DOCSLIB.ORG

The Roles of Tubulins in the Developing Mouse Brain

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Roles of Tubulins in the Developing Mouse Brain The Roles of Tubulins in the Developing Mouse Brain A thesis submitted to the Division of Graduate Studies and Research of the University of Cincinnati In partial fulfillment of the requirements for the degree of Master of Science In the Department of Molecular Genetics, Biochemistry, & Microbiology of the College of Medicine 2018 Elizabeth A. Bittermann B.S, Anderson University, 2016 Committee Chair: Rolf W. Stottmann, Ph.D. Abstract The tubulin genes form a superfamily composed of eight alpha-tubulins, nine beta-tubulins, and two gamma-tubulins. Together these form microtubules which are important for cell motility, membrane structure, cilia structure, and neuron extension support. The alpha- and beta-tubulins alternate to form cylindrical structures, which are nucleated by gamma-tubulins, to bind laterally and form the tube structure of the microtubule. Elongation of the microtubule is critical for neurite extension during neuronal migration. Neuronal migration is, in turn critical for proper brain development. Neurons have both radial and tangential migration routes which are crucial for proper brain architecture. To date, mutations have been found in ten of the human tubulin genes. Eight have been linked to brain phenotypes including polymicrogyria, lissencephaly, enlarged ventricles, and microcephaly. TUBA1A is one of these, with two homologs which have almost identical amino acid sequences. TUBB2A and TUBB2B are two of the eight genes with brain phenotypes, which have almost identical amino acid sequences. There have only been four mouse models of tubulin mutations to model the different brain phenotypes, but none were designed to precisely recapitulate variants found in humans. All four mice were made through ENU screens. The severity of these phenotypes is surprising as the high homology between genes suggests they may be able to compensate for each other. Here we used CRISPR-CAS9 genome editing and created five novel alleles with the deletion of Tubb2a, Tubb2b, and Tuba1a. We also acquired a null allele of Tuba8. Tubb2ad3964, Tubb2ad4223, Tubb2bd4183, and Tuba8em1J mice were all viable and fertile in the homozygous state, with no difference in size. Tuba1a homozygous loss led to embryonic lethality. Deletion of Tuba1a produced mice that had enlarged ventricles with loss of the intermediate zone of the cortex, and about a 25% incidence of cleft palate. The Tuba1aquas was previously identified through an ENU screen with an R215* nonsense mutation. Tuba1aquas ii mutants have a phenotype similar to the Tuba1a null, with enlarged ventricles and a loss of intermediate zone. A complementation test between Tuba1ad4353/wt and Tuba1aquas/wt produced no live animals with both mutations, confirming the Tuba1a R215* mutation to be an allele of Tuba1a. Preliminary molecular characterization of these Tuba1a phenotypes indicated an increase in proliferation and differentiation of neurons in Tuba1aquas mutants. Similar analysis of the Tuba1ad4353 mutants also suggested a possible decrease in proliferation and an increase in differentiation of neurons. Overall, Tuba1a is critical for brain development, but Tubb2a and Tubb2b have the ability to compensate for each other. iii Acknowledgments I would like to thank Dr. Rolf Stottmann for all the help and guidance he has provided while I have been in his lab. His willingness to answer every question, no matter how basic, has been a wonderful help in furthering my love of genetics and biology. I am also sincerely grateful to Ryan Liegel, a postdoc in the lab who helped me get started. In addition, thank you to Chelsea Menke who helped with the mouse work and Dr. William Miller and Dr. David Wieczorek for their willingness to be part of my committee. Lastly, I would like to thank my family who is a constant source of support. iv v Table of Contents Abstract Acknowledgments Table of Contents List of Figures and Tables List of Abbreviations Chapter I. Introduction Microtubules: Structure and Function Tubulins Genes in Human and Mouse The Neurons Role in Brain Development Tubulinopathies Tubulins in the Mouse Tubb2b-eGFP Mouse Tuba1a Mice Tubb2b Mouse Tubg Mouse Chapter II. Not All Tubulins are Created Equal: Tuba1a is Required for Brain Development Abstract Introduction What is a Tubulin? TUBA1A, TUBB2A, TUBB2B Phenotypes Gene Similarities No Null Alleles Published Hypothesis Materials and Methods Results Discussion Chapter III. Future Directions vi References vii Figures and Tables Figure 1. Structure of the microtubule. Figure 2. Tuba1* and Tubb2* genes are adjacent to each other on their respective chromosomes. Figure 3. Amino acid sequences between tubulin proteins are almost identical. Figure 4. Cell fate is determined by the division of neural progenitors. Figure 5. Migration of neurons radially from the ventricular zone (VZ) or tangentially from the ganglionic eminences form the cortex. Table 1. CRISPR sgRNA guide, PCR primer, and sequencing primer sequences. Figure 6. PCR and Sanger sequencing confirm successful deletion of Tubb2a, Tubb2b, Tuba1a and exon 2 of Tuba8. Figure 7. Second alleles of Tubb2a and Tuba1a deletions was confirmed through PCR and Sanger sequencing. Table 2. Survival at weaning of mice with deletions of Tubb2a, Tubb2b, Tuba8, and Tuba1a. Figure 8. Homozygous deletion of Tubb2a or Tubb2b has no significant difference on the weight of adult mice. Figure 9. Homozygous deletion of Tubb2a, Tubb2b, and exon 2 of Tuba8 has no morphological or histological effect on the adult mouse brain. Table 3. Embryonic survival of Tuba1a deletion mutants (E14.5-E18.5). Figure 10. Loss of Tuba1a causes edema, hemorrhaging, enlarged ventricles and layering defects. Table 4. Survival stats of Tuba1ad4353/wt x Tuba1aquas/wt at weaning and embryonically (E17.5). Figure 11. Tuba1aquas/quas mutants show significant cortical malformations as early as E14.5. Figure 12. Quas allele confirmed as a causative allele of Tuba1a through a complementation test. Figure 13. Tuba1aquas mutants show an increase in proliferation and increased differentiation. Figure 14. Tuba1ad4353 mutants show a possible decrease in proliferation and an increase in differentiation. viii List of Abbreviations CCHMC: Cincinnati Children’s Hospital Medical Center CGE: caudal ganglionic eminence CP: cortical plate E: embryonic day GCPs: gamma-tubulin complex proteins IHC: immunohistochemistry IZ: intermediate zone LGE: lateral ganglionic eminences MAPs: microtubule-associated proteins MGE: medial ganglionic eminences MT: microtubules MTOCs: microtubule organizing centers PFA: paraformaldehyde RMS: rostral migratory stream SNP: single nucleotide polymorphism SVZ: sub-ventricular zone Tuba1*: Tuba1a, Tuba1b, Tuba1c Tubb2*: Tubb2a, Tubb2b VZ: ventricular zone WT: wild-type ix Chapter I. Introduction 10 Microtubules: Structure and Function The cytoskeleton of the cells is, in part, composed of microtubules. Microtubules are an important part of the cell, not just for their shape, but also for their function. Their uses include transport of different materials or signals and the composition of mitotic spindles which pull chromosomes apart during cell division. In addition, microtubules provide structure to the cell membrane, structure to cilia, and are paramount to cell motility (1). Most often they are a group of thirteen linear filaments that are arranged to form hollow cylinders (2). Filaments are composed of alternating alpha- and beta-tubulin monomers, connecting laterally to form the cylinder (Figure 1). Between each alpha- and beta-tubulin monomer is one molecule of GTP. If the GTP is bound to the alpha-tubulin, it stays as GTP. If the GTP is bound to the beta-tubulin monomer, the GTP can be hydrolyzed to GDP and then exchanged for a new GTP. The hydrolysis of GTP to GDP allows for the next alpha-tubulin to bind and elongate the microtubule. Thirteen cylinders then group together to provide the structure of cilia, mitotic spindles, and the support for neuron extensions in the form of axons and dendrites (1). Figure 1. Structure of the microtubule. The microtubule structure is composed of gamma- tubulins at the base, with alpha-tubulins and beta- tubulins composing the long filament structure. Image adapted (3). 11 Microtubules are a dynamic structure that grows and shrinks depending on the needs of the cell. Their base is at the centriole, where a network of gamma-tubulin rings and gamma-tubulin complex proteins (GCPs) form a microtubule-organizing center (MTOC). The GCPs either make a gamma-tubulin small complex or a gamma-tubulin ring complex. These complexes, especially the gamma-tubulin ring complex, form a structure that is similar to the final shape of the microtubule filaments. Gamma-tubulins are attached to these complexes and together they nucleate the microtubule, which allows the filaments to bind together (4, 5). Gamma-tubulins mark the minus-end of the microtubule, while the end that is most often growing is the plus-end. The growth and destruction of microtubules helps to move neurons to the proper layers of the brain as it grows and develops. Movement of neurons is caused by the extension of a process, which is created by the growth of the microtubule, followed by the nucleus being pulled along. Since the microtubules are anchored to the centrioles, a structure can be formed around the nucleus which allows the microtubules, along with the help of actin filaments, to be able to pull or push the nucleus to follow the neurite extension (6). Disruptions in the microtubule structure can have drastic effects
Load more

Recommended publications
  • Transcriptomic Analysis of Human Brain Microvascular Endothelial
    www.nature.com/scientificreports OPEN Transcriptomic analysis of human brain microvascular endothelial cells exposed to laminin binding protein (adhesion lipoprotein) and Streptococcus pneumoniae Irene Jiménez‑Munguía1, Zuzana Tomečková1, Evelína Mochnáčová1, Katarína Bhide1, Petra Majerová2 & Mangesh Bhide1,2* Streptococcus pneumoniae invades the CNS and triggers a strong cellular response. To date, signaling events that occur in the human brain microvascular endothelial cells (hBMECs), in response to pneumococci or its surface adhesins are not mapped comprehensively. We evaluated the response of hBMECs to the adhesion lipoprotein (a laminin binding protein—Lbp) or live pneumococci. Lbp is a surface adhesin recently identifed as a potential ligand, which binds to the hBMECs. Transcriptomic analysis was performed by RNA‑seq of three independent biological replicates and validated with qRT‑PCR using 11 genes. In total 350 diferentially expressed genes (DEGs) were identifed after infection with S. pneumoniae, whereas 443 DEGs when challenged with Lbp. Total 231 DEGs were common in both treatments. Integrative functional analysis revealed participation of DEGs in cytokine, chemokine, TNF signaling pathways and phagosome formation. Moreover, Lbp induced cell senescence and breakdown, and remodeling of ECM. This is the frst report which maps complete picture of cell signaling events in the hBMECs triggered against S. pneumoniae and Lbp. The data obtained here could contribute in a better understanding of the invasion of pneumococci across BBB and underscores role of Lbp adhesin in evoking the gene expression in neurovascular unit. Streptococcus pneumoniae (also known as pneumococcus) is a life-threatening pathogen responsible for high morbidity and mortality rates worldwide1. It can cross the blood–brain barrier (BBB) and cause meningitis, commonly known as pneumococcal meningitis, a rare but life-threatening medical emergency.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
    [CANCER RESEARCH 64, 6453–6460, September 15, 2004] Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Be´atrice Orsetti,1 Me´lanie Nugoli,1 Nathalie Cervera,1 Laurence Lasorsa,1 Paul Chuchana,1 Lisa Ursule,1 Catherine Nguyen,2 Richard Redon,3 Stanislas du Manoir,3 Carmen Rodriguez,1 and Charles Theillet1 1Ge´notypes et Phe´notypes Tumoraux, EMI229 INSERM/Universite´ Montpellier I, Montpellier, France; 2ERM 206 INSERM/Universite´ Aix-Marseille 2, Parc Scientifique de Luminy, Marseille cedex, France; and 3IGBMC, U596 INSERM/Universite´Louis Pasteur, Parc d’Innovation, Illkirch cedex, France ABSTRACT 17q12-q21 corresponding to the amplification of ERBB2 and collinear genes, and a large region at 17q23 (5, 6). A number of new candidate Chromosome 17 is severely rearranged in breast cancer. Whereas the oncogenes have been identified, among which GRB7 and TOP2A at short arm undergoes frequent losses, the long arm harbors complex 17q21 or RP6SKB1, TBX2, PPM1D, and MUL at 17q23 have drawn combinations of gains and losses. In this work we present a comprehensive study of quantitative anomalies at chromosome 17 by genomic array- most attention (6–10). Furthermore, DNA microarray studies have comparative genomic hybridization and of associated RNA expression revealed additional candidates, with some located outside current changes by cDNA arrays. We built a genomic array covering the entire regions of gains, thus suggesting the existence of additional amplicons chromosome at an average density of 1 clone per 0.5 Mb, and patterns of on 17q (8, 9). gains and losses were characterized in 30 breast cancer cell lines and 22 Our previous loss of heterozygosity mapping data pointed to the primary tumors.
    [Show full text]
  • Cytoplasmic Mrna Decay Represses RNA Polymerase II Transcription
    RESEARCH ARTICLE Cytoplasmic mRNA decay represses RNA polymerase II transcription during early apoptosis Christopher Duncan-Lewis1, Ella Hartenian1, Valeria King1, Britt A Glaunsinger1,2,3* 1Department of Molecular and Cell Biology; University of California, Berkeley, Berkeley, United States; 2Department of Plant and Microbial Biology; University of California, Berkeley, Berkeley, United States; 3Howard Hughes Medical Institute, Berkeley, Berkeley, United States Abstract RNA abundance is generally sensitive to perturbations in decay and synthesis rates, but crosstalk between RNA polymerase II transcription and cytoplasmic mRNA degradation often leads to compensatory changes in gene expression. Here, we reveal that widespread mRNA decay during early apoptosis represses RNAPII transcription, indicative of positive (rather than compensatory) feedback. This repression requires active cytoplasmic mRNA degradation, which leads to impaired recruitment of components of the transcription preinitiation complex to promoter DNA. Importin a/b-mediated nuclear import is critical for this feedback signaling, suggesting that proteins translocating between the cytoplasm and nucleus connect mRNA decay to transcription. We also show that an analogous pathway activated by viral nucleases similarly depends on nuclear protein import. Collectively, these data demonstrate that accelerated mRNA decay leads to the repression of mRNA transcription, thereby amplifying the shutdown of gene expression. This highlights a conserved gene regulatory mechanism by which cells respond to threats. *For correspondence: [email protected] Competing interests: The authors declare that no Introduction competing interests exist. Gene expression is often depicted as a unidirectional flow of discrete stages: DNA is first transcribed Funding: See page 18 by RNA polymerase II (RNAPII) into messenger RNA (mRNA), which is processed and exported to Received: 28 April 2020 the cytoplasm where it is translated and then degraded.
    [Show full text]
  • Gamma Tubulin (TUBG1) (NM 001070) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119462 gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: gamma Tubulin (TUBG1) (NM_001070) Human Untagged Clone Tag: Tag Free Symbol: TUBG1 Synonyms: CDCBM4; GCP-1; TUBG; TUBGCP1 Vector: pCMV6-XL5 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC119462 sequence for NM_001070 edited (data generated by NextGen Sequencing) ATGCCGAGGGAAATCATCACCCTACAGTTGGGCCAGTGCGGCAATCAGATTGGGTTCGAG TTCTGGAAACAGCTGTGCGCCGAGCATGGTATCAGCCCCGAGGGCATCGTGGAGGAGTTC GCCACCGAGGGCACTGACCGCAAGGACGTCTTTTTCTACCAGGCAGACGATGAGCACTAC ATCCCCCGGGCCGTGCTGCTGGACTTGGAACCCCGGGTGATCCACTCCATCCTCAACTCC CCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAACATGGAGGAGGAGCT GGCAACAACTGGGCCAGCGGATTCTCCCAGGGAGAAAAGATCCATGAGGACATTTTTGAC ATCATAGACCGGGAGGCAGATGGTAGTGACAGTCTAGAGGGCTTTGTGCTGTGTCACTCC ATTGCTGGGGGGACAGGCTCTGGACTGGGTTCCTACCTCTTAGAACGGCTGAATGACAGG TATCCTAAGAAGCTGGTGCAGACATACTCAGTGTTTCCCAACCAGGACGAGATGAGCGAT GTGGTGGTCCAGCCTTACAATTCACTCCTCACACTCAAGAGGCTGACGCAGAATGCAGAC TGTGTGGTGGTGCTGGACAACACAGCCCTGAACCGGATTGCCACAGACCGCCTGCACATC CAGAACCCATCCTTCTCCCAGATCAACCAGCTGGTGTCTACCATCATGTCAGCCAGCACC ACCACCCTGCGCTACCCTGGCTACATGAACAATGACCTCATCGGCCTCATCGCCTCGCTC ATTCCCACCCCACGGCTCCACTTCCTCATGACCGGCTACACCCCTCTCACTACGGACCAG TCAGTGGCCAGCGTGAGGAAGACCACGGTCCTGGATGTCATGAGGCGGCTGCTGCAGCCC
    [Show full text]
  • Alpha Tubulin (TUBA1A) Chicken Polyclonal Antibody Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TA306750 alpha Tubulin (TUBA1A) Chicken Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: WB Recommended Dilution: WB: 0.5 - 1 ug/mL Reactivity: Human, Mouse, Rat Host: Chicken Isotype: IgY Clonality: Polyclonal Immunogen: Tubulin antibody was raised against a 16 amino acid peptide near the amino terminus of human Tubulin. Formulation: PBS containing 0.02% sodium azide. Concentration: 1ug/ul Purification: Affinity chromatography purified via peptide column Conjugation: Unconjugated Storage: Store at -20°C as received. Stability: Stable for 12 months from date of receipt. Gene Name: tubulin alpha 1a Database Link: NP_006000 Entrez Gene 22142 MouseEntrez Gene 64158 RatEntrez Gene 7846 Human Q71U36 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 alpha Tubulin (TUBA1A) Chicken Polyclonal Antibody – TA306750 Background: Alpha-tubulin belongs to the tubulin superfamily, which is composed of six distinct families. Along with beta-tubulins, alpha-tubulins are the major components of microtubules. These microtubules are involved in a wide variety of cellular activities ranging from mitosis and transport events to cell movement and the maintenance of cell shape. Alpha- and beta- tubulin dimers are assembled to 13 protofilaments that form a microtubule of 22-nm diameter. Tyrosine ligase adds a C-terminal tyrosine to monomeric alpha-tubulin.
    [Show full text]
  • S1 Table Protein
    S1 Table dFSHD12_TE dFSHD12_NE aFSHD51_TE aFSHD51_NE Accession Gene Protein H/L SD # bold H/L SD # bold H/L SD # bold H/L SD # bold Intermediate filament (or associated proteins) P17661 DES Desmin 0.91 N.D. 37 1.06 1.35 19 0.89 1,13 33 * 1.20 1.21 17 * P02545 LMNA Prelamin-A/C 0.90 1.25 30 * 1.07 1.26 20 0.96 1.23 34 1.21 1.24 19 * P48681 NES Nestin 0.91 N.D. 60 0.94 1.25 27 0.72 1.20 50 * 0.89 1.27 31 * P08670 VIM Vimentin 1.04 N.D. 35 1.24 1.24 14 * 1.21 1.18 36 * 1.39 1.17 16 * Q15149 PLEC Plectin-1 1.10 1.28 19 1.05 1.10 3 1.07 1.23 26 1.25 1.27 7 * P02511 CRYAB Alpha-crystallin B chain (HspB5) 1.47 1.17 2 1.17 2 1.14 1.12 2 Tubulin (or associated proteins) P62158 CALM1 Calmodulin (CaM) 0.83 0.00 1 0.93 0.00 1 Programmed cell death 6- Q8WUM4 PDCD6IP 1.34 0.00 1 interacting protein Q71U36 TUBA1A Tubulin α-1A chain (α-tubulin 3) 1.44 1.12 3 * Tubulin β chain (Tubulin β-5 P07437 TUBB 1.52 0.00 1 chain) Nuclear mitotic apparatus Q14980 NUMA1 0.68 0.00 1 0.75 0.00 1 protein 1 Microtubule-associated protein P27816 MAP4 1.10 1 4 Microtubule-associated protein P78559 MAP1A 0.76 0.00 1 1A Q6PEY2 TUBA3E Tubulin α-3E chain (α-tubulin 3E) 0.91 0.00 1 1.12 0.00 1 0.98 1.12 3 Tubulin β-2C chain (Tubulin β-2 P68371 TUBB2C 0.93 1.13 7 chain) Q3ZCM7 TUBB8 Tubulin β-8 chain 0.97 1.09 4 Serine P34897 SHMT2 hydroxymethyltransferase 0.93 0.00 1 (serine methylase) Cytoskeleton-associated protein Q07065 CKAP4 0.98 1.24 5 0.96 0.00 1 1.08 1.28 6 0.75 0.00 1 4 (p63) Centrosomal protein of 135 kDa Q66GS9 CEP135 0.84 0.00 1 (Centrosomal protein 4) Pre-B cell leukemia transcription Q96AQ6 PBXIP1 0.74 0.00 1 0.80 1 factor-interacting protein 1 T-complex protein 1 subunit P17897 TCP1 0.84 0.00 1 alpha (CCT-alpha) Cytoplasmic dynein Q13409 DYNC1I2 1.01 0.00 1 intermediate chain 2 (DH IC-2) Dynein heavy chain 3 (Dnahc3- Q8TD57 DNAH3 b) Microtubule-actin cross- linking Q9UPN3 MACF1 factor 1 (Trabeculin-alpha) Actin (or associated including myofibril-associated porteins) P60709 ACTB Actin, cytoplasmic 1 (β-actin) 1.11 N.D.
    [Show full text]
  • Recombinant Human TUBG1 Protein Catalog Number: ATGP3767
    Recombinant human TUBG1 protein Catalog Number: ATGP3767 PRODUCT INPORMATION Expression system Baculovirus Domain 1-451aa UniProt No. P23258 NCBI Accession No. NP_001061 Alternative Names Tubulin gamma-1 chain, TUBG1, CDCBM4, GCP-1, TUBG, TUBGCP1 PRODUCT SPECIFICATION Molecular Weight 51.9 kDa (457aa) Concentration 0.25mg/ml (determined by Bradford assay) Formulation Liquid in. 20mM Tris-HCl buffer (pH 8.0) containing 40% glycerol, 0.1M NaCl, 2mM DTT, 50mM imidazole. Purity > 85% by SDS-PAGE Endotoxin level < 1 EU per 1ug of protein (determined by LAL method) Tag His-Tag Application SDS-PAGE Storage Condition Can be stored at +2C to +8C for 1 week. For long term storage, aliquot and store at -20C to -80C. Avoid repeated freezing and thawing cycles. BACKGROUND Description TUBG1, also known as tubulin gamma-1 chain, is a member of the tubulin superfamily. This protein is found at microtubule organizing centers (MTOC) such as the spindle poles or the centrosome. It is the pericentriolar matrix component that regulates alpha/beta tubulin minus-end nucleation, centrosome duplication and spindle formation. It is required for microtubule formation and progression of the cell cycle. Also, this protein is interacts 1 Recombinant human TUBG1 protein Catalog Number: ATGP3767 with GCP2, GCP3, and B9D2. The interaction is leading to centrosomal localization of TUBG1 and CDK5RAP2. Recombinant human TUBG1, fused to His-tag at C-terminus, was expressed in insect cell and purified by using conventional chromatography techniques. Amino acid Sequence MPREIITLQL
    [Show full text]
  • Conditional Gene Expression and Lineage Tracing of Tuba1a Expressing Cells During Zebrafish Development and Retina Regeneration
    RESEARCH ARTICLE Conditional Gene Expression and Lineage Tracing of tuba1a Expressing Cells During Zebrafish Development and Retina Regeneration Rajesh Ramachandran,1 Aaron Reifler,1,2 Jack M. Parent,2,3 and Daniel Goldman1,2,4* 1Molecular and Behavioral Neuroscience Institute, University of Michigan, Ann Arbor, Michigan 48109 2Neuroscience Program, University of Michigan, Ann Arbor, Michigan 48109 3Department of Neurology, University of Michigan, Ann Arbor, Michigan 48109 4Department of Biological Chemistry, University of Michigan, Ann Arbor, Michigan 48109 ABSTRACT During development, recombination revealed transient The tuba1a gene encodes a neural-specific a-tubulin tuba1a expression in not only neural progenitors but isoform whose expression is restricted to the develop- also cells that contribute to skeletal muscle, heart, and ing and regenerating nervous system. By using zebra- intestine. In the adult, recombination revealed tuba1a fish as a model system for studying CNS regeneration, expression in brain, olfactory neurons, and sensory cells we recently showed that retinal injury induces tuba1a of the lateral line, but not in the retina. After retinal gene expression in Mu¨ller glia that reentered the cell injury, recombination showed tuba1a expression in cycle. However, because of the transient nature of Mu¨ller glia that had reentered the cell cycle, and line- tuba1a gene expression during development and regen- age tracing indicated that these cells are responsible eration, it was not possible to trace the lineage of the for regenerating retinal neurons and glia. These results tuba1a-expressing cells with a reporter directly under suggest that tuba1a-expressing progenitors contribute the control of the tuba1a promoter. To overcome this to multiple cell lineages during development and that limitation, we generated tuba1a:CreERT2 and b-actin2: tuba1a-expressing Mu¨ller glia are retinal progenitors in loxP-mCherrry-loxP-GFP double transgenic fish that the adult.
    [Show full text]
  • Pdf Breuss No 3
    © 2016. Published by The Company of Biologists Ltd | Development (2016) 143, 1126-1133 doi:10.1242/dev.131516 RESEARCH ARTICLE Mutations in the murine homologue of TUBB5 cause microcephaly by perturbing cell cycle progression and inducing p53-associated apoptosis Martin Breuss1, Tanja Fritz1, Thomas Gstrein1, Kelvin Chan1,2, Lyubov Ushakova1, Nuo Yu1, Frederick W. Vonberg1,3, Barbara Werner1, Ulrich Elling4 and David A. Keays1,* ABSTRACT abnormalities (Breuss et al., 2012; Ngo et al., 2014). Tubb5 is Microtubules play a crucial role in the generation, migration and widely expressed throughout embryonic development, and is differentiation of nascent neurons in the developing vertebrate brain. enriched in the developing cortex, where it is found in radial glial Mutations in the constituents of microtubules, the tubulins, are known to progenitors, intermediate progenitors and postmitotic neurons. As is cause an array of neurological disorders, including lissencephaly, true for the vast majority of tubulin mutations that cause human TUBB5 de novo polymicrogyria and microcephaly. In this study we explore the disease, those in are heterozygous and . The genetic and cellular mechanisms that cause TUBB5-associated preponderance of such mutations and absence of disease-causing microcephaly by exploiting two new mouse models: a conditional null alleles has led to the assertion that tubulin mutations act by a E401K knock-in, and a conditional knockout animal. These mice gain-of-function mechanism rather than haploinsufficiency (Hu present with profound microcephaly due to a loss of upper-layer et al., 2014; Kumar et al., 2010). neurons that correlates with massive apoptosis and upregulation of Here, we investigate this contention by generating an E401K p53.
    [Show full text]
  • Genomics of Inherited Bone Marrow Failure and Myelodysplasia Michael
    Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington 2015 Reading Committee: Mary-Claire King, Chair Akiko Shimamura Marshall Horwitz Program Authorized to Offer Degree: Molecular and Cellular Biology 1 ©Copyright 2015 Michael Yu Zhang 2 University of Washington ABSTRACT Genomics of inherited bone marrow failure and myelodysplasia Michael Yu Zhang Chair of the Supervisory Committee: Professor Mary-Claire King Department of Medicine (Medical Genetics) and Genome Sciences Bone marrow failure and myelodysplastic syndromes (BMF/MDS) are disorders of impaired blood cell production with increased leukemia risk. BMF/MDS may be acquired or inherited, a distinction critical for treatment selection. Currently, diagnosis of these inherited syndromes is based on clinical history, family history, and laboratory studies, which directs the ordering of genetic tests on a gene-by-gene basis. However, despite extensive clinical workup and serial genetic testing, many cases remain unexplained. We sought to define the genetic etiology and pathophysiology of unclassified bone marrow failure and myelodysplastic syndromes. First, to determine the extent to which patients remained undiagnosed due to atypical or cryptic presentations of known inherited BMF/MDS, we developed a massively-parallel, next- generation DNA sequencing assay to simultaneously screen for mutations in 85 BMF/MDS genes. Querying 71 pediatric and adult patients with unclassified BMF/MDS using this assay revealed 8 (11%) patients with constitutional, pathogenic mutations in GATA2 , RUNX1 , DKC1 , or LIG4 . All eight patients lacked classic features or laboratory findings for their syndromes.
    [Show full text]
  • University of California, San Diego
    UC San Diego UC San Diego Electronic Theses and Dissertations Title The post-terminal differentiation fate of RNAs revealed by next-generation sequencing Permalink https://escholarship.org/uc/item/7324r1rj Author Lefkowitz, Gloria Kuo Publication Date 2012 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO The post-terminal differentiation fate of RNAs revealed by next-generation sequencing A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Gloria Kuo Lefkowitz Committee in Charge: Professor Benjamin D. Yu, Chair Professor Richard Gallo Professor Bruce A. Hamilton Professor Miles F. Wilkinson Professor Eugene Yeo 2012 Copyright Gloria Kuo Lefkowitz, 2012 All rights reserved. The Dissertation of Gloria Kuo Lefkowitz is approved, and it is acceptable in quality and form for publication on microfilm and electronically: __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ __________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION Ma and Ba, for your early indulgence and support. Matt and James, for choosing more practical callings. Roy, my love, for patiently sharing the ups and downs
    [Show full text]