Delineating the Heterogeneity of Matrix-Directed Differentiation Toward Soft and Stiff Tissue Lineages Via Single-Cell Profiling
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
ICRS Heritage Summit 1
ICRS Heritage Summit 1 20th Anniversary www.cartilage.org of the ICRS ICRS Heritage Summit June 29 – July 01, 2017 Gothia Towers, Gothenburg, Sweden Final Programme & Abstract Book #ICRSSUMMIT www.cartilage.org Picture Copyright: Zürich Tourismus 2 The one-step procedure for the treatment of chondral and osteochondral lesions Aesculap Biologics Facing a New Frontier in Cartilage Repair Visit Anika at Booth #16 Easy and fast to be applied via arthroscopy. Fixation is not required in most cases. The only entirely hyaluronic acid-based scaffold supporting hyaline-like cartilage regeneration Biologic approaches to tissue repair and regeneration represent the future in healthcare worldwide. Available Sizes Aesculap Biologics is leading the way. 2x2 cm Learn more at www.aesculapbiologics.com 5x5 cm NEW SIZE Aesculap Biologics, LLC | 866-229-3002 | www.aesculapusa.com Aesculap Biologics, LLC - a B. Braun company Website: http://hyalofast.anikatherapeutics.com E-mail: [email protected] Telephone: +39 (0)49 295 8324 ICRS Heritage Summit 3 The one-step procedure for the treatment of chondral and osteochondral lesions Visit Anika at Booth #16 Easy and fast to be applied via arthroscopy. Fixation is not required in most cases. The only entirely hyaluronic acid-based scaffold supporting hyaline-like cartilage regeneration Available Sizes 2x2 cm 5x5 cm NEW SIZE Website: http://hyalofast.anikatherapeutics.com E-mail: [email protected] Telephone: +39 (0)49 295 8324 4 Level 1 Study Proves Efficacy of ACP in -
Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients with Hypertrophic and Dilated Cardiomyopathy
Physiol. Res. 61: 169-175, 2012 https://doi.org/10.33549/physiolres.932157 Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients With Hypertrophic and Dilated Cardiomyopathy M. JÁCHYMOVÁ1, A. MURAVSKÁ1, T. PALEČEK2, P. KUCHYNKA2, H. ŘEHÁKOVÁ1, S. MAGAGE2, A. KRÁL2, T. ZIMA1, K. HORKÝ2, A. LINHART2 1Institute of Clinical Chemistry and Laboratory Diagnostics, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic, 2Second Department of Internal Medicine – Clinical Department of Cardiology and Angiology, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic Received February 1, 2011 Accepted October 17, 2011 On-line January 31, 2012 Summary Introduction Mutations in troponin T (TNNT2) gene represent the important part of currently identified disease-causing mutations in Cardiomyopathies are generally defined as hypertrophic (HCM) and dilated (DCM) cardiomyopathy. The aim myocardial disorders in which the heart muscle is of this study was to analyze TNNT2 gene exons in patients with structurally and functionally abnormal, in the absence of HCM and DCM diagnosis to improve diagnostic and genetic coronary artery disease, hypertension, valvular disease consultancy in affected families. All 15 exons and their flanking and congenital heart disease sufficient to cause the regions of the TNNT2 gene were analyzed by DNA sequence observed myocardial abnormality (Elliott et al. 2008). analysis in 174 patients with HCM and DCM diagnosis. We According to the morphological and functional phenotype identified genetic variations in TNNT2 exon regions in 56 patients the diagnosis of hypertrophic and dilated cardiomyopathy and genetic variations in TNNT2 intron regions in 164 patients. -
Defining Osteoblast and Adipocyte Lineages in the Bone Marrow
Bone 118 (2019) 2–7 Contents lists available at ScienceDirect Bone journal homepage: www.elsevier.com/locate/bone Full Length Article Defining osteoblast and adipocyte lineages in the bone marrow T ⁎ J.L. Piercea, D.L. Begunb, J.J. Westendorfb,c, M.E. McGee-Lawrencea,d, a Department of Cellular Biology and Anatomy, Medical College of Georgia, Augusta University, Augusta, GA, USA b Department of Orthopedic Surgery, Mayo Clinic, Rochester, MN, USA c Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, MN, USA d Department of Orthopaedic Surgery, Augusta University, Augusta, GA, USA ARTICLE INFO ABSTRACT Keywords: Bone is a complex endocrine organ that facilitates structural support, protection to vital organs, sites for he- Bone marrow mesenchymal/stromal cell matopoiesis, and calcium homeostasis. The bone marrow microenvironment is a heterogeneous niche consisting Osteogenesis of multipotent musculoskeletal and hematopoietic progenitors and their derivative terminal cell types. Amongst Osteoblast these progenitors, bone marrow mesenchymal stem/stromal cells (BMSCs) may differentiate into osteogenic, Adipogenesis adipogenic, myogenic, and chondrogenic lineages to support musculoskeletal development as well as tissue Adipocyte homeostasis, regeneration and repair during adulthood. With age, the commitment of BMSCs to osteogenesis Marrow fat Aging slows, bone formation decreases, fracture risk rises, and marrow adiposity increases. An unresolved question is whether osteogenesis and adipogenesis are co-regulated in the bone marrow. Osteogenesis and adipogenesis are controlled by specific signaling mechanisms, circulating cytokines, and transcription factors such as Runx2 and Pparγ, respectively. One hypothesis is that adipogenesis is the default pathway if osteogenic stimuli are absent. However, recent work revealed that Runx2 and Osx1-expressing preosteoblasts form lipid droplets under pa- thological and aging conditions. -
Defining Functional Interactions During Biogenesis of Epithelial Junctions
ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. -
Cardiomyopathy
UNIVERSITY OF MINNESOTA PHYSICIANS OUTREACH LABS Submit this form along with the appropriate MOLECULAR DIAGNOSTICS (612) 273-8445 Molecular requisition (Molecular Diagnostics or DATE: TIME COLLECTED: PCU/CLINIC: Molecular NGS Oncology). AM PM PATIENT IDENTIFICATION DIAGNOSIS (Dx) / DIAGNOSIS CODES (ICD-9) - OUTPATIENTS ONLY SPECIMEN TYPE: o Blood (1) (2) (3) (4) PLEASE COLLECT 5-10CC IN ACD-A OR EDTA TUBE ORDERING PHYSICIAN NAME AND PHONE NUMBER: Tests can be ordered as a full panel, or by individual gene(s). Please contact the genetic counselor with any questions at 612-624-8948 or by pager at 612-899-3291. _______________________________________________ Test Ordered- EPIC: Next generation sequencing(Next Gen) Sunquest: NGS Brugada syndrome DMD Aortopathy Full panel DNAJC19 SCN5A DSP Full panel GPD1L Cardiomyopathy, familial MYH11 CACNA1C hypertrophic ACTA2 SCN1B Full panel MYLK KCNE3 ANKRD1 FBN2 SCN3B JPH2 SLC2A10 HCN4 PRKAG2 COL5A2 MYH7 COL5A1 MYL2 COL3A1 Cardiomyopathy ACTC1 CBS Cardiomyopathy, dilated CSRP3 SMAD3 Full panel TNNC1 TGFBR1 LDB3 MYH6 TGFBR2 LMNA VCL FBN1 ACTN2 MYOZ2 Arrhythmogenic right ventricular DSG2 PLN dysplasia NEXN CALR3 TNNT2 TNNT2 NEXN Full panel RBM20 TPM1 TGFB3 SCN5A MYBPC3 DSG2 MYH6 TNNI3 DSC2 TNNI3 MYL3 JUP TTN TTN RYR2 BAG3 MYLK2 TMEM43 DES Cardiomyopathy, familial DSP CRYAB EYA4 restrictive PKP2 Full panel Atrial fibrillation LAMA4 MYPN TNNI3 SGCD MYPN TNNT2 Full panel CSRP3 SCN5A MYBPC3 GJA5 TCAP ABCC9 ABCC9 SCN1B PLN SCN2B ACTC1 KCNQ1 MYH7 KCNE2 TMPO NPPA VCL NPPA TPM1 KCNA5 TNNC1 KCNJ2 GATAD1 4/1/2014 -
Ex Vivo Systems to Study Chondrogenic Differentiation and Cartilage Integration
Journal of Functional Morphology and Kinesiology Review Ex Vivo Systems to Study Chondrogenic Differentiation and Cartilage Integration Graziana Monaco 1,2, Alicia J. El Haj 2,3, Mauro Alini 1 and Martin J. Stoddart 1,2,* 1 AO Research Institute Davos, Clavadelerstrasse 8, CH-7270 Davos Platz, Switzerland; [email protected] (G.M.); [email protected] (M.A.) 2 School of Pharmacy & Bioengineering Research, University of Keele, Keele ST5 5BG, UK; [email protected] 3 Healthcare Technology Institute, Translational Medicine, School of Chemical Engineering, University of Birmingham, Birmingham B15 2TH, UK * Correspondence: [email protected]; Tel.: +41-81-414-2448 Abstract: Articular cartilage injury and repair is an issue of growing importance. Although common, defects of articular cartilage present a unique clinical challenge due to its poor self-healing capacity, which is largely due to its avascular nature. There is a critical need to better study and understand cellular healing mechanisms to achieve more effective therapies for cartilage regeneration. This article aims to describe the key features of cartilage which is being modelled using tissue engineered cartilage constructs and ex vivo systems. These models have been used to investigate chondrogenic differentiation and to study the mechanisms of cartilage integration into the surrounding tissue. The review highlights the key regeneration principles of articular cartilage repair in healthy and diseased joints. Using co-culture models and novel bioreactor designs, the basis of regeneration is aligned with recent efforts for optimal therapeutic interventions. Keywords: bioreactors; osteochondral; integration; tissue engineering Citation: Monaco, G.; El Haj, A.J.; Alini, M.; Stoddart, M.J. -
Sarcomere Gene Variants Act As a Genetic Trigger Underlying the Development of Left Ventricular Noncompaction
www.nature.com/pr BASIC SCIENCE ARTICLE Sarcomere gene variants act as a genetic trigger underlying the development of left ventricular noncompaction Asami Takasaki1, Keiichi Hirono1, Yukiko Hata2, Ce Wang1,3, Masafumi Takeda4, Jun K Yamashita4, Bo Chang1, Hideyuki Nakaoka1, Mako Okabe1, Nariaki Miyao1, Kazuyoshi Saito1, Keijiro Ibuki1, Sayaka Ozawa1, Michikazu Sekine5, Naoki Yoshimura6, Naoki Nishida2, Neil E. Bowles7 and Fukiko Ichida1 BACKGROUND: Left ventricular noncompaction (LVNC) is a primary cardiomyopathy with heterogeneous genetic origins. The aim of this study was to elucidate the role of sarcomere gene variants in the pathogenesis and prognosis of LVNC. METHODS AND RESULTS: We screened 82 Japanese patients (0–35 years old), with a diagnosis of LVNC, for mutations in seven genes encoding sarcomere proteins, by direct DNA sequencing. We identified variants in a significant proportion of cases (27%), which were associated with poor prognosis (p = 0.012), particularly variants in TPM1, TNNC1, and ACTC1 (p = 0.012). To elucidate the pathological role, we developed and studied human-induced pluripotent stem cells (hiPSCs) from a patient carrying a TPM1 p. Arg178His mutation, who underwent heart transplantation. These cells displayed pathological changes, with mislocalization of tropomyosin 1, causing disruption of the sarcomere structure in cardiomyocytes, and impaired calcium handling. Microarray analysis indicated that the TPM1 mutation resulted in the down-regulation of the expression of numerous genes involved in heart development, and positive regulation of cellular process, especially the calcium signaling pathway. CONCLUSIONS: Sarcomere genes are implicated as genetic triggers in the development of LVNC, regulating the expression of numerous genes involved in heart development, or modifying the severity of disease. -
Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals
animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W. -
Supplemental Material and Methods Expression Plasmids, Sirna, Cell
Supplemental Material and Methods Expression Plasmids, siRNA, Cell culture and reagents. The full-length human SETD2 cDNA was cloned into pMSCV-puro/neo to generate SETD2 expression plasmids. SETD2 shRNA sequences are CCGGTGATAGCCATGATAGTATTAACTCGAGTTAATACTATCATGGCTA TCATTTTTG; CCGGCAGGGAGAACAGGCGTAATAACTCGAGTTATTACGCCTGTTC TCCCTGTTTTTG. SSO with 2’-O-methoxyethyl (MOE)-phosphorothioate modification was targeted to the 3’-splice site of intron 2 in DVL2 pre-mRNA. SSO sequence is CACCCUUCUAGCUGGUGUCCUC. HCT116, DLD1, RKO and 293T cells were obtained from ATCC and cultured in DMEM with 10% fetal bovine serum. Cells were transfected with siRNA duplexes (60 nM) or Antisense Oligonucleotide (60 nM) by using Lipofectamine 2000 (Invitrogen) or Dharmacon Transfection (Dharmacon) reagents according to manufacturer’s instructions. To establish the individual stable cells, retrovirus/lentivirus was used. Cell proliferation assay was performed using CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT) kit (Promega) based on the manufacturer’s instructions. Standard 24-well Boyden invasion chambers (BD Biosciences) were used to assess cell migration abilities following the manufacturer’s suggestions. For oncosphere formation assay, cells were suspended in serum-free DMEM-F12 medium containing N-2 Plus Media Supplement (Life Technologies), B-27 Supplement (Life Technologies), 20 ng/ml EGF (PeproTech) and 10 ng/ml FGF (PeproTech) in ultra-low attachment 96-well plate to support growth of oncospheres. Colonies were scored and documented by photomicroscopy 1 week after preparations. For soft-agar colony formation assay, cells were suspended in DMEM containing 0.35% low-melting agar (Invitrogen) and 10% FBS and seeded onto a coating of 0.7% low-melting agar in DMEM containing 10% FBS. Plates were incubated at 37 °C and 5% CO2 and colonies were scored 3 weeks after preparations. -
Sarcomeres Regulate Murine Cardiomyocyte Maturation Through MRTF-SRF Signaling
Sarcomeres regulate murine cardiomyocyte maturation through MRTF-SRF signaling Yuxuan Guoa,1,2,3, Yangpo Caoa,1, Blake D. Jardina,1, Isha Sethia,b, Qing Maa, Behzad Moghadaszadehc, Emily C. Troianoc, Neil Mazumdara, Michael A. Trembleya, Eric M. Smalld, Guo-Cheng Yuanb, Alan H. Beggsc, and William T. Pua,e,2 aDepartment of Cardiology, Boston Children’s Hospital, Boston, MA 02115; bDepartment of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, MA 02215; cDivision of Genetics and Genomics, The Manton Center for Orphan Disease Research, Boston Children’s Hospital and Harvard Medical School, Boston, MA 02115; dAab Cardiovascular Research Institute, Department of Medicine, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642; and eHarvard Stem Cell Institute, Harvard University, Cambridge, MA 02138 Edited by Janet Rossant, The Gairdner Foundation, Toronto, ON, Canada, and approved November 24, 2020 (received for review May 6, 2020) The paucity of knowledge about cardiomyocyte maturation is a Mechanisms that orchestrate ultrastructural and transcrip- major bottleneck in cardiac regenerative medicine. In develop- tional changes in cardiomyocyte maturation are beginning to ment, cardiomyocyte maturation is characterized by orchestrated emerge. Serum response factor (SRF) is a transcription factor that structural, transcriptional, and functional specializations that occur is essential for cardiomyocyte maturation (3). SRF directly acti- mainly at the perinatal stage. Sarcomeres are the key cytoskeletal vates key genes regulating sarcomere assembly, electrophysiology, structures that regulate the ultrastructural maturation of other and mitochondrial metabolism. This transcriptional regulation organelles, but whether sarcomeres modulate the signal trans- subsequently drives the proper morphogenesis of mature ultra- duction pathways that are essential for cardiomyocyte maturation structural features of myofibrils, T-tubules, and mitochondria. -
Nomina Histologica Veterinaria, First Edition
NOMINA HISTOLOGICA VETERINARIA Submitted by the International Committee on Veterinary Histological Nomenclature (ICVHN) to the World Association of Veterinary Anatomists Published on the website of the World Association of Veterinary Anatomists www.wava-amav.org 2017 CONTENTS Introduction i Principles of term construction in N.H.V. iii Cytologia – Cytology 1 Textus epithelialis – Epithelial tissue 10 Textus connectivus – Connective tissue 13 Sanguis et Lympha – Blood and Lymph 17 Textus muscularis – Muscle tissue 19 Textus nervosus – Nerve tissue 20 Splanchnologia – Viscera 23 Systema digestorium – Digestive system 24 Systema respiratorium – Respiratory system 32 Systema urinarium – Urinary system 35 Organa genitalia masculina – Male genital system 38 Organa genitalia feminina – Female genital system 42 Systema endocrinum – Endocrine system 45 Systema cardiovasculare et lymphaticum [Angiologia] – Cardiovascular and lymphatic system 47 Systema nervosum – Nervous system 52 Receptores sensorii et Organa sensuum – Sensory receptors and Sense organs 58 Integumentum – Integument 64 INTRODUCTION The preparations leading to the publication of the present first edition of the Nomina Histologica Veterinaria has a long history spanning more than 50 years. Under the auspices of the World Association of Veterinary Anatomists (W.A.V.A.), the International Committee on Veterinary Anatomical Nomenclature (I.C.V.A.N.) appointed in Giessen, 1965, a Subcommittee on Histology and Embryology which started a working relation with the Subcommittee on Histology of the former International Anatomical Nomenclature Committee. In Mexico City, 1971, this Subcommittee presented a document entitled Nomina Histologica Veterinaria: A Working Draft as a basis for the continued work of the newly-appointed Subcommittee on Histological Nomenclature. This resulted in the editing of the Nomina Histologica Veterinaria: A Working Draft II (Toulouse, 1974), followed by preparations for publication of a Nomina Histologica Veterinaria. -
Snapshot: Actin Regulators II Anosha D
SnapShot: Actin Regulators II Anosha D. Siripala and Matthew D. Welch Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720, USA Representative Proteins Protein Family H. sapiens D. melanogaster C. elegans A. thaliana S. cerevisiae Endocytosis and Exocytosis ABP1/drebrin mABP1, drebrin, drebrin- †Q95RN0 †Q9XUT0 Abp1 like EPS15 EPS15 Eps-15 EHS-1 †Q56WL2 Pan1 HIP1R HIP1R †Q8MQK1 †O62142 Sla2 Synapsin synapsin Ia, Ib, IIa, IIb, III Synapsin SNN-1 Plasma Membrane Association Anillin anillin Scraps ANI-1, 2, 3 Annexins annexin A1–11, 13 (actin Annexin B9-11 NEX-1–4 ANN1-8 binding: 1, 2, 6) ERM proteins ezrin, radixin, moesin DMoesin ERM-1 MARCKS MARCKS, MRP/ Akap200 MACMARCKS/F52 Merlin *merlin/NF2 Merlin NFM-1 Protein 4.1 4.1R, G, N, B Coracle Spectrin α-spectrin (1–2), β-spectrin α-spectrin, β-spectrin, β heavy- SPC-1 (α-spectrin), UNC-70 (1–4), β heavy-spectrin/ spectrin/Karst (β-spectrin), SMA-1 (β heavy- karst spectrin) Identifi ed Cellular Role: X Membrane traffi cking and phagocytosis Cell-Cell Junctions X Cytokinesis α-catenin α-catenin 1–3 α-catenin HMP-1 X Cell surface organization and dynamics X Cell adhesion Afadin afadin/AF6 Canoe AFD-1 X Multiple functions ZO-1 ZO-1, ZO-2, ZO-3 ZO-1/Polychaetoid †Q56VX4 X Other/unknown Cell-Extracellular Matrix Junctions †UNIPROT database accession number *Mutation linked to human disease Dystrophin/utrophin *dystrophin, utrophin/ Dystrophin DYS-1 DRP1, DRP2 LASP LASP-1, LASP-2, LIM- Lasp †P34416 nebulette Palladin palladin Parvin α-, β-, χ-parvin †Q9VWD0 PAT-6