3178 Vol. 8, 3178–3186, October 2002 Clinical Cancer Research Investigation in Liver Tissues and Cell Lines of the Transcription of 13 Genes Mapping to the 16q24 Region That Are Frequently Deleted in Hepatocellular Carcinoma Philippe Riou, Raphae¨l Saffroy, Je´rome Comoy, INTRODUCTION Marine Gross-Goupil, Jean-Paul Thie´ry, HCC2 is one of the most frequent human cancers world- Jean-Franc¸ois Emile, Daniel Azoulay, wide (1). However, the molecular mechanisms underlying HCC Dominique Piatier-Tonneau, Antoinette Lemoine, tumorigenesis and tumor metastasis are still poorly understood. 1 HCC, like other solid tumors, seems to develop following mul- and Brigitte Debuire tiple genetic events (2), including the functional inactivation of Service de Biochimie et Biologie mole´culaire [P. R., R. S., J. C., TSGs and the activation of oncogenes. Previous studies of LOH M. G-G., J-P. T., A. L., B. D.], Service d’Anatomie pathologique have suggested that several genomic regions may be involved in [J-F.E.], and Centre He´patobiliaire Hoˆpital Universitaire Paul Brousse [D. A.], UPRES 1596-Faculte´deMe´decine Paris-Sud, 94804 Villejuif liver carcinogenesis. These regions are mostly located on chro- Cedex, France, and Ge´ne´tique Mole´culaire et Biologie du mosome arms 1p, 4q, 5q, 6q, 8p, 9p, 11p, 13q, 16p, 16q, and De´veloppement, FRE 2376, Centre National de la Recherche 17p, indicating that dysfunctions of diverse tumor or metastasis Scientifique, 94801 Villejuif Cedex, France [D. P-T.] suppressor genes located on these chromosomes are involved in the development of HCC (3–5). ABSTRACT LOH on the long arm of chromosome 16 has been reported to be frequent in several human cancers, including HCC. Anal- Many studies have associated chromosomal deletions in yses of LOH frequencies (6–12), comparative genomic hybrid- the 16q24 region with human cancers, including hepatocel- ization (13–15), and aberrant DNA methylation (16, 17) have lular carcinoma. A more limited region around the micro- suggested that one or more TSGs involved in the development satellite D16S402 has been shown implicated in the meta- of HCC map to chromosome 16q. LOH on chromosome 16q has static spread of hepatocellular carcinoma, prostate cancer, been correlated with clinicopathological characteristics, such as and Wilms’ tumors. It is likely that one or more tumor the degree of differentiation, size, and the occurrence of metas- suppressor genes are located in this 16q24 area. tases, indicating that LOH on chromosome 16 may be involved We used SYBR Green reagents to quantify, by real- in the progression of HCC (6, 12). time quantitative RT-PCR, the production of mRNA for 13 Subsequent molecular analyses in HCC (5, 10–12, 15, genes mapping to 16q24. The locations of these genes were 18–20), prostate (21, 22), ovarian (23–25), breast (26, 27), determined from published human genome sequencing data. bladder (28), and Wilms’ (29–32) tumors have identified the We studied mRNA levels in 10 liver tumor tissues, 10 non- 16q24 region as a major region of LOH, associated with meta- tumor liver tissues, five hepatoma cell lines, and in isolated static and aggressive behavior of the cancer (21, 22, 29, 32–34). hepatocytes. Results were compared with those for loss of Mashimo et al. (33) recently used microcell-mediated chromo- heterozygosity observed in the D16S402 region and recur- some transfer into a highly metastatic rat prostatic cancer cell rence. line to show that microsatellite marker D16S402 was retained in No down-regulation was observed in tumor tissues. microcell hybrids displaying significant reduction in lung me- Two genes were consistently overexpressed: OKL38 and tastasis. We have shown that changes in the D16S402 micro- CDH13. CDH13, which functions in cell-cell adhesion, seems satellite are frequent in European HCC patients and are corre- to be involved in liver carcinogenesis. However, no relation- lated with a higher risk of recurrence (35). LOH studies in ship was observed between the expression of this gene and several other types of tumor have also suggested that there is at changes in the D16S402 microsatellite or tumor recurrence. least one TSG near the D16S402 locus (19, 23, 26, 31, 36). None of the other genes tested seemed to be a good candidate Data from the human genome sequencing program were for a major tumor suppressor gene in liver carcinogenesis. recently published (37), and information concerning the fine Our results suggest that additional unknown genes in- mapping of genes is now available on via the internet.3 We volved in carcinogenesis are located in the 16q24 area. identified 13 genes mapping to the 16q23.3–24.1 chromosomal region between the D16S422 and D16S3037 loci, encompassing a region of approximately 2 cM, including D16S402 (Fig. 1). We selected only known genes and full-length mRNAs corre- Received 10/19/01; revised 4/22/02; accepted 6/4/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom requests for reprints should be addressed, at Service de 2 The abbreviations used are: HCC, hepatocellular carcinoma; LOH, Biochimie et Biologie mole´culaire, Hoˆpital Universitaire Paul Brousse, loss of heterozygosity; TSG, tumor suppressor gene; NL, normal liver UPRES 1596-Faculte´deMe´decine Paris-Sud, 14 avenue Paul Vaillant RNA; NTL, nontumor liver RNA; TL, tumoral liver RNA. Couturier, 94804 Villejuif Cedex, France. 3 Internet address: www.genome.cse.ucsc.edu. Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2002 American Association for Cancer Research. Clinical Cancer Research 3179 Fig. 1 Genetic map and known function of the 13 genes mapping to the 16q23.3–24.1 chromosomal region. sponding to unknown genes for study. The expression of these nation by the pathologist and were then frozen and stored at genes has not previously been studied in patients with HCC. Ϫ80°C for RNA and DNA extraction. Particular attention was We quantified the expression of these genes in tumoral and paid to obtain the “core” part of the tumor to avoid the adjacent nontumoral tissues from the liver and in five hepatoma cell noncancerous tissue, as proved by histopathological examina- lines. We compared the results obtained for gene expression tion. The clinicopathological features of the HCCs are summa- with those concerning LOH specific to D16S402 and surround- rized in Table 1. For each patient, we collected paired peripheral ing microsatellite markers and metastatic spread. blood samples at a time when the patient was not undergoing surgery, to prevent contamination of the blood with hepatocytes, MATERIALS AND METHODS which may occur during surgery (38), or specimens of non- Tissue and Cell Specimens. The Institutional Review hepatic tissue—such as gallbladder, if possible—for use as a Board of the Hoˆpital Universitaire Paul Brousse and the Com- normal control for microsatellite analysis. Ten NL tissue sam- mittee for Research on Human Subjects at the Faculte´ de Me´- ples were obtained from biopsies of donated livers during graft decine Paris-Sud approved this research. Liver tumor tissue and harvesting. These samples were treated in the same way as HCC noncancerous liver tissues were excised during surgery from 10 samples and were used for histological analysis to determine the patients with HCC. The tissues underwent histological exami- normal expression profile of the genes studied. Human liver Downloaded from clincancerres.aacrjournals.org on September 23, 2021. © 2002 American Association for Cancer Research. 3180 The 16q24 Region and HCC Table 1 Characteristics of the 10 patients Patient Age Underlying liver Etiology Recurrencea No. of nodules Diameter of nodulesb Edmonson’s grade 166Cc HCV ϩϾ325II 2 66 C HEMO ϩϾ3 10 III 318NC0 0 Ͼ340II 448NC0 0 Ͼ3 220 II/III 5 64 C HCV ϩϾ3 10 III 6 39 C HBV ϩ HDV 0 Յ320II 7 45 C HBV ϩ Յ310II 8 75 CH HBV ϩ Յ3 60 II/III 9 45 C HCV 0 Յ318II 10 64 NC 0 0 Յ3 130 III a Within 15 months after curative surgery. b Diameter of the greatest nodule (millimeters). c C, cirrhosis; NC, without cirrhosis; CH, chronic hepatitis; HEMO, hemochromatosis; HCV, hepatitis C virus; HBV, hepatitis B virus; HDV, hepatitis D virus. Table 2 Oligonucleotide primer sequences used Priming site GenBank accession no. Upstream (5Ј–3Ј) Downstream (5Ј–3Ј) Microsatellite markers D16S422 AFM249xc5 CAGTGTAACCTGGGGGC CTTTCGATTAGTTTAGCAGAATGAG D16S3091 AFMb297zc1 GGGAGATAGCCTTAAACTTTCTTAC TGTTGCTAATAACACTAGGCCA D16S402 AFM031xa5 TTTTGTAACCATGTACCCCC ATTTATAGGGCCATGACCAG WFDC1-GT12 AC009123 TGACTGTGTCCGCTAGAGTG TACGCACGCATCCCC WFDC1-GT20 AC009123 CCTGTCTTCGTAAAGGG TCAAATCGTTCATTTGGGAG D16S3061 AFMa304wa9 CTACTGGTGAGGCTGAGGTG ATATCTCGGGATTTGTTGCTTTAC D16S3037 AFMa191ya9 GAGCCAAGATGACACCACT GCACTGGGAACCTAAGGA Target genes ␤-actin M10277 AGCCTCGCCTTTGCCGA GCGCGGCGATATCATCATC AK022605 AK022605 GCAGCTTCTCACGGGACAA GGACTGTACGTCTCTACTGAAGAGAGC LOC083693 AK025626 CACAGGTGCTCGTGGTTGG CCCACACCCAGAGCCATTC CDH13 NM 018110 GGCGCTTCTAGTCGGACAAA GCCATCGCTGTTCACCTTG HSBP1 NM 001537 CGCCAAGCTGGGCATC ATTCTCCCAATGATCTGGTCAG HUMCLPB AK026033 CAAGAGGTCCAAGTTTGCCCT CTGGGCGTCGTAATTGGCT KIAA0190 D80012 TGTGGCACACAGGCTGT TCCAAAGCGAGGGCAG KIAA0703 NM 014861 CGGAGACCGGATCCCTG GATGTTGCTGAGGGTGGTGAG KIAA1609 AB046829 CACAGACAGGAGCTGAGAGGCT GACCAGGGTAGTCAGATCAAGAGAC MLYCD NM 012213 TGCGCTTCCTGGTGCAG GCCAGGTAACCCGTTCTAGGT OKL38 NM 013370 GTGATCCTGAGCCAAGGCC CCAGACCCTTCTTGACCACGT