DOCSLIB.ORG

Investigation in Liver Tissues and Cell Lines of the Transcription of 13 Genes Mapping to the 16Q24 Region That Are Frequently Deleted in Hepatocellular Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigation in Liver Tissues and Cell Lines of the Transcription of 13 Genes Mapping to the 16Q24 Region That Are Frequently Deleted in Hepatocellular Carcinoma 3178 Vol. 8, 3178–3186, October 2002 Clinical Cancer Research Investigation in Liver Tissues and Cell Lines of the Transcription of 13 Genes Mapping to the 16q24 Region That Are Frequently Deleted in Hepatocellular Carcinoma Philippe Riou, Raphae¨l Saffroy, Je´rome Comoy, INTRODUCTION Marine Gross-Goupil, Jean-Paul Thie´ry, HCC2 is one of the most frequent human cancers world- Jean-Franc¸ois Emile, Daniel Azoulay, wide (1). However, the molecular mechanisms underlying HCC Dominique Piatier-Tonneau, Antoinette Lemoine, tumorigenesis and tumor metastasis are still poorly understood. 1 HCC, like other solid tumors, seems to develop following mul- and Brigitte Debuire tiple genetic events (2), including the functional inactivation of Service de Biochimie et Biologie mole´culaire [P. R., R. S., J. C., TSGs and the activation of oncogenes. Previous studies of LOH M. G-G., J-P. T., A. L., B. D.], Service d’Anatomie pathologique have suggested that several genomic regions may be involved in [J-F.E.], and Centre He´patobiliaire Hoˆpital Universitaire Paul Brousse [D. A.], UPRES 1596-Faculte´deMe´decine Paris-Sud, 94804 Villejuif liver carcinogenesis. These regions are mostly located on chro- Cedex, France, and Ge´ne´tique Mole´culaire et Biologie du mosome arms 1p, 4q, 5q, 6q, 8p, 9p, 11p, 13q, 16p, 16q, and De´veloppement, FRE 2376, Centre National de la Recherche 17p, indicating that dysfunctions of diverse tumor or metastasis Scientifique, 94801 Villejuif Cedex, France [D. P-T.] suppressor genes located on these chromosomes are involved in the development of HCC (3–5). ABSTRACT LOH on the long arm of chromosome 16 has been reported to be frequent in several human cancers, including HCC. Anal- Many studies have associated chromosomal deletions in yses of LOH frequencies (6–12), comparative genomic hybrid- the 16q24 region with human cancers, including hepatocel- ization (13–15), and aberrant DNA methylation (16, 17) have lular carcinoma. A more limited region around the micro- suggested that one or more TSGs involved in the development satellite D16S402 has been shown implicated in the meta- of HCC map to chromosome 16q. LOH on chromosome 16q has static spread of hepatocellular carcinoma, prostate cancer, been correlated with clinicopathological characteristics, such as and Wilms’ tumors. It is likely that one or more tumor the degree of differentiation, size, and the occurrence of metas- suppressor genes are located in this 16q24 area. tases, indicating that LOH on chromosome 16 may be involved We used SYBR Green reagents to quantify, by real- in the progression of HCC (6, 12). time quantitative RT-PCR, the production of mRNA for 13 Subsequent molecular analyses in HCC (5, 10–12, 15, genes mapping to 16q24. The locations of these genes were 18–20), prostate (21, 22), ovarian (23–25), breast (26, 27), determined from published human genome sequencing data. bladder (28), and Wilms’ (29–32) tumors have identified the We studied mRNA levels in 10 liver tumor tissues, 10 non- 16q24 region as a major region of LOH, associated with meta- tumor liver tissues, five hepatoma cell lines, and in isolated static and aggressive behavior of the cancer (21, 22, 29, 32–34). hepatocytes. Results were compared with those for loss of Mashimo et al. (33) recently used microcell-mediated chromo- heterozygosity observed in the D16S402 region and recur- some transfer into a highly metastatic rat prostatic cancer cell rence. line to show that microsatellite marker D16S402 was retained in No down-regulation was observed in tumor tissues. microcell hybrids displaying significant reduction in lung me- Two genes were consistently overexpressed: OKL38 and tastasis. We have shown that changes in the D16S402 micro- CDH13. CDH13, which functions in cell-cell adhesion, seems satellite are frequent in European HCC patients and are corre- to be involved in liver carcinogenesis. However, no relation- lated with a higher risk of recurrence (35). LOH studies in ship was observed between the expression of this gene and several other types of tumor have also suggested that there is at changes in the D16S402 microsatellite or tumor recurrence. least one TSG near the D16S402 locus (19, 23, 26, 31, 36). None of the other genes tested seemed to be a good candidate Data from the human genome sequencing program were for a major tumor suppressor gene in liver carcinogenesis. recently published (37), and information concerning the fine Our results suggest that additional unknown genes in- mapping of genes is now available on via the internet.3 We volved in carcinogenesis are located in the 16q24 area. identified 13 genes mapping to the 16q23.3–24.1 chromosomal region between the D16S422 and D16S3037 loci, encompassing a region of approximately 2 cM, including D16S402 (Fig. 1). We selected only known genes and full-length mRNAs corre- Received 10/19/01; revised 4/22/02; accepted 6/4/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 To whom requests for reprints should be addressed, at Service de 2 The abbreviations used are: HCC, hepatocellular carcinoma; LOH, Biochimie et Biologie mole´culaire, Hoˆpital Universitaire Paul Brousse, loss of heterozygosity; TSG, tumor suppressor gene; NL, normal liver UPRES 1596-Faculte´deMe´decine Paris-Sud, 14 avenue Paul Vaillant RNA; NTL, nontumor liver RNA; TL, tumoral liver RNA. Couturier, 94804 Villejuif Cedex, France. 3 Internet address: www.genome.cse.ucsc.edu. Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2002 American Association for Cancer Research. Clinical Cancer Research 3179 Fig. 1 Genetic map and known function of the 13 genes mapping to the 16q23.3–24.1 chromosomal region. sponding to unknown genes for study. The expression of these nation by the pathologist and were then frozen and stored at genes has not previously been studied in patients with HCC. Ϫ80°C for RNA and DNA extraction. Particular attention was We quantified the expression of these genes in tumoral and paid to obtain the “core” part of the tumor to avoid the adjacent nontumoral tissues from the liver and in five hepatoma cell noncancerous tissue, as proved by histopathological examina- lines. We compared the results obtained for gene expression tion. The clinicopathological features of the HCCs are summa- with those concerning LOH specific to D16S402 and surround- rized in Table 1. For each patient, we collected paired peripheral ing microsatellite markers and metastatic spread. blood samples at a time when the patient was not undergoing surgery, to prevent contamination of the blood with hepatocytes, MATERIALS AND METHODS which may occur during surgery (38), or specimens of non- Tissue and Cell Specimens. The Institutional Review hepatic tissue—such as gallbladder, if possible—for use as a Board of the Hoˆpital Universitaire Paul Brousse and the Com- normal control for microsatellite analysis. Ten NL tissue sam- mittee for Research on Human Subjects at the Faculte´ de Me´- ples were obtained from biopsies of donated livers during graft decine Paris-Sud approved this research. Liver tumor tissue and harvesting. These samples were treated in the same way as HCC noncancerous liver tissues were excised during surgery from 10 samples and were used for histological analysis to determine the patients with HCC. The tissues underwent histological exami- normal expression profile of the genes studied. Human liver Downloaded from clincancerres.aacrjournals.org on September 25, 2021. © 2002 American Association for Cancer Research. 3180 The 16q24 Region and HCC Table 1 Characteristics of the 10 patients Patient Age Underlying liver Etiology Recurrencea No. of nodules Diameter of nodulesb Edmonson’s grade 166Cc HCV ϩϾ325II 2 66 C HEMO ϩϾ3 10 III 318NC0 0 Ͼ340II 448NC0 0 Ͼ3 220 II/III 5 64 C HCV ϩϾ3 10 III 6 39 C HBV ϩ HDV 0 Յ320II 7 45 C HBV ϩ Յ310II 8 75 CH HBV ϩ Յ3 60 II/III 9 45 C HCV 0 Յ318II 10 64 NC 0 0 Յ3 130 III a Within 15 months after curative surgery. b Diameter of the greatest nodule (millimeters). c C, cirrhosis; NC, without cirrhosis; CH, chronic hepatitis; HEMO, hemochromatosis; HCV, hepatitis C virus; HBV, hepatitis B virus; HDV, hepatitis D virus. Table 2 Oligonucleotide primer sequences used Priming site GenBank accession no. Upstream (5Ј–3Ј) Downstream (5Ј–3Ј) Microsatellite markers D16S422 AFM249xc5 CAGTGTAACCTGGGGGC CTTTCGATTAGTTTAGCAGAATGAG D16S3091 AFMb297zc1 GGGAGATAGCCTTAAACTTTCTTAC TGTTGCTAATAACACTAGGCCA D16S402 AFM031xa5 TTTTGTAACCATGTACCCCC ATTTATAGGGCCATGACCAG WFDC1-GT12 AC009123 TGACTGTGTCCGCTAGAGTG TACGCACGCATCCCC WFDC1-GT20 AC009123 CCTGTCTTCGTAAAGGG TCAAATCGTTCATTTGGGAG D16S3061 AFMa304wa9 CTACTGGTGAGGCTGAGGTG ATATCTCGGGATTTGTTGCTTTAC D16S3037 AFMa191ya9 GAGCCAAGATGACACCACT GCACTGGGAACCTAAGGA Target genes ␤-actin M10277 AGCCTCGCCTTTGCCGA GCGCGGCGATATCATCATC AK022605 AK022605 GCAGCTTCTCACGGGACAA GGACTGTACGTCTCTACTGAAGAGAGC LOC083693 AK025626 CACAGGTGCTCGTGGTTGG CCCACACCCAGAGCCATTC CDH13 NM 018110 GGCGCTTCTAGTCGGACAAA GCCATCGCTGTTCACCTTG HSBP1 NM 001537 CGCCAAGCTGGGCATC ATTCTCCCAATGATCTGGTCAG HUMCLPB AK026033 CAAGAGGTCCAAGTTTGCCCT CTGGGCGTCGTAATTGGCT KIAA0190 D80012 TGTGGCACACAGGCTGT TCCAAAGCGAGGGCAG KIAA0703 NM 014861 CGGAGACCGGATCCCTG GATGTTGCTGAGGGTGGTGAG KIAA1609 AB046829 CACAGACAGGAGCTGAGAGGCT GACCAGGGTAGTCAGATCAAGAGAC MLYCD NM 012213 TGCGCTTCCTGGTGCAG GCCAGGTAACCCGTTCTAGGT OKL38 NM 013370 GTGATCCTGAGCCAAGGCC CCAGACCCTTCTTGACCACGT
Load more

Recommended publications
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • System, Method and Software for Calculation of a Cannabis Drug Efficiency Index for the Reduction of Inflammation
    International Journal of Molecular Sciences Article System, Method and Software for Calculation of a Cannabis Drug Efficiency Index for the Reduction of Inflammation Nicolas Borisov 1,† , Yaroslav Ilnytskyy 2,3,†, Boseon Byeon 2,3,4,†, Olga Kovalchuk 2,3 and Igor Kovalchuk 2,3,* 1 Moscow Institute of Physics and Technology, 9 Institutsky lane, Dolgoprudny, Moscow Region 141701, Russia; [email protected] 2 Department of Biological Sciences, University of Lethbridge, Lethbridge, AB T1K 3M4, Canada; [email protected] (Y.I.); [email protected] (B.B.); [email protected] (O.K.) 3 Pathway Rx., 16 Sandstone Rd. S., Lethbridge, AB T1K 7X8, Canada 4 Biomedical and Health Informatics, Computer Science Department, State University of New York, 2 S Clinton St, Syracuse, NY 13202, USA * Correspondence: [email protected] † First three authors contributed equally to this research. Abstract: There are many varieties of Cannabis sativa that differ from each other by composition of cannabinoids, terpenes and other molecules. The medicinal properties of these cultivars are often very different, with some being more efficient than others. This report describes the development of a method and software for the analysis of the efficiency of various cannabis extracts to detect the anti-inflammatory properties of the various cannabis extracts. The method uses high-throughput gene expression profiling data but can potentially use other omics data as well. According to the signaling pathway topology, the gene expression profiles are convoluted into the signaling pathway activities using a signaling pathway impact analysis (SPIA) method. The method was tested by inducing inflammation in human 3D epithelial tissues, including intestine, oral and skin, and then exposing these tissues to various extracts and then performing transcriptome analysis.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Temporal Proteomic Analysis of HIV Infection Reveals Remodelling of The
    1 1 Temporal proteomic analysis of HIV infection reveals 2 remodelling of the host phosphoproteome 3 by lentiviral Vif variants 4 5 Edward JD Greenwood 1,2,*, Nicholas J Matheson1,2,*, Kim Wals1, Dick JH van den Boomen1, 6 Robin Antrobus1, James C Williamson1, Paul J Lehner1,* 7 1. Cambridge Institute for Medical Research, Department of Medicine, University of 8 Cambridge, Cambridge, CB2 0XY, UK. 9 2. These authors contributed equally to this work. 10 *Correspondence: [email protected]; [email protected]; [email protected] 11 12 Abstract 13 Viruses manipulate host factors to enhance their replication and evade cellular restriction. 14 We used multiplex tandem mass tag (TMT)-based whole cell proteomics to perform a 15 comprehensive time course analysis of >6,500 viral and cellular proteins during HIV 16 infection. To enable specific functional predictions, we categorized cellular proteins regulated 17 by HIV according to their patterns of temporal expression. We focussed on proteins depleted 18 with similar kinetics to APOBEC3C, and found the viral accessory protein Vif to be 19 necessary and sufficient for CUL5-dependent proteasomal degradation of all members of the 20 B56 family of regulatory subunits of the key cellular phosphatase PP2A (PPP2R5A-E). 21 Quantitative phosphoproteomic analysis of HIV-infected cells confirmed Vif-dependent 22 hyperphosphorylation of >200 cellular proteins, particularly substrates of the aurora kinases. 23 The ability of Vif to target PPP2R5 subunits is found in primate and non-primate lentiviral 2 24 lineages, and remodeling of the cellular phosphoproteome is therefore a second ancient and 25 conserved Vif function.
    [Show full text]
  • WFDC1 (NM 021197) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP306450 WFDC1 (NM_021197) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Purified recombinant protein of Homo sapiens WAP four-disulfide core domain 1 (WFDC1) Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 20.6 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_067020 Locus ID: 58189 UniProt ID: Q9HC57 RefSeq Size: 1396 Cytogenetics: 16q24.1 RefSeq ORF: 660 Synonyms: PS20 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 WFDC1 (NM_021197) Human Recombinant Protein – TP306450 Summary: This gene encodes a member of the WAP-type four disulfide core domain family. The WAP- type four-disulfide core domain contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor.
    [Show full text]
  • Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders
    177 Arch Neuropsychitry 2020;57:177−191 RESEARCH ARTICLE https://doi.org/10.29399/npa.24890 Chromosomal Microarray Analysis in Turkish Patients with Unexplained Developmental Delay and Intellectual Developmental Disorders Hakan GÜRKAN1 , Emine İkbal ATLI1 , Engin ATLI1 , Leyla BOZATLI2 , Mengühan ARAZ ALTAY2 , Sinem YALÇINTEPE1 , Yasemin ÖZEN1 , Damla EKER1 , Çisem AKURUT1 , Selma DEMİR1 , Işık GÖRKER2 1Faculty of Medicine, Department of Medical Genetics, Edirne, Trakya University, Edirne, Turkey 2Faculty of Medicine, Department of Child and Adolescent Psychiatry, Trakya University, Edirne, Turkey ABSTRACT Introduction: Aneuploids, copy number variations (CNVs), and single in 39 (39/123=31.7%) patients. Twelve CNV variant of unknown nucleotide variants in specific genes are the main genetic causes of significance (VUS) (9.75%) patients and 7 CNV benign (5.69%) patients developmental delay (DD) and intellectual disability disorder (IDD). were reported. In 6 patients, one or more pathogenic CNVs were These genetic changes can be detected using chromosome analysis, determined. Therefore, the diagnostic efficiency of CMA was found to chromosomal microarray (CMA), and next-generation DNA sequencing be 31.7% (39/123). techniques. Therefore; In this study, we aimed to investigate the Conclusion: Today, genetic analysis is still not part of the routine in the importance of CMA in determining the genomic etiology of unexplained evaluation of IDD patients who present to psychiatry clinics. A genetic DD and IDD in 123 patients. diagnosis from CMA can eliminate genetic question marks and thus Method: For 123 patients, chromosome analysis, DNA fragment analysis alter the clinical management of patients. Approximately one-third and microarray were performed. Conventional G-band karyotype of the positive CMA findings are clinically intervenable.
    [Show full text]
  • The Genetic Basis of Malformation of Cortical Development Syndromes: Primary Focus on Aicardi Syndrome
    The Genetic Basis of Malformation of Cortical Development Syndromes: Primary Focus on Aicardi Syndrome Thuong Thi Ha B. Sc, M. Bio Neurogenetics Research Group The University of Adelaide Thesis submitted for the degree of Doctor of Philosophy In Discipline of Genetics and Evolution School of Biological Sciences Faculty of Science The University of Adelaide June 2018 Table of Contents Abstract 6 Thesis Declaration 8 Acknowledgements 9 Publications 11 Abbreviations 12 CHAPTER I: Introduction 15 1.1 Overview of Malformations of Cortical Development (MCD) 15 1.2 Introduction into Aicardi Syndrome 16 1.3 Clinical Features of Aicardi Syndrome 20 1.3.1 Epidemiology 20 1.3.2 Clinical Diagnosis 21 1.3.3 Differential Diagnosis 23 1.3.4 Development & Prognosis 24 1.4 Treatment 28 1.5 Pathogenesis of Aicardi Syndrome 29 1.5.1 Prenatal or Intrauterine Disturbances 29 1.5.2 Genetic Predisposition 30 1.6 Hypothesis & Aims 41 1.6.1 Hypothesis 41 1.6.2 Research Aims 41 1.7 Expected Outcomes 42 CHAPTER II: Materials & Methods 43 2.1 Study Design 43 2.1.1 Cohort of Study 44 2.1.2 Inheritance-based Strategy 45 1 2.1.3 Ethics for human and animals 46 2.2 Computational Methods 46 2.2.1 Pre-Processing Raw Reads 46 2.2.2 Sequencing Coverage 47 2.2.3 Variant Discovery 49 2.2.4 Annotating Variants 53 2.2.5 Evaluating Variants 55 2.3 Biological Methods 58 2.3.1 Cell Culture 58 2.3.2 Genomic DNA Sequencing 61 2.3.3 Plasmid cloning 69 2.3.4 RNA, whole exome & Whole Genome Sequencing 74 2.3.5 TOPFlash Assay 75 2.3.6 Western Blot 76 2.3.7 Morpholino Knockdown in Zebrafish 79 CHAPTER III: A mutation in COL4A2 causes autosomal dominant porencephaly with cataracts.
    [Show full text]
  • Human Epididymis Protein-4 (HE-4): a Novel Cross-Class Protease Inhibitor
    Human Epididymis Protein-4 (HE-4): A Novel Cross-Class Protease Inhibitor Nirmal Chhikara1., Mayank Saraswat1.¤, Anil Kumar Tomar1, Sharmistha Dey1, Sarman Singh2, Savita Yadav1* 1 Department of Biophysics, All India Institute of Medical Sciences, New Delhi, India, 2 Department of Lab Medicine, All India Institute of Medical Sciences, New Delhi, India Abstract Epididymal proteins represent the factors necessary for maturation of sperm and play a crucial role in sperm maturation. HE- 4, an epididymal protein, is a member of whey acidic protein four-disulfide core (WFDC) family with no known function. A WFDC protein has a conserved WFDC domain of 50 amino acids with eight conserved cystine residue. HE-4 is a 124 amino acid long polypeptide with two WFDC domains. Here, we show that HE-4 is secreted in the human seminal fluid as a disulfide-bonded homo-trimer and is a cross-class protease inhibitor inhibits some of the serine, aspartyl and cysteine proteases tested using hemoglobin as a substrate. Using SPR we have also observed that HE-4 shows a significant binding with all these proteases. Disulfide linkages are essential for this activity. Moreover, HE-4 is N-glycosylated and highly stable on a wide range of pH and temperature. Taken together this suggests that HE-4 is a cross-class protease inhibitor which might confer protection against microbial virulence factors of proteolytic nature. Citation: Chhikara N, Saraswat M, Tomar AK, Dey S, Singh S, et al. (2012) Human Epididymis Protein-4 (HE-4): A Novel Cross-Class Protease Inhibitor. PLoS ONE 7(11): e47672. doi:10.1371/journal.pone.0047672 Editor: William R.
    [Show full text]
  • WFDC1 Antibody (C-Term H163) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # Ap12472b
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 WFDC1 Antibody (C-term H163) Affinity Purified Rabbit Polyclonal Antibody (Pab) Catalog # AP12472b Specification WFDC1 Antibody (C-term H163) - Product Information Application WB, IHC-P, FC,E Primary Accession Q9HC57 Other Accession NP_067020.2 Reactivity Human Host Rabbit Clonality Polyclonal Isotype Rabbit Ig Antigen Region 148-177 WFDC1 Antibody (C-term H163) - Additional Information Gene ID 58189 Other Names Anti-WFDC1 Antibody (C-term H163) at WAP four-disulfide core domain protein 1, Prostate stromal protein ps20, ps20 growth 1:2000 dilution + SK-BR-3 whole cell lysate inhibitor, WFDC1, PS20 Lysates/proteins at 20 µg per lane. Secondary Goat Anti-Rabbit IgG, (H+L), Target/Specificity Peroxidase conjugated at 1/10000 dilution. This WFDC1 antibody is generated from Predicted band size : 24 kDa rabbits immunized with a KLH conjugated Blocking/Dilution buffer: 5% NFDM/TBST. synthetic peptide between 148-177 amino acids from the C-terminal region of human WFDC1. Dilution WB~~1:2000 IHC-P~~1:100 FC~~1:10~50 Format Purified polyclonal antibody supplied in PBS with 0.09% (W/V) sodium azide. This antibody is purified through a protein A column, followed by peptide affinity purification. Storage Maintain refrigerated at 2-8°C for up to 2 weeks. For long term storage store at -20°C Immunohistochemical analysis of AP12472b in small aliquots to prevent freeze-thaw on paraffin-embedded Human prostate cycles. tissue. Tissue was fixed with formaldehyde at room temperature. Heat induced epitope Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Precautions retrieval was performed by EDTA buffer (pH9.
    [Show full text]
  • Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Harvard University - DASH Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Varas, Florencio, Matthias Stadtfeld, Luisa de Andres-Aguayo, Nimet Maherali, Alessandro di Tullio, Lorena Pantano, Cedric Notredame, et al. 2009. Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions. Stem Cells 27(2): 300-306. Published Version doi:10.1634/stemcells.2008-0696 Accessed February 18, 2015 8:46:59 PM EST Citable Link http://nrs.harvard.edu/urn-3:HUL.InstRepos:4459933 Terms of Use This article was downloaded from Harvard University's DASH repository, and is made available under the terms and conditions applicable to Open Access Policy Articles, as set forth at http://nrs.harvard.edu/urn- 3:HUL.InstRepos:dash.current.terms-of-use#OAP (Article begins on next page) EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS Fibroblast-Derived Induced Pluripotent Stem Cells Show No Common Retroviral Vector Insertions FLORENCIO VARAS,a MATTHIAS STADTFELD,b LUISA DE ANDRES-AGUAYO,a NIMET MAHERALI,b ALESSANDRO DI TULLIO,a LORENA PANTANO,c CEDRIC NOTREDAME,c KONRAD HOCHEDLINGER,b THOMAS GRAFa,d aDifferentiation and Cancer and cBioinformatics Program, Center for Genomic Regulation and Pompeu Fabra University, Barcelona, Spain; bCancer Center and Center for Regenerative Medicine, Massachusetts General Hospital, Harvard Stem Cell Institute, Boston, Massachusetts, USA; dInstitucio´ Catalana de Recerca i Estudis Avanc¸ats Key Words.
    [Show full text]
  • Identification of SCARA3 with Potential Roles in Metabolic Disorders
    www.aging-us.com AGING 2021, Vol. 13, No. 2 Research Paper Identification of SCARA3 with potential roles in metabolic disorders Hui Peng1, Qi Guo1, Tian Su1, Ye Xiao1, Chang-Jun Li1, Yan Huang1, Xiang-Hang Luo1 1Department of Endocrinology, Endocrinology Research Center, Xiangya Hospital of Central South University, Changsha, China Correspondence to: Yan Huang, Xiang-Hang Luo; email: [email protected], [email protected] Keywords: adipogenesis, obesity, SCARA3, methylation, metabolic disorders Received: July 22, 2020 Accepted: October 22, 2020 Published: December 9, 2020 Copyright: © 2020 Peng et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Obesity is characterized by the expansion of adipose tissue which is partially modulated by adipogenesis. In the present study, we identified five differentially expressed genes by incorporating two adipogenesis-related datasets from the GEO database and their correlation with adipogenic markers. However, the role of scavenger receptor class A member 3 (SCARA3) in obesity-related disorders has been rarely reported. We found that Scara3 expression in old adipose tissue-derived mesenchymal stem cells (Ad-MSCs) was lower than it in young Ad-MSCs. Obese mice caused by deletion of the leptin receptor gene (db/db) or by a high-fat diet both showed reduced Scara3 expression in inguinal white adipose tissue. Moreover, hypermethylation of SCARA3 was observed in patients with type 2 diabetes and atherosclerosis. Data from the CTD database indicated that SCARA3 is a potential target for metabolic diseases.
    [Show full text]