DOCSLIB.ORG

The Ribosomal Gene Loci—The Power Behind the Throne

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Ribosomal Gene Loci—The Power Behind the Throne G C A T T A C G G C A T genes Review The Ribosomal Gene Loci—The Power behind the Throne Konstantin I. Panov 1,2, Katherine Hannan 2,3, Ross D. Hannan 2,3,4,5,6 and Nadine Hein 2,* 1 PGJCCR and School of Biological Sciences, Queen’s University, Belfast BT9 5DL, UK; [email protected] 2 ACRF Department of Cancer Biology and Therapeutics, John Curtin School of Medical Research, Australian National University, Acton 2601, Australia; [email protected] (K.H.); [email protected] (R.D.H.) 3 Department of Biochemistry and Molecular Biology, University of Melbourne, Parkville 3010, Australia 4 Oncogenic Signalling and Growth Control Program, Peter MacCallum Cancer Centre, Melbourne 3000, Australia 5 Department of Biochemistry and Molecular Biology, Monash University, Clayton 3800, Australia 6 School of Biomedical Sciences, University of Queensland, St Lucia 4067, Australia * Correspondence: [email protected] Abstract: Nucleoli form around actively transcribed ribosomal RNA (rRNA) genes (rDNA), and the morphology and location of nucleolus-associated genomic domains (NADs) are linked to the RNA Polymerase I (Pol I) transcription status. The number of rDNA repeats (and the proportion of actively transcribed rRNA genes) is variable between cell types, individuals and disease state. Substantial changes in nucleolar morphology and size accompanied by concomitant changes in the Pol I tran- scription rate have long been documented during normal cell cycle progression, development and malignant transformation. This demonstrates how dynamic the nucleolar structure can be. Here, we will discuss how the structure of the rDNA loci, the nucleolus and the rate of Pol I transcription are important for dynamic regulation of global gene expression and genome stability, e.g., through the modulation of long-range genomic interactions with the suppressive NAD environment. These observations support an emerging paradigm whereby the rDNA repeats and the nucleolus play a key Citation: Panov, K.I.; Hannan, K.; regulatory role in cellular homeostasis during normal development as well as disease, independent Hannan, R.D.; Hein, N. The Ribosomal Gene Loci—The Power of their role in determining ribosome capacity and cellular growth rates. behind the Throne. Genes 2021, 12, 763. https://doi.org/10.3390/ Keywords: nucleolus; nucleolar associated domain (NAD); ribosomal genes; RNA polymerase I; genes12050763 transcription; heterochromatin; genome architecture; cell fate; differentiation; cancer Academic Editor: Kumiko Ui-Tei Received: 15 April 2021 1. Nucleoli and the rDNA Genes Accepted: 14 May 2021 Although genetic information is encoded in a linear DNA sequence, the transcription Published: 18 May 2021 of particular genes (or gene clusters) depends on the surrounding chromatin structure and higher-order chromosomal interactions. Eukaryotic chromatin is tightly packed into the Publisher’s Note: MDPI stays neutral nucleus with a portion compressed into subnuclear domains, one of which is the nucleolus. with regard to jurisdictional claims in Nucleoli form around ribosomal RNA (rRNA) genes (rDNA) and dictate the nucleolar published maps and institutional affil- morphology and the positioning of nucleolar-associated chromatin domains (NADs) within iations. the nucleus. rRNA genes were first visualized in yeast in the late 1960s by Miller and Beatty using Miller spreads, which provided structural details of actively transcribed rRNA genes, specifically showing a single rDNA repeat transcribed by a multitude of RNA Polymerase I (Pol I) complexes, which they described as the Christmas tree structure [1]. These Copyright: © 2021 by the authors. preparations further revealed that around 100 Pol I molecules simultaneously transcribe Licensee MDPI, Basel, Switzerland. one gene at a speed of approximately 95 nucleotides/second [2]. In higher eukaryotes, This article is an open access article the presence of histones in the transcribed region is a matter of debate, but it is widely distributed under the terms and accepted that the transcribed region is deprived of fully assembled nucleosomes [2,3], conditions of the Creative Commons which are replaced by upstream binding factor (UBTF). The transcribed 47S precursor Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ rRNA (pre-rRNA) is rapidly processed into the mature 28S, 5.8S and 18S rRNA, which 4.0/). assemble together with the 5S rRNA synthesized by RNA Polymerase III and approximately Genes 2021, 12, 763. https://doi.org/10.3390/genes12050763 https://www.mdpi.com/journal/genes Genes 2021, 12, x FOR PEER REVIEW 2 of 18 which assemble together with the 5S rRNA synthesized by RNA Polymerase III and ap- proximately 79 ribosomal proteins translated from mRNAs transcribed by RNA Polymer- ase II (Pol II) into the 40S and 60S ribosomal subunits. While the process of ribosome bio- Genes 2021, 12, 763 2 of 17 genesis (RiBi) has long been associated with the nucleolus, more recently other essential non-ribosomal cellular functions have been attributed to this nuclear subdomain. The nu- cleolus is now recognized as a plurifunctional hub coordinating the nucleolar surveillance pathway79 ribosomal in response proteins to translatedcellular stress from [4–8], mRNAs a modulator transcribed of bygenome RNA Polymerasearchitecture II[9–11] (Pol II) andinto a phase-separated the 40S and 60S ribosomalcompartment subunits. for protein While quality the process control of [12]. ribosome biogenesis (RiBi) has long been associated with the nucleolus, more recently other essential non-ribosomal 2. cellularCanonical functions and Non-Canonical have been attributed rDNA Repeats to this nuclear subdomain. The nucleolus is now recognized as a plurifunctional hub coordinating the nucleolar surveillance pathway in In humans, the rDNA genes are arranged in a head-to-tail orientation forming repeat response to cellular stress [4–8], a modulator of genome architecture [9–11] and a phase- arrays organized in the nucleolar organizer regions (NOR) at the short arm of the 5 acro- separated compartment for protein quality control [12]. centric chromosomes. The precise organization and exact number of repeats is species, cell2. type Canonical and age and dependent Non-Canonical [13,14]. rDNA Canonica Repeatsl repeats in human cells are 43–45 kb in length and composed of a core and spacer promoter, a transcribed region containing both In humans, the rDNA genes are arranged in a head-to-tail orientation forming repeat a 5′ and 3′ external transcribed spacer region (ETS), two internal transcribed spacer regions arrays organized in the nucleolar organizer regions (NOR) at the short arm of the 5 acro- (ITS) and the 18S, 5.8S and 28S rRNA coding regions, with each individual repeat sepa- centric chromosomes. The precise organization and exact number of repeats is species, cell rated by a non-coding intergenic spacer (IGS; ~30 kb) [15] (Figure 1). In higher eukaryotes, type and age dependent [13,14]. Canonical repeats in human cells are 43–45 kb in length the core promoter dictates transcription of the pre-47S rRNA [16,17], whereas the spacer and composed of a core and spacer promoter, a transcribed region containing both a 50 and promoter [18–21] mediates transcription of non-coding RNAs (see below). Transcription 30 external transcribed spacer region (ETS), two internal transcribed spacer regions (ITS) termination factor 1 (TTF-1) binds to the transcription terminator sites downstream of the and the 18S, 5.8S and 28S rRNA coding regions, with each individual repeat separated 28Sby coding a non-coding region and intergenic blocks Pol spacer I elongation (IGS; ~30 [22–24]. kb) [15 ] (Figure1). In higher eukaryotes, theThe core upstream promoter transcription dictates transcription enhancer ofelements the pre-47S (UTEEs), rRNA also [16, 17known], whereas as the the spacer spacer promoterpromoter enhancer [18–21] mediatesrepeat, are transcription another regulato of non-codingry element RNAs located (see in below).the IGS Transcription[25]. This is thetermination site of the factorformation 1 (TTF-1) of an binds enhancer to the boundary transcription complex terminator formed sites by downstreamCCCTC-binding of the factor28S coding(CTCF) region and cohesion and blocks [24]. Pol I elongation [22–24]. FigureFigure 1. rDNA 1. rDNA gene gene arrays arrays (purple) (purple) are located are located on the onshort the arms short of armsthe human of the acrocentric human acrocentric chro- mosomes.chromosomes. Organization Organization of a single of a singlerDNA rDNAgene: e gene:nhancer, enhancer, upstream upstream control control element element (UCE), (UCE), core core promoterpromoter (CORE), (CORE), 5′/3 50′/3 external0 external transcribed transcribed spacer spacer (ETS), (ETS), 18S, 18S, 5.8S, 5.8S, 28S, 28S, internal internal transcribed transcribed spacer spacer (ITS1/2),(ITS1/2), and and transcription transcription term terminatorinator factor factor 1 (TTF-1) 1 (TTF-1) site. site. UpstreamThe upstream the enhancer transcription boundary enhancer complex elements is flanked (UTEEs), by nucleosomes, also known while as the down- spacer streampromoter various enhancer components repeat, of are the another Pol I basal regulatory transcription element apparatus located inwere the found, IGS [25 includ-]. This is ingthe Pol site I, selectively of the formation factor -1 of (SL-1), an enhancer UBTF, boundaryRRN3, and complex TTF-1. The formed functional by CCCTC-binding significance of factorthese components (CTCF) and cohesionis unclear
Load more

Recommended publications
  • Meiotic Cohesin and Variants Associated with Human Reproductive Aging and Disease
    fcell-09-710033 July 27, 2021 Time: 16:27 # 1 REVIEW published: 02 August 2021 doi: 10.3389/fcell.2021.710033 Meiotic Cohesin and Variants Associated With Human Reproductive Aging and Disease Rachel Beverley1, Meredith L. Snook1 and Miguel Angel Brieño-Enríquez2* 1 Division of Reproductive Endocrinology and Infertility, Department of Obstetrics, Gynecology, and Reproductive Sciences, University of Pittsburgh, Pittsburgh, PA, United States, 2 Magee-Womens Research Institute, Department of Obstetrics, Gynecology, and Reproductive Sciences, University of Pittsburgh, Pittsburgh, PA, United States Successful human reproduction relies on the well-orchestrated development of competent gametes through the process of meiosis. The loading of cohesin, a multi- protein complex, is a key event in the initiation of mammalian meiosis. Establishment of sister chromatid cohesion via cohesin rings is essential for ensuring homologous recombination-mediated DNA repair and future proper chromosome segregation. Cohesin proteins loaded during female fetal life are not replenished over time, and therefore are a potential etiology of age-related aneuploidy in oocytes resulting in Edited by: decreased fecundity and increased infertility and miscarriage rates with advancing Karen Schindler, Rutgers, The State University maternal age. Herein, we provide a brief overview of meiotic cohesin and summarize of New Jersey, United States the human genetic studies which have identified genetic variants of cohesin proteins and Reviewed by: the associated reproductive phenotypes
    [Show full text]
  • Distinct Functions of Human Cohesin-SA1 and Cohesin-SA2 in Double-Strand Break Repair
    Distinct Functions of Human Cohesin-SA1 and Cohesin-SA2 in Double-Strand Break Repair Xiangduo Kong,a Alexander R. Ball, Jr.,a Hoang Xuan Pham,a Weihua Zeng,a* Hsiao-Yuan Chen,a John A. Schmiesing,a Jong-Soo Kim,a* Michael Berns,b,c Kyoko Yokomoria Department of Biological Chemistry, School of Medicine, University of California, Irvine, California, USAa; Beckman Laser Instituteb and Department of Biomedical Engineering, Samueli School of Engineering,c University of California, Irvine, California, USA Cohesin is an essential multiprotein complex that mediates sister chromatid cohesion critical for proper segregation of chromo- somes during cell division. Cohesin is also involved in DNA double-strand break (DSB) repair. In mammalian cells, cohesin is involved in both DSB repair and the damage checkpoint response, although the relationship between these two functions is un- clear. Two cohesins differing by one subunit (SA1 or SA2) are present in somatic cells, but their functional specificities with re- gard to DNA repair remain enigmatic. We found that cohesin-SA2 is the main complex corecruited with the cohesin-loading factor NIPBL to DNA damage sites in an S/G2-phase-specific manner. Replacing the diverged C-terminal region of SA1 with the corresponding region of SA2 confers this activity on SA1. Depletion of SA2 but not SA1 decreased sister chromatid homologous recombination repair and affected repair pathway choice, indicating that DNA repair activity is specifically associated with cohe- sin recruited to damage sites. In contrast, both cohesin complexes function in the intra-S checkpoint, indicating that cell cycle- specific damage site accumulation is not a prerequisite for cohesin’s intra-S checkpoint function.
    [Show full text]
  • DEDD (NM 001039712) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC310813 DEDD (NM_001039712) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: DEDD (NM_001039712) Human Untagged Clone Tag: Tag Free Symbol: DEDD Synonyms: CASP8IP1; DEDD1; DEFT; FLDED1; KE05 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_001039712, the custom clone sequence may differ by one or more nucleotides ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTGT ACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCTTT CCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTGGCA CTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATCACTC GCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGACAAGTA TCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCTCCCCAG CCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATGTGTAGCA AGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACACCAGATCC CAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAGACTGCTCTG CAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAACCAGGCCAACA CCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTCACCTACCTCGA TGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTCATCACAGACTCC CTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAGGACTATGAGCTGG
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
    [CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors.
    [Show full text]
  • Rabbit Anti-TAF1C/FITC Conjugated Antibody
    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-TAF1C/FITC Conjugated antibody SL24053R-FITC Product Name: Anti-TAF1C/FITC Chinese Name: FITC标记的TATA盒Binding protein相关因子TAF1C抗体 RNA polymerase I-specific TBP-associated factor 110 kDa; SL1; Taf1c; TAF1C_MOUSE; TAFI110; TAFI95; TATA box binding protein associated factor 1C; TATA box-binding protein-associated factor 1C; TATA box-binding protein-associated Alias: factor RNA polymerase I subunit C; TBP associated factor 1C; TBP associated factor RNA polymerase I 95 kDa; TBP associated factor, RNA polymerase I, 110-KD; TBP- associated factor 1C; Transcription initiation factor SL1/TIF-IB subunit C. Organism Species: Rabbit Clonality: Polyclonal React Species: ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 95kDa Form: Lyophilized or Liquid Concentration: 2mg/1ml immunogen: KLHwww.sunlongbiotech.com conjugated synthetic peptide derived from mouse TAF1C Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: Initiation of transcription by RNA polymerase I requires the formation of a complex Product Detail: composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I.
    [Show full text]
  • Cohesin Architecture and Clustering in Vivo Siheng Xiang, Douglas Koshland*
    RESEARCH ARTICLE Cohesin architecture and clustering in vivo Siheng Xiang, Douglas Koshland* Department of Molecular and Cell Biology, University of California, Berkeley, Berkeley, United States Abstract Cohesin helps mediate sister chromatid cohesion, chromosome condensation, DNA repair, and transcription regulation. We exploited proximity-dependent labeling to define the in vivo interactions of cohesin domains with DNA or with other cohesin domains that lie within the same or in different cohesin complexes. Our results suggest that both cohesin’s head and hinge domains are proximal to DNA, and cohesin structure is dynamic with differential folding of its coiled coil regions to generate butterfly confirmations. This method also reveals that cohesins form ordered clusters on and off DNA. The levels of cohesin clusters and their distribution on chromosomes are cell cycle-regulated. Cohesin clustering is likely necessary for cohesion maintenance because clustering and maintenance uniquely require the same subset of cohesin domains and the auxiliary cohesin factor Pds5p. These conclusions provide important new mechanistic and biological insights into the architecture of the cohesin complex, cohesin–cohesin interactions, and cohesin’s tethering and loop-extruding activities. Introduction Chromosome segregation, DNA damage repair, and the regulation of gene expression require the tethering or folding of chromosomes (Uhlmann, 2016; Onn et al., 2008). Remarkably, these differ- ent types of chromosome organizations are all mediated by a conserved family of protein complexes *For correspondence: [email protected] called structural maintenance of chromosomes (SMC) (Onn et al., 2008; Nolivos and Sherratt, 2014; Hirano, 2016; Hassler et al., 2018). SMC complexes tether and fold chromosomes by two Competing interests: The activities.
    [Show full text]
  • Bidirectional Cooperation Between Ubtf1 and SL1 Determines RNA Polymerase I Promoter
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.07.447350; this version posted June 7, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Bidirectional cooperation between Ubtf1 and SL1 determines RNA Polymerase I promoter 2 recognition in cell and is negatively affected in the UBTF-E210K neuroregression syndrome. 3 4 Michel G. Tremblay1, Dany S. Sibai1,2, Melissa Valère1,2, Jean-Clément Mars1,2,+, Frédéric Lessard1, 5 Roderick T. Hori3, Mohammad M. Khan4, Victor Y. Stefanovsky1, Mark S. Ledoux5 and Tom Moss1,2*. 6 7 1Laboratory of Growth and Development, St-Patrick Research Group in Basic Oncology, Cancer 8 Division of the Quebec University Hospital Research Centre, Québec, Canada. 2Department of 9 Molecular Biology, Medical Biochemistry and Pathology, Faculty of Medicine, Laval University, 10 Québec, Canada. 3Departments of Microbiology, Immunology and Biochemistry and 4Departments of 11 Neurology and Anatomy & Neurobiology, University of Tennessee Health Science Center, Memphis, 12 TN, USA. 5Department of Psychology, University of Memphis, Memphis TN and Veracity 13 Neuroscience LLC, Memphis, TN 14 15 +Present address, IRIC, Université de Montréal, Montréal, Québec, Canada 16 17 Correspondence should be addressed to; 18 Tom Moss, PhD, 19 Edifice St Patrick, 9 rue McMahon, Québec, QC, G1R 3S3, Canada. 20 E-mail. [email protected] 21 Tel. 1 418 691 5281 22 FAX 1 418 691 5439 23 24 Short title: Ubtf1-SL1 cooperation and the Ubtf-E210K syndrome.
    [Show full text]
  • Cross-Cohort Analysis Identifies a TEAD4– MYCN Positive Feedback Loop As the Core Regulatory Element of High-Risk Neuroblastoma
    Cross-Cohort Analysis Identifies a TEAD4– MYCN Positive Feedback Loop as the Core Regulatory Element of High-Risk Neuroblastoma The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Rajbhandari, Presha et al. “Cross-Cohort Analysis Identifies a TEAD4–MYCN Positive Feedback Loop as the Core Regulatory Element of High-Risk Neuroblastoma.” Cancer Discovery 8, 5 (March 2018): 582–599 © 2018 AACR As Published http://dx.doi.org/10.1158/2159-8290.CD-16-0861 Publisher American Association for Cancer Research Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/117503 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike Detailed Terms http://creativecommons.org/licenses/by-nc-sa/4.0/ HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cancer Manuscript Author Discov. Author manuscript; Manuscript Author available in PMC 2018 August 01. Published in final edited form as: Cancer Discov. 2018 May ; 8(5): 582–599. doi:10.1158/2159-8290.CD-16-0861. Cross-cohort analysis identifies a TEAD4 ↔ MYCN positive- feedback loop as the core regulatory element of high-risk neuroblastoma Presha Rajbhandari1,2,$, Gonzalo Lopez1,3,$, Claudia Capdevila1, Beatrice Salvatori1, Jiyang Yu1,#, Ruth Rodriguez-Barrueco4,5, Daniel Martinez3, Mark Yarmarkovich3, Nina Weichert-Leahey6, Brian J. Abraham7, Mariano J Alvarez1, Archana Iyer1, Jo Lynne Harenza3, Derek Oldridge3, Katleen De Preter8, Jan Koster9, Shahab Asgharzadeh10,11, Robert
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Shaping of the 3D Genome by the Atpase Machine Cohesin Yoori Kim1 and Hongtao Yu1,2
    Kim and Yu Experimental & Molecular Medicine (2020) 52:1891–1897 https://doi.org/10.1038/s12276-020-00526-2 Experimental & Molecular Medicine REVIEW ARTICLE Open Access Shaping of the 3D genome by the ATPase machine cohesin Yoori Kim1 and Hongtao Yu1,2 Abstract The spatial organization of the genome is critical for fundamental biological processes, including transcription, genome replication, and segregation. Chromatin is compacted and organized with defined patterns and proper dynamics during the cell cycle. Aided by direct visualization and indirect genome reconstruction tools, recent discoveries have advanced our understanding of how interphase chromatin is dynamically folded at the molecular level. Here, we review the current understanding of interphase genome organization with a focus on the major regulator of genome structure, the cohesin complex. We further discuss how cohesin harnesses the energy of ATP hydrolysis to shape the genome by extruding chromatin loops. Introduction dynamic and preferentially form at certain genomic loci to The diploid human genome contains 46 chromosomes regulate gene expression and other DNA transactions. In and 6 billion nucleotides of DNA that, when fully exten- this article, we review our current understanding of the ded, span a length of over 2 m. The genomic DNA has to local and global landscapes of interphase chromatin and fi 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; be folded and con ned in the nucleus, which has a discuss how cohesin structures chromatin. dimension of ~10 μm. The compaction of genomic DNA also needs to be dynamic and orderly to allow myriad Local folding of interphase chromatin biochemical reactions that occur on the DNA template, Until recently, the dominant hypothesis for genome including DNA replication and repair, homologous packaging was the hierarchical folding model.
    [Show full text]