DOCSLIB.ORG

Investigation in Liver Tissues and Cell Lines of the Transcription of 13 Genes Mapping to the 16Q24 Region That Are Frequently Deleted in Hepatocellular Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigation in Liver Tissues and Cell Lines of the Transcription of 13 Genes Mapping to the 16Q24 Region That Are Frequently Deleted in Hepatocellular Carcinoma 3178 Vol. 8, 3178–3186, October 2002 Clinical Cancer Research Investigation in Liver Tissues and Cell Lines of the Transcription of 13 Genes Mapping to the 16q24 Region That Are Frequently Deleted in Hepatocellular Carcinoma Philippe Riou, Raphae¨l Saffroy, Je´rome Comoy, INTRODUCTION Marine Gross-Goupil, Jean-Paul Thie´ry, HCC2 is one of the most frequent human cancers world- Jean-Franc¸ois Emile, Daniel Azoulay, wide (1). However, the molecular mechanisms underlying HCC Dominique Piatier-Tonneau, Antoinette Lemoine, tumorigenesis and tumor metastasis are still poorly understood. 1 HCC, like other solid tumors, seems to develop following mul- and Brigitte Debuire tiple genetic events (2), including the functional inactivation of Service de Biochimie et Biologie mole´culaire [P. R., R. S., J. C., TSGs and the activation of oncogenes. Previous studies of LOH M. G-G., J-P. T., A. L., B. D.], Service d’Anatomie pathologique have suggested that several genomic regions may be involved in [J-F.E.], and Centre He´patobiliaire Hoˆpital Universitaire Paul Brousse [D. A.], UPRES 1596-Faculte´deMe´decine Paris-Sud, 94804 Villejuif liver carcinogenesis. These regions are mostly located on chro- Cedex, France, and Ge´ne´tique Mole´culaire et Biologie du mosome arms 1p, 4q, 5q, 6q, 8p, 9p, 11p, 13q, 16p, 16q, and De´veloppement, FRE 2376, Centre National de la Recherche 17p, indicating that dysfunctions of diverse tumor or metastasis Scientifique, 94801 Villejuif Cedex, France [D. P-T.] suppressor genes located on these chromosomes are involved in the development of HCC (3–5). ABSTRACT LOH on the long arm of chromosome 16 has been reported to be frequent in several human cancers, including HCC. Anal- Many studies have associated chromosomal deletions in yses of LOH frequencies (6–12), comparative genomic hybrid- the 16q24 region with human cancers, including hepatocel- ization (13–15), and aberrant DNA methylation (16, 17) have lular carcinoma. A more limited region around the micro- suggested that one or more TSGs involved in the development satellite D16S402 has been shown implicated in the meta- of HCC map to chromosome 16q. LOH on chromosome 16q has static spread of hepatocellular carcinoma, prostate cancer, been correlated with clinicopathological characteristics, such as and Wilms’ tumors. It is likely that one or more tumor the degree of differentiation, size, and the occurrence of metas- suppressor genes are located in this 16q24 area. tases, indicating that LOH on chromosome 16 may be involved We used SYBR Green reagents to quantify, by real- in the progression of HCC (6, 12). time quantitative RT-PCR, the production of mRNA for 13 Subsequent molecular analyses in HCC (5, 10–12, 15, genes mapping to 16q24. The locations of these genes were 18–20), prostate (21, 22), ovarian (23–25), breast (26, 27), determined from published human genome sequencing data. bladder (28), and Wilms’ (29–32) tumors have identified the We studied mRNA levels in 10 liver tumor tissues, 10 non- 16q24 region as a major region of LOH, associated with meta- tumor liver tissues, five hepatoma cell lines, and in isolated static and aggressive behavior of the cancer (21, 22, 29, 32–34). hepatocytes. Results were compared with those for loss of Mashimo et al. (33) recently used microcell-mediated chromo- heterozygosity observed in the D16S402 region and recur- some transfer into a highly metastatic rat prostatic cancer cell rence. line to show that microsatellite marker D16S402 was retained in No down-regulation was observed in tumor tissues. microcell hybrids displaying significant reduction in lung me- Two genes were consistently overexpressed: OKL38 and tastasis. We have shown that changes in the D16S402 micro- CDH13. CDH13, which functions in cell-cell adhesion, seems satellite are frequent in European HCC patients and are corre- to be involved in liver carcinogenesis. However, no relation- lated with a higher risk of recurrence (35). LOH studies in ship was observed between the expression of this gene and several other types of tumor have also suggested that there is at changes in the D16S402 microsatellite or tumor recurrence. least one TSG near the D16S402 locus (19, 23, 26, 31, 36). None of the other genes tested seemed to be a good candidate Data from the human genome sequencing program were for a major tumor suppressor gene in liver carcinogenesis. recently published (37), and information concerning the fine Our results suggest that additional unknown genes in- mapping of genes is now available on via the internet.3 We volved in carcinogenesis are located in the 16q24 area. identified 13 genes mapping to the 16q23.3–24.1 chromosomal region between the D16S422 and D16S3037 loci, encompassing a region of approximately 2 cM, including D16S402 (Fig. 1). We selected only known genes and full-length mRNAs corre- Received 10/19/01; revised 4/22/02; accepted 6/4/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom requests for reprints should be addressed, at Service de 2 The abbreviations used are: HCC, hepatocellular carcinoma; LOH, Biochimie et Biologie mole´culaire, Hoˆpital Universitaire Paul Brousse, loss of heterozygosity; TSG, tumor suppressor gene; NL, normal liver UPRES 1596-Faculte´deMe´decine Paris-Sud, 14 avenue Paul Vaillant RNA; NTL, nontumor liver RNA; TL, tumoral liver RNA. Couturier, 94804 Villejuif Cedex, France. 3 Internet address: www.genome.cse.ucsc.edu. Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2002 American Association for Cancer Research. Clinical Cancer Research 3179 Fig. 1 Genetic map and known function of the 13 genes mapping to the 16q23.3–24.1 chromosomal region. sponding to unknown genes for study. The expression of these nation by the pathologist and were then frozen and stored at genes has not previously been studied in patients with HCC. Ϫ80°C for RNA and DNA extraction. Particular attention was We quantified the expression of these genes in tumoral and paid to obtain the “core” part of the tumor to avoid the adjacent nontumoral tissues from the liver and in five hepatoma cell noncancerous tissue, as proved by histopathological examina- lines. We compared the results obtained for gene expression tion. The clinicopathological features of the HCCs are summa- with those concerning LOH specific to D16S402 and surround- rized in Table 1. For each patient, we collected paired peripheral ing microsatellite markers and metastatic spread. blood samples at a time when the patient was not undergoing surgery, to prevent contamination of the blood with hepatocytes, MATERIALS AND METHODS which may occur during surgery (38), or specimens of non- Tissue and Cell Specimens. The Institutional Review hepatic tissue—such as gallbladder, if possible—for use as a Board of the Hoˆpital Universitaire Paul Brousse and the Com- normal control for microsatellite analysis. Ten NL tissue sam- mittee for Research on Human Subjects at the Faculte´ de Me´- ples were obtained from biopsies of donated livers during graft decine Paris-Sud approved this research. Liver tumor tissue and harvesting. These samples were treated in the same way as HCC noncancerous liver tissues were excised during surgery from 10 samples and were used for histological analysis to determine the patients with HCC. The tissues underwent histological exami- normal expression profile of the genes studied. Human liver Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2002 American Association for Cancer Research. 3180 The 16q24 Region and HCC Table 1 Characteristics of the 10 patients Patient Age Underlying liver Etiology Recurrencea No. of nodules Diameter of nodulesb Edmonson’s grade 166Cc HCV ϩϾ325II 2 66 C HEMO ϩϾ3 10 III 318NC0 0 Ͼ340II 448NC0 0 Ͼ3 220 II/III 5 64 C HCV ϩϾ3 10 III 6 39 C HBV ϩ HDV 0 Յ320II 7 45 C HBV ϩ Յ310II 8 75 CH HBV ϩ Յ3 60 II/III 9 45 C HCV 0 Յ318II 10 64 NC 0 0 Յ3 130 III a Within 15 months after curative surgery. b Diameter of the greatest nodule (millimeters). c C, cirrhosis; NC, without cirrhosis; CH, chronic hepatitis; HEMO, hemochromatosis; HCV, hepatitis C virus; HBV, hepatitis B virus; HDV, hepatitis D virus. Table 2 Oligonucleotide primer sequences used Priming site GenBank accession no. Upstream (5Ј–3Ј) Downstream (5Ј–3Ј) Microsatellite markers D16S422 AFM249xc5 CAGTGTAACCTGGGGGC CTTTCGATTAGTTTAGCAGAATGAG D16S3091 AFMb297zc1 GGGAGATAGCCTTAAACTTTCTTAC TGTTGCTAATAACACTAGGCCA D16S402 AFM031xa5 TTTTGTAACCATGTACCCCC ATTTATAGGGCCATGACCAG WFDC1-GT12 AC009123 TGACTGTGTCCGCTAGAGTG TACGCACGCATCCCC WFDC1-GT20 AC009123 CCTGTCTTCGTAAAGGG TCAAATCGTTCATTTGGGAG D16S3061 AFMa304wa9 CTACTGGTGAGGCTGAGGTG ATATCTCGGGATTTGTTGCTTTAC D16S3037 AFMa191ya9 GAGCCAAGATGACACCACT GCACTGGGAACCTAAGGA Target genes ␤-actin M10277 AGCCTCGCCTTTGCCGA GCGCGGCGATATCATCATC AK022605 AK022605 GCAGCTTCTCACGGGACAA GGACTGTACGTCTCTACTGAAGAGAGC LOC083693 AK025626 CACAGGTGCTCGTGGTTGG CCCACACCCAGAGCCATTC CDH13 NM 018110 GGCGCTTCTAGTCGGACAAA GCCATCGCTGTTCACCTTG HSBP1 NM 001537 CGCCAAGCTGGGCATC ATTCTCCCAATGATCTGGTCAG HUMCLPB AK026033 CAAGAGGTCCAAGTTTGCCCT CTGGGCGTCGTAATTGGCT KIAA0190 D80012 TGTGGCACACAGGCTGT TCCAAAGCGAGGGCAG KIAA0703 NM 014861 CGGAGACCGGATCCCTG GATGTTGCTGAGGGTGGTGAG KIAA1609 AB046829 CACAGACAGGAGCTGAGAGGCT GACCAGGGTAGTCAGATCAAGAGAC MLYCD NM 012213 TGCGCTTCCTGGTGCAG GCCAGGTAACCCGTTCTAGGT OKL38 NM 013370 GTGATCCTGAGCCAAGGCC CCAGACCCTTCTTGACCACGT
Load more

Recommended publications
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Temporal Proteomic Analysis of HIV Infection Reveals Remodelling of The
    1 1 Temporal proteomic analysis of HIV infection reveals 2 remodelling of the host phosphoproteome 3 by lentiviral Vif variants 4 5 Edward JD Greenwood 1,2,*, Nicholas J Matheson1,2,*, Kim Wals1, Dick JH van den Boomen1, 6 Robin Antrobus1, James C Williamson1, Paul J Lehner1,* 7 1. Cambridge Institute for Medical Research, Department of Medicine, University of 8 Cambridge, Cambridge, CB2 0XY, UK. 9 2. These authors contributed equally to this work. 10 *Correspondence: [email protected]; [email protected]; [email protected] 11 12 Abstract 13 Viruses manipulate host factors to enhance their replication and evade cellular restriction. 14 We used multiplex tandem mass tag (TMT)-based whole cell proteomics to perform a 15 comprehensive time course analysis of >6,500 viral and cellular proteins during HIV 16 infection. To enable specific functional predictions, we categorized cellular proteins regulated 17 by HIV according to their patterns of temporal expression. We focussed on proteins depleted 18 with similar kinetics to APOBEC3C, and found the viral accessory protein Vif to be 19 necessary and sufficient for CUL5-dependent proteasomal degradation of all members of the 20 B56 family of regulatory subunits of the key cellular phosphatase PP2A (PPP2R5A-E). 21 Quantitative phosphoproteomic analysis of HIV-infected cells confirmed Vif-dependent 22 hyperphosphorylation of >200 cellular proteins, particularly substrates of the aurora kinases. 23 The ability of Vif to target PPP2R5 subunits is found in primate and non-primate lentiviral 2 24 lineages, and remodeling of the cellular phosphoproteome is therefore a second ancient and 25 conserved Vif function.
    [Show full text]
  • Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
    177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable.
    [Show full text]
  • The Genetic Basis of Malformation of Cortical Development Syndromes: Primary Focus on Aicardi Syndrome
    The Genetic Basis of Malformation of Cortical Development Syndromes: Primary Focus on Aicardi Syndrome Thuong Thi Ha B. Sc, M. Bio Neurogenetics Research Group The University of Adelaide Thesis submitted for the degree of Doctor of Philosophy In Discipline of Genetics and Evolution School of Biological Sciences Faculty of Science The University of Adelaide June 2018 Table of Contents Abstract 6 Thesis Declaration 8 Acknowledgements 9 Publications 11 Abbreviations 12 CHAPTER I: Introduction 15 1.1 Overview of Malformations of Cortical Development (MCD) 15 1.2 Introduction into Aicardi Syndrome 16 1.3 Clinical Features of Aicardi Syndrome 20 1.3.1 Epidemiology 20 1.3.2 Clinical Diagnosis 21 1.3.3 Differential Diagnosis 23 1.3.4 Development & Prognosis 24 1.4 Treatment 28 1.5 Pathogenesis of Aicardi Syndrome 29 1.5.1 Prenatal or Intrauterine Disturbances 29 1.5.2 Genetic Predisposition 30 1.6 Hypothesis & Aims 41 1.6.1 Hypothesis 41 1.6.2 Research Aims 41 1.7 Expected Outcomes 42 CHAPTER II: Materials & Methods 43 2.1 Study Design 43 2.1.1 Cohort of Study 44 2.1.2 Inheritance-based Strategy 45 1 2.1.3 Ethics for human and animals 46 2.2 Computational Methods 46 2.2.1 Pre-Processing Raw Reads 46 2.2.2 Sequencing Coverage 47 2.2.3 Variant Discovery 49 2.2.4 Annotating Variants 53 2.2.5 Evaluating Variants 55 2.3 Biological Methods 58 2.3.1 Cell Culture 58 2.3.2 Genomic DNA Sequencing 61 2.3.3 Plasmid cloning 69 2.3.4 RNA, whole exome & Whole Genome Sequencing 74 2.3.5 TOPFlash Assay 75 2.3.6 Western Blot 76 2.3.7 Morpholino Knockdown in Zebrafish 79 CHAPTER III: A mutation in COL4A2 causes autosomal dominant porencephaly with cataracts.
    [Show full text]
  • Sex-Biased Expression of Genes Allocated in the Autosomal Chromosomes: Lc-Ms/Ms Protein Profling in Healthy Subjects
    Sex-Biased Expression of Genes Allocated in the Autosomal Chromosomes: Lc-ms/ms Protein Proling in Healthy Subjects Hayder Ahmed Giha ( [email protected] ) Arabian Gulf University College of Medicine and Medical Science-previous https://orcid.org/0000-0001-6343-1949 Rabab Asghar Abdulwahab University of Bahrain College of Health Sciences Jaafar Abbas Gulf Medical and Diabetes Center Zakia Shinwari King Faisal Specialist Hospital and Research Center Ayodele Alaiya King Faisal Centre Health Science Library: King Faisal Specialist Hospital and Research Center Research Article Keywords: Sex/gender, Sex-biased gene expression, Proteomics, LC-MS/MS, Bioinformatics, Bahrain Posted Date: March 30th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-353208/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/13 Abstract Sex and gender has large impact in human health and disease prediction. Men differ from women by a limited number of genes in Y chromosome while their phenotypes differ markedly. In this study, serum samples from healthy Bahraini men and women were analyzed by LC-MS/MS. Bioinformatics databases were used for proteins/peptides (PPs) identication and their gene localization. Results revealed that, the PPs which differed signicantly (p<0.05 ANOVA) in abundance with fold change (FC) of ³1.5, were twenty, 11 were up-regulated in women (up to 8-folds), and 9 were up-regulated in men but with much lower FC, however, all PPs are encoded by genes located in autosomal chromosomes, indicative of sex-biased gene expression. The only PP related to sex, the sex hormone-binding globulin, was up-regulated in women.
    [Show full text]
  • TIF-IA: an Oncogenic Target of Pre-Ribosomal RNA Synthesis Rui Jin, Emory University Wei Zhou, Emory University
    TIF-IA: An oncogenic target of pre-ribosomal RNA synthesis Rui Jin, Emory University Wei Zhou, Emory University Journal Title: Biochimica et Biophysica Acta Molecular and Cell Biology of Lipids Volume: Volume 1866, Number 2 Publisher: Elsevier: 12 months | 2016-12-01, Pages 189-196 Type of Work: Article | Post-print: After Peer Review Publisher DOI: 10.1016/j.bbcan.2016.09.003 Permanent URL: https://pid.emory.edu/ark:/25593/s6qwz Final published version: http://dx.doi.org/10.1016/j.bbcan.2016.09.003 Copyright information: © 2016 Elsevier B.V. All rights reserved. Accessed September 30, 2021 12:20 AM EDT HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Biochim Manuscript Author Biophys Acta. Manuscript Author Author manuscript; available in PMC 2017 December 01. Published in final edited form as: Biochim Biophys Acta. 2016 December ; 1866(2): 189–196. doi:10.1016/j.bbcan.2016.09.003. TIF-IA: an oncogenic target of pre-ribosomal RNA synthesis Rui Jin1 and Wei Zhou1,2,* 1Department of Hematology and Medical Oncology, The Winship Cancer Institute of Emory University, Atlanta, GA 30322, USA 2Department of Pathology and Laboratory Medicine and Department of Human Genetics Emory University School of Medicine, Atlanta, GA, USA Abstract Cancer cells devote the majority of their energy consumption to ribosome biogenesis, and pre- ribosomal RNA transcription accounts for 30–50% of all transcriptional activity. This aberrantly elevated biological activity is an attractive target for cancer therapeutic intervention if approaches can be developed to circumvent the development of side effects in normal cells. TIF-IA is a transcription factor that connects RNA polymerase I with the UBF/SL-1 complex to initiate the transcription of pre-ribosomal RNA.
    [Show full text]
  • Network-Based Analysis of Key Regulatory Genes Implicated in Type
    www.nature.com/scientificreports OPEN Network‑based analysis of key regulatory genes implicated in Type 2 Diabetes Mellitus and Recurrent Miscarriages in Turner Syndrome Anam Farooqui1, Alaa Alhazmi2, Shaful Haque3, Naaila Tamkeen4, Mahboubeh Mehmankhah1, Safa Tazyeen1, Sher Ali5 & Romana Ishrat1* The information on the genotype–phenotype relationship in Turner Syndrome (TS) is inadequate because very few specifc candidate genes are linked to its clinical features. We used the microarray data of TS to identify the key regulatory genes implicated with TS through a network approach. The causative factors of two common co‑morbidities, Type 2 Diabetes Mellitus (T2DM) and Recurrent Miscarriages (RM), in the Turner population, are expected to be diferent from that of the general population. Through microarray analysis, we identifed nine signature genes of T2DM and three signature genes of RM in TS. The power‑law distribution analysis showed that the TS network carries scale‑free hierarchical fractal attributes. Through local‑community‑paradigm (LCP) estimation we fnd that a strong LCP is also maintained which means that networks are dynamic and heterogeneous. We identifed nine key regulators which serve as the backbone of the TS network. Furthermore, we recognized eight interologs functional in seven diferent organisms from lower to higher levels. Overall, these results ofer few key regulators and essential genes that we envisage have potential as therapeutic targets for the TS in the future and the animal models studied here may prove useful in the validation of such targets. Te medical systems and scientists throughout the world are under an unprecedented challenge to meet the medical needs of much of the world’s population that are sufering from chromosomal anomalies.
    [Show full text]
  • Family-Based Whole Exome Sequencing of Atopic Dermatitis Complicated with Cataracts
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 35), pp: 59446-59454 Research Paper Family-based whole exome sequencing of atopic dermatitis complicated with cataracts Wenxin Luo1,*, Wangdong Xu2,*, Lin Xia3, Dan Xie3, Lin Wang4, Zaipei Guo5, Yue Cheng1, Yi Liu2 and Weimin Li1 1Department of Respiratory and Critical Care Medicine, West China Hospital, Sichuan University, Chengdu, Sichuan, 610041, PR China 2Department of Rheumatology and Immunology, West China Hospital, Sichuan University, Chengdu, Sichuan, 610041, PR China 3State Key Laboratory of Biotherapy and Collaborative Innovation Center for Biotherapy, West China Hospital, Sichuan University, Chengdu, Sichuan, 610041, PR China 4Department of Ophthalmology, West China Hospital, Sichuan University, Chengdu, Sichuan, 610041, PR China 5Department of Dermatology, West China Hospital, Sichuan University, Chengdu, Sichuan, 610041, PR China *Wenxin Luo and Wangdong Xu contributed equally to this work, and should be considered as the co-first author Correspondence to: Weimin Li, email: [email protected] Keywords: atopic dermatitis, cataracts, mutation Received: November 07, 2016 Accepted: June 02, 2017 Published: July 31, 2017 Copyright: Luo et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Background: Atopic dermatitis (AD) is a common skin disorder with elevated prevalence. Cataract induced by AD rarely occurs in adolescent and young adult patients, which is also called atopic cataract. Using whole exome sequencing, we aimed to explore genetic alterations among AD and atopic cataract. Result: We recruited a 19 year-old Chinese male with AD accompanied with cataracts, his father with AD and his mother without AD or cataract.
    [Show full text]
  • Molecular Sciences High-Resolution Chromosome Ideogram Representation of Currently Recognized Genes for Autism Spectrum Disorder
    Int. J. Mol. Sci. 2015, 16, 6464-6495; doi:10.3390/ijms16036464 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article High-Resolution Chromosome Ideogram Representation of Currently Recognized Genes for Autism Spectrum Disorders Merlin G. Butler *, Syed K. Rafi † and Ann M. Manzardo † Departments of Psychiatry & Behavioral Sciences and Pediatrics, University of Kansas Medical Center, Kansas City, KS 66160, USA; E-Mails: [email protected] (S.K.R.); [email protected] (A.M.M.) † These authors contributed to this work equally. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +1-913-588-1873; Fax: +1-913-588-1305. Academic Editor: William Chi-shing Cho Received: 23 January 2015 / Accepted: 16 March 2015 / Published: 20 March 2015 Abstract: Recently, autism-related research has focused on the identification of various genes and disturbed pathways causing the genetically heterogeneous group of autism spectrum disorders (ASD). The list of autism-related genes has significantly increased due to better awareness with advances in genetic technology and expanding searchable genomic databases. We compiled a master list of known and clinically relevant autism spectrum disorder genes identified with supporting evidence from peer-reviewed medical literature sources by searching key words related to autism and genetics and from authoritative autism-related public access websites, such as the Simons Foundation Autism Research Institute autism genomic database dedicated to gene discovery and characterization. Our list consists of 792 genes arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms, thereby enabling clinical and laboratory geneticists and genetic counsellors to access convenient visual images of the location and distribution of ASD genes.
    [Show full text]
  • Partial Monosomy 8P and Trisomy 16Q in Two Children with Developmental Delay Detected by Array Comparative Genomic Hybridization
    8808 MOLECULAR MEDICINE REPORTS 16: 8808-8818, 2017 Partial monosomy 8p and trisomy 16q in two children with developmental delay detected by array comparative genomic hybridization ZOE PAPADOPOULOU1, IOANNIS PAPOULIDIS2, STAVROS SIFAKIS3, GEORGIOS MARKOPOULOS1,4, ANNALISA VETRO5, ANGELIKI‑MARIA VLAIKOU1, MONICA ZIEGLER6, THOMAS LIEHR6, LORETTA THOMAIDIS7, ORSETTA ZUFFARDI5, MARIA SYRROU1, KITSOS GEORGE8 and EMMANOUIL MANOLAKOS2,9 1Laboratory of Biology, Faculty of Medicine, School of Health Sciences, University of Ioannina, Ioannina 45110; 2Access To Genome, Laboratory of Genetics, Athens 11528-Thessaloniki 55134; 3Department of Obstetrics and Gynecology, University Hospital of Heraklion, Heraklion 71201; 4Biomedical Research Division, Institute of Molecular Biology and Biotechnology, Foundation of Research and Technology, University Campus, Ioannina 45110, Greece; 5Department of Molecular Medicine, University of Pavia, I-27100 Pavia, Italy; 6Jena University Hospital, Friedrich Schiller University, Institute of Human Genetics, D‑07743 Jena, Germany; 7Developmental Assessment Unit, 2nd Department of Pediatrics, P. & A. Kyriakou Children's Hospital, National and Kapodistrian University of Athens School of Medicine, Athens 11527; 8Department of Ophthalmology, University of Ioannina, Ioannina 45110, Greece; 9Department of Medical Genetics, University of Cagliari, I-09124 Cagliari, Italy Received January 28, 2016; Accepted February 7, 2017 DOI: 10.3892/mmr.2017.7760 Abstract. Two cases of liveborn unrelated children with Introduction developmental delay and overlapping unbalanced transloca- tions der(8)t(8;16)(p23.2;q23.3) and der (8)t(8;16)(p23.1;q23.1), Monosomy 8p is a rare chromosomal disorder characterized leading to partial monosomy 8p and partial trisomy 16q, are by deletion of a part of the eighth chromosome. The incidence reported in the present study.
    [Show full text]
  • Molecular Regulation of High Muscle Mass in Developing Blonde D'aquitaine Cattle Fetuses
    Molecular regulation of high muscle mass in developing Blonde d’Aquitaine cattle fetuses Isabelle Cassar-Malek, Céline Boby, Brigitte Picard, Antonio Reverter-Gomez, Nicholas Hudson To cite this version: Isabelle Cassar-Malek, Céline Boby, Brigitte Picard, Antonio Reverter-Gomez, Nicholas Hudson. Molecular regulation of high muscle mass in developing Blonde d’Aquitaine cattle fetuses. Biology Open, Royal Society, 2017, 6 (10), pp.bio.024950. 10.1242/bio.024950. hal-01607200 HAL Id: hal-01607200 https://hal.archives-ouvertes.fr/hal-01607200 Submitted on 26 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License © 2017. Published by The Company of Biologists Ltd | Biology Open (2017) 6, 1483-1492 doi:10.1242/bio.024950 RESEARCH ARTICLE Molecular regulation of high muscle mass in developing Blonde d’Aquitaine cattle foetuses Isabelle Cassar-Malek1,Céline Boby1, Brigitte Picard1, Antonio Reverter2 and Nicholas J. Hudson3,* ABSTRACT scientists have numerous breeds at their disposal that, through The Blonde d’Aquitaine (BA) is a French cattle breed with enhanced generations of selective breeding, possess strong phenotypes muscularity, partly attributable to a MSTN mutation.
    [Show full text]
  • Autosomal Recessive Variants in Intellectual Disability and Autism Spectrum Disorder
    Autosomal Recessive Variants in Intellectual Disability and Autism Spectrum Disorder by Ricardo Simeon Harripaul A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy of Medical Science Institute of Medical Sciences University of Toronto © Copyright by Ricardo Simeon Harripaul 2021 Autosomal Recessive Variants in Intellectual Disability and Autism Spectrum Disorder Ricardo Simeon Harripaul Doctor of Philosophy of Medical Science Institute of Medical Sciences University of Toronto 2021 Abstract The development of the nervous system is a tightly timed and controlled process where aberrant development may lead to neurodevelopmental disorders. Two of the most common forms of neurodevelopmental disorders are Intellectual Disability (ID) and Autism Spectrum Disorder (ASD). These two disorders are intertwined, but much about the etiological relationship between them remains a mystery. Little attention has been given to the role recessive variants play in ID and ASD, perhaps related to the ability of recessive variants to remain hidden in the population. This thesis aims to help determine the role of recessive variants in ID and ASD and identify novel genes associated with these neurodevelopmental disorders. Technological advancements such as Next Generation Sequencing (NGS) and large population-scale sequencing reference sets have ushered in a new era of high throughput gene identification. In total, 307 families were whole-exome sequenced (192 consanguineous multiplex ID families and 115 consanguineous trio ASD families), representing 537 samples in total. This work identified 26 novel genes for ID such as ABI2, MAPK8, MBOAT7, MPDZ, PIDD1, SLAIN1, TBC1D23, TRAPPC6B, UBA7, and USP44 in large multiplex families with an overall diagnostic yield of 51 %.
    [Show full text]