Cell-Cycle Regulation of Formin-Mediated Actin Cable Assembly
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients with Hypertrophic and Dilated Cardiomyopathy
Physiol. Res. 61: 169-175, 2012 https://doi.org/10.33549/physiolres.932157 Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients With Hypertrophic and Dilated Cardiomyopathy M. JÁCHYMOVÁ1, A. MURAVSKÁ1, T. PALEČEK2, P. KUCHYNKA2, H. ŘEHÁKOVÁ1, S. MAGAGE2, A. KRÁL2, T. ZIMA1, K. HORKÝ2, A. LINHART2 1Institute of Clinical Chemistry and Laboratory Diagnostics, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic, 2Second Department of Internal Medicine – Clinical Department of Cardiology and Angiology, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic Received February 1, 2011 Accepted October 17, 2011 On-line January 31, 2012 Summary Introduction Mutations in troponin T (TNNT2) gene represent the important part of currently identified disease-causing mutations in Cardiomyopathies are generally defined as hypertrophic (HCM) and dilated (DCM) cardiomyopathy. The aim myocardial disorders in which the heart muscle is of this study was to analyze TNNT2 gene exons in patients with structurally and functionally abnormal, in the absence of HCM and DCM diagnosis to improve diagnostic and genetic coronary artery disease, hypertension, valvular disease consultancy in affected families. All 15 exons and their flanking and congenital heart disease sufficient to cause the regions of the TNNT2 gene were analyzed by DNA sequence observed myocardial abnormality (Elliott et al. 2008). analysis in 174 patients with HCM and DCM diagnosis. We According to the morphological and functional phenotype identified genetic variations in TNNT2 exon regions in 56 patients the diagnosis of hypertrophic and dilated cardiomyopathy and genetic variations in TNNT2 intron regions in 164 patients. -
Analysis of Gene Expression Data for Gene Ontology
ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins. -
Annexina7 and CAP1 Are Associated with Regulating Tumor Cell Adhesion Molecule Expression and Biological Behavior
AnnexinA7 and CAP1 are associated with regulating tumor cell adhesion molecule expression and biological behavior Type Research paper Keywords hepatocellular carcinoma, adhesion molecule, AnnexinA7, CAP1, Biological behaviors Abstract Introduction To find out the correlations between the effects of down-regulating AnnexinA7 and CAP1 gene on cell adhesion factors and the biological behavior of Hca-p cells cells, and finally infer the relationship between the two genes. Material and methods Western blot ,qRT-PCR,immunocytochemistry, CCK8 cell proliferation, flow cytometry, lymph node adhesion and transwell chamber assay testing . Results AnnexinA7 and CAP1 were consistent with the regulation of the expression of the adhesion molecules such as FAK, Src, Paxillin and E-cadherin. At the mRNA and protein levels, the expression of FAK, Src and Paxillin were increased with down-regulated AnnexinA7 and CAP1 genes, while E-cadherin was down-regulated in the change of these two genes. And the low expression of AnnexinA7 could affect the expression of CAP1 in mRNA and protein levels. otherwise, the localization of AnnexinA7 and CAP1 in hepatocellular carcinoma cells was also the same. After down-regulating the expression of CAP1, the functions of proliferation, lymph node adhesion and invasion were increased and earlyPreprint apoptotic ability was decreased in Hca-P cells. Conclusions AnnexinA7 and CAP1 could control the expression of these adhesion molecules in the same trend. We speculated they may be co-localization. And AnnexinA7 gene may be related to the molecular mechanism of CAP1 gene, which is likely to have a consistent effect on cell adhesion molecules and be closely related to the biological behaviors of Hca-P cells.AnnexinA7 and CAP1 may play an inhibitory role in lymph node metastasis to provide a reliable basis for the early identification of lymphatic metastasis in hepatocellular carcinoma. -
Defining Functional Interactions During Biogenesis of Epithelial Junctions
ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. -
Cardiomyopathy
UNIVERSITY OF MINNESOTA PHYSICIANS OUTREACH LABS Submit this form along with the appropriate MOLECULAR DIAGNOSTICS (612) 273-8445 Molecular requisition (Molecular Diagnostics or DATE: TIME COLLECTED: PCU/CLINIC: Molecular NGS Oncology). AM PM PATIENT IDENTIFICATION DIAGNOSIS (Dx) / DIAGNOSIS CODES (ICD-9) - OUTPATIENTS ONLY SPECIMEN TYPE: o Blood (1) (2) (3) (4) PLEASE COLLECT 5-10CC IN ACD-A OR EDTA TUBE ORDERING PHYSICIAN NAME AND PHONE NUMBER: Tests can be ordered as a full panel, or by individual gene(s). Please contact the genetic counselor with any questions at 612-624-8948 or by pager at 612-899-3291. _______________________________________________ Test Ordered- EPIC: Next generation sequencing(Next Gen) Sunquest: NGS Brugada syndrome DMD Aortopathy Full panel DNAJC19 SCN5A DSP Full panel GPD1L Cardiomyopathy, familial MYH11 CACNA1C hypertrophic ACTA2 SCN1B Full panel MYLK KCNE3 ANKRD1 FBN2 SCN3B JPH2 SLC2A10 HCN4 PRKAG2 COL5A2 MYH7 COL5A1 MYL2 COL3A1 Cardiomyopathy ACTC1 CBS Cardiomyopathy, dilated CSRP3 SMAD3 Full panel TNNC1 TGFBR1 LDB3 MYH6 TGFBR2 LMNA VCL FBN1 ACTN2 MYOZ2 Arrhythmogenic right ventricular DSG2 PLN dysplasia NEXN CALR3 TNNT2 TNNT2 NEXN Full panel RBM20 TPM1 TGFB3 SCN5A MYBPC3 DSG2 MYH6 TNNI3 DSC2 TNNI3 MYL3 JUP TTN TTN RYR2 BAG3 MYLK2 TMEM43 DES Cardiomyopathy, familial DSP CRYAB EYA4 restrictive PKP2 Full panel Atrial fibrillation LAMA4 MYPN TNNI3 SGCD MYPN TNNT2 Full panel CSRP3 SCN5A MYBPC3 GJA5 TCAP ABCC9 ABCC9 SCN1B PLN SCN2B ACTC1 KCNQ1 MYH7 KCNE2 TMPO NPPA VCL NPPA TPM1 KCNA5 TNNC1 KCNJ2 GATAD1 4/1/2014 -
Sarcomere Gene Variants Act As a Genetic Trigger Underlying the Development of Left Ventricular Noncompaction
www.nature.com/pr BASIC SCIENCE ARTICLE Sarcomere gene variants act as a genetic trigger underlying the development of left ventricular noncompaction Asami Takasaki1, Keiichi Hirono1, Yukiko Hata2, Ce Wang1,3, Masafumi Takeda4, Jun K Yamashita4, Bo Chang1, Hideyuki Nakaoka1, Mako Okabe1, Nariaki Miyao1, Kazuyoshi Saito1, Keijiro Ibuki1, Sayaka Ozawa1, Michikazu Sekine5, Naoki Yoshimura6, Naoki Nishida2, Neil E. Bowles7 and Fukiko Ichida1 BACKGROUND: Left ventricular noncompaction (LVNC) is a primary cardiomyopathy with heterogeneous genetic origins. The aim of this study was to elucidate the role of sarcomere gene variants in the pathogenesis and prognosis of LVNC. METHODS AND RESULTS: We screened 82 Japanese patients (0–35 years old), with a diagnosis of LVNC, for mutations in seven genes encoding sarcomere proteins, by direct DNA sequencing. We identified variants in a significant proportion of cases (27%), which were associated with poor prognosis (p = 0.012), particularly variants in TPM1, TNNC1, and ACTC1 (p = 0.012). To elucidate the pathological role, we developed and studied human-induced pluripotent stem cells (hiPSCs) from a patient carrying a TPM1 p. Arg178His mutation, who underwent heart transplantation. These cells displayed pathological changes, with mislocalization of tropomyosin 1, causing disruption of the sarcomere structure in cardiomyocytes, and impaired calcium handling. Microarray analysis indicated that the TPM1 mutation resulted in the down-regulation of the expression of numerous genes involved in heart development, and positive regulation of cellular process, especially the calcium signaling pathway. CONCLUSIONS: Sarcomere genes are implicated as genetic triggers in the development of LVNC, regulating the expression of numerous genes involved in heart development, or modifying the severity of disease. -
Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals
animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W. -
Supplemental Material and Methods Expression Plasmids, Sirna, Cell
Supplemental Material and Methods Expression Plasmids, siRNA, Cell culture and reagents. The full-length human SETD2 cDNA was cloned into pMSCV-puro/neo to generate SETD2 expression plasmids. SETD2 shRNA sequences are CCGGTGATAGCCATGATAGTATTAACTCGAGTTAATACTATCATGGCTA TCATTTTTG; CCGGCAGGGAGAACAGGCGTAATAACTCGAGTTATTACGCCTGTTC TCCCTGTTTTTG. SSO with 2’-O-methoxyethyl (MOE)-phosphorothioate modification was targeted to the 3’-splice site of intron 2 in DVL2 pre-mRNA. SSO sequence is CACCCUUCUAGCUGGUGUCCUC. HCT116, DLD1, RKO and 293T cells were obtained from ATCC and cultured in DMEM with 10% fetal bovine serum. Cells were transfected with siRNA duplexes (60 nM) or Antisense Oligonucleotide (60 nM) by using Lipofectamine 2000 (Invitrogen) or Dharmacon Transfection (Dharmacon) reagents according to manufacturer’s instructions. To establish the individual stable cells, retrovirus/lentivirus was used. Cell proliferation assay was performed using CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT) kit (Promega) based on the manufacturer’s instructions. Standard 24-well Boyden invasion chambers (BD Biosciences) were used to assess cell migration abilities following the manufacturer’s suggestions. For oncosphere formation assay, cells were suspended in serum-free DMEM-F12 medium containing N-2 Plus Media Supplement (Life Technologies), B-27 Supplement (Life Technologies), 20 ng/ml EGF (PeproTech) and 10 ng/ml FGF (PeproTech) in ultra-low attachment 96-well plate to support growth of oncospheres. Colonies were scored and documented by photomicroscopy 1 week after preparations. For soft-agar colony formation assay, cells were suspended in DMEM containing 0.35% low-melting agar (Invitrogen) and 10% FBS and seeded onto a coating of 0.7% low-melting agar in DMEM containing 10% FBS. Plates were incubated at 37 °C and 5% CO2 and colonies were scored 3 weeks after preparations. -
Sarcomeres Regulate Murine Cardiomyocyte Maturation Through MRTF-SRF Signaling
Sarcomeres regulate murine cardiomyocyte maturation through MRTF-SRF signaling Yuxuan Guoa,1,2,3, Yangpo Caoa,1, Blake D. Jardina,1, Isha Sethia,b, Qing Maa, Behzad Moghadaszadehc, Emily C. Troianoc, Neil Mazumdara, Michael A. Trembleya, Eric M. Smalld, Guo-Cheng Yuanb, Alan H. Beggsc, and William T. Pua,e,2 aDepartment of Cardiology, Boston Children’s Hospital, Boston, MA 02115; bDepartment of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, MA 02215; cDivision of Genetics and Genomics, The Manton Center for Orphan Disease Research, Boston Children’s Hospital and Harvard Medical School, Boston, MA 02115; dAab Cardiovascular Research Institute, Department of Medicine, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642; and eHarvard Stem Cell Institute, Harvard University, Cambridge, MA 02138 Edited by Janet Rossant, The Gairdner Foundation, Toronto, ON, Canada, and approved November 24, 2020 (received for review May 6, 2020) The paucity of knowledge about cardiomyocyte maturation is a Mechanisms that orchestrate ultrastructural and transcrip- major bottleneck in cardiac regenerative medicine. In develop- tional changes in cardiomyocyte maturation are beginning to ment, cardiomyocyte maturation is characterized by orchestrated emerge. Serum response factor (SRF) is a transcription factor that structural, transcriptional, and functional specializations that occur is essential for cardiomyocyte maturation (3). SRF directly acti- mainly at the perinatal stage. Sarcomeres are the key cytoskeletal vates key genes regulating sarcomere assembly, electrophysiology, structures that regulate the ultrastructural maturation of other and mitochondrial metabolism. This transcriptional regulation organelles, but whether sarcomeres modulate the signal trans- subsequently drives the proper morphogenesis of mature ultra- duction pathways that are essential for cardiomyocyte maturation structural features of myofibrils, T-tubules, and mitochondria. -
Effects of Tumor-Specific CAP1 Expression and Body Constitution on Clinical Outcomes in Patients with Early Breast Cancer
Bergqvist et al. Breast Cancer Research (2020) 22:67 https://doi.org/10.1186/s13058-020-01307-5 RESEARCH ARTICLE Open Access Effects of tumor-specific CAP1 expression and body constitution on clinical outcomes in patients with early breast cancer Malin Bergqvist1* , Karin Elebro1,2, Malte Sandsveden2, Signe Borgquist1,3 and Ann H. Rosendahl1* Abstract Background: Obesity induces molecular changes that may favor tumor progression and metastatic spread, leading to impaired survival outcomes in breast cancer. Adenylate cyclase-associated protein 1 (CAP1), an actin regulatory protein and functional receptor for the obesity-associated adipokine resistin, has been implicated with inferior cancer prognosis. Here, the objective was to investigate the interplay between body composition and CAP1 tumor expression regarding breast cancer outcome through long-term survival analyses. Methods: Among 718 women with primary invasive breast cancer within the large population-based prospective Malmö Diet and Cancer Study, tumor-specific CAP1 levels were assessed following thorough antibody validation and immunohistochemical staining of tumor tissue microarrays. Antibody specificity and functional application validity were determined by CAP1 gene silencing, qRT-PCR, Western immunoblotting, and cell microarray immunostaining. Kaplan-Meier and multivariable Cox proportional hazard models were used to assess survival differences in terms of breast cancer-specific survival (BCSS) and overall survival (OS) according to body composition and CAP1 expression. Results: Study participants were followed for up to 25 years (median 10.9 years), during which 239 deaths were observed. Patients with low CAP1 tumor expression were older at diagnosis, displayed anthropometric measurements indicating a higher adiposity status (wider waist and hip, higher body mass index and body fat percentage), and were more prone to have unfavorable tumor characteristics (higher histological grade, higher Ki67, and estrogen receptor (ER) negativity). -
Snapshot: Actin Regulators II Anosha D
SnapShot: Actin Regulators II Anosha D. Siripala and Matthew D. Welch Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720, USA Representative Proteins Protein Family H. sapiens D. melanogaster C. elegans A. thaliana S. cerevisiae Endocytosis and Exocytosis ABP1/drebrin mABP1, drebrin, drebrin- †Q95RN0 †Q9XUT0 Abp1 like EPS15 EPS15 Eps-15 EHS-1 †Q56WL2 Pan1 HIP1R HIP1R †Q8MQK1 †O62142 Sla2 Synapsin synapsin Ia, Ib, IIa, IIb, III Synapsin SNN-1 Plasma Membrane Association Anillin anillin Scraps ANI-1, 2, 3 Annexins annexin A1–11, 13 (actin Annexin B9-11 NEX-1–4 ANN1-8 binding: 1, 2, 6) ERM proteins ezrin, radixin, moesin DMoesin ERM-1 MARCKS MARCKS, MRP/ Akap200 MACMARCKS/F52 Merlin *merlin/NF2 Merlin NFM-1 Protein 4.1 4.1R, G, N, B Coracle Spectrin α-spectrin (1–2), β-spectrin α-spectrin, β-spectrin, β heavy- SPC-1 (α-spectrin), UNC-70 (1–4), β heavy-spectrin/ spectrin/Karst (β-spectrin), SMA-1 (β heavy- karst spectrin) Identifi ed Cellular Role: X Membrane traffi cking and phagocytosis Cell-Cell Junctions X Cytokinesis α-catenin α-catenin 1–3 α-catenin HMP-1 X Cell surface organization and dynamics X Cell adhesion Afadin afadin/AF6 Canoe AFD-1 X Multiple functions ZO-1 ZO-1, ZO-2, ZO-3 ZO-1/Polychaetoid †Q56VX4 X Other/unknown Cell-Extracellular Matrix Junctions †UNIPROT database accession number *Mutation linked to human disease Dystrophin/utrophin *dystrophin, utrophin/ Dystrophin DYS-1 DRP1, DRP2 LASP LASP-1, LASP-2, LIM- Lasp †P34416 nebulette Palladin palladin Parvin α-, β-, χ-parvin †Q9VWD0 PAT-6 -
Bee1, a Yeast Protein with Homology to Wiscott-Aldrich Syndrome Protein, Is Critical for the Assembly of Cortical Actin Cytoskel
Published February 10, 1997 Bee1, a Yeast Protein with Homology to Wiscott-Aldrich Syndrome Protein, Is Critical for the Assembly of Cortical Actin Cytoskeleton Rong Li Department of Cell Biology, Harvard Medical School, Boston, MA 02115 Abstract. Yeast protein, Bee1, exhibits sequence ho- associated patches, actin filaments in the buds of Dbee1 mology to Wiskott-Aldrich syndrome protein (WASP), cells form aberrant bundles that do not contain most of a human protein that may link signaling pathways to the cortical cytoskeletal components. It is significant the actin cytoskeleton. Mutations in WASP are the pri- that Dbee1 is the only mutation reported so far that mary cause of Wiskott-Aldrich syndrome, character- abolishes cortical actin patches in the bud. Bee1 protein ized by immuno-deficiencies and defects in blood cell is localized to actin patches and interacts with Sla1p, a morphogenesis. This report describes the character- Src homology 3 domain–containing protein previously ization of Bee1 protein function in budding yeast. Dis- implicated in actin assembly and function. Thus, Bee1 ruption of BEE1 causes a striking change in the organi- protein may be a crucial component of a cytoskeletal zation of actin filaments, resulting in defects in budding complex that controls the assembly and organization of Downloaded from and cytokinesis. Rather than assemble into cortically actin filaments at the cell cortex. roteins that are conserved between yeast and mam- In addition to the conserved actin-binding proteins, mals are likely to carry out fundamental cellular building blocks of protein interactions common to mam- P functions. The complete yeast genome database malian cytoskeletal and signaling molecules are also found on April 4, 2017 provides a facile route for the identification of these pro- in yeast.