DOCSLIB.ORG

Adenylate Cyclase-Associated Protein 1 Overexpressed in Pancreatic Cancers Is Involved in Cancer Cell Motility

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Adenylate Cyclase-Associated Protein 1 Overexpressed in Pancreatic Cancers Is Involved in Cancer Cell Motility Laboratory Investigation (2009) 89, 425–432 & 2009 USCAP, Inc All rights reserved 0023-6837/09 $32.00 Adenylate cyclase-associated protein 1 overexpressed in pancreatic cancers is involved in cancer cell motility Ken Yamazaki1, Masaaki Takamura2, Yohei Masugi1, Taisuke Mori1, Wenlin Du1, Taizo Hibi3, Nobuyoshi Hiraoka4, Tsutomu Ohta4, Misao Ohki4, Setsuo Hirohashi5 and Michiie Sakamoto1 Pancreatic cancer has the worst prognosis among cancers due to the difficulty of early diagnosis and its aggressive behavior. To characterize the aggressiveness of pancreatic cancers on gene expression, pancreatic cancer xenografts transplanted into severe combined immunodeficient mice served as a panel for gene-expression profiling. As a result of profiling, the adenylate cyclase-associated protein 1 (CAP1) gene was shown to be overexpressed in all of the xenografts. The expression of CAP1 protein in all 73 cases of pancreatic cancer was recognized by immunohistochemical analyses. The ratio of CAP1-positive tumor cells in clinical specimens was correlated with the presence of lymph node metastasis and neural invasion, and also with the poor prognosis of patients. Immunocytochemical analyses in pancreatic cancer cells demonstrated that CAP1 colocalized to the leading edge of lamellipodia with actin. Knockdown of CAP1 by RNA interference resulted in the reduction of lamellipodium formation, motility, and invasion of pancreatic cancer cells. This is the first report demonstrating the overexpression of CAP1 in pancreatic cancers and suggesting the involvement of CAP1 in the aggressive behavior of pancreatic cancer cells. Laboratory Investigation (2009) 89, 425–432; doi:10.1038/labinvest.2009.5; published online 2 February 2009 KEYWORDS: CAP1; metastasis; microarray; pancreatic cancer; prognosis Pancreatic cancer is a leading cause of cancer death world- expression level of genes by epigenetic or transcriptional wide.1,2 Only about 20% of pancreatic cancer can be surgi- manner may be a cue to elucidate the mechanism of cancer cally resected with curative intent at the time of diagnosis.3 metastasis. Mainly due to the difficulty in early detection and frequent Recent developments in the technology of human genome metastatic dissemination, the 5-year survival rate for pan- research enabled us to obtain genome-wide gene-expression creatic cancer patients remains below 5%.3,4 Considering that profiles, and vast numbers of marker molecule candidates for vascular involvement, lymph node metastasis, and neural pancreatic cancer have been proposed.13–18 In this study, invasion have been proposed as prognostic factors,5–7 it xenografts of clinical specimens orthotopically transplanted seems that metastasis is responsible for the aggressive beha- into severe combined immunodeficient (SCID) mice19 were vior of pancreatic cancer. Pancreatic cancer appears to ac- utilized as a panel for gene-expression profiling of pancreatic quire genetic aberrations with successive alteration of genes cancer. Among commonly overexpressed genes in pancreatic involved in the regulation of cell proliferation. The alterations cancer xenografts, we further evaluated the adenylate cyclase- include activating mutations of the KRAS gene8,9 that occur associated protein 1 (CAP1) gene, which encodes an actin early in the stage of pancreatic carcinogenesis, and inactiva- monomer-binding protein (reviewed in reference20). The tions by the deletion and mutation of the CDKN2A,10 reorganization of actin filament is essential for cell migration TP53,11 and SMAD4 genes.12 In addition to cell proliferation, and is regulated by actin-binding proteins in some signaling cell motility is one of the factors associated with cancer pathways.21,22 Therefore, we examined the role of over- metastasis; however, no alteration of such genes has been expression of CAP1 in cell motility and the pathology of revealed in pancreatic cancer. Therefore, alteration of the pancreatic cancer. 1Department of Pathology, School of Medicine, Keio University, Tokyo, Japan; 2Division of Gastroenterology and Hepatology, Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan; 3Department of Surgery, School of Medicine, Keio University, Tokyo, Japan; 4Cancer Genomics Division, National Cancer Center Research Institute, Tokyo, Japan and 5Pathology Division, National Cancer Center Research Institute, Tokyo, Japan Correspondence: Professor M Sakamoto, MD, PhD, Department of Pathology, School of Medicine, Keio University, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan. E-mail: [email protected] Received 19 September 2008; revised 5 December 2008; accepted 9 December 2008 www.laboratoryinvestigation.org | Laboratory Investigation | Volume 89 April 2009 425 Overexpression of CAP1 in pancreatic cancers K Yamazaki et al MATERIALS AND METHODS Burlingame, CA, USA) with diaminobenzidine. The sections Tissue Samples were counterstained with hematoxylin and then mounted. Pancreatic cancer and non-neoplastic pancreas tissues were Histologic diagnoses were made according to the Japanese obtained from patients who underwent surgical resection at Pancreas Society classification.25 Keio University Hospital and the National Cancer Center Hospital, Japan. All experiments using human samples were Statistical Analyses approved by the ethics committees of the National Cancer The w2-test was used when appropriate to determine the Center and of Keio University, School of Medicine. Cancer correlations between clinicopathological variables and CAP1 tissue fragments from 12 patients were orthotopically im- immunolabeling. Survival rates were calculated by the planted into SCID mice as described previously.19 Kaplan–Meier method, and the log-rank test was applied. In the 73 consecutive patients, 4 patients who suffered Microarray Analyses in-hospital death and 15 patients without follow-up data Total RNA of each xenograft was extracted with Trizol (In- were excluded for survival analysis. Taken together, follow-up vitrogen, Carlsbad, CA, USA) and then RNeasy (QIAGEN, data of 54 patients were utilized for survival analysis. All Valencia, CA, USA). Biotinylated cRNA was prepared from statistical analyses were performed using the SPSS software 5 mg of total RNA and then hybridized to GeneChip HG- (SPSS Inc., Chicago, IL, USA). U133A (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s protocol. Each profile was normalized as the Immunocytochemical Analyses mean signal of all probe sets at 1000. Microarray data are Human pancreatic cancer cell lines PANC-1, CFPAC-1, and accessible from our in-house database, Genome Medicine Hs 766T were obtained from the American Type Culture Database of Japan (GeMDBJ; https://gemdbj.nibio.go.jp/ Collection (Manassas, VA, USA). Cells cultured on culture dgdb/). slides (BD Biosciences, San Diego, CA, USA) were fixed with 3.7% formaldehyde in PBS, permeabilized with 0.1% Triton Antibodies X-100 in PBS, and probed with anti-CAP1 antibody over- We used two antisera against human CAP1 protein. Both a night at 41C. The slides were rinsed with PBS, covered with rat polyclonal antibody (a kind gift from Dr Kenji Moriyama, FITC-labeled secondary antibody with rhodamine-phalloidin The Tokyo Metropolitan Institute of Medical Science, Tokyo, (Invitrogen), and visualized using an Axiovert 200 Japan)23 and a rabbit polyclonal antibody recognize the C- microscope, an AxioCam CCD camera, and the AxioVision terminal domain of human CAP1. Each antibody raises si- software (Carl Zeiss MicroImaging Inc., Tokyo, Japan). In- milar results in Western blot and immunohistochemical filtrating lymphocytes served as a positive control for CAP1 analyses, and the specificity was further confirmed by antigen staining. absorption tests as in a previous report24 for the rabbit polyclonal antibody (data not shown). RNA Interference For knockdown of CAP1, two siRNA molecules (siCAP1A Western Blot Analyses and siCAP1B) were synthesized by QIAGEN. Their target Lysates of pancreatic cancers, non-neoplastic pancreas tis- sequences were AAACCGAGTCCTCAAAGAGTA and AAAC sues, and pancreatic cancer cells were loaded onto 10% AGATGGCTGCCATGCTT, respectively. As a control, nega- polyacrylamide-SDS gels, separated by electrophoresis, and tive control siRNA (nonsilencing siRNA) was purchased from blotted onto PVDF membranes by the semidry transfer QIAGEN. CFPAC-1 and PANC-1 cells were dispersed into method. Anti-CAP1 and anti-actin (Sigma, St Louis, MO, collagen I-coated six-well plates at 5 Â 104 cells/well and USA) antibodies were hybridized to the membranes over- cultured overnight under normal conditions. The following night at 41C. Horseradish peroxidase-conjugated secondary day, cells were transfected with siRNA in serum-free medium antibodies were probed to the membranes and visualized by using Oligofectamine (Invitrogen) for 4 h at 371C with 5% exposure to X-ray films with the ECL system (GE Healthcare CO2. After 4-h transfection, an equal volume of medium, UK Ltd., Buckinghamshire, UK). supplemented with 20% fetal bovine serum (FBS), was added and the transfectants were cultured until further analyses. To Immunohistochemical Analyses observe lamellipodium formation, the transfectants (48 h We reviewed the medical records of all consecutive patients after transfection) were serum starved for 24 h, and then who underwent resection with curative intent for pancreatic stimulated with serum (by changing serum-free medium for cancer from 1995 to 2004 at Keio University Hospital, Japan. medium supplemented
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Annexina7 and CAP1 Are Associated with Regulating Tumor Cell Adhesion Molecule Expression and Biological Behavior
    AnnexinA7 and CAP1 are associated with regulating tumor cell adhesion molecule expression and biological behavior Type Research paper Keywords hepatocellular carcinoma, adhesion molecule, AnnexinA7, CAP1, Biological behaviors Abstract Introduction To find out the correlations between the effects of down-regulating AnnexinA7 and CAP1 gene on cell adhesion factors and the biological behavior of Hca-p cells cells, and finally infer the relationship between the two genes. Material and methods Western blot ,qRT-PCR,immunocytochemistry, CCK8 cell proliferation, flow cytometry, lymph node adhesion and transwell chamber assay testing . Results AnnexinA7 and CAP1 were consistent with the regulation of the expression of the adhesion molecules such as FAK, Src, Paxillin and E-cadherin. At the mRNA and protein levels, the expression of FAK, Src and Paxillin were increased with down-regulated AnnexinA7 and CAP1 genes, while E-cadherin was down-regulated in the change of these two genes. And the low expression of AnnexinA7 could affect the expression of CAP1 in mRNA and protein levels. otherwise, the localization of AnnexinA7 and CAP1 in hepatocellular carcinoma cells was also the same. After down-regulating the expression of CAP1, the functions of proliferation, lymph node adhesion and invasion were increased and earlyPreprint apoptotic ability was decreased in Hca-P cells. Conclusions AnnexinA7 and CAP1 could control the expression of these adhesion molecules in the same trend. We speculated they may be co-localization. And AnnexinA7 gene may be related to the molecular mechanism of CAP1 gene, which is likely to have a consistent effect on cell adhesion molecules and be closely related to the biological behaviors of Hca-P cells.AnnexinA7 and CAP1 may play an inhibitory role in lymph node metastasis to provide a reliable basis for the early identification of lymphatic metastasis in hepatocellular carcinoma.
    [Show full text]
  • Effects of Tumor-Specific CAP1 Expression and Body Constitution on Clinical Outcomes in Patients with Early Breast Cancer
    Bergqvist et al. Breast Cancer Research (2020) 22:67 https://doi.org/10.1186/s13058-020-01307-5 RESEARCH ARTICLE Open Access Effects of tumor-specific CAP1 expression and body constitution on clinical outcomes in patients with early breast cancer Malin Bergqvist1* , Karin Elebro1,2, Malte Sandsveden2, Signe Borgquist1,3 and Ann H. Rosendahl1* Abstract Background: Obesity induces molecular changes that may favor tumor progression and metastatic spread, leading to impaired survival outcomes in breast cancer. Adenylate cyclase-associated protein 1 (CAP1), an actin regulatory protein and functional receptor for the obesity-associated adipokine resistin, has been implicated with inferior cancer prognosis. Here, the objective was to investigate the interplay between body composition and CAP1 tumor expression regarding breast cancer outcome through long-term survival analyses. Methods: Among 718 women with primary invasive breast cancer within the large population-based prospective Malmö Diet and Cancer Study, tumor-specific CAP1 levels were assessed following thorough antibody validation and immunohistochemical staining of tumor tissue microarrays. Antibody specificity and functional application validity were determined by CAP1 gene silencing, qRT-PCR, Western immunoblotting, and cell microarray immunostaining. Kaplan-Meier and multivariable Cox proportional hazard models were used to assess survival differences in terms of breast cancer-specific survival (BCSS) and overall survival (OS) according to body composition and CAP1 expression. Results: Study participants were followed for up to 25 years (median 10.9 years), during which 239 deaths were observed. Patients with low CAP1 tumor expression were older at diagnosis, displayed anthropometric measurements indicating a higher adiposity status (wider waist and hip, higher body mass index and body fat percentage), and were more prone to have unfavorable tumor characteristics (higher histological grade, higher Ki67, and estrogen receptor (ER) negativity).
    [Show full text]
  • Regulation of INF2-Mediated Actin Polymerization Through Site-Specific Lysine Acetylation of Actin Itself
    Regulation of INF2-mediated actin polymerization through site-specific lysine acetylation of actin itself Mu Aa, Tak Shun Funga, Lisa M. Francomacaroa, Thao Huynha, Tommi Kotilab, Zdenek Svindrycha, and Henry N. Higgsa,1 aDepartment of Biochemistry and Cell Biology, Geisel School of Medicine at Dartmouth, Hanover, NH 03755; and bHiLIFE Institute of Biotechnology, University of Helsinki, 00100 Helsinki, Finland Edited by Thomas D. Pollard, Yale University, New Haven, CT, and approved November 26, 2019 (received for review August 13, 2019) INF2 is a formin protein that accelerates actin polymerization. A rich sequences, and a C-terminal CARP domain (Fig. 1B). The common mechanism for formin regulation is autoinhibition, N-terminal OD from both budding yeast CAP and human CAP1 through interaction between the N-terminal diaphanous inhibi- has been shown to hexamerize (9, 10), consistent with our results tory domain (DID) and C-terminal diaphanous autoregulatory on full-length CAP2 (8). domain (DAD). We recently showed that INF2 uses a variant of Two regions of CAP can bind actin monomers: the WH2 motif this mechanism that we term “facilitated autoinhibition,” whereby a and the CARP domain. The CARP domain binds ADP-actin with complex consisting of cyclase-associated protein (CAP) bound to high affinity, while the WH2 domain binds ATP-actin with lower lysine-acetylated actin (KAc-actin) is required for INF2 inhibition, affinity (11–13). The structure of the CARP/actin complex shows in a manner requiring INF2-DID. Deacetylation of actin in the CAP/ that dimeric CARP binds 2 actin monomers in a manner that KAc-actin complex activates INF2.
    [Show full text]
  • Cap1 Mouse Shrna Lentiviral Particle (Locus ID 12331) Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TL500258V Cap1 Mouse shRNA Lentiviral Particle (Locus ID 12331) Product data: Product Type: shRNA Lentiviral Particles Product Name: Cap1 Mouse shRNA Lentiviral Particle (Locus ID 12331) Locus ID: 12331 Vector: pGFP-C-shLenti (TR30023) Format: Lentiviral particles RefSeq: BC005446, BC005472, NM_007598.1, NM_007598.2, NM_007598.3, NM_007598.4, NM_001301067.1 Summary: The product of this gene plays a role in regulating actin dynamics by binding actin monomers and promoting the turnover of actin filaments. Reduced expression of this gene causes a reduction in actin filament turnover rates, causing multiple defects, including an increase in cell size, stress-fiber alterations, and defects in endocytosis and cell motility. A pseudogene of this gene is found on chromosome 14. Alternative splicing results in multiple transcript variants, but does not affect the protein. [provided by RefSeq, Jul 2014] shRNA Design: These shRNA constructs were designed against multiple splice variants at this gene locus. To be certain that your variant of interest is targeted, please contact [email protected]. If you need a special design or shRNA sequence, please utilize our custom shRNA service. Performance OriGene guarantees that the sequences in the shRNA expression cassettes are verified to Guaranteed: correspond to the target gene with 100% identity. One of the four constructs at minimum are guaranteed to produce 70% or more gene expression knock-down provided a minimum transfection efficiency of 80% is achieved.
    [Show full text]
  • Cell-Cycle Regulation of Formin-Mediated Actin Cable Assembly
    Cell-cycle regulation of formin-mediated actin PNAS PLUS cable assembly Yansong Miaoa, Catherine C. L. Wongb,1, Vito Mennellac,d, Alphée Michelota,2, David A. Agardc,d, Liam J. Holta, John R. Yates IIIb, and David G. Drubina,3 aDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; bDepartment of Chemical Physiology, The Scripps Research Institute, La Jolla, CA 92037; and cDepartment of Biochemistry and Biophysics and dThe Howard Hughes Medical Institute, University of California, San Francisco, CA 94158 Edited by Ronald D. Vale, University of California, San Francisco, CA, and approved September 18, 2013 (received for review July 25, 2013) Assembly of appropriately oriented actin cables nucleated by for- Formin-based actin filament assembly using purified proteins min proteins is necessary for many biological processes in diverse also has been reported (29, 30). However, reconstitution of eukaryotes. However, compared with knowledge of how nucle- formin-derived actin cables under the more physiological con- ation of dendritic actin filament arrays by the actin-related pro- ditions represented by cell extracts has not yet been reported. tein-2/3 complex is regulated, the in vivo regulatory mechanisms The actin nucleation activity of formin proteins is regulated by for actin cable formation are less clear. To gain insights into mech- an inhibitory interaction between the N- and C-terminal domains, anisms for regulating actin cable assembly, we reconstituted the which can be released when GTP-bound Rho protein binds to the assembly process in vitro by introducing microspheres functional- formin N-terminal domain, allowing access of the C terminus ized with the C terminus of the budding yeast formin Bni1 into (FH1-COOH) to actin filament barbed ends (31–40).
    [Show full text]
  • Proteins Marking the Sequence of Genotoxic Signaling from Irradiated Mesenchymal Stromal Cells to CD34+ Cells
    International Journal of Molecular Sciences Article Proteins Marking the Sequence of Genotoxic Signaling from Irradiated Mesenchymal Stromal Cells to CD34+ Cells Vanessa Kohl 1,†, Oliver Drews 2,†, Victor Costina 2, Miriam Bierbaum 3, Ahmed Jawhar 4, Henning Roehl 5, Christel Weiss 6, Susanne Brendel 1, Helga Kleiner 1, Johanna Flach 1, Birgit Spiess 1, Wolfgang Seifarth 1, Daniel Nowak 1, Wolf-Karsten Hofmann 1, Alice Fabarius 1 and Henning D. Popp 1,* 1 Department of Hematology and Oncology, Medical Faculty Mannheim, Heidelberg University, 68167 Mannheim, Germany; [email protected] (V.K.); [email protected] (S.B.); [email protected] (H.K.); [email protected] (J.F.); [email protected] (B.S.); [email protected] (W.S.); [email protected] (D.N.); [email protected] (W.-K.H.); [email protected] (A.F.) 2 Department of Clinical Chemistry, University Medical Center Mannheim, 68167 Mannheim, Germany; [email protected] (O.D.); [email protected] (V.C.) 3 Department of Radiation Oncology, Medical Faculty Mannheim, Heidelberg University, 68167 Mannheim, Germany; [email protected] 4 Department of Orthopedics and Trauma Surgery, Medical Faculty Mannheim, Heidelberg University, 68167 Mannheim, Germany; [email protected] 5 Department of Orthopedics and Trauma Surgery, Diakonissen Hospital, 68163 Mannheim, Germany; [email protected] 6 Department of Medical Statistics and Biomathematics, Medical Faculty Mannheim, Heidelberg University, Citation: Kohl, V.; Drews, O.; 68167 Mannheim, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-621-383-71307 Costina, V.; Bierbaum, M.; Jawhar, A.; † These authors contributed equally to this work.
    [Show full text]
  • CAP2 Sirna (M): Sc-142002
    SAN TA C RUZ BI OTEC HNOL OG Y, INC . CAP2 siRNA (m): sc-142002 BACKGROUND STORAGE AND RESUSPENSION Cyclase-associated proteins (CAPs) are a family of evolutionary conserved Store lyophilized siRNA duplex at -20° C with desiccant. Stable for at least proteins that participate in signal transduction and function to regulate events one year from the date of shipment. Once resuspended, store at -20° C, associated with the actin cytoskeleton. CAP1 and CAP2 (adenylate cyclase- avoid contact with RNAses and repeated freeze thaw cycles. associated protein 1 and 2, respectively) are two members of the CAP fam - Resuspend lyophilized siRNA duplex in 330 µl of the RNAse-free water ily, both of which localize to the cell membrane and contain one C- CAP/cofac - pro vided. Resuspension of the siRNA duplex in 330 µl of RNAse-free water tor C-like domain. CAP1 is involved in the regulation of actin filaments and is makes a 10 µM solution in a 10 µM Tris-HCl, pH 8.0, 20 mM NaCl, 1 mM thought to mediate processes such as establishment of cell polarity and EDTA buffered solution. mRNA localization, while CAP2 has a bifunctional regulatory role and can interact directly with actin. Although CAP1 is expressed throughout the body, APPLICATIONS CAP2 is predominately expressed in skin, brain, heart and skeletal muscle. Overexpression of CAP2 is associated with hepatocellular carcinoma, sug gest - CAP2 siRNA (m) is recommended for the inhibition of CAP2 expression in ing a possible role for CAP2 in carcinogenesis. mouse cells. REFERENCES SUPPORT REAGENTS 1. Matviw, H., et al.
    [Show full text]
  • CAP1 (NM 001105530) Human Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP325806 CAP1 (NM_001105530) Human Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Purified recombinant protein of Homo sapiens CAP, adenylate cyclase-associated protein 1 (yeast) (CAP1), transcript variant 2 Species: Human Expression Host: HEK293T Tag: C-Myc/DDK Predicted MW: 51.5 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol Preparation: Recombinant protein was captured through anti-DDK affinity column followed by conventional chromatography steps. Storage: Store at -80°C. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_001099000 Locus ID: 10487 UniProt ID: Q01518, D3DPU2 RefSeq Size: 2780 Cytogenetics: 1p34.2 RefSeq ORF: 1425 Synonyms: CAP; CAP1-PEN Summary: The protein encoded by this gene is related to the S. cerevisiae CAP protein, which is involved in the cyclic AMP pathway. The human protein is able to interact with other molecules of the same protein, as well as with CAP2 and actin. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2016] Protein Families: Druggable Genome This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 CAP1 (NM_001105530) Human Recombinant Protein – TP325806 Product images: Coomassie blue staining of purified CAP1 protein (Cat# TP325806).
    [Show full text]
  • Neutrophil Extracellular Traps Protein Composition Is Specific for Patients
    www.nature.com/scientificreports OPEN Neutrophil Extracellular Traps protein composition is specifc for patients with Lupus nephritis and Received: 17 September 2018 Accepted: 28 April 2019 includes methyl-oxidized αenolase Published: xx xx xxxx (methionine sulfoxide 93) Maurizio Bruschi1, Andrea Petretto2, Laura Santucci1, Augusto Vaglio3, Federico Pratesi4, Paola Migliorini4, Roberta Bertelli1, Chiara Lavarello2, Martina Bartolucci2, Giovanni Candiano1, Marco Prunotto 5 & Gian Marco Ghiggeri1,6 NETs constitute a network of DNA and proteins released by neutrophils in response to infectious and immunologic triggers. NET proteins are recognized as autoantigens in ANCA vasculitis; limited knowledge is available in other autoimmune pathologies. The composition of NETs produced ex vivo by resting and Phorbol-myristate acetate (PMA) stimulated neutrophils was analyzed by high-throughput Fusion Orbitrap technology in 16 patients with Systemic Lupus Erythematosus/Lupus nephritis (9 SLE/7 LN) and in 11 controls. Seven-hundred proteins were characterized and specifc fngerprints discriminated LN from SLE. We focused on methyl-oxidized αenolase (methionine sulfoxide 93) that was markedly increased in NETs from LN and was localized in NET flaments in tight connection and outlying DNA. The isotype of anti-αenolase antibodies was IgG2 in LN and IgG4 in other autoimmune glomerulonephritis (Membranous Nephropathy, MN); serum anti-αenolase IgG2 were higher in LN than in SLE and absent in MN. The same IgG2 antibodies recognized 5 epitopes of the protein one containing methionine sulphoxide 93. In conclusion, specifc NET protein fngerprints characterize diferent subsets of SLE; methyl-oxidized αenolase is over-expressed in LN. Circulating anti-αenolase IgG2 recognize the oxidized epitope and are high in serum of LN patients.
    [Show full text]
  • Phosphorylation of CAP1 Regulates Lung Cancer Proliferation, Migration and Invasion
    Phosphorylation of CAP1 Regulates Lung Cancer Proliferation, Migration and Invasion Jie Zeng Tongji University Tenth People's Hospital: Shanghai Tenth People's Hospital Xuan Li Tongji University Tenth People's Hospital: Shanghai Tenth People's Hospital Long Liang Tongji University Tenth People's Hospital: Shanghai Tenth People's Hospital Hongxia Duan Tongji University Tenth People's Hospital: Shanghai Tenth People's Hospital Shuanshuan Xie Tongji University Tenth People's Hospital: Shanghai Tenth People's Hospital Changhui Wang ( [email protected] ) Tongji University Tenth People's Hospital: Shanghai Tenth People's Hospital https://orcid.org/0000- 0001-6118-6126 Research Article Keywords: Adenylate cyclase-associated protein, Phosphorylation, NSCLC, EMT Posted Date: May 6th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-481872/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/26 Abstract Purpose: Cyclase-associated protein 1 (CAP1) is a ubiquitous protein which regulates actin dynamics. Comprehensive bioinformatics analysis showed CAP1 is a type of cancer-related protein. Previous studies have shown that the protein CAP1 can be phosphorylated. S308 and S310 are the two major phosphorylated sites in human CAP1. In the present study, we aimed to investigate the mechanism of lung cancer metastasis mediated by CAP1. Methods: Massive bioinformatics analysis were applied to determine CAP1’s role in different cancers and especially in lung cancer. Lung cancer patients’ serum was collected and analyzed. CAP1 shRNA- lentivirus were applied to CAP1 gene knockdown, and plasmids were constructed for CAP1 phosphorylation and dephosphorylation. Microarray analysis was used for CAP1-associated difference analysis.
    [Show full text]
  • The Role of Cyclase-Associated Protein (CAP)
    Recent Publications in this Series: Actin DynamicsDuringCellMotilityandMorphogenesis in (CAP) RoleofCyclase-AssociatedProtein The ENNI BERTLING 20/2007 Henna Vihola Studies on Thermosensitive Poly(N-Vinylcaprolactam) Based Polymers for Pharmaceutical Applications 21/2007 Terhi Hakala Characterization of the Lignin-Modifying Enzymes of the Selective White-Rot Fungus Physisporinus Rivulosus 22/2007 Ilya Belevich Proton Translocation Coupled to Electron Transfer Reactions in Terminal Oxidases 23/2007 Johan Pahlberg Spectral Tuning and Adaptation to Different Light Environments of Mysid Visual Pigments 24/2007 Beata Kluczek-Turpeinen Lignocellulose Degradation and Humus Modifi cation by the Fungus Paecilomyces infl atus 25/2007 Sabiruddin Mirza Crystallization as a Tool for Controlling and Designing Properties of Pharmaceutical Solids 26/2007 Kaisa Marjamaa Peroxidases in Lignifying Xylem of Norway Spruce, Scots Pine and Silver Birch 27/2007 Pekka Nieminen Molecular Genetics of Tooth Agenesis 28/2007 Sanna Koutaniemi Lignin Biosynthesis in Norway Spruce: from a Model System to the Tree 29/2007 Anne Rantala Evolution and Detection of Cyanobacterial Hepatotoxin Synthetase Genes 30/2007 Tiina Sikanen SU-8-Based Microchips for Capillary Electrophoresis and Electrospray Ionization Mass Spectrometry 31/2007 Pieta Mattila Missing-In-Metastasis (MIM)Regulates Cell Morphology by Promoting Plasma Membrane and Actin The Role of Cyclase-Associated Protein (CAP) Cytoskeleton Dynamics 32/2007 Justus Reunanen in Actin Dynamics During Cell Motility Lantibiotic
    [Show full text]