the zebrafish as a model for the study of vertebrate specific features. We believe that the combination of several approaches and systems in one laboratory provides a powerful basis for further understanding of the development of complexity in the life of an animal.

From Les Prix Nobel 1995.http://nobelprize.org/medicine/laureates/1995/nusslein-volhard-autobio.html

A Gathering of Nobel Laureates: Science for the 21st Century - 133 - Classroom Connections: 1. In small groups, read Nüsslein-Volhard’s autobiography. Work together to answer the following questions. Be prepared to share your answers in a large group discussion.

a. What connection does Nüsslein-Volhard’s family have with science and academia? Does she believe that her parents were a major influence in her career?

b. What type of childhood did Nüsslein-Volhard experience? How did she enjoy spending her time?

c. What fields did Nüsslein-Volhard consider majoring in before she eventually turned to developmental genetics?

d. What events led Nüsslein-Volhard to become interested in her research area?

e. Construct a brief timeline of Nüsslein-Volhard’s life using dates listed in the autobiography. Record key events leading up to winning the Nobel Prize in 1995.

2. In large class discussion, compare and contrast notes taken by the small groups. Key questions to consider include: a. What are the most impressive characteristics of Dr. Nüsslein-Volhard, that you feel prepared her to win Nobel Prize? b. What types of learning environments tend to promote creativity and imagination in people? 3. As an extension activity, have students also read the autobiography for Eric Weischaus (http://nobelprize.org/medicine/laureates/1995/wieschaus-autobio.html), or look at the biographies and autobiographies (see this Curriculum Guide or visit www.nobelprize.org) for other Laureate Guests who are visiting Charlotte. Compare and contrast their backgrounds and the qualities that they have in common and how they differ in their pursuit of knowledge.

Education – Christiane Nüsslein-Volhard • 1962-1964 Johann-Wolfgang-Goethe-Universität, Frankfurt/Main, Germany, (Biology, Physics, Chemistry) • 1964-1968 Eberhard-Karls-Universität, Tübingen, Germany, Diploma in Biochemistry • 1973 PhD in Biology (Genetics), University of Tübingen

Major Events - Christiane Nüsslein-Volhard Appointments and Professional Activities • 1969-1974 Max-Planck-Institut für Virusforschung, Tübingen, Diplom- and PhD thesis, thesis supervisor: Dr Heinz Schaller, Research associate • 1978-1980 Head of group, European Molecular Biology Laboratory (EMBL), Heidelberg • 1981-1985 Group leader in the Friedrich-Miescher -Laboratorium der Max-Planck- Gesellschaft, Tübingen • 1985 - Scientific member of the Max-Planck-Society and Director at the Max-Planck-Institut für Entwicklungsbiologie (Developmental Biology), Genetics Division, Tübingen

A Gathering of Nobel Laureates: Science for the 21st Century - 134 -

Fellowships and awards • 1975-1976 Postdoctoral fellow (EMBO fellowship) laboratory of Professor Dr Walter Gehring, Biozentrum, Basel • 1977 Postdoctoral fellow (DFG fellowship) laboratory of Professor Dr Klaus Sander, University of Freiburg • 1986 Leibnizpreis der Deutschen Forschungsgemeinschaft Franz-Vogt-Preis der Universität Giessen • 1988 Brooks Lecturer, Harvard Medical School • 1989 Carus-Medaille der Deutschen Akademie der Wissenschaften Leopoldina Halle, Carus-Preis der Stadt Schweinfurth, Honorary Professor, Universität, Tübingen, Silliman Lecturer, Yale University • 1990 Rosenstiel Medal, Brandeis University, ScD, Yale University, Mattia Award, Roche Institute, New Jersey • 1991 Dr h.c. Utrecht University, Dr h.c. Princeton University, Dunham Lecturer, Harvard Medical School, Harvey Lecturer, Rockefeller University, Albert Lasker Medical Research Award, New York • 1992 Prix Louis Jeantet de Médecine, Geneva, Otto Bayer Preis der Bayer AG, Leverkusen, Alfred Sloan Price of the General Motors Company, Gregor Mendel Medal of the Genetical Society, Great Britain, Otto Warburg Medal of the Deutsche Gesellschaft für Biochemie • 1993 Dr h.c. Universität Freiburg , Dr h.c. Harvard University, Sir Hans Krebs Medal of the Federation of European Biochemical Societies, Theodor Boveri Preis der Gesellschaft Physico- Medica der Universität Würtzburg, Ernst Schering Preis , Berlin, Bertner Award, Anderson Cancer Research Center, Houston, Texas, Sonneborn Lecturer, Indiana University • 1994 Das Verdienstkreuz 1 Klasse des Verdienstordens der Bundesrepublik Deutschland • 1995 Nobel Prize in Medicine

Interview Watch a taped interview with Sir Harold Kroto ,Günter Blobel, Edmond Fischer, and Christiane Nüsslein- Volhard at www.vega.org.uk.

A Gathering of Nobel Laureates: Science for the 21st Century - 135 - Christiane Nüsslein-Volhard -- Current Interests Developmental genetics of flies and fishes: An overview

The Department of Genetics at the Max-Planck Insitut was established in 1985. The central focus of the department is the identification and characterization of genes that play important roles in the development of two model organisms: the fruit fly Drosophila melanogaster and the zebra fish Danio rerio.

The use of mutagenesis as a tool to identify genes has traditionally been performed in bacteria, fungi and invertebrate organisms. The first systematic large-scale screens in Drosophila for mutations that affect patterning of the larva were performed at the beginning of the 1980s (Nüsslein-Volhard and Wieschaus, 1980). Screens for maternal mutants, including a large-scale screen in the Nüsslein-Volhard research group at the FML, soon followed. The current research of the department focuses on the processes of axis determination that begin with the polarisation of germ cells during oogenesis and result in the establishment of several gradients of transcription factors along the dorso-ventral and anterior-posterior axis in the early embryo. Previous work lead to the identification and molecular analysis of many maternal genes, these studies have allowed the construction of a general picture of the logic underlying axis determination (St. Johnston and Nüsslein-Volhard, 1992). In the Drosophila group, the localization of bicoid RNA during Drosophila oogenesis is therefore presently investigating using biochemical and cell biological approaches. In addition, further mutant screens are identifying genetic components involved in anteroposterior and dorso-ventral patterning that have escaped detection in previous screens.

Comparing genes and their functions provides convincing evidence for a large degree of conservation of processes between invertebrate and vertebrate organisms. This means that investigations in Drosophila in many instances are of great relevance for the understanding of the development of other organisms including mammals. However, many aspects of vertebrate body organization fundamentally differ from those of insects. For example, vertebrates have a diverse group of highly complex organs and structures that bear little if any resemblance to those of insects such as Drosophila. For this reason, beginning in 1988, the the Nüsslein-Volhard lab developed genetic approaches that allow the use of the zebra fish Danio rerio as a model organism for the analysis of development, physiology and behavior.

The zebra fish is ideally suited for experimental embryology as the embryos are transparent, are produced in large numbers, and develop outside the female organism in a very short time to a self-feeding larval stage. They can be raised and kept at high density, with a generation time of 2 to 4 month. The Tübingen fish house, which was built in 1992, contains approximately 7,000 aquaria which in total hold around 360,000 fish.

In 1993 the Nüsslein-Volhard lab performed a large scale mutagenesis screen which resulted in the characterization of approximately 1,000 mutants affecting a large variety of processes such as early development, organ formation, simple behavior and - in collaboration with the group of F. Bonhoeffer (Department of Physical Biology) - axonal path finding (Haffter et al., 1996a). Recently the Nüsslein- Volhard lab also performed screens for maternal effect mutations. Projects that have been and are being investigated in the laboratory include somitogenesis, cell type diversification in the myotome, the formation of the eyes, midline development, fin formation, the development of the skin and the development of neural crest derivatives, such as the peripheral nervous system, the pigment pattern and the craniofacial cartilages.

A Gathering of Nobel Laureates: Science for the 21st Century - 136 - In 2000 the Nüsslein-Volhard lab carried out a new large-scale mutagenesis experiment in collaboration with Exelixis Deutschland GmbH in which more than 6500 zebra fish mutants were found. For 2005 another screen as a part of the Zebrafish models EU project is planned.

References

1. Zebrafish, A Practical Approach. Christiane Nüsslein-Volhard and Ralf Dahm (eds.), Oxford University Press (2002). 303 pages. 2. Haffter, P., Granato, M., Brand, M., Mullins, M. C., Hammerschmidt, M., Kane, D. A., Odenthal, J., van Eeden, F. J. M., Jiang, Y.-J., Heisenberg, C.-P., Kelsh, R. N., Furutani-Seiki, M., Vogelsang, E., Beuchle, D., Schach, U., Fabian, C. and Nüsslein-Volhard, C. (1996a). The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development 123: 1-36. 3. St. Johnston and Nüsslein-Volhard, 1992: The origin of pattern and polarity in the Drosophila embryo. Cell 68: 201-219 4. Nüsslein-Volhard and Wieschaus, 1980: Mutations affecting segment number and polarity in Drosophila. Nature 287: 795-801

Research Projects Developmental genetics of Drosophila melanogaster Genetic screen for mutations affecting early embryonic patterning http://www.eb.tuebingen.mpg.de/dept3/research_interests/early_embryo.html Localization of RNA http://www.eb.tuebingen.mpg.de/dept3/research_interests/drosoph_oogenesis.html Dorso-ventral patterning http://www.eb.tuebingen.mpg.de/dept3/research_interests/dorsovent.html Differentiation of the larval cuticle http://www.eb.tuebingen.mpg.de/dept3/research_interests/cute_larv.html

Developmental genetics of the zebra fish, Danio rerio Pigment pattern formation http://www.eb.tuebingen.mpg.de/dept3/research_interests/early_embryo.html Eye development http://www.eb.tuebingen.mpg.de/eye-screen/home.html Skin development http://www.eb.tuebingen.mpg.de/dept3/research_interests/skin_dev.html DNA recombination http://www.eb.tuebingen.mpg.de/dept3/research_interests/recomb.html Dermal bone induction and patterning http://www.eb.tuebingen.mpg.de/dept3/research_interests/harris/home.html Sex determination and differentiation http://www.eb.tuebingen.mpg.de/dept3/research_interests/siegfried/home.html Microglia in the zebra fish embryo: the guardians of the brain http://www.eb.tuebingen.mpg.de/dept3/research_interests/guardians.html Cell type diversification in the myotome http://www.eb.tuebingen.mpg.de/dept3/research_interests/diversification.html Development of the enteric nervous system http://www.eb.tuebingen.mpg.de/dept3/research_interests/nerves.html

Associated Research Groups Genes regulating synaptic growth and structure (Hermann Aberle) http://www.eb.tuebingen.mpg.de/dept3/research_interests/aberle/home.html Functional genomics in the zebra fish (Robert Geisler) http://www.eb.tuebingen.mpg.de/dept3/geisler/home.html Cell migration & neural crest development (Darren Gilmour) http://www.eb.tuebingen.mpg.de/dept3/research_interests/nc_screen.html Sensory hair cell function in the zebra fish (formerTeresa Nicolson group) http://www.eb.tuebingen.mpg.de/abt.allg/junior_groups/nicolson/people_tn.html

A Gathering of Nobel Laureates: Science for the 21st Century - 137 -

Press Release: The 1995 Nobel Prize in Physiology or Medicine THE NOBEL ASSEMBLY AT THE KAROLINSKA INSTITUTE 9 October 1995 The Nobel Assembly at the Karolinska Institute has today decided to award the Nobel Prize in Physiology or Medicine for 1995 jointly to Edward B. Lewis, Christiane Nüsslein-Volhard and Eric F. Wieschaus for their discoveries concerning "the genetic control of early embryonic development". Summary The 1995 laureates in physiology or medicine are developmental biologists who have discovered important genetic mechanisms, which control early embryonic development. They have used the fruit fly, Drosophila melanogaster, as their experimental system. This organism is classical in genetics. The principles found in the fruit fly apply also to higher organisms, including man. Using Drosophila Nüsslein-Volhard and Wieschaus were able to identify and classify a small number of genes that are of key importance in determining the body plan and the formation of body segments. Lewis investigated how genes could control the further development of individual body segments into specialized organs. He found that the genes were arranged in the same order on the chromosomes as the body segments they controlled. The first genes in a complex of developmental genes controlled the head region, genes in the middle controlled abdominal segments while the last genes controlled the posterior ("tail") region. Together these three scientists have achieved a breakthrough that will help explain congenital malformations in man. What controls the development of the fertilized egg? The fertilized egg is spherical. It divides rapidly to form 2, 4, 8 cells and so on. Up until the 16- cell stage the early embryo is symmetrical and all cells are equal. Beyond this point, cells begin to specialize and the embryo becomes asymmetrical. Within a week it becomes clear what will form the head and tail regions and what will become the ventral and dorsal sides of the embryo. Somewhat later in development the body of the embryo forms segments and the position of the vertebral column is fixed. The individual segments undergo different development, depending on their position along the "head-tail" axis. Which genes control these events? How many are they? Do they cooperate or do they exert their controlling influence independently of each other? This year's laureates have answered several of these questions by identifying a series of important genes and how they function to control the formation of the body axis and body segments. They have also discovered genes that determine which organs will form in individual segments. Although the fruit fly was used as an experimental system, the principles apply also to higher animals and man. Furthermore, genes analogous to those in the fruit fly have been found in man. An important conclusion is that basic genetic mechanisms controlling early development of multicellular organisms have been conserved during evolution for millions of years.

A Gathering of Nobel Laureates: Science for the 21st Century - 138 - Brave decision by two young scientists Christiane Nüsslein-Volhard and Eric Wieschaus both finished their basic scientific training at the end of the seventies. They were offered their first independent research positions at the European Molecular Biology Laboratory (EMBL) in Heidelberg. They knew each other before they arrived in Heidelberg because of their common interest: they both wanted to find out how the newly fertilized Drosophila egg developed into a segmented embryo. The reason they chose the fruit fly is that embryonic development is very fast. Within 9 days from fertilization the egg develops into an embryo, then a larvae and then into a complete fly.

Fig. 1. Regions of activity in the embryo for the genes belonging to the gap, pair-rule, and segment-polarity groups. The gap genes start to act in the very early embryo (A) to specify an initial segmentation (B). The pair-rule genes specify the 14 final segments (C) of the embryo under the influence of the gap genes. These segments later acquire a head-to-tail polarity due to the segment polarity genes. They decided to join forces to identify the genes, which control the early phase of this process. It was a brave decision by two young scientists at the beginning of their scientific careers. Nobody before had done anything similar and the chances of success were very uncertain. For one, the number of genes involved might be very great. But they got started. Their experimental strategy was unique and well planned. They treated flies with mutagenic substances so as to damage (mutate) approximately half of the Drosophila genes at random (saturation mutagenesis). They then studied genes which, if mutated would cause disturbances in the formation of a body axis or in the segmentation pattern. Using a microscope where two persons could simultaneously examine the same embryo they analyzed and classified a large number of malformations caused by mutations in genes controlling early embryonic development. For more than a year the two scientists sat opposite each other examining Drosophila embryos resulting from genetic crosses of mutant Drosophila strains. They were able to identify 15 different genes which, if mutated, would cause defects in segmentation. The genes could be classified with respect to the order in which they were important during development and how mutations affected segmentation. Gap genes (Fig 1) control the body plan along the head-tail axis. Loss of gap gene function results in a reduced number of body segments. Pair rule genes affect every second body segment: loss of a gene known as "even-skipped" results in an embryo consisting only of odd numbered segments. A third class of genes called segment polarity genes affect the head-to-tail polarity of individual segments.

A Gathering of Nobel Laureates: Science for the 21st Century - 139 - The results of Nüsslein-Volhard and Wieschaus were first published in the English scientific journal Nature during the fall of 1980. They received a lot of attention among developmental biologists and for several reasons. The strategy used by the two young scientists was novel. It established that genes controlling development could be systematically identified. The number of genes involved was limited and they could be classified into specific functional groups. This encouraged a number of other scientists to look for developmental genes in other species. In a fairly short time it was possible to show that similar or identical genes existed also in higher organisms and in man. It has also been demonstrated that they perform similar functions during development. The fly with the extra pair of wings Already at the beginning of this century geneticists had noted occasional malformations in Drosophila. In one type of mutation the organ that controls balance (the halteres), was transformed into an extra pair of wings (Fig. 2). In this type of bizarre disturbance of the body plan, cells in one region behave as though they were located in another. The Greek word homeosis was used to describe this type of malformation and the mutations were referred to as homeotic mutations.

Fig. 2. Comparison of a normal and a four-winged fruit fly. The third thoracic segment has developed as a duplicate of the second due to a defective homeotic gene. In the normal fly only the second segment develops wings. The fly with the extra pair of wings interested Edward B. Lewis at the California Institute of Technology in Los Angeles. He had, since the beginning of the 1940s, been trying to analyze the genetic basis for homeotic transformations. Lewis found that the extra pair of wings was due to a duplication of an entire body segment. The mutated genes responsible for this phenomenon were found to be members of a gene family (Bithorax-complex) that controls segmentation along the anterior-posterior body axis (Fig. 3). Genes at the beginning of the complex controlled anterior body segments while genes further down the genetic map controlled more posterior body segments (the colinearity principle). Furthermore, he found that the regions controlled by the individual genes overlapped, and that several genes interacted in a complex manner to specify the development of individual body segments. The fly with the four wings was a result of inactivity of the first gene of the Bithorax complex in a segment that normally would have produced the halteres, the balancing organ of the fly (Fig 3). This caused other homeotic genes to respecify this particular segment into one that forms wings. Edward Lewis worked on these problems for decades and was far ahead of his time. In 1978 he summarized his results in a review article and formulated theories about how homeotic genes interact, how the gene order corresponded to the segment order along the body axis, and how the individual genes were expressed. His pioneering work on homeotic genes induced other scientists to examine families of analogous genes in higher organisms. In mammals, the gene clusters first found in Drosophila have been classified into four complexes known as the HOX

A Gathering of Nobel Laureates: Science for the 21st Century - 140 - genes. Human HOX genes are so similar to their Drosophila analogues that they can restore normal function when added to a fly embryo containing mutated homologous genes.

Fig. 3. The principle of colinearity in Drosophila (A-C) and mouse (Mus musculus, D-F) embryos. The horizontal bars indicate in which areas the homeotic genes 1-9 are active along the body axis. Gene 1 is active in the head region (left in A and F, respectively); gene 9 is active in the tail region (right). Gene 7 of the bithorax complex was inactive in the fly with four wings. The bar showing its normal range of activity is indicated with an asterisk. The individual genes within the four HOX gene families in vertebrates occur in the same order as they do in Drosophila and they exert their influence along the body axis (Fig 3 D-F) in agreement with the colinearity principle first discovered by Lewis in Drosophila. More recent research has suggested that the segments where shoulders and the pelvis form is determined by homeotic genes.

Congenital malformations in man Most of the genes studied by Nüsslein-Volhard, Wieschaus and Lewis have important functions during the early development of the human embryo. The functions include the formation of the body axis, i.e. the polarity of the embryo, the segmentation of the body, and the specialization of individual segments into different organs. It is likely that mutations in such important genes are responsible for some of the early, spontaneous abortions that occur in man, and for some of the about 40% of the congenital malformations that develop due to unknown reasons. Environmental factors such as very high doses of vitamin A during early pregnancy are also known to disturb the regulation of HOX-genes, thus inducing severe congenital malformations. In some cases mutations have been found in human genes related to those described here for Drosophila. A human gene related to the Drosophila gene paired will cause a condition known as Waardenburg's syndrome. It is a rare disease, which involves deafness, defects in the facial skeleton and altered pigmentation of the iris. Another developmental gene mutation causes a complete loss of the iris, a condition known as aniridia. Literature 1. Lewis, E.B. (1978) A Gene Complex Controlling Segmentation in Drosophila. Nature 276, 565-570 Nüsslein-Volhard, C., Wieschaus, E. (1980). Mutations Affecting Segment Number and Polarity in Drosophila. Nature 287, 795-801 2.McGinnis, W., Kuziora, M. (1994). The Molecular Architects of Body Design. Scientific American 270, 36-42 3.Lawrence, P. The Making of a Fly. Blackwell Scientific Publications. Oxford 1992. 4.Molecular Biology of the Cell. Eds Alberts, B. et al, 3rd edition pp 1077-1107. Garland Publishing, New York 1994 Source: http://nobelprize.org/physics/laureates/1995/press.html A Gathering of Nobel Laureates: Science for the 21st Century - 141 - Overview of Discovery of the Genetic Control of Early Embryonic Development

Edward B. Lewis Christiane Nüsslein-Volhard Eric Wieschaus California Institute Max-Planck-Institut für Entwicklungsbiologie Princeton University of Technology Genetics Division Princeton, NJ USA Pasadena, CA, USA Tübingen, Federal Republic of Germany

Edited by Dr. Kimberly McKinney and Dr. Lowell Rayburn of the Cannon Research Center, Carolinas Medical Center.

From Egg to Adult Fly The egg of the fruit-fly Drosophila melanogaster is long and narrow, with a length of 0.4 mm and a diameter of 0.16 mm. The embryonic development starts immediately after the fertilization and lasts for twenty-four hours, after which the larva hatches. The larval stage consists of three phases and lasts for four days after which the developing animal passes into the pupal stage. Over the course of the next five to six days, metamophosis occurs and results in the adult fly. During early embryonic development the embryo is divided into 14 invisible segments, which are also present in the newly hatched larva. Each segment in the larva results in a specific segment in the adult fly and will eventually give rise to structure in the adult such as wings and antennae. The adult fly consists of a head, three thoracic segments, eight or nine abdominal segments and a tail. Segmentation is not specific to insects. It is a common developmental principle which is also obvious in the early human embryo as somites which are the origin of our vertebral column, ribs and certain muscles. Since the beginning of the 20th century Drosophila melanogaster has been extensively used in genetic research, starting with the American geneticist Thomas Hunt Morgan. In 1933 he was awarded the Nobel Prize in Physiology or Medicine for his discoveries concerning hereditary functions of chromosomes. Drosophila has only four pairs of chromosomes, develops quickly, and is easy to breed. These qualities make Drosophila an ideal organism for genetic research.

A Gathering of Nobel Laureates: Science for the 21st Century - 142 -

From egg to adult fly: The adult fly consists of head, 3 thoracic segments, 8 or 9 abdominal segments and tail. The individual segments develop differently during embryogenesis - but how is this done? Which genes control these events? How many are they? Do they cooperate or are they working independently of each other? Nüsslein-Volhard's and Wieschaus' Discoveries

Christiane Nüsslein-Volhard and Eric F.Wieschaus identified and classified 15 genes of key importance in determining the body plan and the formation of body segments of the fruit fly Drosophila melanogaster.

Most of the embryonic development is controlled by zygotically active genes (e.g. the egg's own genes). These genes act as follows: The gap- genes are busy at the start, specifying a rough body plan along the head-to-tail axis. The pair rule-genes govern formation of every second body segment. The segment polarity-genes refine the head-to-tail polarity of each Loss of gap gene Loss of a pair rule- Loss of a segment individual segment, meaning results in a reduced gene, e.g. even- polarity-gene leads that the head-end and the tail- number of skipped, allows to segments with end of a segment look segments as shown only odd- similar head and different. in the embryo to numbered tail ends. the right. segments to develop.

A Gathering of Nobel Laureates: Science for the 21st Century - 143 - Hunting for the Genes Behind Pattern Formation in Drosophila's Early Embryonic Development

Working together at the European Molecular Biology Laboratory (EMBL) in Heidelberg, Germany, Christiane Nüsslein-Volhard and Eric F. Wieschaus decided to find out how segmentation is controlled by genes in the newly fertilized egg of the Drosophila fruit fly. Their experimental strategy was unique and well planned. They treated Drosophila females with chemicals which damaged their genes and caused random mutations. They reasoned that since genes control embryonic development it should be possible to see the genetic damages as defects in the offspring and thus identify genes that specify segmentation. Studying genes intentionally damaged by mutation was the only accessible way to obtain knowledge about genes controlling development. By disturbing the system and looking for what happens you may be able to learn something about it. Christiane Nüsslein-Volhard and Eric F. Wieschaus studied about 40,000 mutations and were able to identify 15 different genes that control the early phase of Drosophila's embryonic development (through continued research additional such genes have been found and today they are about 25). These genes caused defective segmentation when mutated, resulting, for example, in a reduced number of segments, in embryos consisting only of odd-or even-numbered segments or in segments with their head and tail ends looking similar. Much of the embryonic development is controlled by the egg's own genes. They are divided into three functional groups, which act as follows:

• The gap-genes lay the foundations of a rough body plan along the head-to-tail axis, • the pair rule-genes govern formation of every second body segment, • the segment polarity-genes refine the head-to-tail polarity of each individual segment, meaning that the head-end and the tail-end of a segment look different. The three types of genes reflect a gradual refinement of Drosophila's developmental program. They come in three waves, one after the other - and it is a quick work, everything happens within hours! Nüsslein-Volhard and Wieschaus published their important results 1980 in Nature. Their publication has had an enormous impact on how genes that control development are studied today. The paper is consequently regarded as a milestone in developmental biology.

A Gathering of Nobel Laureates: Science for the 21st Century - 144 - Lewis' Discoveries Edward B. Lewis at the California Institute of Technology in Pasadena was interested in questions concerning certain developmental changes in Drosophila and how the genes causing these changes cooperate during body segmentation. The answers he discovered laid the foundation of one of the most surprising discoveries in developmental biology -the same type of genes controlling the early embryonic development of Drosophila also control the early embryogenesis of higher organisms, including humans. This means that the genetic control mechanisms have been preserved roughly unchanged through 650 million years of evolution!

In his research into the genetic basis of homeotic transformation during embryonic development, Lewis started with the now famous four-winged Drosophilla mutant. In this mutant, Lewis noticed that an entire body segment –the one from which the two wings normally originate –had been duplicated. From this observation and subsequent research, we now know that homeotic genes control the specialization of each body segment. Consequently, in the four-winged fly, one of these homeotic genes was inactivated in the body segment that normally contains the halteres, such that other homeotic genes transformed the segment to look like the one from which the wings normally originate. Lewis named the complex of genes he was studying the Bithorax complex. Interestingly, Lewis discovered that the genes in

the DNA are arranged in the same general order as their expression pattern along the head to tail axis. This observation is now known as the colinearity principle. In his co-linearity principle, Edward B. Lewis also found that the genetic expression domains overlap and that the first gene in the complex becomes active a little earlier than the second gene and so on. Later research has shown that the homeotic genes of the fly are homologous to homeotic genes in other types of animals, including humans.

A Gathering of Nobel Laureates: Science for the 21st Century - 145 - Homeotic Gene Complexes are Similar in Flies and Mammals

As discussed above, the homeotic genes in Drosophila are clustered close to each other in the DNA and are responsible for setting the pattern of embryonic development in the fly. Vertebrates also contain homeotic (HOX) genes which are closely related to the insect genes in that their order in the DNA is the same and their actions during embryonic development mimic those of the fly HOX genes in both a spatial and temporal fashion. In fact, human HOX genes, when placed into a Drosophila embyo can function like the fly HOX genes normally do. Edward Lewis’s research truly advanced the field of developmental biology. In the 1970s Lewis summarized the results of his scientific work from several decades and formulated novel theories on the function of homeotic genes. Together with the discoveries made by Nüsslein-Volhard and Wieschaus, Lewis' pioneering work has had an enormous impact on our understanding of how invertebrate and vertebrate embryos develop. Other scientists have later found that the homeotic genes of Drosophila directly correspond to similar gene complexes in all animals including humans.

Extensions of the Discoveries

The primitive Brain

The primitive brain develops in nine segments called rhombomeres that are visible in the mouse embryo. Different HOX genes are active in different rhombomeres. For example, the HOX-B 2 gene is expressed in rhombomere 4, the HOX-B 3 gene in rhombomeres 5 and 6, and the HOX-B 4 gene in rhombomeres 7 and 8.

If a HOX gene is lost the result is incorrect development of the rhombomeres concerned and, as a consequence of this, icorrect development of the brachial arches, neck, or head structures.

0001

A Gathering of Nobel Laureates: Science for the 21st Century - 146 - Razor-sharp boundaries

The blue color reveals the specific activity of two homeotic genes in the mouse embryo. In panel A of the figure, the HOX-D 2 gene is active earlier in development and cloer to the embryo’s head-end than the HOX-D 4 gene shown in panel B. In both cases there is a razor sharp boundary at the upper end of the gene’s active zone.

Waardenburg's Syndrome Mutations have been found in human genes similar to those described for Drosophila. A defective human HOX gene related to the Drosophila gene paired causes a condition known as Waardenburg's syndrome, a very rare disease that affects one in 42,000 children. Symptons of Waardenburg’s Syndrome include deafness, defects in the facial skeleton and altered pigmentation of the iris.

The Human Embryo The human embryo is, in its early stages, hard to distinguish from the embryo of a mouse, a rabbit or a giraffe. The human embryo is in fact segmented like the fruit fly embryo according to a basic body plan that applies to most living things. The segments of the human embryo consist of somites, cell masses which develop into ribs, vertebrae and back muscles.

Aniridia If the homeotic gene PAX 6 is mutated, there is a complete loss of the iris in the eye, a condition known as Aniridia. Without an iris, the eye is unable to control the amount of light entering the eye. The only treatment of aniridia is the use of colored eye lenses which limits the amount of light entering the eye

A Gathering of Nobel Laureates: Science for the 21st Century - 147 - Other Conditions

Experimental studies in mice have shown that disturbances in homeotic genes can cause a malformation of the colon called megacolon. Researchers are currently investigating whether magacolon in humans is caused by the disruption of HOX genes. Homeotic genes are also involved in the proper formation of facial features such as the palate, lips, and jaw.

Congenital Malformations in Mouse and Man Most of the genes studied by Nüsslein-Volhard, Wieschaus and Lewis have important functions during the early development of the embryo. These genes control formation of the body axis, which means the polarity of the embryo, the segmentation of the body, and the specialization of individual segments into different organs like ribs, pelvis and extremities. Mutations in such important genes may alter embryonic development in ways that may cause the developing embryo to be inviable. About 40% of the known congenital malformations in humans are due to unknown reasons, and it is likely that some of these defects are due to mutations in homeotic genes.

Normal mouse embryo Retinoic acid: More retinoic acid: loss of many vertebrae no posterior region formed

A Gathering of Nobel Laureates: Science for the 21st Century - 148 - It is also known that environmental factors, such as very high doses of vitamin A during early pregnancy, can disturb the regulation of HOX genes, and thereby cause congenital malformations. Experiments with mouse embryos confirm this. As shown in the above figure, baby mice of mothers given high doeses of Vitamin A during pregnancy have severe defects. In 1995 a Boston University School of Medicine study of 22,000 mothers stated taking as little as three times the recommended dose of Vitamin A during the first trimester of the pregnancy may cause fetal damage. Vitamin A is found in foods such as liver as well as in prescription drugs, so it is important for pregnant women to avoid excess Vitamin A during their pregnancy.

Conclusions In summary, the work of Edward Lewis, Christiane Nusslein-Volhard, and Eric Wieschaus fundamentally shaped the study of early development in organisms as diverse as fruit flies and humans. Their discoveries opened new avenues of investigation for all biologists and have helped generations of scientists better understand the process of development.

Other Sources of Information

The story of the discoveries of Christiane Nüsslein-Volhard and Eric Wieschaus: http://www.embl-heidelberg.de/ExternalInfo/public_relations/TurningPoint.html

Eric Wieschaus' homepage at Princeton University:

http://www.molbio.princeton.edu/faculty/wieschaus.php

http://nobelprize.org/medicine/laureates/1995/illpr

A Gathering of Nobel Laureates: Science for the 21st Century - 149 -

Implications Nüsslein-Volhard’s place in the History of Science: One Person’s View CHRISTIANE NÜSSLEIN-VOLHARD AND DROSOPHILA EMBRYOGENESIS

A summary of: E. F. Keller (1996). Drosophila embryos as transitional objects: The work of Donald Poulson and Christiane Nüsslein-Volhard. History and Sociology of the Physical Sciences 26 (2): 313 - 346.

Edited by Dr. Kimberly McKinney and Dr. Lowell Rayburn of the Cannon Research Center, Carolinas Medical Center.

Why were Christiane Nüsslein-Volhard and Eric Wieschaus the ones who discovered the importance of maternal effect genes to the formation of the body axis? According to Michael Ashburner's (1993) thoughtful history of the field, these experiments could have been done forty years earlier if anyone had wanted to do so. All it required was "some standard genetics, a mutagen, and a dissecting microscope, all available in the 1930s." Why hadn't anyone saturated the Drosophila genome for mutations that prevented early Drosophila development?

Why the delay?

According to Evelyn Fox Keller (1996), there were conceptual and cultural regions for the delay. First, it is important to recall that the Drosophila embryo had not been an object of intensive study. Up until the 1970s, embryologists tended to study amphibians, sea urchins, and chickens, animals with large eggs whose cells could be transplanted.

Second, Drosophila geneticists claimed that there was no difference between the actions of a gene early in development and its actions later in development. Consequently, almost all Drosophila geneticists studied those genes which effected traits in the adult flies.

Third, those who did study Drosophila development had a rough time. Work was difficult, labor- intensive, and slow. "Death" is a difficult phenotype to analyze. Donald F. Poulson was an important Drosophila embryologist in the 1930s and 1940s, but he had a difficult time attracting graduate students into his laboratory. The state of the field can be gauged by the fact that until The Development of Drosophila melanogaster was published in 1993, Poulson's reviews were still being used by researchers.

Fourth, there was a conceptual barrier. The developmental process was understood to be either regulative (conditional) or mosaic (autonomous). Consequently, developmental geneticists doubted the results of their experiments with embryos because they did not hold to the current “ideal” of developmental regulation. Despite the fact that Alan Gehring and Walter Gehring (1972) showed that wild-type cytoplasm could rescue a lethal maternal-effect phenotype, this line of research was abandoned.

Fifth, there is what Keller calls the "discourse of gene action". The nucleus was the center of gene action, not the cytoplasm. Embryology was understood to be cytoplasmic while genetics was thought of as nuclear, so the two fields of study remained separated.

A Gathering of Nobel Laureates: Science for the 21st Century - 150 -

Why were Nüsslein-Volhard and Wieschaus the ones to do the work?

Keller sees Nüsslein-Volhard at the nexus of several strands of social, political, and scientific development. "Even if neither the questions she posed nor the techniques she employed were new, the possibilities that faced her in the mid-1970s--as a woman, as a German, as a recent Ph.D. in biochemistry and molecular biology turning to the study of development (and more specifically, to Drosophila embryogenesis)--these were conspicuously new."

Nüsslein-Volhard was born at the height of World War II, and after the War, she attended an all-girls' school in Frankfurt, West Germany. She learned to love Goethe, mathematics, and biology. When she entered the University in Frankfurt, she soon became bored with her biology classes and switched to mathematics and physics. After two years, she felt that physics was "too dry" and was excited about entering a new program in biochemistry that was starting in Tübingen. Tübingen became a center for young German biologists who were interested in the physical bases of life, and it was the center of a new institute, headed by Alfred Gierer, one of the few German biologists who had gone to the United States (in his case, MIT and CalTech) and who had seen the revolution in molecular biology that had come to America. Molecular biology at that time was new to Germany.

Again, Nüsslein-Volhard seemed to be disappointed. She did not want to spend the rest of her life sequencing DNA. Gierer convinced her that developmental biology was a place where she could make a difference and a field that needed her expertise. She decided that she wanted to combine genetics with embryology, and this meant learning both embryology and genetics. Moreover, she decided that the most interesting place was that "no man's land"--the Drosophila embryo. In 1973, she met Walter Gehring, one of the few continental Europeans who knew both molecular biology and development. He had just finished his work at Yale in Garen's laboratory, showing that wild-type cytoplasm could rescue maternal effect mutants. However, Gehring's interest had turned to the later stages of Drosophila development and to developing new molecular techniques. She worked in Gehring's laboratory in Basel, learned how to do genetic crosses from a postdoctoral fellow, Jeanette Holden, and learned Drosophila embryology from a graduate student, Eric Wieschaus.

Wieschaus had been a graduate student of Poulson's, so he was one of the few people well versed in early Drosophila development. Wieschaus met Gehring while at Yale and then went to Basel with Ghering. Wieschaus was a perfect counter to Nüsslein-Volhard. While Nüsslein-Volhard was "an intense, driven young woman with the imprimatur of molecular biology," Wieschaus was "a gentle, apparently easy- going and soft-spoken man who had been a conscientious objector during the Vietnam War..." According to Keller, they formed a quick and long-lasting friendship. "He taught her to look at embryos, how to do transplantations. She provided enthusiasm, drive, and a single-minded focus on the onset of embryonic pattern."

Meanwhile, Nüsslein-Volhard tried to streamline the entire process of producing and analyzing embryos. If they were to do a "saturation mutagenesis " screen, they were going to have to look at thousands of fly embryos and determine immediately whether they had pattern deformities. First, she found that if they used a particular oil that other investigators had used to protect dechorionated eggs from drying out, it made the opaque chorion transparent. This got around the technically difficult and time-consuming process of taking the chorion off the embryo (a process that often destroyed the embryo, itself). Second, if she let the females lay their eggs on medium containing apple juice (instead of the usual dark grape juice) and poured the oil onto the plate, she could analyze the embryos directly on the plate. A third innovation - -a method of dropping eggs from one female into forty labeled vials at a time, was a major time saver.

A Gathering of Nobel Laureates: Science for the 21st Century - 151 -

With these three advances, what had taken earlier investigators years could now be done in weeks. Keller identifies several interacting strands that come together to enable Nüsslein-Volhard and Eric Wieschaus to do this work. From her identity as a molecular biologist, Nüsslein-Volhard drew confidence, a kind of arrogance, and a cultural style. As a German, she had imbibed a tradition, shared by the French, of finding interest in complexity ("the more complicated the more interesting it was"). Moreover, Nüsslein-Volhard came from a family with an "artistic temperament", a particular visual acumen that, she claims, is needed to recognize small deviations from pattern. Also, this work would have been impossible for her had she not come into the field at a moment in time when opportunities for women in science were just beginning to appear and if she had not teamed up with somebody competent who would work with her.

Interestingly, "to American women scientists, Nüsslein-Volhard is a heroine. Her role in their success is and has been significant in several ways. First, in the example she sets, and more substantively, in the women she trained. Three out of her first four post-docs were women, and at least two of them have gone on to be leaders of the field. Others who came later also owe a great debt to her mentorship, and even some senior women have found inspiration in her laboratory. But she is no heroine to German feminists. Those who know of her at all are more likely to see her as an enemy than as an ally. Her ambition, her phenomenal drive, her all consuming investment in her research, are anathema to a generation of feminist scientists in Germany who have become known for their advocacy of a kinder, gentler, and more "relevant" -- in a word, a "greener" -- science. Fiercely opposed to genetic engineering, they see her as a member of the bio-tech establishment. Opponents also complain bitterly of Nusslein-Volhard’s intolerance of any interference with the scientific work of those in her lab incurred by family obligations. Even the day-care center she worked so hard to establish at the MPI for Developmental Biology in 1990 (one of the first such examples in western Germany) meets with their disapproval: only partially subsidized by the Max Planck Society, the costs seem prohibitive to them (Keller, 1997).

Nüsslein-Volhard's opportunity was a function of her particular location in cultural, scientific, and political time; her individual contribution derived from her ability to make good use of this opportunity. She was a bricoleur par excellence, in part because of the extent to which she was able to make opportune use of local alliances -- allying herself, for example, with those strains in feminism that agree with, and those women who share, her goals.

References:

1. Ashburner, M., 1993. "Epilogue" to The Development of Drosophila melanogaster , (eds. M. Bate and A. M. Arias), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 2. Garen, A. and Gehring, W. 1972. Repair of the lethal developmental defect in deep orange embryos of Drosophila by injection of normal egg cytoplasm. Proc. Natl. Acad. Sci. USA 69: 2982 - 2985. 3. Keller, E. F. 1996.Drosophila embryos as transitional objects: The work of Donald Poulson and Christiane Nüsslein-Volhard. History and Sociology of the Physical Sciences 26 (2): 313 - 346. 4. Keller, E. F. 1997. Developmental biology as a feminist cause? Osiris. In press. http://zygote.swarthmore.edu/droso1.html

Discussion: In small groups discuss the points made in this article. Do you agree or disagree with the author’s point. If you have time and can find a copy of Keller’s article, read it and see if you have the same opinion as the author.

A Gathering of Nobel Laureates: Science for the 21st Century - 152 -

“A Turning Point in the History of Developmental Genetics”1 (http://www.embl-heidelberg.de/ExternalInfo/public_relations/TurningPoint.html)

Edited by Dr. Kimberly McKinney and Dr. Lowell Rayburn of the Cannon Research Center, Carolinas Medical Center.

The publication of a single paper in Nature in 1980, entitled "Mutations Affecting Segment Number and Polarity in Drosophila," revolutionized the field of developmental genetics. The two authors, Christiane Nüsslein-Volhard and Eric Wieschaus, working together in a small laboratory at EMBL, had systematically searched for mutant genes that affect the formation of segments in the eggs of a small fruit fly. Their goal was to identify all of the genes of this type and, through them, understand the processes that govern development in the Drosophila embryo. It was a novel and courageous approach. Few scientists had bothered to look at embryos by genetics, and fewer still believed that such a task was manageable. Nüsslein-Volhard's and Wieschaus' techniques, as often is the case in good science, were deceptively simple. Their patience and care in conducting massive screenings of embryos and the intuition that led to their conclusions were superb. The two scientists identified an initial set of 15 lethal mutants in this seminal paper. More importantly, they categorized the mutants as representing three different types of genes, which they believed controlled an increasingly complex organization of the organism. The paper was a turning point in the history of developmental biology and set off a chain reaction of impressive research on development, first in Drosophila and then in other organisms, including vertebrates. The work also helped build a bridge between the fields of developmental genetics and cell biology.

How Is the Progressive Development of a Living Organism Controlled? How is the progressive development of a living organism controlled? What are the rules that govern the early organization of an embryo and the subsequent creation of ever more complex structures in the mature organism? Are they interrelated? Geneticists have studied the small fruit fly Drosophila since the beginning of the 20th century, exploring questions about inheritance using what we now call classical genetics. But serious progress in establishing the connections between genetics and the progressive development of an organism is relatively recent. By the mid 1970s, a number of biologists had turned serious attention to Drosophila development. Certain mutations in the adult fly, like the "Bithorax complex" (mutations leading to development of two sets of wings) and the "Antennapedia complex" (substitution of legs for antennae), had caught attention as a way to explore how insects develop. The concept of cell lineage "compartments" in developing structures had gained support. Almost all of this research concentrated on the determination and development of the structures of the adult fly. Although a number of known mutations affected embryonic development, most research involving embryos tended to focus on tracing back a single mutation from the adult backward. No one had yet taken a comprehensive approach to investigate mutations affecting the embryos themselves. After all, most of these mutations killed the embryos; few scientists considered them as a key to understanding how normal development might work.

1 Since the publication of this article, Nüsslein-Volhard and Wieschaus (along with Edward Lewis) have been awarded the 1995 Nobel Prize for Physiology/Medicine. A Gathering of Nobel Laureates: Science for the 21st Century -153-

Christiane Nüsslein-Volhard and Eric Wieschaus Meet in Basel Christiane Nüsslein-Volhard and Eric Wieschaus were among the very few who did. These two scientists met each other in 1975 in Walter Gehring's laboratory in Basel, Switzerland. Nüsslein-Volhard had been trained as a biochemist and had gone to Basel to understand the genetics of fly development. Wieschaus was finishing his own Ph.D. work with Gehring and ready to leave for postdoctoral work in Zurich. The two immediately established personal and professional rapport, and began discussing their common interests in studying Drosophila embryos. They would remain in close contact with each other, even after Wieschaus had left Basel for Zurich and after Nüsslein-Volhard had left for a second postdoc in Freiburg. Normal Drosophila embryos are elongated ovals, but they soon divide along one axis into distinct segments. One end of the embryo eventually develops into a head region (anterior), the other the tail end (posterior) of the fly, with the segments in between forming the thoracic and abdominal regions of the fly. In the mid 1970s, one of the few known embryonic mutations was bicaudal, a "maternal effect" mutation that created a mirror-image duplication of the posterior at both ends of embryos laid by mutant females.

Drosophilists Trudi Schüpbach, Christiane Nüsslein-Volhard, Janos Szabad,and Eric Wieschaus in the late 1970s The bicaudal mutation piqued the interest of Nüsslein-Volhard and Wieschaus. They began to ask themselves how the embryonic pattern, the number and special properties of the segments, are determined? How do they become different over time? They asked themselves if maternal effect genes are unique as developmental determinants, or whether genes expressed in the embryo (zygotic genes) also contribute essential information. Did one gene explain formation of the segmental pattern, or was there a family of genes? More importantly, was it possible to determine what each "pattern formation" gene was doing by studying its mutations? As is often the case with major scientific breakthroughs, innovative ideas often flow against the intellectual tide. Today, the connections between early segmentation of the Drosophila embryo and development of the body structure in the adult fly might seem quite obvious. But this was not the case in the mid-1970s. At the time Nüsslein-Volhard and Wieschaus began to travel down this road, there were few other scientists who believed their course would be fruitful. Despite this skepticism, Nüsslein- Volhard and Wieschaus chose to focus their research on the identification of the genes that affect gross morphology of the embryo. Their basic faith that they could understand Drosophila development by studying mutant embryos was unusual, but it led quickly to a major scientific breakthrough.

A Gathering of Nobel Laureates: Science for the 21st Century -154-

Intellectual Courage and Research Independence This choice of research program was particularly courageous for two scientists who were at an early stage of their career, when gambles can be very costly. However, if the courage of their own convictions was critical, EMBL played an important enabling role. In 1978, the laboratory was still recruiting its first wave of group leaders. On the basis of strong recommendations by their previous research supervisors and others, both Nüsslein-Volhard and Wieschaus were invited to take independent Scientist positions in the new EMBL's Division of Cell Biology, where they would be free to follow their line of research. Already at this time, EMBL's basic philosophy was to recruit bright young researchers and give them the freedom to pursue their ideas. Early independence was considered a fundamental correlate to creative research. The two scientists were given a small laboratory space in EMBL's main building - the small size of which has taken on almost mythical proportions in the folklore of Drosophila researchers. If their laboratory was small, however, they had no teaching responsibilities, no grants to write, and no major professor's dictates to follow. Nüsslein-Volhard and Wieschaus were already good friends and EMBL was an environment that encouraged collaboration. Despite two strong personalities and professional equality, which could have easily prompted them to pursue separate research directions, they decided to collaborate. This decision was fateful for the discipline of developmental biology. Nüsslein-Volhard and Wieschaus were initially interested in very broad morphological questions about the embryo. Prompted by bicaudal, they wanted to explore how the pattern of development is already determined during oogenesis by maternal-effect genes. They thought that segmentation probably also required the expression of zygotically active genes. They did not, however, have any idea how many maternal or zygotic genes might be required for segmentation, what the relative importance of these different types of genes was, or if they had any role in later development of the fly. When they began working with mutations of maternal effect genes, they quickly realized that this represented a massive undertaking because it meant sorting (screening) thousands of flies in three successive generations. And, frankly, the original screens they devised for maternal genes simply did not work.

A Search for All Zygotically Active Mutants: The “Saturation” Screens Nüsslein-Volhard and Wieschaus decided to change tactics and screen first for zygotically active mutants, which would be detectable more easily in two generations. The logic of their screen was simple: mutants in genes that are essential for embryonic pattern formation should lead to embryonic lethality. Still, the specifics of the screens were not straightforward, especially as they had made the critical decision to search for all of the genes responsible for spatial organization of the embryo, rather than being satisfied with studying one or two mutants. Without this decision, their work would never have had its current impact. As we now know, the genes which they found through tireless "saturation" screens proved to work together in a step-wise process to form the embryo and, indeed, to support the overall development of the fly. Their decision meant that they would have to do screens on a very large scale, involving the study of progenies of thousands of individual flies for two generations (required to bring the mutations to homozygosity). Then they would have to search through very many eggs for dead embryos with segmentation defects. Furthermore, in order to make these screens practical, they had to develop new methods to make the embryos transparent so that their pattern would be easily visible. Again, the methods they devised were relatively simple, but essential for detecting mutants on a mass scale and for describing accurately the overall pattern defects. For a year, Wieschaus and Nüsslein- Volhard (later joined by Gerd Jürgens as a postdoc) sat opposite each other, day after day, at a table in their small laboratory, carefully examining a microscope stage filled with new stocks of Drosophila embryos. They used a special dual microscope, simultaneously observing the same embryos. Because their goal was to identify every gene involved in forming a proper embryonic pattern, the search had to be

A Gathering of Nobel Laureates: Science for the 21st Century -155- massive: no one knew how many genes to expect and there was fear that the numbers might be unmanageable. And it was important to describe carefully the phenotypes of the abnormal embryos to give clues as to what could be wrong in each case. As Nüsslein-Volhard now recalls, "It was a very difficult, but very exciting task. It also was great fun, as so many interesting discoveries were made."

The "Bierhelderhoff" Restaurant near EMBL, where discussions between "shifts" of the saturation screens took place. These tedious "saturation screens" were punctuated with stimulating discussions made possible by the use of the dual microscope. Nüsslein-Volhard and Wieschaus often found themselves debating whether a particular embryo constituted a new mutant or discussing how a gene might be functionally relevant. These discussions were often continued during dinner at the nearby farm restaurant, Bierhelderhof, before returning to the lab for the "night shift." More screenings, more discussion, and more thinking about what it all meant. After screening through half of the fly's genome, 15 genes affecting segmentation had been discovered plus another 50 or so affecting other aspects of the pattern.

A New Paradigm for Embryonic Development Remarkably, the phenotypes could be easily classified into three distinct categories. They called them gap, pair-rule, and segment-polarity, depending on what was missing from the embryo: a large domain of the body, smaller domains spaced every other segment, or even smaller domains within each segment. As they continued to accumulate more mutants, it became clear that they all fell into one of these three distinct categories, even if details (e.g. the exact borders of the missing domains) differed. Wieschaus and Nüsslein-Volhard believed that their exhaustive screens disproved the traditional view that the details of the body plan are already laid down by maternal effect genes. They proposed, instead, that embryos develop from much simpler beginnings, using a few maternal-effect genes and a larger number of zygotic genes. Most importantly, coupling careful observation and a good dose of brilliant intuition, they concluded that the tripartite classification of the zygotic genes reflects step-wise refinement of the body plan of the fly in early embryogenesis. The genes disrupted in gap mutants, they decided, affect broad regions of the embryo; pair-rule genes then operate on smaller regions that are spaced two segments apart; and finally, the segment-polarity genes affect part of each individual segment. They suggested that these three types of genes were responsible for a progressive subdivision of the embryo, starting with a rough sketch of the embryo body pattern and then filling in finer and finer details as two new waves of genes become active.

A Gathering of Nobel Laureates: Science for the 21st Century -156-

The paper was immediately accepted by Nature. It greatly impressed many developmental biologists, although, as is often the case with innovative new work, it was not universally appreciated. As carefully as their observations had been made, Nüsslein-Volhard's and Wieschaus' theories were still derived from descriptive analysis of phenotypes. The molecular studies that would prove them unequivocally correct came later, both from their own labs and those of a rapidly expanding group of scientists who would henceforth combine molecular and genetic approaches.

An Historical Turning Point in the Study of Embryology Wieschaus' and Nüsslein-Volhard's work was momentous in itself and it tore down a perceived barrier to research in this field. Before 1980, studying embryology had seemed a hopeless task. Suddenly, with a few key steps understood, it looked simple. A wave of new researchers was stimulated to search for other Drosophila (and, later, nematode and mouse) mutant genes affecting development - both zygotic and maternal-effect.

Christiane Nüsslein-Volhard and Eric Wieschaus today Soon afterwards, molecular biology cloning techniques allowed many developmental mutants to be characterized at the molecular level. Many were shown to code for transcription factors, thus explaining how they can directly control subsequent chapters in the embryo's developmental program. Others were shown to be involved in signal emission, reception or interpretation by the interacting cells of the embryo — thus explaining how the complexity of the embryo as a whole increases over time. Approximately 150 developmental regulating genes that affect gross morphology in Drosophila have now been characterized. To everyone's surprise, virtually all the genes involved in early development of Drosophila turn out to be represented also in vertebrates, proving an amazing conservation of regulatory mechanisms across over 600 million years of evolution. Now our understanding of how genes control development has progressed far beyond what Nüsslein-Volhard and Wieschaus discovered at EMBL fifteen years ago. But, as Matthew Scott, another leading figure in the field, says, "Their views of how these genes probably work have influenced everyone in the field and it is really viewed as the revolution in developmental genetics."

A Gathering of Nobel Laureates: Science for the 21st Century -157-

Developmental Research Returns to EMBL Research on development disappeared from EMBL soon after Nüsslein-Volhard and Wieschaus chose to move on to new positions in 1981. In the last few years, however, this field has been reintroduced within the EMBL Differentiation Program, and currently is represented by several group leaders, including three who work on Drosophila. Under EMBL's next Scientific Program, the Laboratory plans to continue strengthening this area. A new Developmental Biology Program is foreseen, which will focus on the next step, not only how specialized cells arise out of the rapid divisions of the early embryo, but also how these cells are integrated into a coherent whole, to give the nascent organism its overall form (morphogenesis) and its complement of functional organs. In developing this area, EMBL will draw upon the strength of existing Programs to nurture a multidisciplinary study of development. And it will draw on the tradition represented by Eric Wieschaus and Christiane Nüsslein-Volhard's work at EMBL: early independence, collaboration and originality.

by David M. States und Fotis C. Kafatos

“A Turning Point in the History of Developmental Genetics”2

Discussion Questions:

1. Why is this discovery considered a “turning point” in developmental genetics? 2. Was there a particular point in time when the researchers had a “Eureka” moment, or did the result come to them more slowly? 3. How did Dr. Nüsslein-Volhard and Weischaus describe their background and preparation for this work? 4. How did the EMBL serve as to support these researchers? 5. Do you think that EMBL deserves to claim some of the notoriety for the work done by these researchers, or does that scientific work belong to the researcher alone? 6. In general, when a researcher works for or works at an institution, whether public or private, to whom should the results and patents belong? The researcher? The supporter? You should be able to argue both sides of this point.

2 Since the publication of this article, Nüsslein-Volhard and Wieschaus (along with Edward Lewis) have been awarded the 1995 Nobel Prize for Physiology/Medicine. A Gathering of Nobel Laureates: Science for the 21st Century -158-

Classroom Connections:

Developmental Biology Developmental Biology http://www.biology.arizona.edu/developmental_bio/developmental_bio.html The Biology Project -- Take the Developmental Mechanisms Problem Set Compare the development of the frog and C. elegans from this link.

Stem Cell Research There is a lot of information on the web about Stem Cell research. Read the following articles and discuss the ethics of Stem Cell Research as related to the genetics of childhood disorders.

March XXXVI. Stem Cell Research, Part 1: New Neurons in the Adult Brain by Henriette Van Praag, http://info.med.yale.edu/chldstdy/plomdevelop/genetics/02margen.htm

May XXXVIII. Stem Cell Research, Part 2: Reconstructing the Brain by Fiona Doetsch, Ph.D. http://info.med.yale.edu/chldstdy/plomdevelop/genetics/02maygen.htm

June XXXIX. Stem Cell Research, Part 3: Regulation of Neurogenesis by Stress and Antidepressant Treatment by Ronald S. Duman, M.D. http://info.med.yale.edu/chldstdy/plomdevelop/genetics/02jungen.htm

July XL. Stem Cell Research, Part 4: Neural Horticulture by Magdalena Chechlacz, M.S., and Janice Naegele, Ph.D. http://info.med.yale.edu/chldstdy/plomdevelop/genetics/02julgen.htm

August XLI. Stem Cell Research, Part 5: Ethical Questions by Gene Outka, Ph.D. http://info.med.yale.edu/chldstdy/plomdevelop/genetics/02auggen.htm

Genetics Genetics (http://serendip.brynmawr.edu/sci_edu/waldron/genetics.html) Activity from Ingrid Waldron at University of Pennsylvania

These activities help students to understand the basic principles of genetics, including Punnett squares and pedigree analysis. The introduction links the understanding of meiosis and fertilization developed in the previous hands-on activity to an understanding of basic principles of genetics. http://serendip.brynmawr.edu/sci_edu/waldron/pdf/GeneticsProtocol.pdf (Teacher preparation notes)

Students learn the principles of Mendelian genetics by using sets of Popsicle sticks, each of which represents a pair of homologous chromosomes with multiple genetic traits. Pairs of students use their sets of Popsicle sticks to represent a mating and then identify the genetic makeup and phenotypic traits of the resulting baby dragon.

Dragon Genetics http://serendip.brynmawr.edu/sci/waldon/pdf/dragon.pdf

Dragon Genetics (http://serendip.brynmawr.edu/sci_edu/waldron/dragongenetics.html)

A Gathering of Nobel Laureates: Science for the 21st Century -159-

Discussion Questions 1. Is a human embryonic stem cell more like an embryo or an ordinary somatic cell?

2. Who should be the decision maker for surplus IVF embryos? The woman and man who provided the sperm and eggs? The woman for whose womb the embryo was originally intended?

3. Are there any problems, including moral ones, with permitting the private sector and states to fund human stem-cell research but not the federal government?

4. If the treatments and medications produced through stem-cell research are costly, who should have access to them and why? What if a treatment for Alzheimer’s disease was discovered, but it cost $125,000 (or more). Should Medicare cover this treat for everyone over 65?

5. Consider each of the following arguments/counter-arguments for reproductive cloning. Where do you stand with respect to each point and why?

a. Objection: Reproductive cloning is wrong because it violates human dignity by substituting the process of human replication for human procreation. Two no longer become one. Response: But, why must human beings procreate? Is anything inherently wrong with replicating?

b. Objection: Reproductive cloning is wrong because it is probably very unsafe and costly. Response: But someday cloning may become very safe and relatively inexpensive.

c. Objection: Reproductive cloning is wrong because it threatens the clone’s sense of individuality. Response: But, twins view themselves as individuals, and clones are simply twins separated at birth time by years instead of minutes.

d. Objection: Reproductive cloning is wrong because it threatens clone’s autonomy. Response: But, parents need not try to get clone to think and act in certain ways. They could instead let the clone develop as the clone wishes.

e. Objection: Reproductive cloning is wrong because it leads to the objectification or instrumentalization of children. Response: But, parents need not view their clones (or naturally born children) as mere means to their own ends.

A Gathering of Nobel Laureates: Science for the 21st Century - 160 -

f. Objection: Reproductive cloning is wrong because it undermines kinship, lineage, and family relations (cloning an existing or deceased child, cloning an unrelated third party, cloning one’s self, and cloning one’s parent). Response: But what is wrong with transforming kinship, lineage, and family relations? They are far from perfect now.

g. Objection: Reproductive cloning is wrong because it will lead to people selecting certain genetic characteristics. Response: But people already do this in a variety of ways. They try to date and marry good-looking people. They try to eliminate harmful genetic diseases.

6. Do you think therapeutic cloning will inevitably lead to reproductive cloning? Why or why not?

7. Should reproductive cloning be banned, regulated, or freely permitted to develop?

8. Would you ever consider cloning yourself? Why or why not?

9. Where do you think reproductive cloning will be first developed? Why?

Case Studies 1. Do you feel President Bush’s stance on public funds for stem cell research contradicts the Nuremberg Code? Why or why not?

2. In February 2004, Science reported that two Korean researchers had created 200 human embryos by cloning human cells. Thirty of these embryos survived to the blastocyst stage of more than 100 cells. During a press conference at a meeting of the American Association for the Advancement of Science

in Seattle, one of the researchers, Woo Suk Hwang, stated: “Our goal is not to clone humans, but to understand the causes of diseases.”

If reproductive cloning holds the promise of curing everything from juvenile diabetes to baldness, should the research remain banned?

A Gathering of Nobel Laureates: Science for the 21st Century - 161 -

3. In 2002, Dr. Hung -Ching Liu of Cornell University’s Center for Reproductive Medicine and Infertility successfully grew human embryos onto an artificial womb wall. The wall was constructed from extracted womb cells that were cultured in serums of growth factors and hormones. The embryonic cells were encouraged to grow on a biodegradable “scaffold” that was shaped in the form of a uterus. “The embryos attached themselves to the walls of our prototype wombs and began to settle there,” Dr. Liu explained. According to Newsmagazine, Dr. Liu halted the experiment after six days, but now plans to continue to 14 days (the IVF industry’s suggested legal age limit for experimentation on living human beings). “We will then see if the embryos put down roots and veins into our artificial wombs’ walls, and see if their cells differentiate into primitive organs and develop a primitive

placenta,” said Dr. Liu, who wants her technology to be used to allow women with damaged uteruses a chance to have their own baby in their “own” womb.

a. What are some of the negative implications of the artificial womb?

b. What are some of the positive implications of the artificial womb?

A Gathering of Nobel Laureates: Science for the 21st Century - 162 -

Pre and Post Test Questions for Christiane Nüsslein-Volhard

1. For what discovery in science did Christiane Nüsslein-Volhard, Edward B. Lewis and Eric F. Wieschaus share the 1995 Nobel Prize in Medicine?

2. Why are fruit flies used so often in genetic research?

3. Why is it important to find out which genes control the development of embryos?

4. Christiane Nüsslein-Volhard confesses to being lazy at school and only working hard at the subjects she liked. In fact she was not very good at English until she went to Switzerland. What would you say if you were a teacher of a pupil like Christiane?

5. Explain the relationship between the functions of the genes studied by Nüsslein-Volhard with those of the human embryo.

6. Why did Nüsslein-Volhard decide that developmental biology was the area where she could make a difference and a field that needed her expertise?

7. Why was the work of Nüsslein-Volhard, Lewis, and Wieschaus considered to be “ A turning point in the history of developmental genetics?

8. What childhood experiences contributed to the love of science that Nüsslein-Volhard has exhibited throughout her life?

9. Would you ever consider cloning yourself or a family member? Why or Why not?

10. What is the significance of the work of Christiane Nüsslein-Volhard, Edward B. Lewis, and Eric F. Wieschaus?

A Gathering of Nobel Laureates: Science for the 21st Century - 163 -

A Gathering of Nobel Laureates: Science for the 21st Century - 164 -

The Echo Foundation presents

“A Gathering of Nobel Laureates: Science for the 21st Century”

Dr. Douglas D. Osheroff and Dr. Robert C. Richardson

©Peter Badge/Typos1 in coop with Foundation Lindau Nobelprizewinner Meetings at Lake Constance

The Nobel Prize in

Physics 1996

with David M. Lee

" for their discovery of superfluidity in helium-3"

Dr. Douglas D. Osheroff Dr. Robert C. Richardson Professor of Physics and Professor of Physics Applied Physics Cornell University Stanford University Ithaca, NY Stanford, CA

A Gathering of Nobel Laureates: Science for the 21st Century - 165 -

A Gathering of Nobel Laureates: Science for the 21st Century - 166 -

Douglas D. Osheroff and Robert C. Richardson Curriculum

Table of Contents Page

Osheroff School Partnership Team 170 Douglas D. Osheroff – The Person 171 Classroom Connections 175

Richardson School Partnership Team 176 Robert C. Richardson – The Person 177 Classroom Connections 181

Superfluidity in Helium-3 182

The Nobel Prize in Physics 1996 186

Overview of Discovery of Superfluidity in Helium-3 188

Supercool Physics on The Nobel Prize 193 Classroom Connections 194

Implications Lord Kelvin, the Kelvin Scale and Cold Temperatures 195 Classroom Connections 196

With Strings Attached 197 Classroom Connections 198

Universal Threads: String Theory 199 Classroom Connections 200

Heat of Solution Classroom Experiment 201

Future Directions Researchers Cool Gas To Record Low 206 Classroom Connections 207

Osheroff Appointed to Shuttle Disaster Investigative Board 208 Classroom Connections 209

Pre and Post Test for Douglas Osheroff and Robert Richardson 210

The Nature of Discovery in Physics, Douglas D. Osheroff, Department of Physics, Stanford University, Stanford, CA, American Journal of Physics, 69, (1), January, 2001, http://ojps.aip.org/ajp/

A Gathering of Nobel Laureates: Science for the 21st Century - 167 -

A Gathering of Nobel Laureates: Science for the 21st Century - 168 -

NOBEL PRIZE IN PHYSICS 1996

The Discovery of the Superfluidity in Helium-3

DOUGLAS D. OSHEROFF ROBERT C. RICHARDSON

Professor of Physics Professor of Physics and Applied Physics Cornell University Stanford University

"I think I was genetically predisposed to “I tried to become a chemistry major but ran become a scientist," Osheroff says. "As a into great difficulty in a course called child, I got into all kinds of things, many quantitative analysis because of my color of which would get me into trouble with blindness. I could not tell when the color of the FBI today." the indicator solution turned from pink to blue unless I made a very strong over- http//www.stanford.edu/dept/news concentration of acid or base. When I /stanfordoday/ed/9701/ST9701smf1.html complained to the professor he told me that I was very fortunate to discover my disability early in my college career because I certainly was not suited to be a chemist. Finally, I turned to physics as a major.”

http://nobelprize.org/physics/laureates/1996/richardson- autobio.html

©Peter Badge/Typos1 in coop with Foundation Lindau Nobelprizewinner Meetings at Lake Constance

A Gathering of Nobel Laureates: Science for the 21st Century - 169 -

The Echo Foundation

Presents

2004-2005 Project

A Gathering of Nobel Laureates: Science for the 21st Century

Laureate Guest

Dr. Douglas Osheroff

School Partnership Team Independence High School North Mecklenburg High School Vance High School

School Facilitators Syndie Fleener Independence High School Julie McConnell North Mecklenburg High School Laura Rosenbach Vance High School

Science Liaisons John Hess Independence High School Michael Kowalski North Mecklenburg High School Kenneth Carter Vance High School

Curriculum Team Jimmie Agnew*, Ph.D. Associate Professor of Physics Coordinator of Science Education Coordinator of Science Without Borders Professor of Physics, Elon University Wayne Fisher, MA Physics, National Board Certification, International Baccalaureate Certification Charlotte Mecklenburg Schools, Myers Park High School, Physics Teacher Mona Hedrick, National Board Certification, International Baccalaureate Certification, Charlotte Mecklenburg Schools, East Mecklenburg High School, Chemistry/Physics Teacher Jeff Steinmetz, Ph.D. Candidate, Queens University of Charlotte, Assistant Professor of Environmental Science

* Curriculum Team Leader A Gathering of Nobel Laureates: Science for the 21st Century - 170 -

Douglas D. Osheroff – The Person Autobiography Ethnically, I come from a mixed family. My father was the son of Jewish immigrants who left Russia shortly after the turn of the century, and my mother was the daughter of a Lutheran minister whose parents were from what is now Slovakia. Mostly, however, I grew up in a medical family. My father's father and all his children either became physicians or married them. My parents had met in New York where my father was a medical intern and my mother was a nurse. At the end of World War II, my parents settled in Aberdeen, a small logging town on the west coast of Washington State, where medical doctors were in short supply. Surrounded by natural beauty, it was a perfect place to raise a family, and I was the second of five children.

To this day I grow pale at the sight of blood, and never for a moment considered a career in medicine. Despite this, my father, who was usually engrossed in his medical career, inspired in me passions for both photography and gardening, which were his hobbies when time permitted, as they are mine. Natural science interested me intensely from a very early age. When I was six I began tearing my toys apart to play with the electric motors. From then on, my free hours were occupied by a myriad of mechanical, chemical and electrical projects, culminating in the construction of a 100 keV X-ray machine during my senior year in high school.

My projects often involved an element of danger, but my parents never seemed too concerned, nor did they inhibit me. Once a muzzle-loading rifle I had built went off in the house, putting a hole through two walls. On another occasion a make-shift acetylene 'miners' lamp blew up on my chemistry bench in the basement, embedding shards of glass in the side of my face, narrowly missing my right eye. With blood running down my face, I came up the stairs cupping my hands to keep the blood off the carpet. My mother was by then at the top of the stairs. Knowing my propensity for practical jokes, she exclaimed loudly "If you're kidding I'll kill you! " As usual, my father lectured me about safety as he sewed the larger wounds closed, and there was always an unspoken understanding that that particular phase of my experimentation was over.

In high school I was a good student, but only really excelled in physics and chemistry classes. While I liked physics much more than chemistry, the chemistry teacher, William Hock, had spent quite a bit of time telling us what physical research was all about (as opposed to my experimentation), and that effort made a deep impression on my young mind. My interest in experimentation helped me to develop excellent technical skills, but I did not feel motivated to do independent reading in those areas of physics or chemistry associated with my projects. I was intellectually rather lazy, and in high school I would always take one free class period so that I could get my homework out of the way, freeing the evenings for my many projects.

My parents were generous, and the home for me was filled with scientific toys and gadgets. In addition, their children were allowed to attend any university to which they could get admitted. I chose Caltech over Stanford to avoid a continuing comparison of my academic record with that of my older brother, then a Stanford undergraduate.

It was a good time to be at Caltech, as Feynman was teaching his famous undergraduate course. This two-year sequence was an extremely important part of my education. Although I cannot say that I understood it all, I think it contributed most to the development of my physical intuition. The Feynman problem sets were very challenging, but I had the good fortune to know Ernest Ma, who was an undergraduate, one year ahead of me. Ernest would never tell me how to solve problems, but would give obscure hints when I got stuck, at least they seemed obscure to me at the time.

A Gathering of Nobel Laureates: Science for the 21st Century - 171 -

It was a shock to suddenly have to work so hard in my studies. I had the most trouble in math, and only through considerable trauma did I gradually improve my performance from a grade of C+ to A+ over a three-year period. Years later, when Caltech was offering me a faculty position, I confided that I did not have a very illustrious career as an undergraduate. To this remark the division chair replied, "That's OK Doug, we are not hiring you to be an undergraduate."

The pressure at Caltech was extreme, and I am not sure I would have survived had I not joined a group of undergraduates working with Gerry Neugebauer on his famous infra-red star survey during my junior year. This experience made me recognize how satisfying research could be, and how different it was from doing endless problem sets. In my senior year, in order to get out of a third term of senior physics lab, I also began working in David Goodstein's low temperature lab (David was in Italy). Two professors, Don McCullum from U.C. Riverside and Walter Ogier from Pamona College, were spending their sabbatical leaves there trying to reach a temperature of 0.5K by pumping on a helium bath in which the superfluid film had been carefully controlled. They filled my mind with the wonders of the low temperature world, and I decided I would go into solid-state physics.

I chose to attend Cornell for graduate school largely because it was so far away from the Pasadena smog. In the end, it was a good choice, and a good time to be at Cornell. Soon after my arrival I met two people who were to become very important in my life. While still looking for housing, I met Phyllis Liu, a pretty young woman from Taiwan, who had also just arrived in Ithaca. We dated a bit, but then she found herself too busy with her studies for such diversions. We met again three years later, and were married in August, 1970, two weeks after she obtained her Ph.D. The other person was David Lee, the head of the low temperature laboratory at Cornell and the professor under whom I was to work as a teaching assistant my first year. Dave seemed to think that I was bright, and encouraged me to join the low temperature group.

Low temperature physics seemed even more exciting at Cornell than it had been at Caltech. New technologies and interesting physics made the field easy to choose, and I found myself thoroughly enjoying every minute of my work. In the spring of my fourth year Dave Lee asked me to talk to the Bell Labs recruiter, who came to campus in the fall and spring of each year. I was not ready to graduate, but we talked a bit, especially about making tiny electrical plugs to be used throughout the Bell Telephone system. It seemed interesting to me, although not really physics. In the fall, Dave suggested I start interviewing in earnest. I first talked with General Electric, who seemed to have no jobs whatsoever. I then talked to Bell Labs again, but this time to a new recruiter, Venky Narayanamurti, who had recently received his Ph.D. in physics at Cornell. Venky was enthusiastic about what I was doing, and felt that I might be able to get a postdoc doing Raman spectroscopy. I didn't confess that I knew nothing about the subject.

We discovered our mysterious phase transitions in my Pomeranchuk cell in November 1971, and almost by magic, Venky called me up in early December with good news. The hiring freeze which had been in place for almost two years at Bell had been lifted. How soon could I be ready to come down for a job interview? I told Venky that we had stumbled on to something that was pretty exciting, and we fixed the date: January 6, 1972.

At Bell Labs, a job interview began with a thesis defense, and it could at times turn nasty. I was lucky that no one questioned my association of the A and B features with the solid. In particular, Dick Werthamer was in the audience, and he had done early work on the p-wave BCS state soon to be associated with the B phase. I think my enthusiasm carried the day, and ultimately Bell Labs offered me not a postdoc position in Raman spectroscopy, but a permanent position, which would allow me to continue my studies on 3He.

A Gathering of Nobel Laureates: Science for the 21st Century - 172 -

Phyllis and I moved to New Jersey in September 1972; Phyllis to a postdoc position at Princeton University, and I to Bell Laboratories at Murray Hill. This was the golden era at Bell Labs. The importance of the transistor, invented in the research area there, made management extremely supportive of basic research. The only requirement was that work done should be 'good physics' in that it changed the way we thought about nature in some important way. I joined the Department of Solid State and Low Temperature Research under the direction of C. C. Grimes, and began purchasing the equipment I would need to continue what I by then knew were studies of superfluidity in 3He. Some instrumentation was even purchased before I arrived in New Jersey. Yet I knew it would take at least a year to set up my laboratory, and I feared that most of the important pioneering work would be done before my own lab became operational.

I was surprised to find that by the time my laboratory did become operational, few of the studies that interested me had been done. Indeed, there seemed to be some question as to whether or not these new phases were all p-wave BCS states. In addition, theorists Phil Anderson and Bill Brinkman at Bell Labs had become interested in the theory of superfluid 3He. This set the stage for what was to be an extremely productive period in my career. Over a five-year period, beginning in 1973, we measured many of the important characteristics of the superfluid phases which helped identify the microscopic states involved. We found the superfluid phases to be almost unbelievably complex, and at the same time extremely well described by the BCS theory and extensions to that theory developed during that period.

In about 1977 I began to feel pressure from Bell Laboratories management to go on to study other physical systems. I decided to study solid 3He, my original thesis topic, and at the same time Gerry Dolan and I began a modest program to test some of the ideas that David Thouless had discussed on electron localization in disordered one-dimensional systems. This latter study had to fit within the extremely slow time scale of the solid 3He work. By late 1979, both of these efforts had succeeded beyond my wildest expectations. We discovered antiferromagnet resonance in nuclear spin ordered solid 3He samples, which we grew from the superfluid phase directly into the spin-ordered solid phase. At the same time, the low temperature group at the University of Florida also discovered these resonances, but because we cooled our samples by adiabatic nuclear demagnetization of copper rather than Pomeranchuk cooling, only we were able to form and study single crystals, and could thus identify the allowed magnetic domain orientations. In the end, Mike Cross, Daniel Fisher and I were able to determine the symmetry of the magnetic sub-lattice structure, and correctly guessed the precise ordered structure, later confirmed by polarized neutron scattering. The frequency shifts resulting from this antiferromagnetic resonance have made solid 3He an extremely useful model magnetic system, and to understand them theoretically, we had borrowed some of the same formalism which Leggett used to understand the frequency shifts in superfluid 3He.

At almost the same time that Cross, Fisher and I made our breakthrough in our solid 3He studies, Dolan and I discovered the log(T) temperature dependence to the electrical resistivity in disordered 2D conductors which Phil Anderson and his 'gang of four' had just predicted would exist, as a result of what they termed 'weak localization'. I did not continue the work on weak localization, as I only had one cryostat, and to do so would have meant that I could not continue my studies on nuclear spin ordering in solid 3He, since the two sets of experiments would have vastly different time scales. Somewhat ironically, I got a second cryostat two years later.

In 1987, after fifteen years, I left Bell Laboratories to accept a position at Stanford University. I had received informal offers of university positions periodically while at Bell Labs, but always found Bell to be the ideal place to do research. The combination of in-house support for basic science and first-rate collaborators made Bell Labs unbeatable as an environment for doing research. However, my wife recognized in me a teacher waiting to be born. In addition, she was not happy with her job in New Jersey, and we agreed that she would apply for positions elsewhere. When she received offers from two biotech companies in California, Amgen A Gathering of Nobel Laureates: Science for the 21st Century - 173 - and Genentech, I suggested that she accept the Genentech offer and that I would start talking to Stanford and U.C. Berkeley. Stanford, which has a small physics department, had just begun a search for a low temperature physicist. Ultimately, I received offers from both institutions, and chose Stanford because we liked the atmosphere better, and it was a better commute for Phyllis.

At Stanford my students and I have continued work on superfluid and solid 3He, studying how the B superfluid phase is nucleated from the higher temperature A phase and diverse properties of magnetically ordered solid 3He in two and three dimensions. In addition, we have developed a program to study the low temperature properties of amorphous solids. Our work has shown that interactions between active defects in these systems create a hole in the density of states vs. local field, just as is seen in spin-glasses. In amorphous materials, it may be possible to measure the size of coupled clusters of such defects, something which has been difficult in spin-glasses.

I have thoroughly enjoyed all aspects of university life, except for having to apply for research support. In particular, I have been fortunate to have had excellent graduate students, and to be able to teach bright undergraduates. Of course, with undergraduates one always has a few students who do not appreciate the professor's efforts. In 1988, after teaching my first large lecture course, one student wrote in his course evaluation: "Osheroff is a typical example of some lunkhead from industry who Stanford University hires for his expertise in some random field." Despite this minority opinion, in 1991 Stanford presented me their Gores Award for excellence in teaching. From 1993-1996 I served as Physics Department chair, and stepped down in September 1996, hoping to spend more time with my graduate students. The day I learned I was to receive the Nobel Prize, after just two and a half hours sleep the night before, I taught my class on the physics of photography, although the lecture was not on photographic lenses, but the discovery of superfluidity in 3He. From Les Prix Nobel 1996 http://nobelprize.org/physics/laureates/1996/osheroff-autobio.html Education - Douglas D. Osheroff • B.S., 1967, Caltech • Ph.D., 1973, Cornell

Major Events - Douglas D. Osheroff

• Member of technical staff of AT&T Bell Laboratories, 1972-87 • Head Solid State and Low Temperature Research Department 1981-87 • Professor of Physics and Applied Physics 1987-present • J. G. Jackson and C. J. Wood Professor of Physics • Fellow of the American Physical Society and the American Academy of Arts and Sciences • Member of the National Academy of Sciences • Simon Memorial Prize 1976 • Oliver E. Buckley Prize, 1981 • MacArthur Prize Fellow, 1981 • Walter J. Gores award for teaching, 1991

Recipient of the Nobel Prize in Physics, 1996, http://www.stanford.edu/dept/physics/people/nobel/osheroff.html

A Gathering of Nobel Laureates: Science for the 21st Century - 174 -

Classroom Connections:

1. In small groups, read Dr. Osheroff’s autobiography. Work together to answer the following questions. Be prepared to share your answers in a large group discussion. A. What type of childhood did Dr. Osheroff experience? How did he enjoy spending his time? B. Describe his attitude towards learning. What subjects in high school did he enjoy the most? Why? C. Why did he choose CalTech over Stanford? What type of student was he at CalTech? D. At various stages of his growth as a student, mentors played key roles helping Dr Osteroff decide which direction his career should take. Name at least three people who Dr. Osteroff would consider to be his mentor. E. Construct a brief timeline of Dr Osteroff’s life using dates listed in the autobiography. Record key events leading up to winning the Nobel Prize in 1996.

2. In large class discussion, compare and contrast notes taken by the small groups. Key questions to consider include:

A. What are some characteristics of people who win Nobel Prizes? B. What types of learning environments tend to promote creativity and imagination in people? C. What role do mentors play in helping people grow academically?

3. As an extension activity, have students also read the autobiography for Robert Richardson, then compare and contrast using a Venn Diagram, the qualities Osheroff and Richardson have in common and how they differ in their pursuit of knowledge.

A Gathering of Nobel Laureates: Science for the 21st Century - 175 -

The Echo Foundation

Presents

2004-2005 Project

A Gathering of Nobel Laureates: Science for the 21st Century

Laureate Guest

Dr. Robert C. Richardson

School Partnership Team Charlotte Country Day School East Mecklenburg High School West Mecklenburg High School

School Facilitators Carol Morris Charlotte Country DaySchool Linda Hewitt East Mecklenburg High School Keith Camburn West Mecklenburg High School

Science Liaisons Marsha Newton-Graham Charlotte Country Day School Mona Hedrick East Mecklenburg High School Keith Camburn West Mecklenburg High School

Curriculum Team Jimmie Agnew*, Ph.D. Associate Professor of Physics Coordinator of Science Education Coordinator of Science Without Borders Professor of Physics, Elon University Wayne Fisher, MS Physics, National Board Certification, Charlotte Mecklenburg Schools, Myers Park High School, Physics Teacher Mona Hedrick, Charlotte Mecklenburg Schools, East Mecklenburg High School, Physics Teacher Jeff Steinmetz, Ph.D. Candidate, Queens University of Charlotte, Assistant Professor of Environmental Science

* Curriculum Team Leader A Gathering of Nobel Laureates: Science for the 21st Century - 176 -

Robert C. Richardson – The Person Autobiography I was born on June 26, 1937 in Georgetown University Hospital in Washington, DC. My parents, Lois Price Richardson and Robert Franklin Richardson, lived in Arlington, VA. My sister and only sibling, Addie Ann Richardson, was born on May 6, 1939, also in Georgetown University Hospital.

My earliest memories are of the apartment building in Arlington where my mother, sister, and I lived during the years of World War II while my father was away in the US Army. He was an officer in the Signal Corps. We lived across the street from the fire department and became accustomed to the blast of the siren at all hours of the day and night. It is fortunate that we lived so close to the fire department because one morning while my mother was visiting neighbors my sister set the apartment on fire while playing with the gas stove. Little damage was done, though I am certain that my mother was thoroughly embarrassed.

My father was a native Virginian. Branches of his family could be traced back to the early colonial times. His father, Robert Coleman Richardson, after whom I was named, owned a general store in a small rural village, Penola, VA. My father attended Roanoke College for two years during the Great Depression. When his mother became seriously ill, he left college because of the increased family expenses. He became interested in electricity and began work as a 'lineman' for the Chesapeake and Potomac Telephone Company in Richmond, VA.

My mother's family was from North Carolina. She was an orphan, practically from birth, and was shuttled among relatives in North Carolina. As was a common practice in the rural South, she was taught at home by various aunts. She attended only one year of public school before going off to college. The one year of high school was in Reidsville, NC in 1918. She attended various colleges - Gulf Park College, the University of Alabama, the University of Mississippi, and the University of Virginia. She was one of the first women to attend the latter and obtained a Master's Degree in History there. During her college career she was brought in to the large and warm family of Ernest H. Mathewson in Richmond, and thus gained three brothers and two sisters. The Mathewsons were known by my sister and me as our other grandparents during our youth.

My parents met in Richmond and were married there in 1935. Shortly thereafter, my father was transferred by the telephone company to their branch in Washington, DC. As an army reservist my father was called to active duty during World War II and again during the Korean War. During his service for the latter he was assigned to the Pentagon so that it did not become necessary for him to leave home. During his second tour of duty with the army he took advantage of the educational benefits associated with the 'G.I. Bill of Rights' to finish college. He graduated from the University of Maryland in 1955.

I do not remember having any special scientific interests during childhood but I did love school. In 1946, when I was in the fourth grade, my family moved from the apartment building we had lived in during the war years. My father bought a new house in one of the housing tract developments so common to the postwar suburbs of American cities. We still lived in Arlington, VA. My new elementary school, Walter Reed, was overcrowded. The fourth and fifth grades met in the same room with the same teacher. I paid as much attention to the fifth grade instruction as the fourth. I especially loved the history lessons because Mrs. Walton, our teacher, was a remarkable storyteller. During the summer between fourth and fifth grade, I went to summer school just to have something to do. The teacher of the summer session was confused about my grade status and inadvertently promoted me to the sixth grade. The Arlington County A Gathering of Nobel Laureates: Science for the 21st Century - 177 -

School system accepted her decision. So I skipped a grade. Had I remained in the same grade, one of my classmates in Walter Reed School would have been Warren Beatty (of film star fame), whose family had just moved to our neighborhood in Arlington.

With my parent's encouragement, I became very active in the Boy Scouts. Scouting did not exist in rural Virginia, where my father grew up. In his youth, he had always envied boys from larger cities who could be in scouting. My involvement gave him, vicariously, the scouting experience he had missed. With his help, I became an Eagle Scout in the minimum amount of time permitted by the rules. I especially enjoyed the outdoor activities of scouting, hiking, camping, and even birdwatching.

I spent the enjoyable summers of my high school years working as a counselor in Camp Letts, a Boy Scout Camp on the western shore of the Chesapeake Bay in Maryland. I was a nature counselor. I spent my days leading tours on nature trails through the camp. My ankles were covered with a minor poison ivy rash from June through August. In the evenings I led groups in 'stargazing;' and one morning each week I led a ten-mile canoe trip through the Maryland marshland to look at birds. I liked the canoe trips best. We would arrive at the entrance of the marsh just at sunrise when the maximum number of birds would be out feeding. The marshes had large water birds like egrets and herons, three kinds of wrens, more than twenty different warblers, vireos, plus large birds of prey like hawks and eagles. It was possible in a single morning for a scout to spot enough birds on a single trip to qualify for the birdwatching merit badge. I learned where all of the birds hung out and how to tell them by their songs. Although I am color blind, I memorized their descriptions in the bird manual. I would describe subtle pastel features of warblers and vireos flitting about in the tree tops 60 feet above the ground to the amazement of even the adult scout leaders. There is a famous painting by James Audobon of a bald eagle diving toward an osprey just after the osprey has caught a fish. Each summer I was fortunate enough to see that scene re-enacted at least once. It made a special impression on the groups I led because I showed them a copy of the painting before we left on the trips.

My high school class at Washington-Lee High School had 925 students in it. I graduated, as I recall, in a six-way tie for 19th place. There was nothing exceptional about the math and science training at Washington-Lee. The idea of 'advanced placement' had not yet been invented. I did not take a calculus course until my second year of college. The biology and physics courses were very old fashioned. The idea of a 'photon' was said to be controversial. This in 1953! I was taught that absolute zero is the temperature at which all motion stops. It is most fortunate that the statement was wrong. Otherwise 3He could not become a superfluid.

I entered Virginia Polytechnic Institute, also called Virginia Tech, in the Fall of 1954. In those days, the Reserve Officers Training Corps program was compulsory for all physically fit entering students at VPI. Moreover, all ROTC students lived in a cadet corps with fairly rigorous military discipline. I surprised myself by really enjoying life in the VPI Corps of Cadets. I learned an easy and democratic camaraderie. As we were assigned to live in cadet companies in alphabetical order, my closest friends were those in the bottom third of the alphabet.

In class, I started out as an electrical engineer but soon became bored and impatient with the mechanical drawing course and the rote application of a single principle, Kirchoff's Laws, in a five-hour course. I tried to become a chemistry major but ran into great difficulty in a course called quantitative analysis because of my color-blindness. I could not tell when the color of the indicator solution turned from pink to blue unless I made a very strong over-concentration of acid or base. When I complained to the professor he told me that I was very fortunate to discover my disability early in my college career because I certainly was not suited to be a chemist. A Gathering of Nobel Laureates: Science for the 21st Century - 178 -

Finally, I turned to physics as a major. I was not an especially diligent student but nevertheless obtained a reasonable education in physics. I graduated with a B average and fourth in a group of about 9 physics majors. My education through the Cadet Corps was at least as valuable as that in formal class training. I was a leader in several campus organizations. The rigorous honor code at VPI in those days was almost exhilarating. We were all very proud of it. I never saw anyone cheat on a test in my years there.

In summers, while in college, I had a very interesting job with the National Bureau of Standards. I worked in the Electricity Division calibrating electrical resistance standards, which power companies sent to NBS once each year. The NBS program for summer students was quite wonderful. First, we were well paid. Next, we actually did useful research. Finally, we attended a weekly seminar series, which was given at our level of understanding. In my spare time at NBS, I read the scientific literature on electrical instrumentation and even met some of the authors of some of the classic articles. The experience at NBS gave me some notion of what a scientific research career could be.

After graduating from college, I had a vague idea of going to a graduate program in business - with hopes of becoming an executive in a large corporation. First, though, I felt that I had not quite given physics and research a chance so I decided to remain at VPI for one more year to obtain a Master's Degree before going off to military service as an Army Officer. The project I worked on was the measurement of the lifetime of photo-excited carriers in germanium. In the process I had to build a great deal of equipment because Tom Gilmer, my advisor, had just come to VPI to a practically empty lab. Tom was a good mentor, but he was very busy as department chairman and VPI professors had quite a large teaching load. I learned a great deal about how to do things with my own hands - operate a lathe, solder, make simple electronic circuits, etc. I knew about keeping a lab book from my summer jobs at NBS. In that year I became a good deal more confident that I could learn physics at advanced levels, but still was not in any way special. I think I was still fourth in the group of graduate students. With the feeling that I would probably be a mediocre physicist, at best, I left VPI with the intent of attending a Masters in Business Administration, MBA, program after finishing military service.

A great piece of good fortune fell for me during my year of graduate work at VPI. The Army ran short of money. Thus, rather than having to spend two years on active duty, I was only assigned for six months of active duty in the US Army Ordnance Corps between November 1959 and May 1960. This was a time well after the Korean War and well before the Vietnam War. There was no likelihood of actually having to see any combat. At Aberdeen Proving Ground, the Ordnance Corps training base, I took courses in how to manage a platoon, which would do things like repairing jeeps and tanks. I hated the course and the being in the Army. Wearing a uniform and the military discipline did not bother me; I had become used to both while in the VPI Cadet Corps. But I did not enjoy the training in how to run a small business - for that's what a repair platoon in the Ordnance Corps was. Therefore, I decided to return to graduate school to obtain a Ph. D. in physics.

I had no opportunity while in the Army to take tests like the Graduate Record Exam to qualify me for admission to one of the top graduate schools - like MIT, Harvard, or Cornell. Besides, I probably would not have been admitted even if I had taken the tests. Therefore, I looked for smaller research universities with strong specialties. In my graduate research project, I had made a simple liquid nitrogen dewar, and found the area of low temperature physics to be interesting. I had read some articles about the work going on at Duke University so decided to apply there. I received a warm letter from Horst Meyer, a new Assistant Professor at Duke, encouraging me to come to work for him. The letter was very flattering - the first strong encouragement I had ever received about my potential as a physicist. Therefore, I entered Duke in the Fall of 1960 as a full-time graduate student. A Gathering of Nobel Laureates: Science for the 21st Century - 179 -

I had a glorious time at Duke. I made strong friendships, which have been maintained through the rest of my life. I met my wife, Betty McCarthy, there. One of only two physics majors in her class at Wellesley College, Betty was also a graduate student in Physics. We were married in 1962 and our daughters Jennifer and Pamela were born in Durham, NC, in 1965 and 1966.

Horst was a very conscientious mentor. He taught me a great deal of the craft of low temperature technology he had learned as a research associate at the Clarendon Laboratory in Oxford. In all of the subsequent years he has been a valued friend. We had the best of two worlds in our low temperature group at Duke in those days. Bill Fairbank had been there but left before I arrived. Much of the old equipment and the residue of the experimental technology from Bill Fairbank remained. Horst brought a different set of techniques with him and we had our choice of which way to do things - for example the use of wood's metal to attach vacuum cans along with Epiezon J-oil for thermal contact were the Oxford technique. Indium O-rings and vacuum grease were the Fairbank method. Both had advantages.

Horst put me on a good problem - the NMR study of the exchange interaction in solid 3He. Earle Hunt came to Duke as a research associate with Horst and taught me about the new methods for pulsed NMR- spin echos and all of that. The combination of training with Horst and Earle put me in business for practically the rest of my research career.

I finished my thesis in 1965 and remained at Duke for another year as a research associate in order to clean up some of the loose ends of the research and to look for a good job. In the latter, I was fortunate indeed. Cornell University, with its special funding as an Interdisciplinary Laboratory (IDL) had decided to expand its effort in low temperature physics. In the spring of 1966 the Laboratory of Atomic and Solid State Physics invited me to join them to work with Dave Lee and John Reppy on very low temperature helium research. As far as I was concerned, there could be no better career opportunity.

I moved my family to Ithaca in October 1966 and have remained there ever since. I received sound career advice from Dave and John from the day I arrived. The research environment at Cornell has been superb with an unbroken string of talented graduate students, close colleagues in both theory and experiment, and a team of technical support specialists who helped make everything work. During my thirty years at Cornell I even learned how to teach undergraduate physics courses, an activity which my wife and I enjoy a great deal. After our daughters entered Junior High School, Betty turned to teaching physics at Cornell also. She is now a Senior Lecturer.

My children grew to adulthood in Ithaca. It is a wholesome college town with few of the problems of large cities. Jennifer went to college back at Duke and later attended a Master of Fine Arts in Creative Writing program at Columbia University. Jenny married James Merlis in June 1994. We had a beautiful wedding reception among my large rhododendron bushes in our back garden. In addition to her writing and other activities, she now plays violin in an all female rock band called Splendora.

Pamela went to college at Cornell. After graduation, she went to the New York School of Interior Design for a year and then decided to become a nurse. She returned home to take the science courses she had skipped at Cornell. She spent a year at our local community college taking chemistry, biology, anatomy, etc., displaying a surprising scientific talent. After the year at home she went to Vanderbilt University where she entered a Masters of Nursing program. In November of 1994 - after one year in the Vanderbilt nursing program - she died tragically, of heart failure. Though she had been born with a heart defect, her death came without warning.

A Gathering of Nobel Laureates: Science for the 21st Century - 180 -

In an effort to drag ourselves out of our grief and despondency over losing Pam, we have taken on a major family project in the past year: the production of an introductory college physics text book. Betty is the co-author of the book, with Alan Giambattista of Cornell; and I have been working on a companion CD ROM. When completed, the work will be published by McGraw Hill. From Les Prix Nobel 1996. http://nobelprize.org/physics/laureates/1996/richardson-autobio.html

Classroom Connections:

1. In small groups, read Dr. Richardson’s autobiography. Work together to answer the following questions. Be prepared to share your answers in a large group discussion. a. What connection does Dr. Richardson’s family have with North Carolina? b. What type of childhood did Dr. Richardson experience? How did he enjoy spending his time? c. What fields did Dr. Richardson consider majoring in before he eventually turned to physics? d. What events led Dr. Richardson become interested in low temperature physics? e. Construct a brief timeline of Dr Richardson’s life using dates listed in the autobiography. Record key events leading up to winning the Nobel Prize in 1996.

2. In large class discussion, compare and contrast notes taken by the small groups. Key questions to consider include:

f. What are some characteristics of people who win Nobel Prizes? g. What types of learning environments tend to promote creativity and imagination in people?

3. As an extension activity, have students also read the autobiography for Douglas Richardson, then compare and contrast using a Venn Diagram, the qualities Osheroff and Richardson have in common and how they differ in their pursuit of knowledge.

A Gathering of Nobel Laureates: Science for the 21st Century - 181 -

Superfluidity in Helium-3

Press Release: The 1996 Nobel Prize in Physics 9 October 1996 The Royal Swedish Academy of Sciences has decided to award the 1996 Nobel Prize in Physics to Professor David M. Lee, Cornell University, Ithaca, New York, USA, Professor Douglas D. Osheroff, Stanford University, Stanford, California, USA and Professor Robert C. Richardson, Cornell University, Ithaca, New York, USA for their discovery of superfluidity in helium-3. A breakthrough in low-temperature physics When the temperature sinks on a cold winter's day water vapour becomes water and water becomes ice. These so-called phase transitions and the changed states of matter can be roughly described and understood with classical physics. What happens when the temperature falls is that the random heat movement in gases, liquids and solid bodies ceases. But the situation becomes entirely different when the temperature sinks further and approaches absolute zero, -273.15°C. In samples of liquid helium what is termed superfluidity occurs, a phenomenon that cannot be understood in terms of classical physics. When a liquid becomes superfluid its atoms suddenly lose all their randomness and move in a coordinated manner in each movement. This causes the liquid to lack all inner friction: It can overflow a cup, flow out through very small holes, and exhibits a whole series of other non-classical effects. Fundamental understanding of the properties of such a liquid requires an advanced form of quantum physics, and these very cold liquids are therefore termed quantum liquids. By studying the properties of quantum liquids in detail and comparing these with the predictions of quantum physics low-temperature, researchers are contributing valuable knowledge of the bases for describing matter at the microscopic level.

David M. Lee, Douglas D. Osheroff and Robert C. Richardson discovered at the beginning of the 1970s, in the low-temperature laboratory at Cornell University, that the helium isotope helium-3 can be made superfluid at a temperature only about two thousandths of a degree above absolute zero. This superfluid quantum liquid differs greatly from the one already discovered in the 1930s and studied at about two degrees (i.e. a thousand times) higher temperature in the normal helium isotope helium-4. The new quantum liquid helium-3 has very special characteristics. One thing these show is that the quantum laws of microphysics sometimes directly govern the behaviour of macroscopic bodies also. The isotopes of helium In nature the inert gas helium exists in two forms, isotopes, with fundamentally different properties. Helium-4 is the commonest while helium-3 occurs only as a very small fraction. Helium-4 has a nucleus with two protons and two neutrons (the 4 stands for the total number of nucleons, i.e. protons and neutrons). The nucleus is surrounded by an electron shell with two electrons. The fact that the number of particles constituting the atom is even makes helium-4 what is termed a boson. The nucleus of helium-3 also has two protons, but only one neutron. Since its electron shell also has two electrons, helium-3 consists of an odd number of particles, which makes it what is termed a fermion. Since the two isotopes of helium are built up of different numbers of particles, dramatic differences in their behaviour arise when they are cooled to temperatures near absolute zero.

A Gathering of Nobel Laureates: Science for the 21st Century - 182 -

The properties of the isotopes Bosons such as helium-4 follow Bose-Einstein statistics which, among other things, means that under certain circumstances they condense in the state that possesses the least energy. A phase transition process in which this occurs is termed Bose-Einstein condensation. The first person to manage to cool helium-4 gas to such low temperatures that it liquidised was Heike Kamerlingh-Onnes (Nobel Prize in Physics 1913). This happened at the beginning of the 1900s. He noted even then that when the temperature came closer to absolute zero than about 2 degrees something special happened in the liquid. But it was not until the end of the 1930s that Pjotr Kapitsa (Nobel Prize in Physics 1978) discovered experimentally the phenomenon of superfluidity in helium-4, a phenomenon first explained schematically by Fritz London and then in detail by Lev Landau (Nobel Prize in Physics 1962). The explanations are based on the fact that the superfluid liquid, which appears at a phase transition when the temperature is only 2.17° above absolute zero, is a kind of Bose-Einstein condensate of helium atoms. Fermions such as helium-3 follow Fermi-Dirac statistics and should not actually be condensable in the lowest energy state. For this reason superfluidity should not be possible in helium-3 which, like helium-4, can be liquidised at a temperature of some degrees above absolute zero. But fermions can in fact be condensed, but in a more complicated manner. This was proposed in the BCS theory for superconductivity in metals, formulated by John Bardeen, Leon Cooper and Robert Schrieffer (Nobel Prize in Physics 1972). The theory is based on the fact that electrons are fermions (they consist of one particle only, an odd number) and therefore follow Fermi-Dirac statistics just as helium-3 atoms do. But electrons in greatly cooled metals can combine in twos to form what are termed Cooper pairs and then behave as bosons. These pairs can undergo Bose-Einstein condensation to form a Bose-Einstein condensate. Starting with the experience of superfluidity in helium-4 and superconductivity in metals, it was expected that the fermions in liquid helium-3 should be capable of forming boson pairs and that superfluidity should be obtainable in very cold samples of the isotope helium-3. Although many research groups had worked with the problem for years, particularly during the 1960s, none had succeeded and many considered that it would never be possible to achieve superfluidity in helium-3. The discovery The researchers at Cornell University were low-temperature specialists and had built their apparatus themselves. With it they could produce such low temperatures that the sample was within a few thousands of a degree of absolute zero. David Lee and Robert Richardson were the senior researchers while Douglas Osheroff was a graduate student in the team. Actually they were looking for a different phenomenon: A phase transition to a kind of magnetic order in frozen helium-3 ice. To find this phase transition, they were studying the pressure measured within the sample as a function of the time during which the volume was slowly increased and reduced. It was Osheroff's vigilant eye that noted small extra jumps in the curve measured (Fig. 1). It is easy to consider such small deviations as more or less inexplicable characteristics of the apparatus, but this student and his older co-workers became convinced that it was a true effect. In a first report published in 1972 the result was interpreted as a phase transition in the solid helium-3 ice which can also form at these low temperatures. But since the interpretation did not correspond precisely with the results of measurement, a rapid series of supplementary measurements was undertaken and in the same year the researchers were able to show in a second publication that there were in fact two phase transitions in liquid helium-3. The discovery heralded the start of intensive research on the new quantum liquid. A particularly important contribution was made by the theoretician Anthony Leggett, who assisted in the interpretation of the discovery. This thus assumed great significance for our knowledge of how the laws of quantum physics, formulated for microscopic systems, sometimes directly govern macroscopic systems also.

A Gathering of Nobel Laureates: Science for the 21st Century - 183 -

Fig. 1. The figure shows the pressure inside a sample containing a mixture of liquid helium-3 and solid helium-3 ice. The sample is first subjected to increasing external pressure for about 40 minutes, whereafter the external pressure is reduced. Note the changes in the slope of the curve at A and B and the temperatures at which these occur. The graph resembles that published by D.D. Osheroff, R.C. Richardson and D.M. Lee in Physical Review Letters 28, 885 (1972) in which the new helium-3 phase transitions were first reported. It is taken from an article by N.D. Mermin and D.M. Lee in Scientific American 1976 (see Further Reading). Superfluidity in helium-3 That the new liquid really was superfluid was confirmed soon after the discovery, among others by a research team under Olli Lounasmaa at the Helsinki University of Technology. They measured the damping of an oscillating string placed in the sample and found that the damping diminished by a factor of one thousand when the surrounding liquid underwent the phase transition to the new state. This shows that the liquid is without inner friction (viscosity). Later research has shown that helium-3 has at least three different superfluid phases, of which one occurs only if the sample is placed in a magnetic field. As a quantum liquid helium-3 thus exhibits a considerably more complicated structure than helium-4. It is, for example, anisotropic, which means that it has different properties in different spatial directions, which does not occur in classical liquids but more resembles the properties of liquid crystals (cf. Nobel Prize in Physics 1991 to Pierre-Gilles de Gennes). If a superfluid liquid is caused to rotate at a speed exceeding a critical value, microscopic vortices arise. This phenomenon, which is also known from superfluid helium-4, has in helium-3 led to extensive research since its vortices can assume more complicated forms. Finnish researchers have developed a technique using optical fibres to observe directly how vortices affect the surface of rotating helium-3 at temperatures only one thousandth of a degree from absolute zero.

A Gathering of Nobel Laureates: Science for the 21st Century - 184 -

A fascinating application of superfluidity in helium-3 The phase transitions to superfluidity in helium-3 have recently been used by two experimental research teams to test a theory regarding how what are termed cosmic strings can be formed in the universe. These immense hypothetical objects, which are thought possibly to have been important for the forming of galaxies, can have arisen as a consequence of the rapid phase transitions believed to have taken place a fraction of a second after the Big Bang. The research teams used neutrino-induced nuclear reactions to heat their superfluid helium-3 samples locally and rapidly. When these were cooled again, balls of vortices were formed. It is these vortices that are presumed to correspond to the cosmic strings. The result, which must not be taken as proof of the existence of cosmic strings in the universe, is that the theory tested appears to be applicable to vortex formation in superfluid helium-3.

Further reading Additional background material on the Nobel Prize in Physics 1996 Superfluid helium 3, by N.D. Mermin and D.M. Lee, Scientific American, December 1976, p. 56. Low temperature science - what remains for the physicist?, by R.C. Richardson, Physics Today, August 1981, p. 46. Special Issue: He3 and He4, Physics Today, February 1987, including among other articles Novel magnetic properties of solid helium-3, by M.C. Cross and D.D. Osheroff, p. 34. The 3He Superfluids, by O.V. Lounasmaa and G.R. Pickett, Scientific American, June 1990.

Source: http://nobelprize.org/physics/laureates/1996/press.html

A Gathering of Nobel Laureates: Science for the 21st Century - 185 -

The Nobel Prize in Physics 1996 Presentation Speech by Professor Carl Nordling of the Royal Swedish Academy of Sciences. http://www.kva.se/KVA_Root/index_eng.asp?br=ie&ver=4up

Translation of the Swedish text Your Majesties, Your Royal Highness, Ladies and Gentlemen,

The air that we breathe not only contains oxygen and nitrogen, but also small quantities of other gases. One of these - often mentioned in connection with the global greenhouse effect - is carbon dioxide. Another is the noble gas helium, which makes up five pails per million of our atmosphere. This chemical element exists in two forms, or isotopes: a heavier one called helium-4 and a lighter one called helium-3. The heavier variety accounts for nearly all helium. Helium-3 makes up only one millionth of the total quantity of helium, which is already very insignificant to begin with. Yet this year's Nobel Prize in Physics is all about helium-3. David Lee, Douglas Osheroff and Robert Richardson used a few cubic centimeters of liquid helium-3 to perform the experiments that would lead to the discovery being rewarded with this year's Nobel Prize. They changed its pressure, temperature and volume, carefully monitoring the mutual dependence of these valuables. In the resulting diagram, they observed two small jogs in the curve, a few thousandths of a degree above absolute zero. Many researchers would probably have shrugged their shoulders at these deviations, dismissing them as minor imperfections in their measuring apparatus. Not these three researchers. Might new magnetic states be manifesting themselves in this way? What the three were actually looking for was magnetism in solid helium-3. At first, they also believed that this was what they had seen. But there was not a perfect correspondence with the measurement data. By means of measurements employing the same technique that has since come to be used in hospital magnetic resonance imaging systems, Lee, Osheroff and Richardson were able to show that the phenomenon was occurring in liquid helium-3, not in solid helium-3. In other words they had discovered two new forms of liquid helium-3, both superfluid. The team eventually discovered three superfluid phases. And as is so often the case in basic research, they had discovered something other than what they were looking for! Superfluidity is a remarkable and unusual property that had previously been observed only in helium-4. It manifests itself in different ways: A super-fluid liquid lacks viscosity and cannot be stored in an unglazed ceramic vessel, because it seeps out through the microscopic pores in the ceramic. If an empty beaker is lowered part way into the liquid, the liquid flows upward, over the edge and down into the beaker. To describe the phenomenon of superfluidity at a fundamental, atomic level, we usually say that the atoms have undergone a Bose-Einstein condensation. This means that all the atoms join in a common quantum state. Such a condensation is only possible in a category of particles called bosons. In the category called fermions, this type of condensation is not possible. As it happens, helium-3 atoms are fermions and should thus not be capable of undergoing a Bose-Einstein condensation and form a superfluid liquid. Yet they can. The explanation is that the atoms form pairs, where the atoms orbit each other. Such a pair behaves like a boson and - presto - Bose-Einstein condensation can now occur and the liquid becomes superfluid! A Gathering of Nobel Laureates: Science for the 21st Century - 186 -

Lee's, Osheroff's and Richardson's discovery triggered intensive research activity in all the low- temperature laboratories of the world. The phase transitions to superfluidity in liquid helium-3 showed that the quantum laws of microphysics sometimes also govern the behavior of macroscopic quantities of matter. They are being used to define the temperature scale at very low temperatures. They are contributing to our growing understanding of "warm" superconductors, and they were recently used as the model for how "cosmic strings" may have been formed in the universe.

Professor Lee, Professor Osheroff, Professor Richardson,

You have been awarded the 1996 Nobel Prize in Physics for your discovery of superfluidity in helium-3. Your discovery has greatly enlarged our knowledge of the possible states of condensed matter. On behalf of the Royal Swedish Academy of Sciences, I wish to congratulate you on this achievement, and I now ask you to step forward and receive your Prize from the hands of His Majesty the King. From Les Prix Nobel 1996 http://nobelprize.org/nobel/nobel-foundation/publications/lesprix.html http://nobelprize.org/physics/laureates/1996/presentation-speech.html

A Gathering of Nobel Laureates: Science for the 21st Century - 187 -

Overview of Discovery of Superfluidity in Helium-3

The Nobel Prize in Physics 1996

The Royal Swedish Academy of Sciences awarded the 1996 Nobel Prize in Physics jointly to

David M. Lee, Douglas D. Osheroff and Robert C. Richardson

for their discovery of superfluidity in helium-3.

David M. Lee Douglas D. Osheroff Robert C. Richardson Cornell University Stanford University Cornell University Ithaca, NY Stanford, CA Ithaca, NY Photo: R. Barker, Photo: Ch. Harrington Cornell University Cornell University Photography Photography

Significant kinks Atoms are governed by the laws of quantum physics. In gases, liquids, and solids, quantum effects are normally hidden by the random thermal motion of the atoms, but at very low temperatures these effects can be observed. A spectacular example is the superfluidity of 3He – a phenomenon that has led to further insight into quantum physics.

A Gathering of Nobel Laureates: Science for the 21st Century - 188 -

Helium Helium (He) is the most common element in the Universe after hydrogen. In the atmosphere of the earth its concentration is only 0.0005%, while in natural gas from the interior of the earth the concentration varies from 0.4% to 8%. Natural helium exists in two isotopic forms, 4He (99.999%) and 3He (0.001%). 3He can be produced in appreciable amounts in nuclear reactors.

Colder than cold To refrigerate a substance to very low temperatures one uses a cryostat (from Greek cryos = cold). The cooling is done in several steps. The first step cools the substance from room temperature to about 1 K. In a second step, from 1 K to about 10 mK, one normally uses a mixture of 4He and 3He in a dilution process. Temperatures down to about 1 mK can be reached by compressing 3He - the Pomeranchuk method. Even lower temperatures can be reached by magnetic methods.

A Gathering of Nobel Laureates: Science for the 21st Century - 189 -

Superfluidity

Pyotr Kapitza* discovered that liquid helium flows without friction when cooled below 2.17 K. This phenomenon is termed superfluidity. A superfluid shows several spectacular effects. For example, superfluid helium cannot be kept in an open vessel because then the fluid creeps as a thin film up the vessel wall and over the rim.

A Gathering of Nobel Laureates: Science for the 21st Century - 190 -

Phases and Phase Transitions

Depending on pressure and temperature, a substance can exist in three phases – as gas, liquid or solid. Water for example exists as steam, water or ice. The transition between phases may be noticed as abrupt changes in pressure and temperature. At normal pressures both 4He and 3He refuse to freeze no matter how low the temperature. The explanation is that no atoms can be completely at rest (zero point motion) and that the attractive force between helium atoms is too weak to make them come to rest. However, if the pressure is increased to about 3 MPa (30 atmospheres) both fluids become solids at very low temperatures.

Statistical Laws Explain Differences

Atoms obey different statistical laws depending upon their character. If they contain an even number of particles they are called bosons and obey Bose-Einstein statistics. If the number of particles is odd they are called fermions and obey Fermi-Dirac statistics. Any number of bosons can occupy the same quantum state, whereas only one fermion can occupy a given state. This fact is the reason for the large differences between bosons and fermions at low temperatures.

A Gathering of Nobel Laureates: Science for the 21st Century - 191 -

How 3He becomes superfluid

Superfluidity in 4He (bosons) occurs because most 4He atoms gather in the lowest quantum state (Bose- Einstein condensation). The 3He atoms are fermions and should not be able to condense. Yet we know from superconductivity that electrons, which are also fermions, can become bosons by pair formation. The same turned out to be true also for 3He atoms. At about 2 mK they form pairs and become bosons. Bose-Einstein condensation occurs and 3He becomes superfluid.

Whirlpools

Superfluid helium in a vessel does not rotate with it as a normal fluid does. Instead, a large number of whirlpools, called vortices, are formed. They have diameters from 1000 Å to 100,000 Å. The vortices repel each other and form a hexagonal pattern. The superfluid circulates around their cores. The circulation is quantized in a way similar to that of electron orbits around atomic nuclei. Several types of vortex occur in 3He, depending upon temperature, rotation speed and magnetic fields. They are being studied with a rotating cryostat at the Low Temperature Laboratory in Helsinki, Finland. Such experiments have been carried out for modeling phase transitions that might have occurred in the very early Universe, a fraction of a second after the Big Bang. 1 Ångström (Å) = 10-10m

A Gathering of Nobel Laureates: Science for the 21st Century - 192 -

Further Reading

Information about the Nobel Prize in Physics 1996 http://nobelprize.org/physics/laureates/1996/press.html (press release), The Royal Swedish Academy of Sciences.

Superfluid Helium 3, N. D. Mermin and D. M. Lee, Scientific American, December 1976, pp. 56.

Low temperature science – what remains for the physicist?, R. C. Richardson, Physics Today, August 1981, pp. 46.

Novel magnetic properties of solid helium-3, M. C. Cross and D. D. Osheroff, Physics Today, Special Issue: Helium-3 and helium -4, February 1987, pp.34.

The 3He Superfluids, O. V. Lounasmaa and G. R. Pickett, Scientific American, June 1990, pp. 64. http://nobelprize.org/physics/laureates/1996/illpres/

Supercool Physics on The Nobel Prize: 100 Years of Creativity and Innovation Interactive CD- ROM with Levitrons and Maglev Vehicles Activity

A Gathering of Nobel Laureates: Science for the 21st Century - 193 -

Classroom Connections:

After viewing “Supercool Physics” on the interactive CD-ROM The Nobel Prize—100 Years of Creativity and Innovation, consider the following questions to discuss:

1. What properties of helium gas did Osheroff and colleagues observe?

2. Why are atom trapping and construction of more accurate atomic clocks important to modern society?

3. What are some of the effects of cold temperatures on magnetic repulsion and super conductors? Why are these effects important?

4. What does cold temperature physics have to do with GPS? OR Why does the average person care about having accurate atomic clocks?

5. How do you store the coldest gas in the Universe?

6. When Osheroff was six years old, why did he destroy his toys?

7. What are some practical applications of magnetic levitation? For more information visit http://www.bwmaglev.com

A Gathering of Nobel Laureates: Science for the 21st Century - 194 -

Implications

Lord Kelvin, the Kelvin Scale and Cold Temperatures Classroom Activities from NPR’s Science Friday

These and additional materials (including RealAudio of a discussion about Lord Kelvin) available at: http://www.sciencefriday.com/kids/sfkc20040604-2.html

Program Summary

Drop the name Charles Darwin, and most people will say, “Oh, yes. The evolution man.” Mention Lord Kelvin or James Maxwell, however, and you’ll probably get a lot of blank stares. All three of these men were moving forces in their respective scientific fields and famous in their own time, but only Darwin’s name seems to have made a lasting impression, perhaps because his theories addressed the very personal concept of what is human.

Kelvin (born William Thomson) and Maxwell were prodigies who flourished in the heady scientific and industrial atmosphere of Victorian England. They were instrumental in defining and shaping the study of physics, which back then wasn’t even called physics, but natural philosophy. Kelvin conceived the idea of thermodynamics, putting into mathematical terms the relationship between temperature and the efficiency of work produced by an engine; his mechanically based temperature scale is still commonly called the Kelvin scale. He also created the idea of absolute zero, the point at which a steam engine is completely efficient and below which one cannot go. Kelvin was also renowned in his time as an inventor, developing and patenting an improved nautical compass and designing numerous devices connected to the operation of the first trans-Atlantic telegraph cable.

Kelvin was a true believer of putting all physics into measurable terms, whereas James Maxwell was much more of a theoretical thinker. Early in his career, he won a competition about the nature of Saturn’s rings, mathematically proving that they must be made up of zillions of small, solid bodies orbiting independently. His answer has since been shown to be true. His idea of electromagnetic forces became one of the basic laws of the universe, linking space and time long before Einstein. His work in light and electricity laid the groundwork for the age of electronics.

Why these men faded from public memory is still rather puzzling; perhaps it had to do with personality or with the swiftness with which physics moved forward, giving rise to more shining stars who eclipsed their fame.

A Gathering of Nobel Laureates: Science for the 21st Century - 195 -

Classroom Connections:

Activities:

Listen to the Science Friday broadcast at the link above and answer the following discussion questions:

• What ideas were Lord Kelvin and James Maxwell known for? • What is thermodynamics? What is the Kelvin scale? What is absolute zero? • Why did Kelvin not agree with some of Maxwell’s theories? • Why do you think the Victorian era was such a fertile period for science? • Name some other great scientists of the Victorian era and their contributions to their fields.

Web based Activities:

How hot is it? Read about the history of measuring temperature at The Story of Thermometer from About.com, and learn about the three temperature scales in use today and how they differ at The History Behind the Thermometer. http://inventors.about.com/library/inventors/blthermometer.htm

Absolutely nothing. The Kelvin Scale shows the Fahrenheit degrees of light, air, and absolute zero on the Kelvin scale. At Physics 2000: Temperature and Absolute Zero, http://www.colorado.edu/physics/2000/bec/temperature.html an animation of molecular movement at different temperatures helps illustrate the discussion of absolute zero.

Degrees of knowledge. Students learn about the development of a new thermometer that measures temperature based on electrical noise and perform a number of temperature-related experiments at A Heated Discussion http://www.nytimes.com/learning/teachers/lessons/20030708tuesday.html?searchpv=learning_lessonsfr om the New York Times Learning Network. About Temperature http://my.unidata.ucar.edu/content/staff/blynds/tmp.htmlis also available in Spanish.

Times gone by. Victorian Science http://www.victorianweb.org/science/sciov.html makes for good reading about the transformation of the sciences into a profession and the formalization of science education. Be sure to explore other subjects on the The Victorian Web http://www.victorianweb.org/index.html for a fuller understanding of the mindset of that era.

A Gathering of Nobel Laureates: Science for the 21st Century - 196 -

With Strings Attached – New evidence suggests that cosmic strings could have pulled together the galaxies.

Scientists have proposed a number of exotic theories to explain what happened to the universe moments after the Big Bang. Eleven years ago, Los Alamos physicist Wojciech Zurek proposed a laboratory experiment to test one theory of how the universe arrived at its present structure.

The results of laboratory experiments by three independent teams of researchers appear to confirm the validity of Zurek’s theory: that one dimensional fractures — dubbed “cosmic strings” — formed as the universe began to cool, just fractions of a second after the Big Bang.

The American team, David Lee and Robert Richardson of Cornell University, and Douglas Osheroff of Stanford University, received the Nobel Prize last fall for their 1972 discovery of the superfluidity of helium-3. In announcing the award, the Royal Swedish Academy of Sciences cited Zurek’s theoretical work and the laboratory experiments by separate research teams in Finland and France.

Zurek is delighted with the recent recognition his proposal has received. “I hope it spurs enthusiasm for basic science because it can suggest new ways of looking at things,” he said. “Basic science often translates into things of very practical interest, as well as cosmological implications.”

Cosmic strings are important because they help solve the scientific riddle involving the formation of the structure of the universe. After the Big Bang, something happened to perturb the uniformity of space and time, allowing matter to coalesce into stars, galaxies, and other structures spread unevenly across the universe.

One theory suggests cosmic strings contained enough energy to exert a gravitational attraction and pull enough matter together to form objects in space. It also suggests that their formation resulted from one or more transitions of energy or matter from one form to another.

These phase transitions, much like steam turning to water and water to ice, also occur when a fluid becomes a superfluid, a state in which it flows without resistance. The transitions gave Zurek the clue for his proposal to test the cosmic string theory in the laboratory.

In a 1985 paper, Zurek said cosmic strings and vortices in a superfluid are analogous and suggested a laboratory experiment to test for key elements of string formation by forcing a fluid into a superfluid state rapidly.

The French and Finnish research teams cooled helium-3 to the temperature at which it undergoes the phase transition, moved it quickly back and forth through the transition, and watched what happened. Both teams reported they observed vortices that behaved the way the theory says cosmic strings behaved.

“The validity of a theory formulated by Zurek ... thus seems to have been confirmed,” the Swedish Royal Academy said in the Nobel Prize citation. “The cosmic strings are believed to be of importance ... for the formation of galaxies.”

A Gathering of Nobel Laureates: Science for the 21st Century - 197 -

The Nobel citation also noted the work of another researcher with a Los Alamos connection. John Wheatley, who worked at the Lab from 1981 until his death in 1986, headed a group at the University of California at San Diego in the 1970s that confirmed the superfluidity of the new phases of helium-3 and performed much of the fundamental thermodynamic research on the new phases.

Zurek was a J. Robert Oppenheimer Fellow in theoretical astrophysics at the Laboratory when he proposed conducting experiments with superfluids to study cosmology. Now a Los Alamos Fellow, Zurek’s research interests also include quantum computing, relativistic astrophysics, and quantum physics.

Interest in the study of the dynamics of second-order phase transitions, such as those that occur in superfluids, is growing rapidly among scientists, Zurek reports.

“There is a good chance that interest in the field will explode. It’s interdisciplinary and very exciting scientifically. It’s one of the few areas in physics where you can tie abstract and concrete thoughts together.”

Zurek predicts the next big step in this field of research will involve superconductivity. By studying dynamics of the superconducting phase transition, scientists can learn a lot about superconductors. “There are a lot of issues that have to do with the strength of materials,” Zurek added. “I think there is a gold mine there.”

Contact: Wojciech Zurek, Theoretical Astrophysics. 505-667-6837. e-mail: [email protected]

From: Dateline Los Alamos. A Monthly Publication of the Public Affairs Office of Los Alamos National Laboratory. April, 1997 Issues. Online at: http://www.lanl.gov/worldview/news/dateline/Dateline0497.pdf

Classroom Connections: Discussion Questions:

1. Why is string theory important to understanding how the universe is formed? 2. How does Osheroff, Lee, and Richardson’s work relate to testing ideas on string theory? 3. What is a phase transition, and what are common examples you are familiar with? 4. Why does Zurek think studying phase transitions is important? 5. What does Zurek say basic science often translates into?

A Gathering of Nobel Laureates: Science for the 21st Century - 198 -

Universal Threads: String Theory

Classroom Activities from NPR’s Science Friday

These and additional materials (including RealAudio of a discussion of NOVA’s “The Elegant Universe” about string theory) available at: http://www.sciencefriday.com/kids/sfkc20031024-3.html

Program Summary

What do a loaf of bread and the string theory have in common? The bread analogy is a great way of describing the universe according to the theory. The entire universe, as guest Brian Greene puts it, “is this gigantic loaf with many other slices, potentially. So our universe could be one slice, and a different, parallel universe could be living on a different slice.”

But which slice has the butter on it?

“The Elegant Universe,” a new PBS NOVA program hosted by Dr. Greene, will help you and your students understand the fascinating, mind-boggling world according to string theory. The program explores the search for the ultimate theory, or theory of everything, which can unify the physics of general relativity with those of quantum mechanics. At the heart of this quest is string theory. What’s string? Greene explains: “Electrons and quarks, little dots that you couldn’t divide any further,” that was the old idea. “Now we imagine that those dots are really little filaments, little string-like filaments of energy that can vibrate.” Like the strings of a violin, string-theory filaments “vibrate in a wealth of different patterns, but instead of hearing them as notes, we see them as different particles. So an electron is a string vibrating one way; a quark is a string vibrating a different way.”

One of the more intriguing things about string theory is that it implies more than four dimensions, possibly as many as eleven! But the other dimensions are so small that we can’t perceive them. Imagining more than four dimensions is one of the challenges of describing the theory. But “The Elegant Universe” uses numerous graphics to paint a picture that’s easier to understand. Viewers will even get to visit the Quantum Café, where they can experience life at the quantum level, where ice cubes can pass through glasses.

As you’ve probably already guessed, this week’s show is geared toward advanced students. So be sure to catch “The Elegant Universe,” and follow up your viewing with the activities suggested here. They’ll put a new spin on the phrase “no strings attached.”

A Gathering of Nobel Laureates: Science for the 21st Century - 199 -

Classroom Connections:

Activities:

Listen to the Science Friday broadcast at the link above and answer the following discussion questions: • Here’s the big question: What is string theory? How is it different from the old notion that atoms were made up of point-like particles? • What are the four known dimensions? Can students imagine what more than four dimensions might be like? • How might Einstein’s theory of general relativity connect with string theory? • Define “quantum mechanics.” How does this study of physics at the very small scale compare with relativity, which tackles the very large scale? • Scientists are looking for a unified theory or ultimate theory. What is it, in concept?

Web based Activities:

Strings and things. Wrapping your head around string theory is easier with the help of Web sites that explain it in simple terms and show illustrations of the concepts. As Brian Greene puts it, when discussing string theory, a ten-second video image is worth ten pages of written explanation. Begin at NASA’s Superstrings http://imagine.gsfc.nasa.gov/docs/science/mysteries_l2/superstring.htmlpage, which serves as a good primer on the topic. Superstrings Home Page http://www.sukidog.com/jpierre/strings/ features a step-by-step approach to explaining the theory using a tutorial and glossary. Finally, the Official String Theory Web Site http://superstringtheory.com/ offers both basic and advanced discussions of the theory and has quizzes to test students’ understanding of the concepts.

An elegant Web site. The companion site to the PBS program “The Elegant Universe” http://www.pbs.org/wgbh/nova/elegant/ is chock full of interviews, information, animations, images, and activities that will make your students’ exploration of string theory accessible and fun. Begin with the article “The Theory of Everything,” http://www.pbs.org/wgbh/nova/elegant/everything.html, which slices an apple from core to atom, to electron, to string. To help students gain an idea of just how small a string might be, they can play a slide show http://www.pbs.org/wgbh/nova/elegant/scale.html that takes them to 10-33 centimeters (string size). Continue with a primer on elementary particles, and view an animation on string vibration called Resonance in Strings http://www.pbs.org/wgbh/nova/elegant/resonance.html. Other stops to make at the site include interviews with physicist Brian Greene and other scientists. Imagining Other Dimensions http://www.pbs.org/wgbh/nova/elegant/resonance.html, guides viewers on a virtual trip from a two- dimensional “Flatland” to a 10-dimensional world. Make sure students try their hands at the Multidimensional Math interactive. Once students have explored what the site has to offer, they’re ready to try some of the excellent activities designed to go along with it and the program. You can download a PDF of the 31-page teacher’s guide at this NOVA Teachers page http://www.pbs.org/wgbh/nova/teachers/programs/3012_elegant.html. By the way, if you miss the program broadcast, you’ll be able to view the entire series online http://www.pbs.org/wgbh/nova/elegant/program.html using QuickTime or RealPlayer plug-ins.

A Gathering of Nobel Laureates: Science for the 21st Century - 200 -

Heat of Solution

Classroom Connections:

Objectives • Measure temperature changes in a calorimeter as a solid solute is dissolved. • Relate temperature changes in a calorimeter to changes in heat energy. • Determine the amount of heat released in joules for each gram of NaOH or KOH that dissolves. • Evaluate the use of NaOH and KOH in a heating pad.

Situation In the summer of 1986, a commercial company began manufacturing an unusual heating pad. It is filled with a liquid solution that exists in a supercooled state at normal temperatures. To use it, a metal disc on the heating pad is pressed and flexed rapidly, causing vibrations that disturb the solution and induce crystallization, which releases a large amount of heat. The heating pad can be reused, by placing it in boiling water to remelt the crystals and then slowly cooling it to room temperature. You have been hired by this firm to explore new product possibilities using a solution of sodium thiosulfate, NaOH, instead of sodium acetate, KOH. An important part of this feasibility study is to determine the amount of heat given off per gram of substance, the amount of the substance needed for a heating pad, and the total cost of the substance needed.

Background The solution in this heating pad is made by dissolving a salt in water. It is a supersaturated solution; that is, it holds more dissolved salt than is usually possible at a particular temperature. The solution is metastable, so disturbing it causes the ions to become ordered enough to crystallize out of solution, releasing heat energy. The same amount of heat energy is involved when crystals dissolve in water. The bombarding of the crystal lattice by water molecules causes it to break apart. Then these free ions break the hydrogen bonds between water molecules. The water molecules surround the ions, attracted by their charge, and hydrate them. As these interactions take place, energy is released. The sum of the enthalpies of these processes is the heat of solution, ∆Hsol. If the hydration step, which involves bond formation, releases more heat than the bond-breaking step, the process is exothermic and ∆Hsol is negative. Otherwise, dissolving is endothermic and ∆Hsol is positive.

Problem To compare the cost effectiveness of using NaOH instead of KOH in a heating pad, you must do the following. * Construct a calorimeter and dissolve each salt in it. * Calculate ∆T and ∆H for the water in which the salts dissolve. * Determine the supplier's price for each salt. * Calculate ∆H per gram and the cost-effectiveness for each salt. * Analyze the precision of your results.

A Gathering of Nobel Laureates: Science for the 21st Century - 201 -

Materials * 100 mL graduated cylinder * 600 mL beaker * Balance, centigram * Corrugated cardboard or lid for cup * Ice * KOH * NaOH * Pencil with point * Plastic washtub * Plastic foam cup, small * Test tubes, small, Pyrex, 4 * Test-tube rack * Wire, 10-15 cm

Probe option * Thermistor probe

Thermometer option * Thermometer, nonmercury

Safety Always wear safety goggles and a lab apron to protect your eyes and clothing. If you get a chemical in your eyes, immediately flush the chemical out at the eyewash station while calling to your teacher. Know the locations of the emergency lab shower and eyewash station and the procedure for using them. Do not touch any chemicals. If you get a chemical on your skin or clothing, wash the chemical off at the sink while calling to your teacher. Carefully read the labels and follow the directions on all containers of chemicals that you use. Do not taste any chemicals or items used in the laboratory. Never return leftovers to their original containers; take only small amounts to avoid wasting supplies. Always clean up the lab and all equipment after use, and dispose of substances according to proper disposal methods. Wash your hands thoroughly before you leave the lab after all lab work is finished.

Preparation 1. Organizing Data Prepare a data table with five columns and five rows. Label the boxes in the first row Measurement, Trial 1--NaOH, Trial 2--NaOH, Trial 3--KOH, and Trial 4-- KOH. Label the second through fifth boxes in the first column Mass of solute (g), Volume of cold H2O (mL), Initial H2O temp. (°C), and Final H2O temp. (°C).

2. Prepare a cold-water bath. Fill a small, plastic washtub with ice. Fill a 600 mL beaker three-fourths full of distilled water. Make a hole in the ice large enough for the beaker. Insert the beaker, and pack the ice around it up to the level of the water. Or use refrigerated water if it is available.

3. Prepare the calorimeter. Cut a square of corrugated cardboard slightly larger than the top of a 4 oz plastic foam cup. Make a hole in the center of the cardboard piece with a pencil. Make a second hole in the cardboard piece less than 1.0 cm away from the hole in the center. Insert a piece of wire through the hole, and bend each end to make 1.0 cm loops, as shown in Figure A in your lab manual. Insert a thermometer or a thermistor probe into the center hole and set the entire assembly aside until step 10.

4. On a piece of weighing paper, measure the mass of approximately 1 g of NaOH to the nearest 0.01 g. Record the mass in your data table.

A Gathering of Nobel Laureates: Science for the 21st Century - 202 -

5. Completely transfer the NaOH to a small Pyrex test tube.

6. Label the tube Trial 1, and set it in a test-tube rack.

7. Repeat steps 3-5 for the following. a. 1 g of NaOH; label the test tube Trial 2 b. 1 g of KOH; label the test tube Trial 3 c. 1 g of KOH; label the test tube Trial 4

Technique 8. Pour approximately 50 mL of the cold water prepared in step 2 into a 100 mL graduated cylinder. Record the volume to the nearest 0.1 mL.

9. Pour the cold water from the graduated cylinder into the plastic foam cup.

10. Put the thermometer into the cup. The bulb of the thermometer should be completely covered by the water but must not touch the bottom of the cup.

11. Record the temperature of the cold water to the nearest 1.0 °C if using a thermometer or to the nearest 0.1 °C if using a thermistor probe.

12. Lift the cardboard slightly and dump the contents of the Trial 1 test tube into the plastic foam cup all at once. Pour the salt near the edge of the cup and not onto the thermometer to avoid false peak temperatures.

13. Gently move the stirring wire up and down inside the cup to disperse the heat. Allow the solid to dissolve completely.

14. Stir continuously until the temperature of the water peaks.

15. Record the highest temperature reached by the water to the nearest 1.0 °C if using a thermometer or to the nearest 0.1 °C if using a thermistor probe.

16. Remove, rinse, and dry the thermometer.

17. Pour the solution into the designated waste container.

18. Rinse and dry the cup.

19. Repeat steps 8 through 18 for Trial 2, Trial 3, and Trial 4.

A Gathering of Nobel Laureates: Science for the 21st Century - 203 -

Cleanup and Disposal 20. Both substances, NaOH and KOH, and their solutions, should be placed in their own designated disposal container. Remember to wash your hands thoroughly after cleaning up your lab area and equipment.

Analysis and Interpretation

1. Organizing Data Determine the change in temperature, ∆T, of the cold water for each trial.

2. Organizing Information Calculate the heat energy in joules absorbed by the cold water for each trial, using the specific heat capacity equation ∆H = m Cp ∆T. Assume the density of water is 1.00 g/mL (which is the same as 1.00 kg/L) and the specific heat capacity of water is 4.180 J/(g.°C).

3. Organizing Data Calculate the amount of heat energy released per gram of NaOH for Trial 1 and Trial 2.

4. Organizing Data Calculate the amount of heat energy released per gram of KOH for Trial 3 and Trial 4.

5. Analyzing Information The accepted value for the heat of solution for NaOH is 1112 J/g. Calculate your percent error for trials 1 and 2.

6. Analyzing Information Calculate the average of Trial 1 and Trial 2, and the average of Trial 3 and Trial 4. Calculate the percent difference between each trial and the average. Comment on your precision.

7. Analyzing Information The cost for NaOH is $10.05/500 g and for KOH it is $12.71/500 g.

a. Calculate the cost per gram for each.

b. Comment on which substance would be the most cost-effective as the primary ingredient of a heat pack.

8. Evaluating Methods Why was a plastic foam cup instead of a beaker used as a reaction vessel?

9. Evaluating Methods How could the apparatus for measuring the temperature change of the water be improved?

A Gathering of Nobel Laureates: Science for the 21st Century - 204 -

Conclusions 10. Using Information What is the source of the heat energy that is released by the NaOH and absorbed by the water? Hint: Look in your book for information on lattice energy and energy of solution.

11. Inferring Conclusions What would be the delta H of a reaction in which KOH crystallizes out of solution? Hint: Heat of crystallization is the reverse energy change of heat of solution.

Extensions 1. Inferring Conclusions Why is the fact that the temperature of a phase change remains constant for a pure substance crucial to the development and use of this heating pad? Hint: Think about how hot you want a heating pack to get.

2. Relating Ideas When ionic substances dissolve in water, the crystal lattice is broken, and the ions are immediately surrounded by water molecules in a process called hydration. Hydration is exothermic. Breaking the lattice absorbs heat energy. ∆Hsol is the net energy resulting from overcoming the lattice energy and releasing the energy of hydration. Draw a diagram relating ∆Hlat, ∆Hhyd, and ∆Hsol.

A Gathering of Nobel Laureates: Science for the 21st Century - 205 -

Future Directions

Researchers Cool Gas To Record Low

The next time you're shivering under your winter coat as your local weather forecaster predicts "record lows," take heart. It could be a lot colder. Try one-half-billionth of a degree above absolute zero, or about -460 degrees Fahrenheit (-273 degrees Celsius).

That's the lowest temperature ever recorded, recently measured by NASA-funded researchers at the Massachusetts Institute of Technology who used a unique combination of gravitational forces and magnetic fields to cool sodium gas.

Absolute zero is the point at which no further cooling is possible. All motion stops, except for tiny vibrations, because the cooling process extracts all energy from the particles. At the new low temperature, it takes atoms half a minute to move a single inch.

The Biggest Chill Scientists have gotten close to absolute zero before, but the new temperature is six times lower than the previous record. It's also the first time a gas has been cooled to below one nanokelvin, which is one billionth of a degree. "To go below one nanokelvin is like running a mile below four minutes for the first time," said Dr. Wolfgang Ketterle, an MIT physics professor who co-led the study. The research, appearing in the September 12 issue of the journal Science, gives scientists at the MIT- Harvard Center for Ultracold Atoms a chance to study a recently discovered form of matter known as the Bose-Einstein condensate, first seen in 1995 by an MIT team led by Ketterle and another group at the University of Colorado.

Normally, atoms bounce around independently in many different directions at extremely high speeds. But when they cool to near absolute zero, they slow down to the point that they condense, marching in lockstep instead of flitting around independently. The discovery of the Bose-Einstein condensate earned Ketterle and University of Colorado researchers Drs. Eric Cornell and Carl Wieman the Nobel Prize for Physics in 2001. So, just how did the MIT team handle something so cold?

Even the best thermos in the world can't be cooled to such temperatures, and even if it could, atoms that cold can't be kept in physical containers, because they would stick to the walls. So researchers came up with a novel way to confine the atoms. They used a "graviton magnetic trap," positioning magnets around the atoms to counteract gravity and keep the gaseous cloud confined without touching it.

Dr. David E. Pritchard, Ketterle's co-leader says the research could have some real world benefits. "Ultra low temperature gases could lead to vast improvements in precision measurements by allowing better atomic clocks and sensors for gravity and rotation." In other words, there's much more to the science than just making a really, really big chill.

http://www.nasa.gov/vision/earth/technologies/biggest_chill.html

A Gathering of Nobel Laureates: Science for the 21st Century - 206 -

Classroom Connections:

Essay/Discussion Questions

1. Research, using the Internet, the scientific community’s attempts to reach absolute zero. Construct a timeline for key events. 2. Discuss the concept of “absolute zero”. What does that really mean? Is it possible to reach that temperature? Why or why not? 3. How is temperature related to kinetic energy? Do some molecules move faster than others if temperature remains constant? 4. What is the fastest moving molecule at standard temperature and pressure? And what is standard temperature? 5. Research and make a list of the coldest recorded temperatures on Earth and in the solar system? What is the temperature on Jupiter? How do we know? 6. What is the Bose-Einstein condensate? Why is it of interest to scientists? 7. List potential applications of the results of low temperature research in regards to designing new products that can affect the quality of life for all humans.

A Gathering of Nobel Laureates: Science for the 21st Century - 207 -

Osheroff Appointed to Shuttle Disaster Investigative Board

By Dawn Levy

NASA has appointed Nobel laureate Douglas Osheroff, the J. G. Jackson and C. J. Wood Professor of Physics, as one of three new members of the team investigating the Feb. 1 loss of the space shuttle Columbia.

"I am honored that they think I have the knowledge and skills they need," Osheroff wrote in an e-mail interview from Washington, D.C., where he was preparing to judge the Intel Science Talent Search. "I am also more than a bit apprehensive. I hope I can contribute, and that we can find what we need."

Also appointed March 5, the other new members of the Columbia Accident Investigation Board are John Logsdon, director of the George Washington University Space Policy Institute, and Sally Ride, the first American woman in space. Ride, a Stanford alumna, holds the Ingrid and Joseph W. Hibben Chair in Space Science & Education at the University of California-San Diego. She flew aboard the space shuttle Challenger in 1983 and 1984 and served on the Presidential commission investigating its subsequent explosion in 1986.

Osheroff's selection echoes that of Nobel Prize-winning physicist Richard Feynman to the team investigating the Challenger explosion. "I am certainly no Richard Feynman," Osheroff said. "He was a brilliant physicist; I am a very good experimental physicist." During the Challenger investigation, Feynman clarified a complex concept by forcing a bent O-ring into ice water to demonstrate how cold robbed it of the ability to spring back to the shape it needed to seal a joint. "I am not sure I am the best person for the job," Osheroff said, "but will give it my best effort."

The ongoing investigation is on a fast track because of the importance of shuttles to support astronauts now at the space station. A contingent of 70 experts have convened at Johnson Space Flight Center in Houston, and much of the shuttle debris has been assembled at Kennedy Space Flight Center in Florida, Osheroff said.

"I doubt this will go on as long as the investigation of the Challenger disaster took [four months], but I think this has to take as long as it takes to get the answers, and to understand what needs to be done," he said. Since Osheroff chairs the Physics Department, associate chair Professor Robert Wagoner will take the helm during his absence. Osheroff has cancelled his Spring quarter classes.

Osheroff received physics degrees from Caltech (B.S. 1967) and Cornell (M.S. 1969 and Ph.D. 1973). His research focuses on the properties of matter near absolute zero.

The physicist shared the 1996 Nobel Prize with David M. Lee and Robert C. Richardson for discovering superfluidity in helium-3. He is member of the National Academy of Sciences whose other honors include the Sir Francis Simon Memorial Prize for discoveries in low-temperature physics, the American Physical Society's Oliver E. Buckley Prize in Condensed Matter Physics, a Walter J. Gores Award for Excellence in Teaching and a MacArthur Prize.

Source: http://www.stanford.edu/dept/news/report/news/2003/march12/osheroff-312.html

A Gathering of Nobel Laureates: Science for the 21st Century - 208 -

Classroom Connections:

1. When national disasters happen, teams of experts are often assembled to try to determine the cause of the disaster. Why do you think Dr. Osheroff was selected to be part of the Columbia Accident Board? What were his contributions to the final report?

2. Osheroff called Feyman “a brilliant physicist” and referred to himself as an “experimental physicist”. What is the difference between a theoretical and an experimental physicist? Give at least three examples of each type from current or past scientists.

3. Research the Intel Science Talent Search winners for 2003. What were the winning entries for the Southeast Region and Nationally? Have students from North Carolina ever won at the regional or national level

A Gathering of Nobel Laureates: Science for the 21st Century - 209 -

Pre and Post Test for Douglas Osheroff and Robert Richardson

1. For what discovery in science did Robert Richardson and Douglass Osheroff share the 1996 Nobel Prize in Physics with David Lee?

2. Where did Richardson and Osheroff do their research that led to their award of a Nobel Prize?

3. What is the significance of their discovery? List at least five applications of their discovery that affect our lives everyday. Explain your answer.

4. What is the history of the Nobel Prize? How are people nominated for a Nobel Prize? How many different types of Nobel Prizes are awarded each year?

5. What type of character traits do you think are needed to do the type of research that may lead to a Nobel Prize? Use examples from the autobiographies of Richardson and Osheroff to support your answer?

6. Why are scientists so interested in conducting experiments near Absolute Zero?

7. What do “String Theory” and the “Big Bang” have to do with the work done by Richardson and Osheroff?

8. Where do Richardson and Osheroff teach today? What are some of their current hobbies and interests?

9. What do you think Nobel Laureates visiting the Charlotte area want people to know, understand and appreciate about science?

10. Why do you think basic scientific research is important? How does science differ from technology? How are they related?

A Gathering of Nobel Laureates: Science for the 21st Century - 210 -

APPENDICES

A Gathering of Nobel Laureates: Science for the 21st Century - 211 -

Photographic Exhibit at

The Light Factory

Teachers and students are invited to experience an extraordinary photographic exhibit at The Light Factory, Charlotte’s center for photography and film. A Gathering of Nobel Laureates: Science for the 21st Century

Photographer Peter Badge has traveled the world to capture the less conspicuous faces of the men and women whose discoveries influence our everyday life. This unique collection of portraits celebrates the distinctive personalities and visions of the Nobel Science Laureates, leading experts in the fields of physics, chemistry, physiology and medicine.

“This exhibit was co-created by the Smithsonian Museum and the Deutsches Museum as a salute to the spirit of innovative thought and action recognized yearly by the Nobel Prizes,” said Art Molella Director of the Lemelson Center at the Smithsonian Institution's National Museum of American History. “This exhibit presents, in their own words, the stories of Nobel laureates who have devoted their lives to the service of knowledge and mankind.”

About The Light Factory

Through photography and film, the most influential artistic mediums of our time, The Light Factory communicates new ideas and expands the parameters of our cultural landscape as we celebrate the infinite possibilities of technology and artistry.

The Light Factory proudly presents A Gathering of Nobel Laureates: Science for the 21st Century by Peter Badge. This exhibition opens Friday, February 11th, with an opening celebration on Friday February 25th from 6pm-9pm in The Light Factory’s Knight Gallery in Spirit Square at 345 N College Street in uptown Charlotte. The gallery will be open Monday through Friday from 10am until 6pm and Friday and Saturdays from 1pm until 5pm.

Mr. Badge will be discussing his work on Sunday, February 27th at a special reception that will include the visiting Nobel Laureates.

A Gathering of Nobel Laureates: Science for the 21st Century - 212 -

CURRICULUM GUIDE

In cooperation with The Echo Foundation, we present this brief curriculum guide to assist teachers as they bring students through this exhibition. We begin with a brief history of photography, then give teachers several activities and questions for discussion as they share with their students this extraordinary exhibit.

A Brief History of Photography

The scientific discoveries fueling the evolution of photography exemplify the merger of science and art. In the mid-16th century, J. B. Porta (1541-1615), a wise Neapolitan, was able to project the image of well-lighted objects through a small hole in one of the faces of a dark chamber; with a convergent lens over the enlarged hole, he noticed that the images became clearer and sharper, thus creating the dark chamber. Then the alchemist Fabricio, observed that silver chloride was darkened by the action of light. From these two discoveries, two hundred years later, a physicist made the first photographic impression, by projecting the outlines of one of his pupils on a white paper sheet impregnated with silver chloride. The outlines were white over a dark background. That rudimentary image, however, dissipated when exposed to light.

In 1802, Wedgwood reproduced transparent drawings on a surface sensitized by silver nitrate and exposed to light. Working from Wedgwood’s ideas, Nicephore Niepce (1765-1833) tried using bitumen, which is altered and made insoluble by light, thus keeping the images obtained unaltered. He communicated his experiences to Daguerre (1787-1851), who noticed that a iodide-covered silver plate - the daguerreotype -, by exposure to iodine fumes, was impressed by the response of light action, and that the almost invisible alteration could be developed with the exposure to mercury fumes. The image was then fixed with a solution of potassium cyanide, which dissolves the unaltered iodine.

Thus, after centuries of experimentation, trial and error, and building on the work of several scientists, the daguerreotype (1839) was the first practical solution for the creation of photography. In 1841, Claudet discovered quickening substances, which allowed the exposure time to be shortened. In the same decade, William Henry Talbot substituted the steel daguerreotype with paper photographs (named “calotype”). Niepce of Saint-Victor (1805-1870), Nicephore’s cousin, invented the photographic glass plate covered with a layer of albumin, sensitized by silver iodide. Maddox and Benett, between 1871 and 1878, discovered the gelatine-bromide plate, as well as how to sensitize it. Vogel, in 1875, sensitized emulsions with small increments of organic composites, to impress the photographic plate.

Improving upon these early processes, George Eastman (1854-1932) created the celluloid film roll that is used today. Just as early processes were refined and/or replaced with better methods, the development of the computers and digital images, likely will cause celluloid film rolls to be replaced by chips that are more practical and have greater capacity for storing images.

Continue reading to learn more about portrait photography as art and medium for communicating ideas…

A Gathering of Nobel Laureates: Science for the 21st Century - 213 -

Portrait Photography

What makes a photograph a portrait is the intention of the photographer to disclose something about the character of the person they are photographing. Portrait photography has two primary forms studio photography using artificial lights with studio setup, or environmental photography using available light and the found surroundings.

Studio Portraits: Studio or artificial lights and lighting techniques are used to depict a person or subject isolated from their natural surroundings. Studio photography is most widely associated with fashion photography, advertising photography and even some family and wedding photography.

Environmental Portraits: In an environmental portrait, the person portrayed is placed in a setting that shares information about the person's life and/or interests. The person may also be holding objects related to their professional trade or interests and hobbies providing a visual narrative.

For this exhibition, Peter Badge, the photographer, documents the Nobel Laureates using black and white film and natural light. Badge creates close up images and then steps back to create environmental portraits providing insight into the lives of the Laureates. One striking element of Badge’s work is that he does not use any artificial lighting, makeup or studio backdrops to document the Laureates.

As you are walking through the gallery, consider these questions for each of the six Laureates you have been studying.

Classroom Connection: 1. In small groups, find the image of the Laureate you have been studying or find the images of the six Laureates you have been studying. Observe the Laureate’s portrait and work together to answer the following questions. Be prepared to share your answers in a large group discussion. a. Is the portrait a close up, environmental or both? If it is both compare and contrast the information provided by each image.

b. What information about the Laureate is revealed with by the portrait(s)?

c. What connection does the portrait have with the Laureate’s discovery?

d. Does the portrait of the Laureate reflect the personality or the type of person you have been studying? Write a descriptive paragraph using the visual metaphors or clues given in each portrait. How does this compare to your readings on each Laureate?

A Gathering of Nobel Laureates: Science for the 21st Century - 214 -

2. In large class discussion, compare and contrast notes taken by the small groups. Key questions to consider include: a. Why did the photographer choose black and white instead of color to portray the Laureates? b. In general, what is the difference between the up close portraits and the far away portraits? c. Are any of the characteristics of people who win Nobel Prizes revealed in the portraits of the Laureates? d. What types of environments are depicted by the images of the Laureates?

3. As an extension activity, students can create environmental portraits of each other using a digital camera(s) in the classroom. Remember to include props, objects and poses that describe you and your personality. As best you can, try to recreate and stand in the environment that best represents you or subject.

Contact Us

For any additional information on the exhibit or The Light Factory, or to schedule a tour and darkroom demonstration, please call Charles Thomas, The Light Factory’s Director of Education at (704) 333-9755. Or visit our website at www.lightfactory.org.

A Gathering of Nobel Laureates: Science for the 21st Century - 215 -

“A Gathering of Nobel Laureates: Science for the 21st Century”

Presented by THE ECHO FOUNDATION

GUIDELINES

ART, PHOTOGRAPHY, ESSAY & POETRY CONTEST

Contest Theme: Global Scientific Discovery and Personal Responsibility World hunger and poverty, the HIV/AIDS epidemic and environmental corruption are among the

mounting global concerns confronting humankind in the 21st Century. Scientific discoveries in

physics, chemistry, and medicine may provide answers to many of the world’s problems. How do

scientific discoveries impact the world in positive ways? How is scientific knowledge used? What

can one person do?

WHAT: Presented by The Echo Foundation, GLOBAL SCIENTIFIC DISCOVERY AND PERSONAL RESPONSIBILITY offers contests in four categories: ART, PHOTOGRAPHY, ESSAY AND POETRY. Keeping in mind the work of the visiting Laureates Guests: Günter Blobel, Edmond Fischer, Christiane Nüsslein-Volhard, Douglas Osheroff, Robert Richardson and Anders Bárány, students are invited to respond to the above paragraph through any of the four mentioned categories. WHO: The Contest is open to all Charlotte area High School Students, grades 9 – 12. WHEN: Entry forms and submissions must be postmarked or received by The Echo Foundation at 1125 East Morehead Street, Suite 106, Charlotte, NC 28204, by 3:00PM, Monday February 14, 2005. HOW: Entry forms may be downloaded at http://www.echofoundation.org, The Echo Foundation web site, or obtained at The Echo Foundation office. No student name should appear on the front of a submission and an entry form must accompany each entry.

PURCHASE AWARDS AND CATEGORIES: First ($100), second ($75) and third ($50) prizes will be given in each of the four categories: art, photography, essay and poetry. All other Art and Photography entries can be reclaimed following the contest’s judging.

JUDGING AND RULES: Educators and professionals in the corresponding fields will serve on the judging panel. The panels reserve the right to not award a cash prize in a category if the submissions do not meet the qualifications for entry. All written entries must be typed (double- spaced). Word limit for essays is 1,500; poetry has no limit on length. 2-D original artwork and photography is not to exceed 36” in height or width.

For more information contact: Lee Bierer, Project Manager, The Echo Foundation at 704-347-3844, or email questions to [email protected].

A Gathering of Nobel Laureates: Science for the 21st Century - 216 -

Please attach student photo here A Gathering of Nobel Laureates: Science for the 21st Century 2004-2005

Presented by

THE ECHO FOUNDATION

ART CONTEST: OFFICIAL ENTRY FORM

******* This completed and signed form must accompany each entry. Copies of this form are permissible. Two-dimensional Original Works of Art no larger than 36” x 36” will be accepted.

Please Print or Type:

Full Name: ______Male Female

Address: ______

City: ______State: ______Zip: ______

Phone: ______Email: ______School: ______

Current Class Status: Freshman Sophomore Junior Senior

Title of entry and brief description:

______

______

I give permission for my student’s art entry to be used in future publications and/or exhibits.

______Parent/Guardian Signature Date

Entry Form and submission must be postmarked or received by The Echo Foundation, 1125 E. Morehead Street, Suite 106, Charlotte, NC 28204, by 3:00PM, Monday, February 14, 2005.

For more information contact: Lee Bierer, Project Manager, The Echo Foundation at 704-347-3844 or email questions to [email protected]

A Gathering of Nobel Laureates: Science for the 21st Century - 217 -

Please attach student photo here A Gathering of Nobel Laureates: Science for the 21st Century 2004-2005

Presented by

THE ECHO FOUNDATION

PHOTOGRAPHY CONTEST: OFFICIAL ENTRY FORM

*******

This completed and signed form must accompany each entry. Copies of this form are permissible. Photographs in Black & White or Color with no size limitations, will be accepted.

Please Print or Type:

Full Name: ______Male Female

Address: ______

City: ______State: ______Zip: ______

Phone: ______Email: ______School: ______

Current Class Status: Freshman Sophomore Junior Senior

Title of entry and brief description:

______

______

I give permission for my student’ photography entry to be used in future publications and/or exhibits.

______Parent/Guardian Signature Date

Entry Form and submission must be postmarked or received by The Echo Foundation, 1125 E. Morehead Street, Suite 106, Charlotte, NC 28204, by 3:00PM, Monday, February 14, 2005.

For more information contact: Lee Bierer, Project Manager, The Echo Foundation at 704-347-3844 or email questions to [email protected]

A Gathering of Nobel Laureates: Science for the 21st Century - 218 -

Please attach student photo here A Gathering of Nobel Laureates: Science for the 21st Century 2004-2005

Presented by

THE ECHO FOUNDATION

ESSAY CONTEST: OFFICIAL ENTRY FORM

******* This completed and signed form must accompany each entry. Copies of this form are permissible. Essays may be no more than 1,500 words, must be printed in size 12 font and double-spaced.

Please Print or Type:

Full Name: ______Male Female

Address: ______

City: ______State: ______Zip: ______

Phone: ______Email: ______School: ______

Current Class Status: Freshman Sophomore Junior Senior

Title of entry and brief description:

______

______

I give permission for my student’s essay entry to be used in future publications and/or exhibits.

______Parent/Guardian Signature Date

Entry Form and submission must be postmarked or received by The Echo Foundation, 1125 E. Morehead Street, Suite 106, Charlotte, NC 28204, by 3:00PM, Monday, February 14, 2005.

For more information contact: Lee Bierer, Project Manager, The Echo Foundation at 704-347-3844 or email questions to [email protected]

A Gathering of Nobel Laureates: Science for the 21st Century - 219 -

Please attach student photo here A Gathering of Nobel Laureates: Science for the 21st Century 2004-2005

Presented by

THE ECHO FOUNDATION

POETRY CONTEST: OFFICIAL ENTRY FORM

*******

This completed and signed form must accompany each entry. Copies of this form are permissible. Poems may be any length, printed in size 12 font and double-spaced.

Please Print or Type:

Full Name: ______Male Female

Address: ______

City: ______State: ______Zip: ______

Phone: ______Email: ______School: ______

Current Class Status: Freshman Sophomore Junior Senior

Title of entry and brief description:

______

______

I give permission for my student’s poetry entry to be used in future publications and/or exhibits.

______Parent/Guardian Signature Date

Entry Form and submission must be postmarked or received by The Echo Foundation, 1125 E. Morehead Street, Suite 106, Charlotte, NC 28204, by 3:00PM, Monday, February 14, 2005.

For more information contact: Lee Bierer, Project Manager, The Echo Foundation at 704-347-3844 or email questions to [email protected]

A Gathering of Nobel Laureates: Science for the 21st Century - 220 -

The Echo Foundation International Board of Advisors - Elie Wiesel, Honorary Chairperson Nobel Laureate for Peace, 1986

Dr. Bernard Kouchner, United Nations Peacekeeper in Kosovo Jonathan Kozol, Child Advocate The Honorable James Martin, Vice President for Research, Carolinas HealthCare Systems Dr. Joseph B. Martin, III, Principal Corporate Affairs Officer, Bank of America Dr. James L. Pughsley, Superintendent, Charlotte-Mecklenburg Schools Jeffrey D. Sachs, Director, The Earth Institute, Columbia University The Honorable Melvin Watt, United States Congressman, North Carolina Harry Wu, Executive Director, The Laogai Research Foundation

- Charlotte Board of Trustees -

Nick Bradick*, Chairperson Stephanie G. Ansaldo*, President The Echo Foundation Anna Wilbanks*, Vice Chair Director Global Studies, Providence Day School Thomas Pollan*, Treasurer Partner, Accenture

Dr. Yele Aluko, President, Mid Carolina Cardiology Bishop George Battle, Jr., AME Zion Church Ambassador Mark Erwin*, President, Erwin Capital Dr. Joan Lorden, Provost, University of NC at Charlotte John M. Papadopulos, Managing Director, Wachovia Securities, LLC Larry Polsky, Partner, L & J Associates James Y. Preston, Partner, Parker, Poe, Adams & Bernstein Malik K. Rahman, Associate Vice President, Central Piedmont Community College Jack Stroker, Partner, L & J Associates Kurt Waldthausen, Partner, Coleman Lew & Associates, Inc. Eulada Watt, Office of Research, University of North Carolina at Charlotte Chester Williams, Executive Vice President, CRA & Community Development, BB&T

*Indicates Executive Committee Member

Our mission “…to sponsor and facilitate those voices that speak of human dignity, justice and moral courage in a way that will lead to positive action for human kind.

A Gathering of Nobel Laureates: Science for the 21st Century - 221 -

The Echo Foundation

AN INTRODUCTION

On March 12, 1997, as the centerpiece of the community-wide, year-long, educational Elie Wiesel Project, internationally revered humanitarian and Nobel Laureate for Peace, Elie Wiesel spoke “Against Indifference” to over 23,000 students and adults. He was so inspired by this visit to Charlotte, that, as he left, he challenged the community to continue its focus on the critical issues of human dignity, justice and moral courage. He offered seed money and his wholehearted assistance in obtaining speakers and developing programs to address these issues. Thus The Echo Foundation was born, and with it its mission: …to sponsor and facilitate those voices that speak of human dignity, justice and moral courage in a way that will lead to positive action for humankind. The mission is implemented by bringing speakers, exhibitions and performances to the Charlotte Region as catalysts for educational programs. For each project school-based curriculum materials that meet national and international standards are developed and made available free of charge to schoolteachers across the region.

Our goals are: A. Educating for compassion, justice and moral decision making; B. Teaching understanding through fostering relationships founded in respect; C. Facilitating opportunities to act against indifference on these issues.

Our region has demonstrated a need and a desire to address issues of racial diversity, culture and the quality of human existence. The Echo Foundation brings together people from all corners of Charlotte- Mecklenburg to address these vital goals through student dialogues, teacher workshops, theatrical productions, lectures and more. The primary focus of all projects is humanity. The secondary focus is specific to the particular speaker, exhibition or performance. For example, the primary focus of The Elie Wiesel Project: Against Indifference was justice and world peace; the secondary focus of the Project was World War II and the Holocaust.

The Echo Foundation’s recent and current projects include the production of the play, The White Rose; The Varian Fry Exhibition Project; The Harry Wu Project; Living Together in the 21st Century, with Jonathan Kozol; the Kerry Kennedy Cuomo Project: For Human Rights; The Wole Soyinka Project: Truth Memory and Reconciliation; Syl Cheney-Coker Project: Free to Write; Considering Social Capital with Henry Louis Gates, Jr. (2003); Bernard Kouchner: Compassion Without Borders (2004); and Science & Art for Humanity: A Nobel Perspective (2004).

Proposed future speakers include: President Vaclav Havel, Amartya Sen, Sec. General Kofi Annan, Archbishop Desmond Tutu, Liv Ullman, President Nelson Mandela and Graca Machel, President Jimmy Carter, Shimon Peres, Steven Spielberg, The Dalai Lama, President Oscar Arias Sanchez, Jody Williams, and more.

The Echo Foundation is governed by an International Board of Advisors and a Charlotte Board of Trustees. Mr. Wiesel is an active Honorary Chairperson who continues to meet with ECHO on a regular basis. To date, many outstanding professionals in the community have offered their services to The Foundation pro bono. The corporate, religious and educational communities have generously exhibited their support of ECHO’s mission and projects.

A Gathering of Nobel Laureates: Science for the 21st Century - 222 -

THE ECHO FOUNDATION: Four Initiatives

The Echo Foundation Mission: “To sponsor and facilitate those voices that speak of human dignity, justice and moral courage in a way that will lead to positive action for humankind.” Echo promotes its mission through the implementation of Four Initiatives, each with a specific target audience: 1) Middle and High School Students, with arms into the community at large, 2) Adults Leaders and 3) Elementary School Children.

• Voices Against Indifference: Middle and High School Initiative. Through bringing renowned humanitarians to Charlotte as a catalyst for education, and with diversity of race, class and culture as our primary focus, The Echo Foundation creates educational programs centered on the message of our annual guest. Voices Against Indifference builds bridges across racial divides by bringing students from all corners of Charlotte Mecklenburg together to learn about the message of Wole Soyinka, 2002; Kerry Kennedy Cuomo 2001; and Harry Wu 2000; and to interpret its impact in our own community. In other words, thinking globally and acting locally – taking lessons learned around the world and seeking to apply the solutions locally. An extension to this initiative is Echo’s Annual Award Dinner at which the International Humanitarian is the Keynote Speaker and a local hero is chosen to receive the Echo Award Against Indifference.

• Forum for Hope: Adult Leadership Initiative. Believing that the tone and culture of an organization begin at the top, Echo invites 20 leaders from the Charlotte Community to travel together for the purpose of exposure to individuals who have, from a humanitarian perspective, shaped the world in a positive way. Our inaugural journey was to Boston for a round table discussion with Echo Foundation Honorary Chair, Elie Wiesel. Participants met twice prior to traveling to build unity around the mission of the initiative and to establish goals and measures for success. A steering committee was formed to identify participants ensuring representation from professional, educational, religious, medical and arts communities with an emphasis on race, ethnicity and gender diversity.

• Living Together in the 21st Century: Elementary School Character Education Initiative. The Echo Foundation’s commitment to humanity and to education finds unique expression in its 2001-2002 pilot program, Living Together in the 21st Century, an education outreach project for 2nd grade students originated by Nobel Peace Laureate, Elie Wiesel with involvement by child activist, Jonathan Kozol, and created by Charlotte Mecklenburg teachers. LT is broad based curriculum that focuses on living together in harmony and teaches problem solving strategies, conflict resolution and respect for others. The underlying mission of the project is to simultaneously begin to build compassion for people of all races, cultures and backgrounds and to teach life skills in young children which will prepare them to live in our society non-violently. A secondary project goal is to create a model which can be shared nationally and internationally. We believe that with increased compassion and sensitivity toward one’s neighbors and with effective problem solving skills, children will be better equipped to live in harmony with one another now and in years to come.

• Charlotte: City of Asylum. Refuge for persecuted writers. Although there are several Cities of Asylum worldwide, only four exist in North America. The Echo Foundation is in the process of making Charlotte the first Southern City of Asylum in America.

A Gathering of Nobel Laureates: Science for the 21st Century - 223 -