CORE Metadata, citation and similar papers at core.ac.uk
Provided by Louisiana State University
Louisiana State University LSU Digital Commons
LSU Doctoral Dissertations Graduate School
2002 Molecular phylogeny of Melanospora and Diaporthales, and population genetics of dogwood anthracnose fungus Ning Zhang Louisiana State University and Agricultural and Mechanical College
Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations
Recommended Citation Zhang, Ning, "Molecular phylogeny of Melanospora and Diaporthales, and population genetics of dogwood anthracnose fungus" (2002). LSU Doctoral Dissertations. 439. https://digitalcommons.lsu.edu/gradschool_dissertations/439
This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. MOLECULAR PHYLOGENY OF MELANOSPORA AND DIAPORTHALES, AND POPULATION GENETICS OF DOGWOOD ANTHRACNOSE FUNGUS
A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy In The Department of Biological Sciences
by Ning Zhang B.S., Shandong University, 1993 M.S., Chinese Academy of Sciences, 1996 May, 2002 ACKNOWLEDGEMENTS I am indebted to many people who have contributed to the work of this dissertation. First and foremost I want to thank Dr. Meredith Blackwell, my major professor, for providing me with the great opportunity to study and complete the dissertation under her direction. She is one of the rare advisors that students dream that they will find. She was there from the very first moment I came to this country. I shall never forget her elaborate guidance, thoughtful and generous support regarding research and travel, and her untiring patience to me. I am grateful for the help and support from my labmates including Sung-Oui Suh, Kevin Jones, and Alex Weir. I would like to especially thank Dr. Suh who has been providing help and advice on research throughout my study in this lab. Several undergraduate students also contributed to the work, especially LaToya Barber and Stacey Soileau who helped in the pathogenicity tests and vegetative compatibility tests, respectively. Sincere gratitude is extended to members of my committee including Drs. Julie Denslow, Kenneth Damann, David Geiser, Thomas Moore, Frederick Rainey, Frederick Sheldon, and Lowell Urbatsch. They have given me support and valuable advice to my research. I also would like to thank Nannette Crochet for technical assistance in sequencing. Cindy Henk, Ying Xiao, and Debra Waters have assisted me in electron microscopy and other lab work. This dissertation would not be accomplished without the help from a number of people outside of LSU. I want to especially acknowledge Gary Samuels, Sandra Anagnostakis, Scott Redlin, Rebecca Schultheiss, George Carroll, Rebecca Reddinger, Amy Rossman, Margery Daughtrey, Yajuan Liu, Benjamin Hall, and John Taylor. Thanks also to the Biological Computation and Visualization Center at
ii Louisiana State University from the Louisiana Board of Regents (BOR HEF (2000-05)- 01) for the financial support. Finally, I would like to thank my family. My parents, sister, and brother have always been providing me with love, encouragement, and support. I am very grateful for my husband’s understanding and help especially during preparation of the dissertation and final exam. I could not have gone this far without them.
iii TABLE OF CONTENTS ACKNOWLEDGEMENTS………………………………………….…………. ii LIST OF TABLES………………………………………………………………. v LIST OF FIGURES……………………………………………………………… vi ABSTRACT……………………………………………………………………… viii CHAPTER 1. INTRODUCTION AND LITERATURE REVIEW…….……….. 1 SYSTEMATICS OF PYRENOMYCETES…………………………….… 2 MOLECULAR PHYOGENY OF MELANOSPORA AND RELATED GENERA……………………………………………………. 10 MOLECULAR PHYLOGENY OF DISCULA DESTRUCTIVA AND THE DIAPORTHALES…………………………………………… 11 POPULATION STUDIES OF D. DESTRUCTIVA…………………….. 13 REFERENCES………………………………………….………………. 16 CHAPTER 2. MOLECULAR PHYLOGENY OF MELANOSPORA AND SIMILAR PYRENOMYCETOUS FUNGI………………. 21 INTRODUCTION………………………………………………………. 21 MATERIALS AND METHODS…………………….………...………… 23 RESULTS………………………………………………….…...……….. 27 DISCUSSION………………………………………….….……………. 32 REFERENCES…………………………………………………………... 36 CHAPTER 3. MOLECULAR PHYLOGENY OF DOGWOOD ANTH- RACNOSE FUNGUS AND THE DIAPORTHALES………….. 39 INTRODUCTION...…………………………………………………….. 39 MATERIALS AND METHODS………………………….…..………… 42 RESULTS….…………………………………………………..………… 47 DISCUSSION…………………………………………………………… 55 REFERENCES………………………………………….…..…………… 59 CHAPTER 4. POPULATION STRUCTURE OF DOGWOOD ANTHRACNOSE FUNGUS (DISCULA DESTRUCTIVA)……. 62 INTRODUCTION………………………………………………………. 62 MATERIALS AND METHODS……………………………………….. 65 RESULTS…………………………………………………………..…… 71 DISCUSSION…………………………………………………….…….. 75 REFERENCES…………………………………………………………... 79 CHAPTER 5. SUMMARY AND CONCLUSIONS………………….………… 83 APPENDIX: LETTERS OF PERMISSION………………………...…………... 87 VITA……………………………………………………………….…………….. 90
iv LIST OF TABLES 1.1. Classification of Eriksson et al. (2001) (MYCONET Outline of Ascomycota – 2001) posted at
3.2. List of taxa in Diaporthales or connected to Diaporthales sequenced in this study.……………………………………………………………..….. 43 3.3. Other taxa included in the analyses…………………………………………... 46 4.1. Discula destructiva isolates used in this study, and AFLP and pathogenicity test results.……………………………………………………. 69 4.2. Genetic diversity and pathogenicity comparison of D. destructiva isolates of different locality, time, and genotypic group……………………… 73
v LIST OF FIGURES 1.1. Molecular phylogeny of the orders of pyrenomycetes based on SSU nrDNA. sequences (after Alexopoulos et al., 1996 and Samuels and Blackwell, 2001). Spathulosporales, Laboulbeniales, Subbaromyces and Kathistes are not included. Taxon names followed Hawksworth et al. (1995). See text for exceptions…………………………… 8 2.1. Strict consensus of 67 most parsimonious trees based on partial SSU nrDNA sequences. Species of Ceratostomataceae are in bold. The tree was 371 steps with a CI of 0.542, RI of 0.788, and RC of 0.427. Bootstrap values of 50% or greater from 1000 bootstrap replications are indicated for the corresponding branches…………………… 28 2.2. The tree with the highest maximum likelihood score out of 22 most parsimonious trees based on partial LSU nrDNA sequences. Species of Ceratostomataceae are shown in bold face type. The tree was 583 steps with a CI of 0.400, RI of 0.706, and RC of 0.282. Bootstrap values of 50% or greater from 1000 bootstrap replications are indicated for the corresponding branches………………………………… 29 2.3. The most parsimonious tree based on partial RPB2 deduced amino acid sequences. The tree length is 591 steps with a CI of 0.726, RI of 0.734, and RC of 0.533. Bootstrap values of 50% or greater from 1000 bootstrap replications are indicated for the corresponding branches……………………………………………………... 31 3.1. Strict consensus of six equally most parsimonious trees of 365 steps based on SSU nrDNA. CI = 0.5479, RI = 0.8232, RC = 0.4510. Numbers above branches are bootstrap values from 200 replicates of a heuristic search. Bootstrap values lower than 50% are not shown…………. 49 3.2. Best (-ln likelihood) of ten equally most parsimonious trees of 209 steps based on LSU nrDNA. CI = 0.4976, RI = 0.6957, and RC = 0.3462. Numbers above branches are bootstrap values from 1000 replicates of a heuristic search. Bootstrap values lower than 50% are not shown…………… 50 3.3. Most parsimonious tree based on combined SSU and LSU nrDNA. The tree is of 290 steps, with CI, RI, and RC of 0.5517, 0.7466, and 0.4119, respectively. Numbers above branches are bootstrap values from 1000 replicates of a heuristic search. Bootstrap values lower than 50% are not shown. The perithecium orientation, ascospore shape and septation, the original color in potato dextrose agar (PDA), the color in 3% KOH, and the color in 85% lactic acid were mapped on the tree. a Data were not available. b Color was the same as the original. c Color was darker than the original. * D=Diaporthaceae, G=Gnomoniaceae, M= Melanconidaceae, V=Valsaceae, -=data not available. From left to right, the taxonomies were according to Wehmeyer (1975), Barr (1978), Barr (1990), and Hawksworth et al. (1995), respectively…………….. 51 3.4. Most parsimonious tree based on RPB2 amino acid sequences. The tree is of 246 steps, with CI, RI, and RC of 0.8618, 0.7888, and
vi 0.6798, respectively. Numbers above branches are bootstrap values from 1000 replicates of a heuristic search. Bootstrap values lower than 50% are not shown……………………………………………………. 53 4.1. Sampling localities. The numbers denote number of isolates from each locality. Isolates in bold face type were collected in 1999 or 2000. Others are from 1983, 1989-1991 (see Table 4.1). The circle delimits the eastern central group. Isolates outside of the circle in the east comprise the eastern frontal group…………………………………….. 66 4.2. Dendrogram of 72 D. destructiva isolates based on AFLP results using Nei and Li's genetic similarity method (1979). The similarity coefficient is indicated above the dendrogram………………………………. 72
vii ABSTRACT Unresolved phylogenetic problems in pyrenomycetes and population structure of an asexual plant pathogen (Discula destructiva) were investigated. Analyses based on DNA sequences of nuclear encoded small and large subunit RNA genes (SSU and LSU nrDNA) and deduced amino acid sequences of a subunit of RNA polymerase II gene (RPB2) indicated that five genera previously considered in Ceratostomataceae of Sordariales were related to Hypocreales. Melanospora (including the type) and a genus of Ceratostomataceae formed a basal clade, but monophyly of the five genera and of the genus Melanospora was rejected. Discula destructiva and four other Discula species were derived from within Diaporthales according to the SSU and LSU nrDNA and RPB2 phylogenies. There were three clades in the LSU nrDNA phylogeny. The five Discula species were in one of the clades but they were not monophyletic. This delimitation is congruent with anamorph and pigmentation distributions in the diaporthalean taxa but is not congruent with family concepts based on other phenotypic characters. Taxa of Magnaporthaceae were excluded from the Diaporthales, but its phylogenetic position remains unresolved. Preliminary studies of the evolutionary mechanisms of D. destructiva involved investigation of its population structure. Two distinct groups of D. destructiva isolates, one from the western U. S. and the other from the eastern U. S., were identified with amplified fragment length polymorphism (AFLP) markers and sequences of several genes. Discula destructiva is thought to have been introduced to North America in late 1970s. The remarkably low genetic diversity compared to other asexual fungi indicated that D. destructiva is still under intense selection pressure and that episodic selection may still be in effect. However, the transition to a less virulent, heterogeneous population might have begun in the New York City area, a possible epidemic center in the east, which had relatively higher genetic diversity than the samples from other areas.
viii CHAPTER 1. INTRODUCTION AND LITERATURE REVIEW Fungi have existed for over 900 million years based on fossil calibrated molecular clock estimations (Berbee and Taylor, 2001; Blackwell, 2000; Heckman et al., 2001). These organisms are adapted to a wide variety of habitats and have made a great impact on all ecosystems (Alexopoulos et al., 1996). Wood-decaying basidiomycetes decompose cellulose and lignin substrates in forests and recycle nutrients. Symbiotic fungi associate with cyanobacteria, algae, or plants to form lichens, endophytes, and mycorrhizae, and in different ways, all the associated organisms benefit from symbiosis. There also are pathogenic fungi, however, causing diseases of plants, animals, or other fungal species. For example, Cryphonectria parasitica, the agent of the chestnut blight disease, swept over the North American chestnut forests during the last century, and turned the American chestnut into an understory shrub (Anagnostakis, 1987). Hawksworth (1991) estimated that there are 1.5 million species of fungi, of which only 72,000 species have been described (Hawksworth et al., 1995). Of the five major groups of the Kingdom Fungi, Ascomycota is the largest and most complex phylum. The group contains over 32,000 described species, which is about the total number of the four other phyla (Chytridiomycota, Zygomycota, Glomales, and Basidiomycota) (Hawksworth et al., 1995). The taxa studied in this dissertation are a derived group of ascomycetes with ovoid to cylindrical unitunicate (one-functional layered) asci in perithecial (flask-shaped) or occasionally cleistothecial (completely closed) ascomata. These ascomycetes often are referred to as pyrenomycetes, and they are fungi of great interest and economic importance due to their broad range of biological associations with other organisms. The group includes parasites of plants (e.g. Gaeumannomyces graminis, the take-all disease of cereal grasses), animals (e.g., Sporothrix schenckii, rose-grower’s disease), and fungi
1 (e.g., Fusarium); endophytes of a variety of plants; mycotoxin producers; and important model organisms for genetic research (e.g., Neurospora). SYSTEMATICS OF PYRENOMYCETES Historically, systematics of pyrenomycetes has been based on morphology of mature ascomatal structures and developmental characters. About a century ago, Saccardo (1882-1931) classified ascomycetous taxa based on ascospore color and septation, and he grouped a number of heterogeneous species together. This classification was largely artificial at the higher taxonomic levels and is not applicable today. Nannfeldt (1932) and Luttrell (1951), for the first time, emphasized the type of ascus dehiscence over many other morphological characters, and they separated pyrenomycetes with unitunicate asci from thick-walled, two-layered bitunicate ascomycetous taxa, known as Loculoascomycetes (Barr, 1990; Wehmeyer, 1975). The separation was well supported by the developmental and molecular characters (Alexopoulos et al., 1996; Winka, 2000). Nannfeldt (1932) also used ascomal ontogeny as a criterion of classification. The idea was accepted and extended by Luttrell (1951) who developed the centrum concept that emphasized the totality of the ascomal component, the centrum, which includes all sterile structures among or around asci and ascospores. He defined four centrum types in pyrenomycetes, which were the basis for assessing relationships among orders of pyrenomycetes until relatively recently (Alexopoulos et al., 1996; Barr, 1990; Samuels and Blackwell, 2001). Since that time, a number of developmental studies of the taxa in pyrenomycetes, and many corrections and new centrum types have been described (Goh and Hanlin, 1994; Huang, 1976; Jensen, 1984; Mhasker and Rao, 1976; Uecker 1976; Samuels, 1973). Samuels and Blackwell (2001) summarized recent developmental studies of pyrenomycetous fungi and outlined ten centrum types. Although centrum development is an informative character at some taxonomic level, it does not always correspond with the results of
2 molecular phylogenetics or morphology (Samuels and Blackwell, 2001). The classification of pyrenomycetes below ordinal level had been based largely on characters such as ascomal texture and shape, ascus morphology and persistence, and ascospore color. Because an asexual life cycle state (anamorph) is common in many groups of pyrenomycetes, it also has been considered as an informative character. Several broad trends in anamorph associations are correlated with other characters found in pyrenomycetes, and they may contribute to the systematics of the group (Samuels and Blackwell, 2001). Secondary metabolites also have been treated as characters in fungal taxonomy; however, an investigation of their pathways and distributions in pyrenomycetes still is in a preliminary stage, which limits their application in the systematics (Rossman et al., 1999; Whalley and Edwards, 1987). Although the systematic study of fungi began more than 250 years ago and has undergone modification continually, the biggest changes have come in the last two decades due to the availability of molecular characters. Most systematists agree that the best classification is one that reflects the evolutionary history of organisms (Hennig, 1966; Wiley, 1981). Unfortunately, morphological traits may be the result of extreme convergence or homoplasy, and loss and rapid modification of characters are very common (Alexopoulos et al., 1996; Samuels and Blackwell, 2001). Because of these problems, traditional taxonomy, which has relied largely on morphology, does not always reflect the natural evolutionary relationships among the organisms. Molecular data, mainly from DNA and proteins, have contributed a wealth of new characters to the study of evolution. Compared to other characters, these are much more numerous and ubiquitous. Most importantly, homology determination for molecular data usually is less biased. Systematists have benefited from rapid progress in many fields of molecular biology, which provides background knowledge for understanding evolution at the
3 molecular level and building better models of molecular data analysis (Huelsenbeck and Crandall, 1997; Li, 1997; Yang, 1995). Application of phylogenetic techniques and use of molecular characters have been important to infer evolutionary history and test taxonomy based on morphological or developmental characters as well. In pyrenomycetes, molecular phylogenetic studies began in the early 1990s (Berbee and Taylor, 1992; Spatafora and Blackwell, 1993), and the most widely used molecular data from pyrenomycetes for phylogentic studies have been sequences of the nuclear encoded small and large subunit ribosomal RNA genes (SSU nrDNA and LSU nrDNA). Generally, SSU nrDNA is used to resolve phylogenetic relationships at the family, ordinal, or higher levels, because it is conservative and evolves at a slow rate. LSU nrDNA has a higher evolutionary rate and has been used for the species, generic, and family level phylogenic studies in fungi (Andersson et al., 1995; Berbee and Taylor, 1992, 1995; Rehner and Samuels, 1995; Spatafora, 1992; Spatafora and Blackwell, 1993, 1994a,b). Sequence data of the internal transcribed and intergenic spacers of the ribosomal RNA gene (ITS and IGS) accumulate changes rapidly and are useful in generic or lower taxonomic level studies, especially for discrimination of plant pathogenic species (Appel and Gordon, 1996; Myburg et al., 1999). SSU nrDNA analysis supports a monophyletic grouping of a number of orders of pyrenomycetous fungi (Fig. 1.1), but little additional data have been considered to support the conclusions based on that gene. The name “pyrenomycete” used here is not a formal taxon (Hawksworth et al., 1995; Samuels and Blackwell, 2001; Winka, 2000) but is used as a matter of tradition and convenience. Most formal taxa used follow the usage in the most recent Ainsworth and Bisby’s Dictionary of the Fungi (Hawksworth et al., 1995) unless otherwise annotated. There are, however, groupings of fungi revealed by molecular analyses that have no names, but which are not well corroborated. Several
4 suggestions to accommodate these situations have been made. The use of clade names (Hibbett and Donoghue, 1998) with no formal taxon description would be both simple to apply and easily changed with little confusion as new data showed a need for taxonomic changes in phylogenetic classifications. A more formal system is gaining acceptance based on the number of times it has been cited recently. The Outline of Ascomycota is updated periodically and is accompanied by an on-line site (Myconet) maintained by Eriksson and his colleagues (1999, http://www.umu.se/myconet/publ.html). The
Myconet classification is based on analyzed molecular data and morphological data used intuitively, and includes paraphyletic groups and those with low bootstrap support. All names are based on a genus name. The classification is intended to be plastic, and archival classifications necessary for reference are maintained on the web site. As shown in Table 1.1, Class Sordariomycetes is equilavent to the informally used “pyrenomycetes,” and the group is subdivided into three subclasses, not all of which correspond to the findings presented here. In addition the classification serves to emphasize that the taxon sampling for molecular studies, even of this relatively well- defined group, still is incomplete. In pyrenomycetes, an early divergence occurred resulting in a basal and a core group (Fig. 1.1). The basal group contains the order Meliolales (black powdery mildews, obligate plant parasites) (Saenz and Taylor, 1999) and two genera previously placed in Halosphaeriales (marine pyrenomycetes). The marine genera, Lindra and Lulworthia, have been removed to a new order, Lulworthiales (Kohlmeyer et al., 2000). Eriksson and colleagues (2001), however, considered both Meliolales and Lulworthiales as “orders of uncertain position.” The core group diverged into two subclades. One includes Ophiostomatales, Diaporthales, Sordariales, and Xylariales, generally corresponding to Subclass Sordariomycetidae (Ophiostomatales, Diaporthales, and Sordariales, including
5 Table 1.1. Classification of Eriksson et al. (2001) (MYCONET Outline of Ascomycota – 2001) posted at
Class Sordariomycetes Subclass Hypocreomycetidae Order Halosphaeriales 1. Halosphaeriaceae Order Hypocreales 1. Bionectriaceae 2. Clavicipitaceae 3. Hypocreaceae 4. Nectriaceae 5. Niessliaceae Order Microascales 1. Chadefaudiellaceae 2. Microascaceae Subclass Sordariomycetidae Order Diaporthales 1.Melanconidaceae 2. Valsaceae 3. Vialaeaceae Order Ophiostomatales 1. Kathistaceae 2. Ophiostomataceae Order Sordariales 1. Annulatascaceae 2. Batistiaceae 3. Boliniaceae 4. Catabotrydaceae 5. Cephalothecaceae 6. Ceratostomataceae 7. Chaetomiaceae 8. Chaetosphaeriacae 9. Coniochaetaceae 10. Helminthosphaeriaceae 11. Lasiosphaeriaceae 12. Nitschkiaceae 13. Sordariaceae Sordariomycetidae inc. sed. 1. Papulosporaceae Subclass Xylariomycetidae Order Xylariales 1. Amphisphaeriaceae 2. Clypeosphaeriaceae (table 1.1 continued)
6 3. Diatrypaceae 4. Graphostromataceae 5. Hyponectriaceae 6. Xylariaceae Sordariomycetes: Orders of uncertain positions Order Calosphaeriales 1. Calosphaeriaceae Order Lulworthiales 1. Lulworthiaceae Order Meliolales 1. Meliolaceae Order Phyllachorales 1. Phaeochoraceae 2. Phyllachoraceae Order Trichosphaeriales 1. Trichosphaeriaceae Sordariomycetes: Families of uncertain positions Apiosporaceae Magnaporthaceae Obryzaceae Thyridiaceae
7 Hypocreales Melanospora Microascales Halosphaeriales Phyllachorales Core Group Diaporthales Sordariales Ophiostomatales
Xylariales
Meliolales Lindra Basal Group Lulworthia
Fig. 1.1. Molecular phylogeny of the orders of pyrenomycetes based on SSU nrDNA. sequences (after Alexopoulos et al., 1996 and Samuels and Blackwell, 2001). Spathulosporales, Laboulbeniales, Subbaromyces and Kathistes are not included. Taxon names followed Hawksworth et al. (1995). See text for exceptions.
8 Melanospora) and Subclass Xylariomycetidae (Xylariales) (Eriksson et al., 2001). The further subdivision of the subclade by setting off the Xylariales is supported by a number of studies (e.g., Zhang and Blackwell, 2001). The second subclade of the core pyrenomycetes includes Hypocreales, Microascales, Halosphaeriales, Phyllachorales, and several species of Melanospora (Alexopoulos et al., 1996; Berbee and Taylor, 1992; Blackwell and Spatafora, 1994; Kohlmeyer et al., 2000; Samuels and Blackwell, 2001; Spatafora, 1992; Spatafora et al., 1998; Spatafora and Blackwell, 1993,1994a,b), and corresponds to Subclass Hypocreomycetidae (Hypocreales, Microascales, and Halosphaeriales) (Eriksson et al., 2001). Species of Spathulosporales, parasites of marine red algae, have been considered closely related to certain core group taxa, but without molecular data, the order is omitted from the phylogeny presented in Fig. 1.1. Species of Laboulbeniales, Subbaromyces, and Kathistes (retained in Ophiostomatales by Eriksson et al., 2001) lie outside of the limits of the pyrenomycetes (Alexopoulos et al., 1996; Blackwell, 1994; Blackwell and Malloch, 1989; Weir and Blackwell, 2001), and have not been included here. Molecular phylogenetic studies have helped to resolve many taxonomic problems in the pyrenomycetes. One example is the finding that clavicipitalean species were derived from within Hypocreales, which is not obvious from morphology or biology. This discovery also provided insight into the evolution of certain morphological and developmental characters in a reinterpretation of the centrum concept (Luttrell, 1951; Spatafora and Blackwell, 1993). However, because molecular phylogenetic studies are less than two decades old, most fungal species still have not been investigated using the new tools. Over 4,000 pyrenomycete species have been described, but less than 5% have been incorporated in a phylogenic tree (Alexopoulos et al., 1996; Hawksworth et al., 1995; Samuels and Blackwell, 2001). Species in most genera and many families have never been sampled, and the relationships of the orders within pyrenomycete lineages
9 mentioned above are not fully resolved, partly due to the poor taxa sampling (see, Table 1.1). Addition of more data, both taxa and genes, should result in a better understanding of fungal evolutionary history. The studies presented here in Chapter 2 and Chapter 3 investigated a variety of taxa in Melanospora and the Diaporthales of the pyrenomycetes, and attempted to clarify long-debated taxonomic problems, especially those at the ordinal and family levels, by use of molecular methods. MOLECULAR PHYOGENY OF MELANOSPORA AND RELATED GENERA Melanospora has been a taxonomically problematic genus of pyrenomycetes and has been placed in several different orders since Corda (1837) erected it about two centuries ago. Traditionally, Melanospora was characterized by translucent perithecial ascomata, pseudoparenchymatous centra, absence of paraphyses in development, clavate evanescent asci, and dark-colored ascospores with germ pores at both ends (Alexopoulos et al., 1996; Hawksworth et al., 1995). Over a hundred species had been placed in the genus, and more than half of these have been segregated by a number of authors into other genera because of their great morphological heterogeneity, such as ascospore ornamentation, shape, and aperture (von Arx, 1981; Doguet, 1955; Hawksworth and Udagawa, 1977). To clarify the vague limits of the genus, Cannon and Hawksworth (1982) with the aid of the scanning electron microscope, proposed that only the species with smooth, ellipsoidal to citriform ascospores, and non-tuberculate germ pores would be retained in Melanospora; those with ornamented or differently shaped ascospores were placed in segregate genera. The monophyly of Melanospora sensu Cannon and Hawksworth (1982) and its phylogenetic relationships with morphological allies were tested in the study (Chapter 2). The ranking and placement of Melanospora and its allies also has been a problem. These species have been included in several different orders because of their conflicting combination of morphological and developmental characters in relation to
10 Luttrell’s centrum concept (Alexopoulos et al., 1962; Barr, 1990; Hawksworth et al. 1995, Luttrell, 1951; Samuels and Blackwell, 2001). These include species from the Ceratostomataceae of the Sordariales. Two species of the genus (M. zamiae, the type, and M. fallax) had been included in previous phylogenic studies using SSU and LSU nrDNA sequences by two groups of mycologists (Rehner and Samuels, 1995; Spatafora and Blackwell, 1994a). Although those studies indicated a close relationship of the two species and Hypocreales, the SSU nrDNA data had placed the Melanospora species outside of the Hypocreales (Spatafora and Blackwell, 1994a), while LSU nrDNA phylogeny indicated that they were derived from within the Nectria group of the Hypocreales (Rehner and Samuels, 1995). The discrepancy has been suggested as being caused by long-branch attraction or poor taxa sampling (see Felsenstein, 1978). Another possible reason for the discrepancy was the identity of sequences previously deposited in GenBank. This study (Chapter 2) sought to answer the following questions using additional data from deduced amino acid sequence data of a protein coding gene (the gene encoding the second largest subunit of RNA polymerase II) and from broader taxon sampling: (1) Is Melanospora a monophyletic group? (2) Does it have a close relationship with its morphological allies? and (3) How is it related to other groups of pyrenomycetes? MOLECULAR PHYLOGENY OF DISCULA DESTRUCTIVA AND THE DIAPORTHALES Another long-debated problem in pyrenomycetes is the family delimitation in the order Diaporthales. Historically, morphological features such as structure of the perithecium, ascus persistency, and ascospore shape and septation were used to circumscribe taxa in the Diaporthales. As stated earlier, morphology has not always been reliable, especially in higher level taxonomy because of the great variation and convergence of phenotypic characters, and, moreover, emphasis of different features. Table 3.1 summarizes the family concepts proposed by several investigators and the
11 basis of their taxonomic decisions (Barr, 1978, 1990; Hawksworth et al., 1995; Nannfeldt, 1932; Luttrell, 1951; Wehmeyer, 1975;). Also, see Table 1.1 for a list of families that have been recognized more recently (Eriksson et al., 2001). Numerous DNA sequences of taxa in the Diaporthales have been obtained and published, which can be accessed from public databases, TREEBASE (http://herbaria.harvard.edu/treebase/) and GenBank (http:// www.ncbi.nlm.nih.gov/entrez). However, only a small portion of the molecular data had been used for phylogenetic purposes. Spatafora and Blackwell (1993) investigated the ordinal placement of a number of perithecial ascomycetes, including two species of the Diaporthales. More recent work on diaporthalean fungi has focused on pathogenicity and phylogenetic studies below the genus level. In fact, there had been no family-level molecular phylogenetic studies in the Diaporthales, and the work presented in Chapter 3 was done to rectify this situation. Another purpose of this work was to test the phylogenetic position of an asexually reproducing fungus, Discula destructiva, in a Diaporthales clade. Discula destructiva Redlin is the causal agent of Dogwood anthracnose, a relatively new disease to North America (Redlin, 1991). The disease broke out in the late 1970s on both northeastern and northwestern coasts of the U.S. and spread rapidly to the native dogwood trees in over 20 states (Daughtrey and Hibben, 1994). Because the disease has not been found anywhere except North America and because a sexual state of D. destructiva was unknown, the geographical and phylogenetic origins of the fungus still were mysteries. The fact that several diaporthalean species have Discula asexual states led to a hypothesis that D. destructiva might have a teleomorph in the Diaporthales (Mielke and Langdon, 1986; Redlin, 1991; Schneeberger and Jackson, 1989), but this had not been verified.
12 Asexual taxa lack the characters of sexual reproduction upon which fungal classification is based, but molecular characters are ubiquitous, and are able to incorporate asexual fungi in a phylogeny among their sexual relatives. The hypothesis that D. destructiva was derived from within the Diaporthales was tested using nrDNA phylogenies in Chapter 3. POPULATION STUDIES OF D. DESTRUCTIVA Evolution is a basic characteristic of life and there are two main areas of study in evolutionary biology. One is the evolutionary history of various organisms, the other is the mechanism of evolution (Nei, 1987). A better understanding of the mechanism helps in reconstructing the evolutionary history of organisms. On the other hand, the knowledge of the tree of life is basis to the study of evolutionary mechanism, and it also can test the hypotheses or theories about the mechanism of evolution (Croft, 1987). Until half a century ago, the two areas were studied somewhat independently by different groups of scientists. Evolutionary history has been studied by systematists, paleobiologists, and embryologists by analyzing fossil records, development, and morphological characters of various organisms. Fossil records are the most reliable and direct among all the methods, and even today’s molecular clock studies need fossil data for calibration (Berbee and Taylor, 2001; Wray et al., 1997; Heckman et al., 2001). The biggest drawback of the fossil record in evolutionary studies is that it is far from adequate and often cannot be interpreted, especially for fungi (Alexopoulos et al., 1996). Therefore, the study of fungal systematics had to largely rely on morphological and developmental characters. However, most of these characters are not ubiquitous in all organisms, and even in a lower taxonomic level study, they could be misleading. The basic questions in the studies of evolutionary mechanisms include (1) what is the source of genetic variation in a population, (2) how is genetic variation maintained, and (3) what are the forces that drive evolution. These questions were the realm of
13 population geneticists and analysis had been restricted to groups of organisms in the same species. The barrier between the two areas of study has been removed with the introduction of molecular techniques, especially after the development of DNA sequencing, polymerase chain reaction (PCR), and restriction enzyme methods (Li, 1997; Nei, 1987). A number of molecular markers have been applied to both intra- and inter- species level studies, and for the first time, data are integrated and mutually useful in both of the study areas. For example, ITS is commonly used to infer fungal phylogenies of closely related species, as well as to access the variability of a population and even the relationship among individuals. With the DNA amplification fingerprinting method (DAF), Trigiano et al. (1995) compared the genetic diversity of D. destructiva populations, with that of other Discula species. The results showed that D. destructiva was highly homogenous across its broad continental range, while the other Discula species showed much more intraspecific variability. Based on these results D. destructiva was suspected of being a recently introduced fungus probably still under intense selection pressure. Discula destructiva offered a good opportunity to study fungal evolutionary mechanisms. The relatively high genetic homogeneity might be explained by the episodic selection theory of Brasier (1987, 1995) that was based on a model of rapidly evolving fungal pathogens. It states that a sudden environmental disturbance, such as climate change, geographic transposition, access to a new host or vector, is likely to lead to the emergence of a highly virulent clone from an originally heterogeneous sexual population. Under these conditions intense selection pressure eliminates or suppresses less fit genotypes. If selection pressure is eased, the population reverts to an outcrossing, highly heterogeneous population. Continued episodic selection, however, may result in speciation. With both recent and older D. destructiva samples available, we aimed to
14 detect whether selection pressure had eased and to find the epidemic center by comparing genetic diversity among groups delimited according to collection time and geographical location (Chapter 4). How to define a fungal species is an unresolved problem, and it is even more difficult and confusing for fungi that apparently have lost the capability for sexual reproduction as has D. destructiva. The classic biological species concept (Mayr, 1963) obviously is not applicable to asexual fungi, because it cannot be determined whether they can interbreed. Theoretically, several other species concepts defined from ecological, genealogical, or phylogenetic perspectives can be applied to asexual organisms (Baum and Shaw, 1995; Nixon and Wheeler, 1990; Van Valen, 1976). However, they are either not practical or not appropriate to delimit asexual fungal species (Harrington and Rizzo, 1999; Taylor et al., 2000). Harrington and Rizzo (1999) slightly modified Nixon and Wheeler’s (1990) phylogenetic species concept and defined species as “…the smallest aggregation of populations with a common lineage that share unique, diagnosable phenotypic characters.” According to this concept, some morphological or physiological differences are the basis for species delimitation. Taylor and colleagues (2000) adopted the genealogical concordance concept (Avise and Ball, 1990; Baum and Shaw, 1995) and developed another species recognition method for fungi. The method requires the comparison of more than one gene genealogy. The transition points in the genealogies from concordance among branches to incongruity identify the point at which species are delimited. Population variability and gene genealogies of D. destructiva were accessed in this study by using a highly sensitive DNA fingerprinting method and sequencing of several genes (Chapter 4). In this chapter the possibility of speciation based on degree of divergence was discussed. It was concluded that the time interval of the samples used in
15 the study was too short to measure much genetic change from an evolutionary perspective, even for a fast-evolving microorganism (Papadopoulos et al., 1999), these results will serve as a baseline for future work. REFERENCES Alexopoulos, C. J., Mims, C. W., and Blackwell, M. 1996. Introductory Mycology. 4th ed. New York: John Wiley and Sons Inc. Anagnostakis, S. L. 1987. Chestnut blight: the classical problem of an introduced pathogen. Mycologia 79: 23-37. Andersson, K., Eriksson, O. E., and Landvik, S. 1995. Boliniaceae transferred to Sordariales (Ascomycota). Systema Ascomycetum 14: 1-16. Appel, D. J. and Gordon, T. R. 1996. Relationships among pathogenic and nonpathogenic isolates of Fusarium oxysporum based on the partial sequences of the intergenic spacer region of the ribosomal DNA. Molecular Plant-Microbe Interactions 9: 125-138. von Arx, J. A. 1981. The Genera of Fungi Sporulating in Pure Culture. 3rd ed. J. Cramer, Vaduz. Avise, J. C. and Ball, R. M., Jr. 1990. Principles of genealogical concordance in species concepts and biological taxonomy. In: Oxford Surveys in Evolutionary Biology. Futuyma, D. and Antonovics, J. eds. Vol. 7, pp. 45-67. Oxford University Press, Oxford, UK. Barr, M. E. 1978. The Diaporthales in North America with emphasis on Gnomonia and its segregates. Mycol. Mem. 7: 1-232. Barr, M. E. 1990. Prodromus to nonlichenized, pyrenomycetous members of class hymenoascomycetes. Mycotaxon 39: 43-184. Baum, D. A. and Shaw, K. L. 1995. Genealogical perspectives on the species problem. In: Experimental and Molecular Approaches to Plant Biosystematics. Hoch, P. C. and Stephenson, A. G. eds. Missouri Botanical Garden, St. Louis, Missouri, pp. 289-303. Berbee, M. L. and Taylor, J. W. 1992. Two ancomycete classes based on fruiting-body characters and ribosomal DNA sequence. Mol. Biol. Evol. 9: 278-284. Berbee, M. L. and Taylor, J. W. 1995. From 18S ribosomal sequence data to evolution of morphology among the fungi. Can. J. Bot. 73 (Suppl. 1): S677-S683. Berbee, M. L. and Taylor, J. W. 2001. Fungal molecular evolution: gene trees and geologic time. In: The Mycota. VII. Systematics and Evolution. Part B. McLaughlin D. J., McLaughlin, E. G., and Lemke, P. A. eds. Springer-Verlag, Berlin, Germany. pp. 229-245.
16 Blackwell, M. 1994. Minute mycological mysteries: the influence of insects on the lived os fungi. Mycologica 86: 1-17. Blackwell, M. 2000. Terrestrial life—fungal from the start? Science 289: 1884-1885. Blackwell, M. and Malloch, D. 1989. Pyxidiophora: life histories and arthropod associations of two species. Can. J. Bot. 67: 2552-2562. Blackwell, M. and Spatafora, J. W. 1994. Molecular data sets and broad taxon sampling in detecting morphological convergence. In: Ascomycete Systematics: Problems and Perspectives in the nineties. Hawksworth, D. L. ed. Plenum Press, New York, pp. 243- 248. Brasier, C. M. 1987. The dynamics of fungal speciation. In: Evolutionary Biology of the Fungi. Edited by Rayner, A. D. M., Brasier, C. M., and Moore, D. Cambridge University Press, England. pp. 231-260. Brasier, C. M. 1995. Episodic selection as a force in fungal microevolution, with special reference to clonal speciation and hybrid introgression. Can. J. Bot. 73 (Suppl. 1): S1213-S1221. Cannon, P. F. and Hawksworth, D. L. 1982. A re-evaluation of Melanospora Corda and similar pyrenomycetes, with a revision of the British species. Botanical Journal of the Linnean Society 84: 115-160. Corda, A. C. I. 1837. Icones Fungorum. vol. 1. J. G. Calve. Prague. Croft, J. H. 1987. Genetic variation and evolution in Aspergillus. In: Evolutionary Biology of the Fungi. Rayner, A. D. M., Brasier, C. M., and Moore, D. eds. Cambridge University Press, Cambridge, UK. pp. 311-324. Daughtrey, M. L. and Hibben, C. R. 1994. Dogwood anthracnose: a new disease threatens two native Cornus species. Annu. Rev. Phytopathol. 32: 61-73. Doguet, G. (1955) Le genre Melanospora biologie, morphologie, développement, systématique. Botaniste 39: 1-313. Eriksson O.E., ed. 1999. Outline of Ascomycota - 1999. Myconet 3: 1-88. Eriksson, O. E. (ed), Baral, H.-O., Currah, R. S., Hansen, K., Kurtzman, C. P., Rambold, G., and Laessøe, T. 2001. Outline of Ascomycota – 2001. Myconet
17 Hawksworth, D. L. 1991. The fungal dimension of biodiversity: magnitude, significance, and conservation. Mycol. Res. 95: 641-655. Hawksworth, D. L., Kirk, P. M., Sutton, B. C., and Pegler, D. M. 1995. Ainsworth and Bisby’s Dictionary of the fungi. 8th ed. Egham, UK: CAB International. 616 pp. Hawksworth, D. L. and Udagawa, S. 1977. Contributions to a monograph of Microthecium. Transactions of the Mycological Society of Japan 18: 143-154. Heckman, D. S., Geiser, D. M., Eidell, B. R., Stauffer, R. L., Kardos, N. L., and Hedges, S. B. 2001. Molecular evidence for the early colonization of land by fungi and plants. Sciences: 293: 1129-1133. Hennig, W. 1966. Phylogenetic Systematics. University of Illinois Press, Urbana. Hibbett, D. S. and Donoghue, M. J. 1998. Integrating phylogenetic analysis and classification in fungi. Mycologia 90: 347-356. Huang, L. H. 1976. Developmental morphology of Triangularia backusii (Sordariaceae). Can. J. Bot. 54: 250-267. Huelsenbeck, J. P. and Crandall, K. A. 1997. Phylogeny estimation and hypothesis testing using maximum likelihood. Annu. Rev. Ecol. Syst. 28: 437-466. Jensen, J. D. 1984. Morphologic Studies in the Pyrenomycetes. Washington State University, Pullman. Kohlmeyer, J., Spatafora, J. W., and Volkmann-Kohlmeyer. 2000. Lulworthiales, a new order of marine Ascomycota. Mycologia 92: 453-458. Li, W.-H. 1997. Molecular Evolution. Sinauer Associates, Inc., Sunderland, MA. Luttrell, E. S. 1951. Taxonomy of the Pyrenomycetes. Univ Missouri Stud Sci Ser 24(3):1-120. Mayr, E. 1963. Populations, Species, and Evolution. Harvard University Press, Cambridge, Massachusetts. Mhasker, D. N. and Rao, V. G. 1976. Development of the ascocarp in Epichloë cinerea (Clavicipitaceae). Mycologia 68: 994-1001. Mielke, M. E. and Langdon, K. 1986. Dogwood anthracnose threatens Catoctin Mt. Park. Park Sci. Winter: 6-8. Myburg, H., Wingfiedl, B. D., and Wingfield, M. J. 1999. Phylogeny of Cryphonectria cubensis and allied species inferred from DNA analysis. Mycologia 91: 243-250. Nannfeldt, J. A. 1932. Studien über die morphologie und systematik der nichtlichenisierten inooperculaten Discomyceten. Nova Acta Reg. Soc. Sci. Uppsaliensis ser. IV, 8: 1-368.
18 Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press. New York. Nixon, K. C. and Wheeler, Q. D. 1990. An amplification of the phylogenetic species concept. Cladistics 6: 211-223. Papadopoulos, D., Schneider, D., Meier-Eiss, J., Arber, W., Lenski, R. E., and Blot, M. 1999. Genomic evolution during a 10,000-generation experiment with bacteria. Proc. Natl. Acad. Sci. USA. 96: 3807-3812. Redlin, S. C. 1991. Discula destructiva sp. nov., cause of dogwood anthracnose. Mycologia 83: 633-642. Rehner, S. A., and Samuels, G. J. 1995. Molecular systematics of the Hypocreales: a teleomorph gene phylogeny and the status of their anamorphs. Can. J. Bot. 73 (Suppl 1): S816-S823. Rossman, A. Y., Samuels, G. J., Rogerson, C. T., and Lowen, R. 1999. Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes). Studies in Mycology 42: 1-248. Saccardo, P. A. 1882-1931. Sylloge Fungorum. 1-25. Saenz, G. S. and Taylor, J. W. 1999. Phylogenetic relationships of Meliola and Meliolina inferred from nuclear small subunit rRNA sequences. Mycol. Res. 103: 1049- 1056. Samuels, G. J. 1973. Perithecial development in Hypomyces aurantius. Amer. J. Bot. 60: 268-276. Samuels, G. J. and Blackwell, M. 2001. Pyrenomycetes. In: The Mycota. Vol. VII, Part A. Systematics and Evolution. McLaughlin, D. J., McLaughlin, E. G., and Lemke, P. A. eds. pp. 221-255. Springer-Verlag, Berlin, Germany. Schneeberger, N. F. and Jackson, W. 1989. Impact of dogood anthracnose on flowering dogwood at Catoctin Mountain Park. Pl. Diagnostician’s Quat. 10: 30-43. Spatafora, J. W. 1992. The Molecular Systematics of Unitunicate, Perithecial Ascomycetes. Louisiana State University and Agricultural and Mechanical College. Louisiana. Spatafora, J. W., and Blackwell, M. 1993. Molecular systematics of unitunicate perithecial ascomycetes: the Clavicipitales-Hypocreales connection. Mycologia 85:912- 922. Spatafora, J. W. and Blackwell, M. 1994a. Cladistic analysis of partial ssrDNA sequences among unitunicate perithecial ascomycetes and its implications on the evolution of centrum development. In: Ascomycete Systematics: Problems and Perspectives in the nineties. Hawksworth, D. L. ed. Plenum Press, New York, pp. 233- 242. Spatafora, J. W. and Blackwell, M. 1994b. The polyphyletic origins of ophiostomatoid fungi. Mycol. Res. 98: 1-9.
19 Spatafora, J. W., Volkmann-Kohlmeyer, B., and Kohlmeyer, J. 1998. Independent terrestrial origins of the Halosphaeriales (marine Ascomyctoa). Amer. J. Bot. 85: 1569- 1580. Taylor, J. W., Jacobson, D. J., Kroken, S., Kasuga, T., Geiser, D. M., Hibbett, D. S., and Fisher, M. C. 2000. Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21-32. Trigiano, R. N., Caetano-Anollés, G., Bassam, B. J., and Windham, M. T. 1995. DNA amplification fingerprinting provides evidence that Discula destructiva, the cause of dogwood anthracnose in North America, is an introduced pathogen. Mycologia 87: 490- 500. Uecker, F. A. 1976. Development and cytology of Sordaria humana. Mycologia 68: 30- 46. Van Valen, L. 1976. Ecological species, multispecies, and oaks. Taxon 25: 233-239. Wehmeyer, L. E. 1975. The pyrenomycetous fungi. Mycol. Mem. 6:1-250. Weir, A. and Blackwell, M. 2001. Molecular data support the Laboulbeniales as a separate class of Ascomycota, Laboulbeniomycetes. Mycol. Res. 105: 715-722. Whalley, A. J. S. and Edwards, R. L. 1987. Xylariaceous fungi: use of secondary metabolites. In: Evolutionary Biology of the Fungi. Rayner, A. D. M., Brasier, C. M., and Moore, D. eds. Cambridge University Press, Cambridge, UK. 423-434pp. Wiley, E. O. 1981. Phylogenetics: The Theory and Practice of Phylogenetics. Systematics. John Wiley and Sons, New York. 439pp. Winka, K. 2000. Phylogenetic Relationships within the Ascomycota Based on 18S rDNA Sequences. Umeå University, Sweden. Wray, G. A., Levinton, J. S., and Shapiro, L. H. 1997. Molecular evidence for deep Precambrian divergences among Metazoan phyla. In: Evolution. Ridley, M. ed. Oxford University Press. Oxford, UK. pp. 319-326. Yang, Z. 1995. A space-time process model for the evolution of DNA sequences. Genetics 139: 993-1005. Zhang, N. and Blackwell, M. 2001. Molecular phylogeny of dogwood anthracnose fungus (Discula destructiva) and the Diaporthales. Mycologia 93: 355-365.
20 CHAPTER 2. MOLECULAR PHYLOGENY OF MELANOSPORA AND SIMILAR PYRENOMYCETOUS FUNGI1
INTRODUCTION Most species of Melanospora are parasitic on or closely associated with other fungi. They have a wide host range including basidiomycetes and both sexual and asexual ascomycetes. The wilt disease fungus Fusarium oxysporum is one of the most common hosts, and some Melanospora species fuse with the host protoplasts to obtain nutrients, an interaction called fusion biotrophism (Jeffries and Young, 1994). Species of Melanospora are potential biocontrol agents because of the damage they cause to the plant pathogenic hosts (Harveson, 1999). Melanospora is a genus with rather vague limits. Traditionally, it was characterized by translucent perithecial ascomata, pseudoparenchymatous centra, absence of paraphyses in development, clavate evanescent asci, and dark coloured ascospores with germ pores at both ends. Over a hundred taxa have been assigned to this genus since Corda (1837) erected it. In the last comprehensive survey, Doguet (1955) listed forty-five species of Melanospora and regarded others as synonyms. With the aid of the scanning electron microscope (SEM), Cannon and Hawksworth (1982) further restricted the range of this genus based on ascospore morphology. Species with smooth, ellipsoidal to citriform ascospores and non-tuberculate germ pores were retained in Melanospora; those with wall ornamentations or ascospores of other shapes were segregated into other genera. For example, Persiciospora contains species with a delicately pitted ascospore wall; species in Sphaerodes have a complex raised tubercle-like germ pore and usually a coarsely reticulate ascospore wall; those of Syspastospora are smooth but cylindrical;
1Reprinted by permission of “Mycological Research”
21 and in Scopinella ascospores are oblong-ellipsoid to quadrangular, with two longitudinal triangular germ slits instead of terminal germ pores (Cannon and Hawksworth, 1982; Horie et al., 1986). We have followed the narrower circumscription of Cannon and Hawksworth (1982) in our study except for the inclusion of M. tiffanii. This species has ascospores with reticulate, pitted walls and should be closely related to Persiciospora according to the generic concept of Cannon and Hawksworth (1982), we retained the traditional generic name for M. tiffanii, however, until detailed SEM studies are done. The ranking and placement of Melanospora and its allies have also been long- standing problems. Their light coloured, soft, and often transparent perithecia led Gwynne-Vaughan and Barnes (1927) and Alexopoulos (1962) to place them in Hypocreales, within Nectriaceae and Melanosporaceae, respectively. Luttrell (1951) recognized the centrum development in Melanospora species to be of the Diaporthe- type and placed Melanosporaceae in Diaporthales. Barr (1990), Hawksworth et al. (1995), and Samuels and Blackwell (2000), emphasizing the ascospore colour and ornamentation, placed Melanospora and its allies in Ceratostomataceae or Melanosporaceae of the Sordariales. Phylogenies based on ribosomal DNA sequences indicated that two species of the genus (M. zamiae, the type, and M. fallax) were within or near Hypocreales (Rehner and Samuels, 1995; Spatafora and Blackwell, 1993, 1994). Alexopoulos et al. (1996) treated the genus in a monotypic order, Melanosporales within a large clade including Hypocreales. This study sought to answer the following questions with additional DNA and deduced amino acid sequence data as well as broader taxon sampling: (1) is Melanospora a natural group? (2) does it have a close relationship with its morphological allies? and (3) how is it related to other groups of pyrenomycetes?
22 MATERIALS AND METHODS The taxa sampled in this study are listed in Table 2.1. Strains were cultured in 2 % malt extract liquid medium at room temperature for about one week before harvesting. Genomic DNA was extracted following the procedure of Lee and Taylor (1990). SSU and LSU nrDNA fragments were amplified using primer sets NS1/NS6 (White et al., 1990) and LS1/LR5 (Hausner et al., 1993; Rehner and Samuels, 1995) by polymerase chain reaction (PCR) (Saiki et al., 1988). The gene encoding the second largest subunit of RNA polymerase II (RPB2) was partially sequenced for M. zamiae, M. tiffanii, Hypocrea pallida, H. schweizinii, and Valetoniellopsis laxa. Primers were designed [RPB2-P2F (GGAAGTGGTGGAGGAGTACGAG) and RPB2-P3R (CTGGTTGTGGTCGGGGAAGGG)] based on the RPB2 sequences of four pyrenomycete species published by Liu, Whelen and Benjamin (1999). RPB2-P2F and P3R are located in motif 6 and 7, respectively (Liu et al., 1999). The PCR conditions included: 95 ˚C for 5 min, 35 cycles of 95 ˚ for 1 min, 56 ˚ for 1 min, and 72 ˚ for 1 min 30 s, and finally 72 ˚ for 10 min. PCR products were purified using a DNA purification kit (Bio-Rad Laboratories, Hercules, CA). The primers used in sequencing reactions were NS2 and NS3 (White et al., 1990) for SSU nrDNA, LR3 and LR5 (Rehner and Samuels, 1994, 1995) for LSU nrDNA, and RPB2-P2F and RPB2-P3R for the RPB2 gene. The DNA sequences were determined by an ABI PRISM 377 DNA sequencer (PE Applied Biosystems, Foster City, CA). The nrDNA sequences and amino acid sequences deduced from RPB2 sequences were aligned with other data obtained from GenBank (Table 2.2) with the Clustal X program (Thompson, Gibson and Higgins, 1997) and optimized visually. Parsimony analyses were performed with PAUP* 4.0b4a (Swofford, 2000). Heuristic tree searches were executed using the tree bisection-reconnection branch swapping algorithm with random sequence analysis. The maximum likelihood analyses also were
23 Table 2.1. List of taxa sequenced in this study.
GenBank Accession
Taxon Sourcea Habitat or host SSU LSU RPB2
Cosmospora episphaeria GJS 88-29 ascomycetes - AY015625 - C. vilior GJS96-186 Hypoxylon - AY015626 - Hypocrea pallida GJS 89-83 - - - AY015639 H. schweinitzii CTR 79-225 plant material - - AY015636 Melanospora brevirostrisATCC 42427 Discomycetes AY015616 AY015627 - M. singaporensis ATCC 38286 soil AY015618 AY015629 - M. tiffanii ATCC 15515 Fusarium AY015619 AY015630 AY015637 M. zamiae ATCC 12340 wide range of fungi AY046578 AY046579 AY046580 M. zamiae ATCC 96173 wide range of fungi AY057905 AY057906 - Persiciospora africana ATCC 64691 soil AY015620 AY015631 - Scopinella solanii CBS 770.84 plant material AY015621 AY015632 - Sphaerodes compressa IMI 212200 soil, cow dung AY015622 AY015633 - S. fimicola ATCC 26180 hare dung AY015617 AY015628 - Syspastospora parasitica IMI 255607 Paecilomyces AY015623 AY015634 - Valetoniellopsis laxa GJS 96-174 palm leaves AY015624 AY015635 AY015638 aATCC = American Type Culture Collection, USA; CBS = Centraalbureau voor Schimmelcultures; IMI = CABI Bioscience (UK centre); CTR = Clark T. Rogerson, New York Botanical Garden, New York; GJS = Gary J. Samuels, Systematic Botany and Mycology Laboratory, USDA, Beltsville, Maryland.
24 Table 2.2. Sequences used in the study from the GenBank database.
GenBank Accession number
Classification1 Taxon SSU LSU RPB2 Diaporthales Cryptodiaporthe corni --AF277149 Diaporthe phaseolorum L36985 - - Discula destructiva --AF277147 Endothia eugeniae --AF277148 Leucostoma persoonii M83259 - - Eurotiales Aspergillus nidulans --AF107793 Byssochlamys nivea --AF107794 Trichophyton rubrum --AF107795 Hypocreales Aphysiostroma stercorarium - U47820 - Atkinsonella hypoxylon - U57087 - Bionectria aureofulva AB13010 U00747 - B. ochroleuca - U00750 - Calonectria morganii - U17409 - Claviceps paspali - U47826 - C. purpurea U44040 U57085 - Cordyceps capitata - U57086 - Cylindrocladium floridanum - U17408 - Echinodothis tuberiformis - U57083 - Heleococcum japonense - U17429 - Hypocrea gelatinosa - U00737 - H. lutea - U00739 - H. schweinitzii - U47833 - Hypomyces polyporinus U32410 - - H. rosellus - U00744 - H. tremellicola - U17427 - Leuconectria clusiae - U17412 - Myriogenospora atramentosa - U57084 - Nectria cinnabarina U32412 U00748 - N. pseudotrichia - U17410 - N. radicicola - U17415 - N. zonata - U17424 - Nectriopsis squamulosa - U17423 - Neocosmospora vasinfecta - U17406 - Roumegueriella rufula - U00754 - Sphaerostilbella lutea - U00757 - Viridispora diparietispora - U17413 - Wallrothiella subiculosa - U17428 - (table 2.2 continued)
25 Leotiales Leotia viscosa --AF107807 Microglossum viride --AF107806 Sclerotinia sclerotiorum --AF107808 Microascales Ceratocystis fimbriata U32418 - - C. virescens U32419 - - Microascus trigonosporus L36987 - AF107792 Petriella setifera U32421 - - Ophiostomatales Ophiostoma piliferum U20377 - - O. ulmi M83261 - - Pezizales Morchella elata --AF107810 Peziza quelepidotia --AF107809 Phyllachorales Colletotrichum gloeosporioides U76339 - - Glomerella cingulata U48427 - - Saccharomycetales Ambrosiozyma platypodis L36984 - - Candida krusei --AF107788 Saccharomyces cerevisiae Z75578 - M15693 Sordariales Cercophora septentrionalis U32400 - - Chaetomium elatum --AF107791 C. globosum U20379 - - Neurospora crassa X04971 - AF107789 Podospora anserina --AF107790 Xylariales Daldinia concentrica U32402 - - Hypoxylon atroroseum U32411 - - Xylaria curta U32417 U47840 - X. hypoxylon U20378 U47841 -
1Hawksworth et al. (1995).
26 performed using PAUP* 4.0b4a (Swofford, 2000). Kishino-Hasegawa Tests (KHT) were conducted with PAUP* 4.0b4a in order to evaluate different tree topologies (Kishino and Hasegawa, 1989). RESULTS SSU nrDNA. Approximately 1050 bp of SSU nrDNA sequences were obtained, among which 151 nucleotides were parsimony informative. Phylogenetic analysis of 33 species of ascomycetes produced 67 equally parsimonious trees with two species of Saccharomycetales as outgroup taxa. The trees were 371 steps (Fig. 2.1) and had a consistency index (CI) of 0.542, retention index (RI) of 0.788, and rescaled consistency index (RC) of 0.427. Melanospora species and the morphologically similar species (indicated in bold in Fig. 2.1) were placed within the clade of hypocrealean taxa that had low resolution. The branch received only low support of 51 % with bootstrap analysis. Among the taxa, four species of Melanospora and two of Sphaerodes formed a monophyletic group with 100 % bootstrap support. Syspastospora parasitica and Claviceps purpurea formed a sister group with 69 % bootstrap value. The maximum likelihood tree also placed Melanospora and its allies in Hypocreales (tree not shown). A discrepancy was found between new SSU and LSU nrDNA sequences for M. zamiae from ATCC 96173 and the sequences deposited in GenBank from ATCC 12340 for SSU (U78356, Spatafora and Blackwell, 1994) and LSU (U17405, Rehner and Samuels, 1995). In order to confirm the new results, M. zamiae (ATCC 12340) was acquired directly from ATCC. The new SSU nrDNA sequence from this isolate and that of ATCC 96173 were identical; the LSU nrDNA sequences varied by only 5 bp. The new sequences (AY046578 and AY046579) gave the results shown in Figs. 2.1 and 2.2. The KHT (model HKY85, Hasegawa et al., 1985) results indicated that the tree shown in Fig. 2.1 had the highest likelihood score compared to the phylogenies with
27 Ambrosiozyma platypodis OUTGROUP Saccharomyces cerevisiae
100 Melanospora zamiae Melanospora tiffanii 100 Melanospora singaporensis 80 Melanospora brevirostris 82 Sphaerodes fimicola Sphaerodes compressa Persiciospora africana HYPOCREALES 51 69 Syspastospora parasitica Claviceps purpurea Scopinella solanii Bionectria aureofulva Hypomyces polyporinus Nectria cinnabarina 68 Valetoniellopsis laxa 100 Ceratocystis fimbriata 96 Ceratocystis virescens MICROASCALES 66 Microascus trigonosporus Petriella setifera 87 Colletotricum gloeosporioides PHYLLACHORALES Glomerella cingulata
100 94 Cercophora septentrionalis 94 Chaetomium globosum SORDARIALES Neurospora crassa 64 99 Diaporthe phaseolarum DIAPORTHALES 53 Leucostoma persoonii 100 Ophiostoma piliferum OPHIOSTOMATALES Ophiostoma ulmi 96 Xylaria curta 77 Xylaria hypoxylon XYLARIALES 75 Daldinia concentrica Hypoxylon atroroseum
Fig. 2.1. Strict consensus of 67 most parsimonious trees based on partial SSU nrDNA sequences. Species of Ceratostomataceae are in bold. The tree was 371 steps with a CI of 0.542, RI of 0.788, and RC of 0.427. Bootstrap values of 50% or greater from 1000 bootstrap replications are indicated for the corresponding branches.
28 Xylaria curta OUTGROUP Xylaria hypoxylon 52 Heleococcum japonense 85 Roumegueriella rufula Nectria zonata BIONECTRIA 100 Bionectria ochroleuca Bionectria aureofulva Myriogenospora atramentosa Atkinsonella hypoxylon Cordyceps capitata CLAVICEPS 92 Claviceps purpurea Claviceps paspali Echinodothis tuberiformis Hypocrea lutea 69 Hypocrea gelatinosa 86 Hypocrea schweinitzii Aphysiostroma stercorarium Sphaerostilbella lutea HYPOCREA 79 Hypomyces tremellicola Hypomyces rosellus Syspastospora parasitica 84 Nectria cinnabarina Nectria pseudotrichia Leuconectria clusiae Nectria radicicola 100 Calonectria morganii Cylindrocladium floridanum NECTRIA 95 Neocosmospora vasinfecta Viridispora diparietispora Persiciospora africana Nectriopsis squamulosa 96 Cosmospora episphaeria Cosmospora vilior 64 Scopinella solani Valetoniellopsis laxa NIESSLIA Melanospora singaporensis Melanospora brevirostris 100 100 Sphaerodes fimicola MELANOSPORA 100 Sphaerodes compressa
100 Melanospora zamiae Melanospora tiffanii Wallrothiella subiculosa 5 changes Fig. 2.2. The tree with the highest maximum likelihood score out of 22 most parsimonious trees based on partial LSU nrDNA sequences. Species of Ceratostomataceae are shown in bold face type. The tree was 583 steps with a CI of 0.400, RI of 0.706, and RC of 0.282. Bootstrap values of 50% or greater from 1000 bootstrap replications are indicated for the corresponding branches.
29 Melanospora and allies in other positions. The reinforced groupings of Melanospora and allies with Microascales, Phyllachorales, Ophiostomatales, Sordariales, Xylariales, and Diaporthales had significantly lower likelihood scores with P-values equal to or less than 0.0009, 0.0101, 0.0009, 0.0001, 0.0005, and 0.0002, respectively. The tree that puts Melanospora and allies out of the other pyrenomycetous fungi was also worse than Fig. 2.1 and the P-value was 0.0003. LSU nrDNA. About 850 bp DNA sequences at the 5' end of the LSU nrDNA were obtained. Among them, 157 nucleotides were parsimony informative characters. Twenty- two equally most parsimonious trees were produced based on LSU nrDNA sequences of 31 taxa of Hypocreales and nine species of Melanospora and its allies; two Xylaria species were used as outgroup taxa. The tree length was 583 steps with a CI, RI, and RC of 0.400, 0.706, and 0.282 respectively. The tree with the highest maximum likelihood score is shown in Fig. 2.2. Six clades were formed among the ingroup taxa, designated as Bionectria, Claviceps, Hypocrea, Nectria, Niesslia, and Melanospora (Rehner and Samuels, 1995; Rossman et al., 1999). Four species of Melanospora and two species of Sphaerodes formed a well supported basal clade. Scopinella solani was a distinct clade. But in six of the 22 most parsimonious trees, it was placed within the Claviceps group. Syspastospora parasitica and Persiciospora africana were within or closely allied to the Hypocrea and Nectria groups respectively. Two species of Niessliaceae, Valetoniellopsis laxa and Wallrothiella subiculosa, did not form a monophyletic clade. The monophyly of the species of Melanospora and allies was rejected by the KHT with a P-value of 0.0419. The P-value for the monophyly test of Niessliaceae was 0.1500, which was not strong enough to reject the monophyletic relationship of the two niessliacean species. RPB2. Approximately 580 bp of RPB2 gene at motifs 6 and 7 (Liu et al., 1999) were sequenced and 182 deduced amino acids sequences were used in phylogenetic analyses,
30 Saccharomyces cerevisiae SACCHAROMYCE TALES Candida krusei
70 Aspergillus nidulans 92 Byssochlamys nivea EUROTIALES Trichophyton rubrum Neurospora crassa 93 SORDARIALES 58 99 Chaetomium elatum Podospora anserina Discula destructiva 100 DIAPORTHALES 99 Endothia eugeniae 98 Cryptodiaporthe corni
Microascus trigonosporus MIC ROASCALES Valetoniellopsis laxa 80 94 56 Hypocrea pallida 62 Hypocrea schweinitzii HYPOC REALES
100 Melanospora tiffanii 100 Melanospora zamiae Microglossum viride 100 75 Leotia viscosa LEOTIALES Sclerotinia sclerotiorum Peziza quelepidotia 64 PEZIZALES Morchella elata 10 changes
Fig. 2.3. The most parsimonious tree based on partial RPB2 deduced amino acid sequences. The tree length is 591 steps with a CI of 0.726, RI of 0.734, and RC of 0.533. Bootstrap values of 50% or greater from 1000 bootstrap replications are indicated for the corresponding branches.
31 among which 90 amino acids were parsimony informative. The most parsimonious tree from RPB2, albeit with reduced taxon sampling (Fig. 2.3) supported the placement of M. zamiae, M. tiffanii, and their allies in Hypocreales. DISCUSSION Placement of Melanospora and Allies in Hypocreales. Our study of Melanospora using characters derived from SSU nrDNA differs from previous studies by increasing taxon sampling with taxa chosen on the basis of morphological characters, and by adding a protein coding gene (RPB2) in the phylogenetic analysis. However, the results are consistent with previous studies using SSU nrDNA (e.g., Spatafora and Blackwell, 1994) sequences, which supported the placement of M. zamiae and M. fallax within Hypocreales. As discussed above, in the past Melanospora had been placed in the Hypocreales based on its pallid ascomata (Alexopoulos, 1962; Gwynne-Vaughan and Barnes, 1927; Gäumann and Dodge, 1928). Luttrell (1951) proposed four centrum types (Diaporthe, Ophiostoma, Nectria, and Xylaria) for unitunicate pyrenomycetous fungi, which heavily influenced ordinal level classifications. The Diaporthe-type was defined as a pseudoparenchymatous centrum and lacking paraphyses. Melanospora was included in this type and placed in Diaporthales. However, later studies (Huang and Luttrell, 1982; Jensen, 1984) showed that some diaporthaceous fungi have paraphyses in the centrum. In addition, the origin of the enveloping hyphae, which give rise to the ascomal wall, is different from development in Diaporthe. In Melanospora, the envelope is derived from the base of the ascogonial coil whereas the source of the envelope in most of the diaporthaceous species that have been examined is from adjacent hyphae (Jensen, 1984). Conidium development also differs between the two groups of fungi. Melanospora species produce hyphomycetous anomorphs, while most diaporthaceous species have coelomycetous asexual states.
32 More recently, the placement of Melanospora in the Ceratostomataceae in the Sordariales was influenced by comparison of ascospore characteristics (Barr, 1990; Hawksworth et al., 1995). Dark ascospores with germ pores are the most conspicuous similarities; however, the Sordaria type centrum (Huang, 1976; Uecker, 1976) is composed of paraphyses in addition to pseudoparenchyma, which differs from the centrum of Melanospora. Based on our SSU nrDNA sequence analyses, not only do Melanospora species not belong in Sordariales, but also some of the other taxa placed in Ceratostomataceae (Barr, 1990) are excluded from the order. The position also is supported by the maximum likelihood tree (not shown), although the bootstrap support in the most parsimonious trees is relatively low (51 %, Fig. 2.1). One could argue that the grouping of Melanospora with Hypocreales is due to long-branch attraction. The KHT results, however, revealed that the reinforced placements of Melanospora and allied species at any other positions on the SSU nrDNA tree are significantly worse than Fig. 2.1, with P-values of 0.0120 or less. The partial RPB2 gene phylogeny (Fig. 2.3) further supported a close relationship between Melanospora and hypocrealean fungi. The RPB2 data set is reduced compared to the nrDNA data, but sequences of M. zamiae (the type), M. tiffanii, and three species of Hypocreales (Hypocrea pallida, H. schweinitzii, and Valetoniellopsis laxa) were included, and the tree topology from the analysis is congruent with that of the nrDNA tree. The support from a different gene provides more confidence for our placement of Melanospora and allies in Hypocreales. Relationships within Hypocreales. Because the SSU nrDNA analyses gave little resolution within the Hypocreales and because portions of LSU nrDNA have been found to evolve more rapidly than SSU nrDNA in perithecial ascomycetes, a variable region of this molecule was used to investigate relationships within the Hypocreales. The most parsimonious tree obtained from LSU nrDNA (Fig. 2.2) inferred six groups among the sampled taxa of Hypocreales (Bionectria, Nectria, Claviceps, and Hypocrea, Rehner and
33 Samuels, 1995; Rossman et al., 1999). Two additional clades proposed in this study are Melanospora and Niesslia (Fig. 2.2), neither of which had members included in previous studies except for M. zamiae. In our study species of Melanospora, including the new sequence of M. zamiae (AY046579), and Sphaerodes formed a basal clade rather than grouping with the Nectria group as was indicated by the LSU nrDNA phylogeny of Hypocreales that included M. zamiae (U17405) and M. fallax (Rehner and Samuels, 1995). The reinforced placement of M. zamiae (AY046579) into Nectria group yielded significantly lower likelihood score with a P-value less than 0.0001. Characteristics of ascomata from culture agreed with the description of M. zamiae. Scanning electron microscopy observations insured that the ascospore walls were smooth. The two Sphaerodes species grouped together (Figs. 2.1 and 2.2). Although the regions of nrDNA obtained in this study did not provide informative characters to distinguish them from M. brevirostris, additional data might support the monophyly of the genus Sphaerodes, which is distinguished by two terminal strongly apiculate germ pores. Other Melanospora-like genera do, however, display heterogeneity. Smooth- walled Melanospora species (M. singaporensis, M. zamiae (AY046579), and M. brevirostris) do not form a monophyletic clade, but rather a grouping with species of reticulated ascospores (Sphaerodes compressa, S. fimicola and M. tiffanii), which disagrees with the generic concept of Melanospora (Cannon and Hawksworth, 1982) The results of this study also are in disagreement with the broad generic concept of Doguet (1955), which does not appear to comprise a natural group either. Scopinella solani, which is superficially similar to Melanospora, and has rectangular ascospores with longitudinal germ slits (Cannon and Hawksworth, 1982). Although the spore wall is smooth, it is not surprising that this species was only distantly related to the Melanospora species (Fig. 2.2). Another species once referred to Melanospora,
34 Syspastospora parasitica, produces smooth, more or less cylindrical ascospores with large terminal germ pores, and it was placed basal to Hypocrea (Fig. 2.2). Our results indicate that ascospore shape and germ aperture, not wall ornamentation, are more informative characters in the phylogenetic study of Ceratostomataceae. Both Valetoniellopsis and Wallrothiella have been considered members of the Niessliaceae in Hypocreales (Barr, 1990). They differ from other families in the order by their dark-coloured ascomatal peridia. Valetoniellopsis laxa was included in the SSU nrDNA phylogeny (Fig. 2.1) and grouped with other Hypocreales. SSU nrDNA sequence of Wallrothiella was not available for this study, but according to the LSU nrDNA most parsimonious tree (Fig. 2.2), the two genera are not sister taxa. Their monophyly, however, was not strongly rejected by KHT (P= 0.1500), but on the basis of our data, Wallrothiella was excluded from the grouping of the Hypocreales. Centrum. Centrum characters have been used in ordinal level classification in the pyrenomycetes. In the Hypocreales, the centrum also may be informative in the classification of families (Fig. 2.2). There are four types of centrum development described among the six groups of Hypocreales. Species in the Bionectria, Nectria, and Niesslia groups have a Nectria-type centrum, characterized by apical paraphyses and pseudoparenchyma. The Hypomyces-type recognized by Samuels (1973), produces centripetal paraphyses during ascoma development. The paraphyses arising from the upper half of the inner perithecial wall elongate more than those of the lower half, and the former were considered as homologous to the apical paraphyses in Nectria (Spatafora and Blackwell, 1994). Centra of the Claviceps group produce lateral paraphyses and were recognized as the Claviceps type (Mhasker and Rao, 1976). Melanospora species form a pseudoparenchymatous centrum (Goh and Hanlin, 1994; Samuels and Blackwell, 2001) and could be treated as a Melanospora-type or the Diaporthe centrum type sensu Luttrell (1951). If Melanospora is the basal group as Fig. 2.2 indicated, a developmental
35 continuum of Melanospora-Nectria-Claviceps-Hypomyces within Hypocreales is reasonable. However, compared to the large number and wide variety of species in the Hypocreales, our molecular and developmental information are still far too limited to draw robust conclusions. REFERENCES Alexopoulos, C. J. 1962. Introductory Mycology. 2nd edn. John Wiley, New York. Alexopoulos, C. J., Mims, C. W., and Blackwell, M. 1996. Introductory Mycology. 4th edn. John Wiley, New York. Barr, M. E. 1990. Prodromus to nonlichenized, pyrenomycetous members of class Hymenoascomycetes. Mycotaxon 39: 43-184. Cannon, P. F. and Hawksworth, D. L. 1982. A re-evaluation of Melanospora Corda and similar pyrenomycetes, with a revision of the British species. Botanical Journal of the Linnean Society 84: 115-160. Corda, A. C. I. 1837. Icones Fungorum. vol. 1. J. G. Calve. Prague. Doguet, G. 1955. Le genre Melanospora biologie, morphologie, développement, systématique. Botaniste 39: 1-313. Gäumann, E. A. and Dodge, C. W. 1928. Comparative Morphology of Fungi. McGraw- Hill, New York. Goh, T. K. and Hanlin, R. T. 1994. Ascomal development in Melanospora zamiae. Mycologia 86: 357-370. Gwynne-Vaughan, H. C. I., and Barnes, B. 1927. The Structure and Development of the Fungi. University Press, Cambridge, UK. Harveson, R. M. 1999. Evaluation of the Parasitic Relationship of Melanospora and Other Allied Genera with Fusarium oxysporum. University of Florida, Gainesville. Hasegawa, M., Kishino, K., and Yano, T. 1985. Dating the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution 22: 160-174. Hausner, G., Reid, J., and Klassen, G. R. 1993. On the subdivision of Ceratocystis s. l., based on partial ribosomal DNA sequences. Canadian Journal of Botany 71: 52-63. Hawksworth, D. L., Kirk, P. M., Sutton, B. C., and Pegler, D. N. 1995. Ainsworth and Bisby’s Dictionary of the Fungi. 8th edn. CAB International, Wallinford, UK. Horie, Y., Udagawa, S., and Cannon, P. F. 1986. Four new Japanese species of the Ceratostomataceae (ascomycetes). Mycotaxaon 25: 229-245.
36 Huang, L. H. 1976. Developmental morphology of Triangularia backusii (Sordariaceae). Can. J. Bot. 54: 250-267. Huang, L. H. and Luttrell, E. S. 1982. Development of the Perithecium in Gnomonia comari (Diaporthaceae). Ameri. J. Bot. 69: 421-431. Jeffries, P. and Young, T. W. K. 1994. Interfungal Parasitic Relationships. CAB International, Wallingford. Jensen, J. D. 1984. Morphologic Studies in the Pyrenomycetes. Washington State University, Pullman. Kishino, H. and Hasegawa, M. 1989. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in hominoid. Journal of Molecular Evolution 29: 170-179. Lee, S. B. and Taylor, J. W. 1990. Isolation of DNA from fungal mycelia and single spores. In: PCR protocols: A Guide to Methods and Applications . Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. eds. pp. 282-287. Academic Press, San Diego, California. Liu, Y. J., Whelen, S., and Benjamin, D. H. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Molecular Biology and Evolution 16: 1799-1808. Luttrell, E. S. 1951 Taxonomy of the pyrenomycetes. University of Missouri Studies, Science Series 24: 1-120. Mhasker, D. N. and Rao, V. G. 1976. Development of the ascocarp in Epichloë cinerea (Clavicipitaceae). Mycologia 68: 994-1001. Rehner, S. A. and Samuels, G. J. 1994. Taxonomy and phylogeny of Gliocladium analysed from nuclear large subunit ribosomal DNA sequences. Mycological Research 98: 625-634. Rehner, S. A. and Samuels, G. J. 1995. Molecular systematics of the Hypocreales: A teleomorph gene phylogeny and the status of their anamorphs. Can. J. Bot. 73 (Suppl. 1): S816-S823. Rossman, A. Y., Samuels, G. J., Rogerson, C. T., and Lowen, R. 1999. Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes). Studies in Mycology 42: 1-248. Saiki, R., Gelfand, D. H., Stoffel, S., Scharf, S., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491. Samuels, G. J. 1973. Perithecial development in Hypomyces aurantius. American Journal of Botany 60: 268-276.
37 Samuels, G. J. and Blackwell, M. 2000. Pyrenomycetes. In: The Mycota. Vol. VII, Part A. Systematics and Evolution. McLaughlin, D. J., McLaughlin, E. G., and Lemke, P. A. eds): pp. 221-255. Springer-Verlag, Berlin. Spatafora, J. W. and Blackwell, M. 1993. Molecular systematics of unitunicate perithecial ascomycetes: the Clavicipitales-Hypocreales Connection. Mycologia 85: 912- 922. Spatafora, J. W. and Blackwell, M. 1994. Cladistic analysis of partial ssrDNA sequences among unitunicate perithecial ascomycetes and its implications on the evolution of centrum development. In: Ascomycete Systematics: problems and perspectives in the nineties. Hawksworth, D. L. ed. pp. 233-241. Plenum Press, New York. Swofford, D. L. 2000. PAUP*: Phylogenetic Analysis Using Parsimony (* and Other Methods). Version 4. Sinauer Associates, Sunderland, MA. Thompson, J. D., Gibson, T. J., and Higgins, D. G. 1997. The CLUSTAL-X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25: 4876. Uecker, F. A. 1976. Development and cytology of Sordaria humana. Mycologia 68: 30- 46. White, T. J., Bruns, T. D., Lee, S. B., and Taylor, J. W. 1990. Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal DNA genes. In: PCR Protocols: A Guide to Methods and Applications. Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J. eds. pp. 315-322. Academic Press, New York.
38 CHAPTER 3. MOLECULAR PHYLOGENY OF DOGWOOD ANTHRACNOSE FUNGUS (DISCULA DESTRUCTIVA) AND THE DIAPORTHALES1
INTRODUCTION Many of the perithecial ascomycetes placed in the Diaporthales are agronomically important plant pathogens (Barr, 1978, 1990). For example, Cryphonectria parasitica, the agent of chestnut blight, ravaged 3.6 million hectares of chestnut forests in eastern North America and reduced the American chestnut to a minor understory shrub in less than 50 yr (Anagnostakis, 1987). A more recent introduction has resulted in the decimation of dogwood trees (Cornus florida and C. nuttallii) by Discula destructiva in the northeastern and northwestern United States. A number of native diaporthalean species cause less severe diseases of both native and crop plants. Historically, mycologists have used morphological features such as configuration of the perithecium, ascus structure, and ascospore shape and septation to circumscribe taxa. Wehmeyer (1975) and Barr (1990) segregated families based on ascospore shape. In addition, Barr (1978) emphasized perithecium position in relation to the substrate and ascospore wall thickness in her circumscription. Morphology has not always been reliable because of the great variation in phenotypic features, the overwhelming number of related asexual forms, and, moreover, emphasis of different characters by different investigators (Nannfeldt, 1932; Luttrell, 1951; Wehmeyer, 1975; Barr, 1978, 1990; Hawksworth et al., 1995) (Table 3.1). As independent characters, molecular sequence data have been applied to resolve the evolutionary history and taxonomic problems, which are difficult to solve using morphology alone. For example, Spatafora and Blackwell (1993) investigated the ordinal level placement of a number of perithecial
1Reprinted by permission of “Mycologia”
39 Table 3.1. Selected classifications proposed for the Diaporthales from 1975 to 1995.
Authors Diaporthaceae Gnomoniaceae Melanconidaceae Pseudovalsaceae Valsaceae
Wehmeyer ascospore nonallantoid, ascospore nonallantoid, - - ascospore allantoid, (1975) stromatic nonstromatic stromatic or nonstromatic
Barr - perithecia upright, beaks perithecia oblique or horizontal, Perithecia upright, beaks Perithecia oblique or (1978) central, rarely eccentric, beaks oblique or lateral, ascospores oblique or lateral, ascospores horizontal, beaks oblique or ascospores thin walled usually thick walled usually thick walled lateral, ascospores thin walled
Barr - ascospores nonallantoid, ascospores nonallantoid, hyaline or - ascospores allantoid, hyaline, 40 (1990) hyaline, thin walled, one pigmented, firm walled, one celled thin walled, one celled celled or septate or septate
Hawksworth --asci persistent, thick walled, remaining - asci numerous, evanescent at (1995) attached, ascospores mainly broad and the base, becoming free within brown, end cells sometimes hyaline the ascomatal cavity, ascospore hyaline to yellowish ascomycetes, with the inclusion of two species of Diaporthales. More recent work on diaporthalean fungi has focused on the pathogenicity and the phylogeny below the genus level (Rehner and Uecker, 1994; Kasahara et al., 2000). In addition to the fungi traditionally placed in the order, a number of other genera have been hypothesized as relatives of Diaporthales based upon their pathogenicity, but with little other evidence. Examples of these are the rice blast fungus, Magnaporthe grisea, and Gaeumannomyces graminis, which causes “take-all” diseases of cereals (Alexopoulos et al., 1996; Barr, 1978, 1990). Cannon (1994) put a group of fungi including Magnaporthe and Gaeumannomyces into a new family Magnaporthaceae based on teleomorph form and pathogenic effects. But he suggested that no ordinal placement be assigned without further study. It is surprising that no modern detailed phylogenetic study has been done on these fungi in light of their economic importance. The purpose of this work was twofold: to test hypotheses of family level phylogenetic relationships among diaporthalean species including anamorphs, and to test the position of the dogwood anthracnose fungus in a Diaporthales clade. Dogwood anthracnose is a recently discovered disease of several native dogwood species in North America, especially flowering and Pacific dogwoods (Cornus florida and C. nuttallii). It affects leaves, bracts, bark, cambium of the trunk and branches, fruits, and seeds. Symptoms include bract necrosis, leaf spot, leaf blight, twig dieback, and trunk canker. Most infected trees are killed in one to three yr or exhibit symptoms of varying severity from yr to yr depending on the environmental conditions (Daughtrey and Hibben, 1994). This disease was first reported on Pacific dogwood in the northwestern United States in the 1970s (Byther and Davidson, 1979). It also appeared suddenly on flowering dogwood in the northeastern United States at almost the same time. Since then, the disease has spread rapidly through native dogwood populations and caused dramatic devastation. At present, infections have been confirmed from
41 Washington, Oregon, Idaho, California, and British Columbia in the western part of North America. In the east, the disease has been reported from New York, Massachusetts, Connecticut, New Jersey, Pennsylvania, Delaware, Maryland, Virginia, West Virginia, North Carolina, South Carolina, Tennessee, Kentucky, Indiana, Vermont, Michigan, Ohio, New Hampshire, Rhode Island, Missouri, Kansas, and as far south as Georgia and Alabama. Redlin (1991) examined 120 isolates from C. florida, C. kousa, and C. nuttallii from both eastern and western localities in North America. He reported that they were all similar in morphology and described this pathogen as Discula destructiva. It produces acervular and subcuticular conidiomata on leaves and twigs of the host. Conidia are ellipsoidal and nonseptate. A sexual state is unknown, and the origin of the disease is still a mystery. The results of DNA amplification fingerprinting (Trigiano et al., 1995) indicated that D. destructiva isolates were genetically very similar regardless of geographic origin or host, which provided evidence that the presence of this fungus might be the result of a single recent introduction to North America. However, agarose- gel banding profiles of double-stranded RNA were very different between eastern and western isolates, which suggested that they might have different origins (Yao et al., 1997). Because teleomorphs of other anthracnose pathogens with Discula anamorphs belong to Apiognomonia and Gnomoniella in the Diaporthales (Barr, 1978; Monod, 1983; Redlin and Stack, 1988), it has been assumed that D. destructiva was derived from certain species in Diaporthales. MATERIALS AND METHODS Materials Studied. The fungal taxa sampled and sequenced in this study are listed in
Table 3.2. Other data included in the analyses are shown in Table 3.3, which were obtained from GenBank.
42 Table 3.2. List of taxa in Diaporthales or connected to Diaporthales sequenced in this study.
GenBank Accession number
Taxon Sourcea Habitat or host SSU LSU Amphiporthe castanea (Tulasne) Barr CBS 392.93 Castanea sativa AF277117 AF277128
Apiognomonia supraseptata Kaneko et Kobayashi ATCC 58737 Quercus glauca AF277118 AF277127 Apioplagiostoma aceriferum (Cook.) Petr. CBS 781.79 Acer campestre AF277111 AF277129 Apiosporopsis carpinea (Fr.) Sacc. CBS 771.79 Carpinus betulus AF277110 AF277130 43 Cryphonectria parasitica (Murr.) Barr S. Anagnostakis 713 Castanea sp. AF277116 AF277132
Cryptodiaporthe corni (Wehmeyer) Petrak ATCC 66834 Cornus alternifolia AF277119 AF277133 Discula campestris (Pass.) v. Arx S. Anagnostakis Acer sp. AF277107 AF277140 Discula destructiva Redlin 254 (type) S. Redlin Cornus florida AF277105 AF277137 Discula destructiva Redlin WA6 S. Redlin Cornus nuttallii AF277126 AF277136
Discula fraxinae Peck (DNA used in sequencing) S. Anagnostakis Fraxinus sp. AF277106 AF277138
(culture used in color reaction) A. Rossman Fraxinus sp. - - (table 3.2 continued) Discula quercina (Cooke) Sacc S. Anagnostakis Quercus sp. AF277108 AF277139 Discula sp. 326 M. Daughtrey Cornus florida AF277104 AF277141 Endothia eugeniae (Nutm. & Roberts) Reid&Booth CBS 534.82 Eugenia aromatica AF277115 AF277142 Gaeumannomyces graminis (Saccardo) von Arx et Olivier var. graminis N. Money Oryza sativa AF277125 - Gnomonia padicola (Libert) Klebahn CBS 845.79 Prunus padus AF277112 AF277134 Gnomonia setacea (Pers. ex Fr.) Ces. & de Not. CBS 863.79 Castanea sativa AF277121 AF277135 Linospora capreae (DC.) Fuckel CBS 372.69 Salix caprea AF277109 AF277143 44 Magnaporthe grisea (Hebert) Barr J. Hamer Guy 11 Oryza sativa AF277123 - Melanconis marginalis (Peck) Wehmeyer ATCC 56907 Alnus tenuifolia AF277122 AF277144 Plagiostoma euphorbiae Fuckel CBS 340.78 Euphorbia palustris AF277114 AF277131 Pleuroceras pleurostylum(Auerswald) Barr CBS 906.79 Salix helvetica AF277113 AF277145 Pyricularia grisea Sacc. M. Marchetti 793 Oryza sativa AF277124 - Valsa ambiens ssp. leucostomoides (Peck)Spielman ATCC 52280 Acer rubrum AF277120 AF277146
aATCC = American Type Culture Collection, USA; CBS = Centraalbureau voor Schimmelcultures. DNA Extractions, PCR, and Sequencing. Cultures were grown in 2% malt extract broth and harvested after one wk. Total nucleic acids were extracted following the procedure of Lee and Taylor (1990). Dilutions of extracted genomic DNA were used as templates for polymerase chain reactions. The nuclear encoded small subunit rRNA gene (SSU nrDNA) was amplified with primers NS1 and NS6 (White et al., 1990). The nuclear large subunit rRNA gene (LSU nrDNA) was amplified with primers ITS3 and LR3 (Rehner and Samuels, 1995). The gene encoding the second largest subunit of RNA polymerase II (RPB2) was partially sequenced for a few diaporthalean species including Cryptodiaporthe corni, Endothia eugeniae, and D. destructiva (S. Redlin 254, Maryland). Primers were designed [RPB2-P2F (GGAAGTGGTGGAGGAGTACGAG) and RPB2-P3R (CTGGTTGTGGTCGGGGAAGGG)] based on the RPB2 sequences of four pyrenomycete species published by Liu et al. (1999). RPB2-P2F and P3R located in motif 6 and 7, respectively (Liu et al., 1999). The PCR conditions included: 95 C for 5 min, 35 cycles of 95 C for 1 min, 56 C for 1 min, and 72 C for 1 min 30 s, and finally 72 C for 10 min. PCR products were purified using a DNA purification kit (Bio-Rad Laboratories, Hercules, California), and the purified double-stranded DNAs were used directly as templates for sequencing. Some templates were used in reactions with an ABI
PRISM TM Dye Terminator Cycle sequencing kit (Perkin-Elmer Applied Biosystems, Foster City, California) and the sequences were determined by using an ABI PRISM 310 Genetic Analyzer (Perkin-Elmer). An ABI PRISM TM BigDye Terminator Cycle sequencing kit (Perkin-Elmer Applied Biosystems, Foster City, California) was used for other templates and the sequences were determined by using an ABI PRISM 377 automated DNA sequencer (Perkin-Elmer). The primers used in sequencing reactions were NS2 and NS3 (White et al., 1990) for SSU nrDNA, LS1 and LR3 (Rehner and Samuels, 1995) for LSU nrDNA, and RPB2-P2F and RPB2- P3R for the RPB2 gene.
45 Table 3.3. Other taxa included in the analyses. GenBank Accession number
Classificationa Taxon SSU LSU RPB2 Saccharomycetales Ambrosiozyma platypodis L36984 - - Candida albicans M60302 - AF107787 Candida krusei --AF107788 Saccharomyces cereviseae Z75578 - M15693 Diaporthales Diaporthe phaseolorum L36985 U47830 - Endothia gyrosa L42443 - - Leucostoma persoonii M83259 - - Phomopsis longicolla U78778 - - Hypocreales Claviceps purpurea U44040 - - Hypocrea pallida U32408 - - Hypomyces polyporinus U32410 - - Nectria cinnabarina U32412 - - Microascales Ceratocystis fimbriata U32418 - - Ceratocystis virescens U32419 - - Microascus trigonosporus L36987 U47835 AF107792 Petriella setifera U32421 - - Ophiostomatales Ophiostoma piliferum U20377 - - Ophiostoma ulmi M83261 - - Phyllachorales Colletotrichum gloeosporioides U76339 - - Glomerella cingulata U48427 - - Sordariales Cercophora septentrionalis U32400 - - Chaetomium elatum --AF107791 Chaetomium globosum U20379 U47825 - Neurospora crassa X04971 - AF107789 Podospora anserina --AF107790 Sordaria fimicola X69851 - - Xylariales Daldinia concentrica U32402 - - Hypoxylon atroroseum U32411 - - Xylaria curta U32417 - - Xylaria hypoxylon U20378 U47841 - Incertae sedis Magnaporthe salvinii U78546 - - aHawksworth et al. (1995).
46 For the RPB2 gene, only three species were sequenced in this study. They were D. destructiva 254, Endothia eugeniae, and Cryptodiaporthe corni. The GenBank accession numbers for RPB2 sequences were AF277147, AF277148, and AF277149, respectively. Data Analyses. The nrDNA sequences were aligned with other data (Table 3.3) obtained from GenBank using the multialignment program Clustal X (Thompson et al., 1997), and optimized visually. RPB2 gene DNA sequences were translated to amino acid sequences and aligned manually. Regions judged to be ambiguously aligned were excluded from the analyses. Sequence alignments are available from TreeBASE (matrices SN498-1740, SN498-1741, SN498-1742, and SN498-1743). Maximum parsimony analyses were performed via heuristic search options in PAUP* 4.0b4a (Swofford, 2000, Figs. 3.1-3.3) using the branch swapping algorithm (tree-bisection- reconnection). A partition homogeneity test (PHT) was performed between the SSU and LSU nrDNA sequences using PAUP* before they were combined and analyzed. Neighbor-joining trees also were produced with PAUP*. Secondary Metabolites. Three 3 x 3 mm squares were cut off from each of the 1-mon fungal cultures on potato dextrose agar. One square was placed in 3% KOH solution, the second one was tested using lactic acid (85%), and distilled water (pH 5) was used as control. After 20 min, color changes were recorded and the three squares were transferred onto filter paper. Agar squares were removed from filter paper after three min. When the paper was air dried, color of the blots was recorded to detect the pigment solubility. A dictionary of color (Maerz and Paul, 1930) was used as a color standard. RESULTS SSU nrDNA. PCR products were around 1500 bp long for the SSU nrDNA with primers NS1 and NS6. The SSU nrDNA data set comprises 50 taxa with three saccharomycetalean species used as outgroup taxa. For each taxon 979 characters were
47 included in the phylogenetic analyses, among which 154 were parsimony-informative. Gaps were treated as missing data. A heuristic search produced six equally most parsimonious trees of 365 steps with consistency index (CI), retention index (RI), and rescaled consistency index (RC) of 0.5479, 0.8232, and 0.4510, respectively. In the strict consensus tree (Fig. 3.1) D. destructiva together with other Discula species were included in the Diaporthales, supported by a bootstrap value of 97%. Magnaporthe grisea, its anamorph Pyricularia grisea, and Gaeumannomyces graminis formed a monophyletic group with a 99% bootstrap support. Excluded from Diaporthales, this group showed a closer relationship to Ophiostoma species, but the bootstrap support was only 61%. LSU nrDNA. Twenty-four taxa were included in the LSU nrDNA data set. Approximately 600 bp of DNA sequences were obtained for each taxon, and 78 were phylogenetically-informative characters. Gaps were treated as missing data. The outgroup taxa used were Xylaria hypoxylon, Chaetomium globosum, and Ophiostoma piliferum. Ten most parsimonious trees were produced by the heuristic search. The trees were of 209 steps with CI, RI, and RC of 0.4976, 0.6957, and 0.3462, respectively. The tree in Fig. 3.2 had the highest log-likelihood value of the ten trees. This phylogenetic tree divided sampled diaporthalean taxa into three major clades. The single taxon Diaporthe phaseolorum (clade I) was sister to clades II and III. Cryphonectria parasitica, Cryptodiaporthe corni, Endothia eugeniae, Valsa ambiens subsp. leucostomoides, and Apiognomonia supraseptata were grouped as another clade (clade II) with bootstrap support of 51%. The last clade (clade III) included Plagiostoma euphorbiae, Gnomonia padicola, G. setacea, Pleuroceras pleurostylum, Linospora capreae, Amphiporthe castanea, Apioplagiostoma aceriferum, Melanconis marginalis, Apiosporopsis carpinea, and several Discula species. This clade had an 85% bootstrap
48 81 Ambrosiozyma platypodis Saccharomyces cerevisiae Candida albicans Discula sp. 326 61 Phomopsis longicolla Diaporthe phaseolorum Endothia eugeniae Cryphonectria parasitica Apiognomonia supraseptata 75 Valsa ambiens ssp. leucostomoides Leucostoma persoonii Cryptodiaporthe corni Discula destructiva 254 98 Discula fraxinae Discula campestris Diaporthales 66 Plagiostoma euphorbiae 97 61 Gnomonia padicola Gnomonia setacea Discula quercina Amphiporthe castanea 93 Linospora capreae Apioplagiostoma aceriferum 75 Pleuroceras pleurostylum 89 Melanconis marginalis Apiosporopsis carpinea Endothia gyrosa Magnaporthe grisea 99 Pyricularia grisea Magnaporthaceae 100 61 Magnaporthe salvinii Gaeumannomyces graminis var. graminis 72 100 Ophiostoma piliferum Ophiostoma ulmi Ophiostomatales 75 Cercophora septentrionalis 78 Chaetomium globosum Sordaria fimicola Sordariales 100 Neurospora crassa 96 Xylaria curta 68 Xylaria hypoxylon Xylariales 75 Daldinia concentrica 100 Hypoxylon atroroseum 100 Ceratocystis fimbriata 55 Ceratocystis virescens 100 Petriella setifera Microascales Microascus trigonosporus 70 Claviceps purpurea Hypomyces polyporinus 82 Hypocreales 98 100 Hypocrea pallida Nectria cinnabarina 99 Colletotrichum gloeosporioides Glomerella cingulata Phyllachorales
Fig. 3.1. Strict consensus of six equally most parsimonious trees of 365 steps based on SSU nrDNA. CI = 0.5479, RI = 0.8232, RC = 0.4510. Numbers above branches are bootstrap values from 200 replicates of a heuristic search. Bootstrap values lower than 50% are not shown.
49 Xylaria hypoxylon
Chaetomium globosum 88 Ophiostoma piliferum
Plagiostoma euphorbiae 87 Discula fraxinae
60 Discula campestris
Apioplagiostoma aceriferum
Pleuroceras pleurostylum
89 Linospora capreae
Gnomonia padicola 95 Gnomonia setacea
Discula quercina
67 Amphiporthe castanea
Discula destructiva WA6
79 68 Discula destructiva 254 clade III Melanconis marginalis 85 Apiosporopsis carpinea
Discula sp. 326 70 Cryphonectria parasitica 74 clade II Cryptodiaporthe corni
51 67 99 Endothia eugeniae
Valsa ambiens ssp. leucostomoides
5 changes clade I Apiognomonia supraseptata
Diaporthe phaseolorum
Fig. 3.2. Best (-ln likelihood) of ten equally most parsimonious trees of 209 steps based on LSU nrDNA. CI = 0.4976, RI = 0.6957, and RC = 0.3462. Numbers above branches are bootstrap values from 1000 replicates of a heuristic search. Bootstrap values lower than 50% are not shown.
50 Fig. 3.3. Most parsimonious tree based on combined SSU and LSU nrDNA. The tree is of 290 steps, with CI, RI, and RC of 0.5517, 0.7466, and 0.4119, respectively. Numbers above branches are bootstrap values from 1000 replicates of a heuristic search. Bootstrap values lower than 50% are not shown. The perithecium orientation, ascospore shape and septation, the original color in potato dextrose agar (PDA), the color in 3% KOH, and the color in 85% lactic acid were mapped on the tree. a Data were not available. b Color was the same as the original. c Color was darker than the original. * D=Diaporthaceae, G=Gnomoniaceae, M=Melanconidaceae, V=Valsaceae, -=data not available. From left to right, the taxonomies were according to Wehmeyer (1975), Barr (1978), Barr (1990), and Hawksworth et al., (1995), respectively.
51 Xylaria hypoxylon color on PDA Chaetomium globosum perithecium ascospore taxonomy 93 orientation shape and septation original KOH lactic acid Ophiostoma piliferum
Plagiostoma euphorbiae horizontal pink light yellow light yellow GVGV* 100 a 64 Discula fraxinae - - pink light yellow light yellow - - - - 74 Discula campestris ------
97 Gnomonia padicola upright brown, arial brown brown GGGV hyphae pink 62 Gnomonia setacea upright - - - GGGV
96 Pleuroceras pleurostylum horizontal orange light yellow light yellow DVGV 90 97 Linospora capreae oblique or horizontal pink light yellow light yellow GVGV
Apioplagiostoma aceriferum horizontal coffee purple coffee - VGV
97 b 98 Discula destructiva WA6 - - black no change no change - - - - Discula destructiva 254 - - black no change no change - - - -
69 Discula quercina 78 ------Amphiporthe castanea oblique pink pink pink - VGV 81 clade III Melanconis marginalis oblique to horizontal black no change no change DMMM 96 Apiosporopsis carpinea upright - - - GGGM Discula sp. 326 - - black no change no change - - - - 77 Cryphonectria parasitica +oblique red to orange - - DVGV 70 clade II Cryptodiaporthe corni oblique orange purple - DVGV
55 67 c 100 Endothia eugeniae upright coffee darker no change DGVV
54 Valsa ambiens ssp. leucostomoides oblique to horizontal olive wood darker no change VVVV 5 changes clade I Apiognomonia supraseptata upright pale luteous - - GGGV
Diaporthe phaseolorum oblique to horizontal pink gray gray DVGV Saccharomyces cerevisiae 56
Candida albicans
Candida krusei
Neurospora crassa
76 Chaetomium elatum 97
96 Podospora anserina
Discula destructiva 254
99 100 Endothia eugeniae 95
Cryptodiaporthe corni
Microascus trigonosporus 10 changes
Fig. 3.4. Most parsimonious tree based on RPB2 amino acid sequences. The tree is of 246 steps, with CI, RI, and RC of 0.8618, 0.7888, and 0.6798, respectively. Numbers above branches are bootstrap values from 1000 replicates of a heuristic search. Bootstrap values lower than 50% are not shown.
53 support. The deep branch topology of the ten trees was the same, although they differed in the positions of a few terminal branches within clades II or III. SSU and LSU nrDNA Combined. The PHT of 500 replicates indicated no significant conflict between the SSU and LSU nrDNA datasets (P=0.932). The combined data set contained the same taxa as the LSU nrDNA data set. A total of 128 phylogenetically- informative characters was used in the analyses. One single most parsimonious tree was produced by a heuristic search (Fig. 3.3). The tree length was 290 steps, with CI, RI, and RC of 0.5517, 0.7466, and 0.4119, respectively. The three major clades based on the LSU phylogeny were further supported here, and higher bootstrap values were obtained for both clade II and clade III (55% and 96%, respectively). RPB2. Three taxa in the Diaporthales were sequenced: Discula destructiva (S. Redlin 254, Maryland), Endothia eugeniae, and Cryptodiaporthe corni. The RPB2 gene region amplified in this study was ca 650 bp. Approximately 580 bp were sequenced and sequences of 175 amino acids were obtained. The phylogenetic analyses were performed based on the amino acid sequences of ten fungal species, and one most parsimonious tree was produced by an exhaustive search (Fig. 3.4). Three saccharomycetalean species were designated as outgroup. The tree length was 246 steps, with CI, RI, and RC of 0.8618, 0.7888, and 0.6798, respectively. D. destructiva was grouped with two diaporthalean species with 99% bootstrap support. Secondary Metabolites. Diaporthe phaseolorum produced abundant pale pink aerial hyphae, which became gray in both KOH and lactic acid. No color change occurred in distilled water. Endothia eugeniae, and Valsa ambiens subsp. leucostomoides were coffee to olive wood color in culture. When KOH was added, the color was darkened and partially dissolved. The Apioplagiostoma aceriferum culture was also coffee color originally, but it changed to purple and partially dissolved in KOH. There was no color change in lactic acid or distilled water. The aerial hyphae of the Gnomonia padicola
54 culture was pink while those submerged in the medium were brown. Yellow pigments also were dissolved in KOH solution, but a color change was not observed. Linospora capreae, Pleuroceras pleurostylum, Plagiostoma euphorbiae, and Discula fraxinae produced pink or orange color colonies. The colors faded immediately or within 15 min in 3% KOH solution and 85% lactic acid, and turned to very light yellow. No color change occurred in distilled water. The colors were not dissolved in KOH, lactic acid, or distilled water. Discula destructiva produced black or dark olive colonies with no color change or dissolution in any of the three reagents. Melanconis marginalis had white hyphae and black sporodochium-like conidia producing structures with no color change reactions either. The reactions of other species were either ambiguous or cultures were not available. DISCUSSION Diaporthales Taxa. The parsimony trees (Figs. 3.1-3.3) based on SSU, LSU, and combined data all placed D. destructiva into the Diaporthales with strong bootstrap support. Neighbor-joining trees (not shown) also gave this result, although the topologies were not exactly the same. The RPB2 phylogeny gave additional evidence of a close relationship between this asexual species with two diaporthalean species (Fig. 3.4). Therefore, although the teleomorph is unknown, both morphological and molecular data suggested the placement of the dogwood anthracnose fungus within the Diaporthales. WA6 and 254 were two D. destructiva isolates from Washington state and Maryland, parasitic on the Pacific and flowering dogwoods, respectively. Their SSU and LSU nrDNA sequences were identical, although the host and locality were different. Discula sp. 326 is undescribed and frequently found to be associated with D. destructiva on the host (Salogga and Ammirati, 1983). It was also included in the Diaporthales, but only distantly related to other Discula species.
55 All of the Discula species sampled here were circumscribed in clade III (Figs. 3.2, 3.3), but they do not constitute a monophyletic group. Their affinities with other taxa were not resolved well, except for D. fraxinae and D. campestris, which formed a sister group with Plagiostoma euphorbiae. The SSU nrDNA phylogeny provided little information about the relationships of taxa within the Diaporthales (Fig. 3.1); however, the monophyly of the Diaporthales was well supported with a bootstrap value of 97%, confirming the placement of the order among other orders of pyrenomycetes (Spatafora and Blackwell, 1994). LSU and combined trees gave more resolution among the species in the Diaporthales. The selected 20 species of Diaporthales were divided into three major clades (Figs. 3.2, 3.3). Diaporthe phaseolorum was basal to other members of Diaporthales, as the single species represented clade I. Clade II had five species and clade III had 14. Clade II did not receive much statistical support (equal or lower than 55%), but it appeared in all the most parsimonious trees based on LSU nrDNA and the combined data. Clade III was much better supported. This grouping conflicts with the taxonomies based solely on morphology (Table 3.1). None of the morphological characters, such as ascospore shape, ascus persistence, or peritherium position, were congruent with the nrDNA tree (Fig. 3.3). The allantoid ascospores occurred in clade II (Valsa and some species of Endothia), but they were also grouped with species of nonallantoid ascospores. Therefore, Wehmeyer (1975) and Barr (1990)’s Valsaceae based on allantoid ascospore shape was paraphyletic. Another paraphyletic family is the Melanconidaceae of Barr (1978, 1990) and Hawksworth (1995). The other families that have been described with the exception of Pseudovalsaceae (Table 3.1) were polyphyletic because the characters that defined them were distributed in two or more clades in the nrDNA tree (Fig. 3.3). A single evolutionary trend in morphology found here was that the filiform ascospore shape was a derived character from broad (ellipsoid or fusoid)
56 ascospore shape in clade III, because the two species with the filiform ascospores (Linospora capreae and Pleuroceras pleurostylum) formed a more recently derived monophyletic group (Figs. 3.2, 3.3). Anamorph variation is more informative in understanding the three clades. Diaporthe phaseolorum has a Phomopsis anamorph, which produces two types of conidia, the ovoid to fusoid α-conidia and the filiform β-conidia. This peculiar trait was either derived after the splitting of clade I from clades II and III, or lost in other lineages except for Melanconis, which also has two types of conidia (Jensen, 1984). Since the Discula anamorph was present only in clade III, one might infer that the derivation of this anamorph was associated with the most recent ancestor of clade III. However, with the addition of more taxa and sequence data, a different distribution pattern of anamorphs may be inferred. Magnaporthe and Gaeumannomyces. Magnaporthaceae is a small pyrenomycetous family with five genera and 13 species recognized (Cannon and Alcorn, 1994; Hawksworth et al., 1995). It is characterized by black perithecia with long hairy necks, tapering paraphyses, filiform ascospores, hyphomycetous anamorphs with pigmented conidiogenous cells, the presence of appressoria, and usually necrotrophic pathogenicity on roots, especially of grasses. The family contains two strongly virulent cereal pathogens, M. grisea and G. graminis. There has been no consensus concerning the ordinal position of these species. They have been considered as members of Diaporthales (Monod, 1983; Alexopoulos et al., 1996), Phyllachorales (Barr, 1977), and Xylariales (Barr, 1990). The SSU nrDNA phylogeny in this study indicated that this group of fungi may be connected to the Ophiostomatales (Fig. 3.1) or Sordariales (neighbor-joining tree, not shown). Since only poor statistical support was obtained, the ordinal placement of Magnaporthaceae is not proposed here. It is, however, interesting that the molecular phylogeny suggested that these species belong in a unique, previously
57 unsuspected position among the unitunicate, pyrenomycetous fungi. Magnaporthaceous species produce hyphomycetous anamorphs, including Pyricularia, Phialophora, Clasterosporium, Nakataea and Mycoleptodiscus, further supporting their segregation from the Diaporthales, which have coelomycetous anamorphs, such as Discula, Phomopsis, Gloeosporium, and Melasmia. Secondary Metabolites. Secondary metabolites of fungi generally include antibiotics, toxins, pigments, and pheromones. Characteristic secondary metabolites have long been used in their taxonomy, especially for lichens (Kärnefelt, 1989), but biochemical systematics has not been widely applied to the pyrenomycetous fungi except for the Hypocreales. Rossman et al. (1999) used pigmentation and color change in KOH to distinguish two families in the Hypocreales. In the Diaporthales, Cryptodiaporthe corni and Endothia s. l. were reported also as having KOH+ reactions. They changed from red or orange to purple in KOH and the colors were reversible with lactic acid (Roane and Stipes, 1978; Redlin and Rossman, 1991). The samples that had reversible color change (A. aceriferum, E. eugeniae, and V. ambiens subsp. leucostomoides) were coffee to olive wood color in culture and became darker than their original color in KOH, except for A. aceriferum (Fig. 3.3). Whether this reaction has the same mechanism as the KOH purple reaction needs further study. Linospora capreae, P. pleurostylum, Pl. euphorbiae, and D. fraxinae showed another color change in KOH. Their bright pink or orange color faded and turned to a very light yellow. This color change was not reversible. The taxa with this reaction all belonged in clade III, which indicted that this secondary metabolite was a derived character in the Diaporthales. Since a purple KOH reaction also occurred in the Hypocreales, it might be an ancestral trait and lost in many lineages since one single mutation could block the metabolite production. Otherwise it could have been gained independently more than one time, a less parsimonious explanation. Since secondary metabolic pathways are genetically inheritable traits, they are potentially
58 phylogenetically and taxonomically informative. Deeper and broader exploitation in this area might be valuable. REFERENCES Alexopoulos, C. J., Mims, C. W., and Blackwell, M. 1996. Introductory mycology. 4th edn. New York: John Wiley and Sons Inc. Anagnostakis, S.L. 1987. Chestnut blight: The classical problem of an introduced pathogen. Mycologia 79: 23-37. Barr, M. E. 1977. Magnaporthe, Telimenella, and Hyponectria (Physosporellaceae). Mycologia 69: 952-966. Barr, M. E. 1978. The Diaporthales in North America with emphasis on Gnomonia and its segregates. Mycol. Mem. 7: 1-232. Barr, M. E. 1990. Prodromus to nonlichenized, pyrenomycetous members of class hymenoascomycetes. Mycotaxon 39: 43-184. Byther, R. S. and Davidson, R. M. Jr. 1979. Dogwood anthracnose. Ornam. NW. Newsl. 3:20-21. Cannon, F. L. 1994. The newly recognized family Magnaporthaceae and its relationships. Syst. Ascomycet. 13: 25-42. Cannon, P. F. and Alcorn, J. L. 1994. Omnidemptus affinis gen. et sp. nov., teleomorph of Mycoleptodiscus affinis sp. nov. Mycotaxon 51: 483-487. Daughtrey, M. L. and Hibben, C. R. 1994. Dogwood anthracnose: a new disease threatens two native Cornus species. Annu. Rev. Phytopathol. 32: 61-73. Hawksworth, D. L, Kirk, P. M, Sutton, B. C., and Pegler, D. M. 1995. Ainsworth and Bisby’s Dictionary of the fungi. 8th edn. Egham, UK: CAB International. Jensen, J. D. 1984. Melanconis marginalis from northern Idaho. Mycotaxon 20: 275- 281. Kärnefelt, I. 1989. Morphology and phylogeny in the Teloschistales. Cryptog. Bot. 1:147-203. Kasahara, S., Wang, P., and Nuss, D. L. 2000. Identification of bdm-1, a gene involved in G protein β -subunit function and α-subunit accumulation. Proc. Natl. Acad. Sci. USA 97: 412-417. Lee, S.B. and Taylor, J. W. 1990. Isolation of total DNA from fungi for amplification by the polymerase chain reaction. In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White,T. J. eds. PCR protocols: a guide to methods and applications. San Diego: Academic press. pp. 282-287.
59 Liu, Y. J., Whelen, S., and Benjamin, D. H. 1999. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerase II subunit. Mol. Biol. Evol. 16: 1799- 1808. Luttrell, E. S. 1951. Taxonomy of the Pyrenomycetes. Univ. Missouri. Stud. Sci. Ser. 24: 1-120. Maerz, A. and Paul, M. R. 1930. A dictionary of color. York, Pennsylvania: McGaraw- Hill Book Company, Inc. Monod, M. 1983. Monographie taxonomique des Gnomoniaceae. Sydowia Beih. 9: 1- 315. Nannfeldt, J. A. 1932. Studien ueber die Morphologie und systematik der nicht- lichenisierten inoperculaten Discomyceten. Nova Acta Regiae Soc. Sci. Upsaliensis Ser. IV 8: 1-368. Redlin, S. C. 1991. Discula destructiva sp. nov., cause of dogwood anthracnose. Mycologia 83: 633-642. Redlin, S. C. and Rossman, A. Y. 1991. Cryptodiaporthe corni (Diaporthales), cause of cryptodiaporthe canker of pagoda dogwood. Mycologia 83: 200-209. Redlin, S. C. and Stack, R. W. 1988. Gnomoniella fraxini sp. nov., teleomorph of the ash anthracnose fungus and its connection to Discula fraxinea comb. nov. Mycotaxon 32:175-198. Rehner, S. A. and Samuels, G. J. 1995. Molecular systematics of the Hypocreales: a teleomorph gene phylogeny and the status of their anamorphs. Can. J. Bot. 73(Suppl 1): S816-823. Rehner, S. A. and Uecker, F. A. 1994. Nuclear ribosomal internal transcribed spacer phylogeny and host diversity in the coelomycete Phomopsis. Can. J. Bot. 72: 1666-74. Roane, M. K. and Stipes, R. J. 1978. Pigments in the fungal genus Endothia. Virginia J. Sci. 29: 137-141. Rossman, A. Y., Samuels, G. J., Rogerson, C. T., and Lowen, R. 1999. Genera of Bionectriaceae, Hypocreaceae and Nectriaceae (Hypocreales, Ascomycetes). Stud. Mycol. 42: 1-248. Salogga, D. A. and Ammirati, J. F. 1983. Discula sp. associated with anthracnose of dogwood in the Pacific Northwest. Pl. Dis. 67: 1290. Spatafora, J. W. and Blackwell, M. 1993. Molecular systematics of unitunicate perithecial ascomycetes: the Clavicipitales-Hypocreales connection. Mycologia 85: 912- 922. Spatafora, J. W. and Blackwell, M. 1994. Cladistic analysis of partial ssrDNA sequences among unitunicate perithecial ascomycetes and its implications on the evolution of centrum development. In: Hawksworth, D. L. ed. Ascomycete systematics. Problems and perspectives in the nineties. New York: Plenum. pp. 233-241.
60 Swofford, D. L. 2000. PAUP*: phylogenetic analysis using parsimony (* and other methods) version 4. Sunderland, Massachusetts: Sinauer Associates. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids. Res. 24: 4876-4882. Trigiano, R. N., Caetano-Anollés, G., Bassam, B. J., and Windham, M. T. 1995. DNA amplification fingerprinting provides evidence that Discula destructiva, the cause of dogwood anthracnose in North America, is an introduced pathogen. Mycologia 87:490- 500. Wehmeyer, L. E. 1975. The pyrenomycetous fungi. Mycol. Mem. 6: 1-250. White, T. J., Bruns, T. D., Lee, S. B., and Taylor, J. W. 1990. Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal DNA genes. In: PCR protocols: a guide to methods and applications. Innis, M. A., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds. New York: Academic Press. pp. 315-322. Yao, J. M., McElreath, S. D., and Tainter, F. H. 1997. Double-stranded RNA in isolates of Discula destructiva from the pacific northwestern United States and British Columbia, Canada. Curr. Microbiol. 34: 67-69.
61 CHAPTER 4. POPULATION STRUCTURE OF DOGWOOD ANTHRACNOSE FUNGUS (DISCULA DESTRUCTIVA) INTRODUCTION Brasier (1987, 1995) described the effects of episodic selection on fungal populations, a phenomenon whereby a sudden environmental disturbance is likely to lead to a significant alteration in the population structure of certain fungal species. Such a disturbance, perhaps a geographic transposition, association with a new host or vector, hybridization, or climate change, might result in the emergence of a highly virulent or fit clone from an originally heterogeneous sexual population. Under these conditions intense selection pressure eliminates or suppresses less fit genotypes. If routine selection is reinstated, the population reverts to an outcrossing, highly heterogeneous population. Continued episodic selection, however, may result in speciation. This model was based on the study of emerging fungal pathogens such as Ophiostoma novo-ulmi, the causal agent of a new wave of Dutch elm disease (Brasier, 1987, 1995). The model also is likely to provide an explanation of the emergence of dogwood anthracnose fungus and predict its evolution. Dogwood anthracnose, caused by Discula destructiva, is a disease of several dogwood species native to North America, especially flowering and Pacific dogwoods (Cornus florida and C. nuttalii) (Farr et al., 1989). Its symptoms include bract necrosis, leaf spot, leaf blight, twig dieback, and trunk canker. The spores probably are dispersed by splashing rain and insects. Isolation of the fungus from fruit and seed of infected dogwood trees indicates that birds might contribute to long-distance dissemination of D. destructiva (Daughtrey et al., 1996). The fungus survives the winter in the host and leaf symptoms generally begin to occur in the early spring of the next year. Infected trees may be killed in years when environmental conditions are favorable to the fungus (Hibben and Daughtrey, 1988; Daughtrey and Hibben, 1994). In culture, D. destructiva reproduces by production of asexual spores in one to four weeks or longer depending on
62 the type of media. Sporulation is enhanced by adding leaves of plants such as dogwood and oak in the medium and by using a light/dark cycle. The optimal growth and sporulation was at 21 to 24 °C (Daughtrey et al., 1996).
The disease was first reported on Pacific dogwood in the northwestern United States in the 1970s (Byther and Davidson, 1979). It also appeared suddenly on flowering dogwood in southeastern New York and southwestern Connecticut at almost the same time (Pirone, 1980). Since then, the disease has spread rapidly through native dogwood populations and has caused dramatic devastation. Since that time, infections have been confirmed from British Columbia, Washington, Oregon, Idaho, and California in the western part of North America. In the east, the disease has been reported from New York, Connecticut, Massachusetts, Vermont, New Jersey, Pennsylvania, Delaware, Maryland, Virginia, West Virginia, North Carolina, South Carolina, Tennessee, Kentucky, Indiana, Michigan, Ohio, New Hampshire, Rhode Island, Missouri, Kansas, and as far south as Georgia and Alabama (Daughtrey et al., 1996; Hagan and Mullen, 1999). The fungus reproduces by asexual spores (mitospores or conidia). A sexual state is unknown. Redlin (1991) examined over a hundred collections from various regions in eastern and western North America. He reported that they were similar in morphology and described the pathogen as a new species of asexual fungus, Discula destructiva. Molecular phylogenetic analyses placed it in the Diaporthales, an order of ascomycetes including a number of plant pathogens such as the chestnut blight fungus (Zhang and Blackwell, 2001). The origin of D. destructiva into North America remains a mystery, though some evidence indicates that it may have been introduced rather recently. Morphology and DNA amplification fingerprinting (DAF) indicated that D. destructiva isolates were highly homogeneous regardless of their collection site or host, suggesting that this fungus might be a single recent introduction to North America (Trigiano et al., 1995).
63 However, the banding profiles of double-stranded RNA (dsRNA), a virus-like genetic element frequently found in the cytoplasm of many fungi, were different between eastern and western isolates (Yao et al., 1997; Rong et al., 2001). In addition, the generation of arbitrary signatures from amplification profiles (ASAP) distinguished subpopulations from northeastern, southeastern, and western North America (Caetano-Anollés et al., 1996). These studies suggested that the eastern and western D. destructiva populations might have had different origins, although the overall genetic variability was relatively low compared to that within other species (Caetano-Anollés et al., 2001). D. destructiva’s sudden emergence, rapid spread in native North American dogwoods, and low genetic diversity point to episodic selection as a potentially important force. There has been a suggestion (Anagnostakis, personal communication, 1997) that the disease now is less virulent than that of two decades ago in northeastern North America. This observation may indicate that selection pressures have eased and the fungal populations are now undergoing routine selection that might be detected by increased genetic diversity among North American populations. In order to test this hypothesis we included more recent collections (1999-2000) to compare genetic diversity with the older isolates (1989-1990). We also wanted to obtain data to determine if southeastern New York was the center of the early epidemic by using the criterion of high genetic diversity in comparison to that of the frontal sites. Although Caetoano- Anollés and colleagues (1996) had distinguished subpopulation structure within D. destructiva, they arbitrarily combined the mycelia of isolates from adjacent locations (e.g. MA, PA, and MD). Therefore, genetic diversity within subpopulations could not be accessed from their study. The main tool we used in this study was detection of amplified fragment length polymorphisms (AFLP), a highly efficient and reproducible genotyping technique that has been applied to a number of organisms, including bacteria (Rademaker et al., 2000),
64 plants (Van Der Haulst et al., 2000), fungi (Tredway et al., 1999), and animals (Reineke et al., 1999), including humans (Prochazka et al., 2001). In comparison to other commonly used genotyping tools such as RAPD and RFLP markers, many researchers have found that AFLP markers are more powerful in distinguishing highly homogeneous populations (González et al., 1998; Yee et al., 1999; Sharma et al., 1996). In addition to AFLP markers, sequencing of several protein-coding and non-coding genes and pathogenicity tests also were performed in order to address the following questions: 1) What is the population structure of D. destructiva? 2) Where is the epidemic center of dogwood anthracnose? 3) Is pathogenicity correlated with the population structure? 4) Has routine selection been re-established in more recent D. destructiva populations or has speciation occurred? MATERIALS AND METHODS Fungal Isolates. Seventy-two isolates of D. destructiva were included in the study. From the west, we used 22 samples: two collected from Oregon in 2000, the others from Washington more than a decade ago. Fifty eastern samples were analyzed, including one North Carolina and 14 Maryland samples collected in 1999 and 2000; others were collected during 1989-1991 from nine eastern states. In the 35 older eastern samples, 15 were from Maryland, New Jersey, and Pennsylvania, the area near New York City, and are referred to as the eastern central group (Fig. 4.1, isolates within the circle). The other 20 make up the eastern frontal group, which were from Massachusetts, Ohio, North Carolina, and as far south as Georgia. Both the 1990 and 1999 Catoctin Mountain Park (CMNP), Maryland collections were from approximately the same ten square kilometer area (Redlin, personal communication, 1999). See Table 4.1 and Fig. 4.1 for more details. DNA Extractions, PCR, Cloning and Sequencing. Cultures were grown in 2 % malt extract broth and harvested after one week. Mycelia were frozen in liquid nitrogen and ground to a fine powder with a mortar and pestle. Total nucleic acids were extracted by a
65 n (western)=22 12 8
2
7 2 2 East Central 1 9,11 (others East Frontal) 3 2,3 66 1 n (eastern)=50 4,1 4
Fig. 4.1. Sampling localities. The numbers denote number of isolates from each locality. Isolates in bold face type were collected in 1999 or 2000. Others are from 1983, 1989-1991 (see Table 4.1). The circle delimits the eastern central group. Isolates outside of the circle in the east comprise the eastern frontal group. Dneasy™ Plant Mini Kit (Qiagen, Valencia, California). Partial nuclear encoded small and large subunit rDNA genes (SSU and LSU rDNAs) were amplified with primers NS1 and NS6 (White et al., 1990), and ITS3 and LR3 (Rehner and Samuels, 1995), respectively, for several selected D. destructiva isolates. The internal transcribed spacer (ITS) region was amplified with primers ITS5 and ITS4 (White et al., 1990). Purified PCR products were used for cycle sequencing directly with the amplification primers.
Translation elongation factor 1 alpha (EF-1α), chitin synthase 1 (CHS-1), and β-tubulin genes also were amplified and sequenced with the primers EF1-728F/EF1-986R, CHS- 79F/CHS-354R (Carbone and Kohn, 1999) and Bt2a/Bt2b (Glass and Donaldson, 1995). Several primers (DIGS1: GTAAGTCCGCTTTTCCCATGTG, DIGS2: CTGCTAGGCATTAGACTACG, DIGS6: CATTTGGCTCGTGAGTCGTG, DIGS8: GCACGCCAGTTTGTGTATGAG, DIGS10: GCTGTAATCCAGCGTTGTG, and their reverse) were designed for PCR and sequencing of the IGS. The IGS PCR products were cloned using a TOPO TA Cloning® Kit for sequencing (Invitrogen, Carlsbad, California). In the cycle sequencing reactions, M13 forward and reverse primers provided with the cloning kit were used to obtain the inserted DNA sequences. Sequencing was performed on an ABI PRISM 377 automated sequencer (Perkin-Elmer Applied Biosystmes, Foster City, California). AFLP Techniques. We used AFLP™ plant mapping and microbial fingerprinting kits (PE Applied Biosystems). Total genomic DNA was digested with EcoRI and MseI and the restriction fragments were then ligated to adapters, which function as annealing sites or core designed for specific primers in subsequent PCR. By changing the number and sequence of the nucleotides adjacent to the core, we could selectively amplify restriction fragments that matched the primer sequences. Genomic variability was revealed by comparing the banding profiles. The amplification products were detected by an ABI PRISM 377 automated sequencer (PE Applied Biosystems). The size of the products
67 was determined by using GeneScan 3.1 fragment analysis software (PE Applied Biosystems). Fifty-seven pairs of selective primers were screened and two pairs (EcoRI- AC/MseI-C, and EcoRI-AA/MseI-0) that showed the greatest number of polymorphisms were chosen for analysis of all isolates. The unweighted pair group method with arithmetic averages (UPGMA) clustering was performed by the NTSYS-pc 1.80 software (Rohlf, 1993) using the Dice coefficent (also known as Nei and Li’s coefficient of similarity, 1979), which is equal to twice the number of common bands divided by the number of all bands in the two profiles. Genetic Diversity, defined as the probability that two randomly chosen haplotypes are different in the sample (Nei, 1987), was calculated by using Arlequin software (Schneider et al., 1997). Fisher’s α, another diversity index that is relatively unbiased by sample size (Magurran, 1988), also was calculated with EstimateS (Colwell, 2000). Pathogenicity Tests. Cultures were set up as described by Redlin (1991). Healthy young leaves were collected from a D. destructiva-free flowering dogwood tree on the Louisiana State University campus (Baton Rouge, East Baton Rouge Parish). The leaves were cut into leaf discs using a 22 mm diam cork borer, surface disinfested with a 1 % sodium hypochlorite solution, rinsed with sterile distilled water, blotted dry, and set into wells on water agar, adaxial side uppermost. Each leaf disc was burned in the middle to cause a wound of 3-4 mm in diameter. An agar plug (4 mm x 4 mm) cut from the margin of a one-week old culture was transferred to the wound. The plates were placed in an incubator at 23 ˚C with a 12-hour light/dark cycle. After three weeks, the percentage leaf area that contained conidiomata of D. destructiva was recorded. We did three replicates for each isolate. Statistical analyses (T-tests) were performed by using SAS 8.01 (SAS Institute, Cary, North Carolina). Pathogenicity of 11 randomly selected D. destructiva isolates also were tested at the temperatures of 28 ˚C and 32 ˚C. Data were recorded in the same way as described above.
68 Table 4.1. Discula destructiva isolates used in this study, and AFLP and pathogenicity test results. Isolate Host Location Geno- Year of Sourcea Pathogenicityb type Collection WA206 C. nuttallii Seattle, WA Q 1990 SCR 31.0±11.6 WA207 C. nuttallii Seattle, WA Q 1990 SCR 6.7±3.3 WA210 C. nuttallii Seattle, WA R 1990 SCR 13.3±4.4 WA212 C. nuttallii Seattle, WA Q 1990 SCR 20.3±15.1 WA220 C. nuttallii Seattle, WA Q 1990 SCR 0.3±0.3 WA221 C. nuttallii Seattle, WA Q 1990 SCR 36.7±21.9 WA222 C. nuttallii Seattle, WA Q 1990 SCR 94.7±4.8 WA1653 C. nuttallii Seattle, WA Q 1983 WHT 41.7±24.2 WAP1 C. nuttallii Poulsbo, WA Q 1990 SCR 7.0±4.2 WAP2 C. nuttallii Poulsbo, WA R 1990 SCR 21.7±14.2 WAP3 C. nuttallii Poulsbo, WA Q 1990 SCR 11.7±4.4 WAP4 C. nuttallii Poulsbo, WA Q 1990 SCR 48.3±25.9 WAP5 C. nuttallii Poulsbo, WA R 1990 SCR 73.7±24.2 WAP6 C. nuttallii Poulsbo, WA S 1990 SCR 8.3±0 WAP11 C. nuttallii Poulsbo, WA R 1989 SCR 12.7±10.3 WAP31 C. nuttallii Poulsbo, WA Q 1989 SCR 91.7±8.3 WAP33 C. nuttallii Poulsbo, WA S 1989 SCR 35.0±15.0 WAP37 C. nuttallii Poulsbo, WA Q 1989 SCR 68.3±29.2 WAP40 C. nuttallii Poulsbo, WA Q 1989 SCR 83.0±16.5 WAP272 C. nuttallii Poulsbo, WA Q 1990 SCR 5.3±2.6 OR1 C. nuttallii Lane Co., OR Q 2000 NZ 77.3±22.2 OR2 C. nuttallii Eugene, OR Q 2000 NZ 44.7±28.1 MAK1 C. kousa Vineyard Haven, MA B 1989 SCR 7.0±3.0 MAK2 C. kousa Vineyard Haven, MA B 1989 SCR 1.7±1.7 MAK3 C. kousa Vineyard Haven, MA B 1989 SCR 50.3±25.8 MAK5 C. kousa Vineyard Haven, MA B 1989 SCR 6.7±3.3 MAF2 C. florida Vineyard Haven, MA F 1989 SCR 0±0 MAF3 C. florida Vineyard Haven, MA F 1989 SCR 40.0±15.3 MAF5 C. florida Vineyard Haven, MA C 1989 SCR 26.7±24.2 NJ307 C. florida Morristown, NJ C 1990 SCR 66.3±30.7 NJ308 C. florida Morristown, NJ F 1990 SCR 98.3±1.7 PA1 C. florida Philadelphia Co., PA J 1989 SCR 5.3±2.6 PA5 C. florida Philadelphia Co., PA K 1989 SCR 89.0±11.0 MD203 C. florida Green Belt Park, MD G 1990 SCR 5.0±0 MD205 C. florida Green Belt, MD C 1990 SCR 45.0±28.4 MD231 C. florida CMNP, MD H 1990 SCR 17.7±8.2 MD233 C. florida CMNP, MD T 1990 SCR 5.0±0 MD234 C. florida CMNP, MD O 1990 SCR 17.7±9.6 MD235 C. florida CMNP, MD N 1990 SCR 58.3±8.3 MD237 C. florida CMNP, MD C 1990 SCR 25.0±7.6 MD240 C. florida CMNP, MD B 1990 SCR 2.3±1.3 MD247 C. florida CMNP, MD P 1990 SCR 8.7±5.8 MD254 C. florida CMNP, MD C 1990 SCR 60.7±5.3 MD304 C. florida CMNP, MD D 1990 SCR 17.0±14.0 MDno1 C. florida Beltsville, MD F 1999 NZ 41.3±29.7 MDno12 C. florida CMNP, MD B 1999 NZ 51.7±23.3
(table 4.1 continued)
69 MDno22 C. florida Beltsville, MD C 1999 NZ 83.3±16.7 MDno26 C. florida Green Belt, MD C 1999 NZ 55.0±22.5 MDRR1 C. florida CMNP, MD A 1999 NZ 98.0±1.5 MDRR2 C. florida CMNP, MD B 1999 NZ 59.3±18.5 MDRR3 C. florida CMNP, MD L 1999 NZ 44.7±22.3 MDRR4 C. florida CMNP, MD M 1999 NZ 83.6±9.0 MDRR5 C. florida CMNP, MD E 1999 NZ 10.0±5.0 MDRR6 C. florida CMNP, MD F 1999 NZ 78.3±11.7 MDRR7 C. florida CMNP, MD H 1999 NZ 24.3±4.3 MDRR8 C. florida CMNP, MD B 1999 NZ 99.7±0.3 MDRR9 C. florida CMNP, MD I 1999 NZ 0±0 MDRR10 C. florida CMNP, MD F 1999 NZ 22.0±11.0 WV264 C. florida Gilmer Co., WV F 1990 SCR 86.3±13.2 WV266 C. florida Upshur Co., WV F 1990 SCR 52.3±26.6 WV271 C. florida Barbour Co., WV F 1990 SCR 8.3±6.0 VA61 C. florida Floyd Co., VA B 1989 SCR 55.0±16.1 OH327 C. florida Franklin Co., OH F 1991 SCR 16.7±16.7 NC84 C. florida Macon Co., NC B 1989 SCR 8.3±1.7 NC85 C. florida Macon Co., NC B 1989 SCR 17.0±16.5 NC86 C. florida Macon Co., NC B 1989 SCR 23.3±13.3 NC87 C. florida Macon Co., NC B 1989 SCR 95.0±2.9 NC009 C. florida Macon Co., NC B 2000 NZ 10.0±0 GA77 C. florida White Co., GA B 1989 SCR 10.0±5.0 GA79 C. florida White Co., GA F 1989 SCR 2.0±1.5 GA80 C. florida Murray Co., GA B 1989 SCR 18.0±9.3 GA81 C. florida Murray Co., GA F 1989 SCR 3.7±1.3 a SCR, S. C. Redlin; WHT, W. H. Taussig; NZ, N. Zhang. MDno1, 12, 22 and 26 were collected by N. Zhang, M. Blackwell and G. Samuels; OR1 and OR2 were collected by G. Carroll; MDRR1-MDRR10 were collected by R. Reddinger. b Pathogenicity results at 23 ˚C, mean percent infected leaf area ± standard error.
70 Vegetative Compatibility Tests. The 72 isolates were paired in all possible combinations on potato dextrose agar plates with food coloring (Rizwana and Powell, 1992) and cultured under the same conditions as for the pathogenicity tests. Cultures were observed every month for a year. RESULTS AFLP. EcoRI-AC/MseI-C detected 50 bands in the size range of 40-500 bp, of which 12 were polymorphic. EcoRI-AA/MseI-0 amplified 67 fragments, only three of which were polymorphic. The other 55 primer pairs either had poor amplification or produced very few polymorphic sites. Twenty genotypes were identified based on both primer pair datasets. The dendrogram (Fig. 4.2) produced from the similarity matrix separated the disjunct western and eastern isolates, with western isolates (WEST) forming a clade, eastern ones (EAST) grouped in another clade, except for a Maryland collection (MD233), which was placed outside both of the major groups. The WEST clade had only three genotypes (Q, R, and S, Fig. 4.2 and Table 4.1), while the EAST clade (MD 233 excluded) had 16 genotypes. Genotypes B, C, F, Q, and R were dominant and wide spread, and other genotypes had only one or a few members. The Genetic Diversity (Nei, 1987) of isolates in the WEST clade (0.45) was much lower than that of the EAST clade (0.82). In the east, the 1989-1990 isolates from the hypothesized epidemic central area (MD, NJ, and PA) had much higher Genetic Diversity than those from the epidemic frontal area (GA, NC, VA, WV, and MA). The CMNP population had no significant change in Genetic Diversity between the years 1990 and 1999 (Table 4.2). The comparison of Fisher’s α showed the same patterns as shown by Nei’s Genetic
Diversity estimates. Pathogenicity. The WEST and EAST clades (Fig. 4.2) did not differ significantly in their pathogenicity, nor did the eastern central and frontal groups. However, significantly higher virulence was shown in the CMNP (Maryland) collections of 1999 compared to
71 0.960 0.968 0.976 0.984 0.992 1.000
Geno type
A MDRR1 MDRR2 MDRR8 MD240 MDno12 NC84 NC85 NC86 B NC87 GA77 GA80 VA61 MAK1 MAK2 MAK3 NC009 MAK5 MD205 MD237 MAF5 C MD254 MDno22 NJ307 MDno26 D MD304 E MDRR5 MDRR6 MDRR10 MDno1 GA79 GA81 F NJ308 OH327 WV266 WV271 WV264 MAF2 EAST MAF3 G MD203 H MDRR7 MD231 I MDRR9 J PA1 K PA5 L MDRR3 M MDRR4 N MD235 O MD234 P MD247 WA222 OR2 WAP272 OR1 WA1653 WAP1 WA220 Q WA206 WAP37 WA221 WA207 WAP4 WAP31 WAP3 WA212 WAP40 WEST WA210 R WAP11 WAP2 WAP5 S WAP33 WAP6 T MD233
Fig. 4.2. Dendrogram of 72 D. destructiva isolates based on AFLP results using Nei and Li's genetic similarity method (1979). The similarity coefficient is indicated above the dendrogram.
72 Table 4.2. Diversity and pathogenicity comparison of D. destructiva isolates of different locality, time, and genotypic group.
Pathogenicity Group Genetic Diversity Fisher’s α (% infection) WEST clade 0.45* 0.93* 37.9 EAST clade 0.82* 9.07* 36.9 CMNP 1990 (MD) 0.97 23.14 23.5* CMNP 1999 (MD) 0.93 10.88 60.0* Eastern Central 1989-1990 27.86* 0.94* 34.8 (MD,NJ,PA) Eastern Frontal 1989-1990 0.95* 0.56* 26.4 (GA,MA,NC,VA,WV) *significant difference (P<0.05).
73 the earlier collections of 1990 from the same area (Table 4.1). The 11 samples cultured at the temperatures of 28 ˚C and 32 ˚C showed less than 0.2% pathogenicity; while at 23 ˚C, pathogenicity of the same isolates ranged from 9% to 95% (data not shown in Table 4.1). Vegetative Compatibility Tests. In the vegetative compatibility tests, no obvious barrage zones or antibiosis reactions were observed in any of the over two thousand pairings. Gene Sequences. No sequence variation was detected from the SSU (1005 bp, GenBank accession numbers: AF277126 and AF429717-AF429719), LSU (569 bp, AF277136 and AF429721-AF429723), ITS (550 bp, AF429741-AF429748), or CHS-1 (261 bp, AF429724-AF429729) regions of the selected isolates. Between the WEST and EAST clades, a fixed T/C transition was found in the β-tubulin sequences (500 bp,
AF429736- AF429740) and a fixed G/A transition in EF-1α sequences (352 bp,
AF429730-AF429735), while no sequence variation was detected within either clade. Sequences of the isolate MD233 were the same as those of all the EAST clade isolates. The intergenic spacer region of D. destructiva was approximately 4.2 kb in eastern isolates and 3.6 kb in western isolates. About 600 bp at the 5’ end (AF429749- AF429755) and 2 kb at the 3’ end of the IGS sequences (AF429756-AF429761, AF424787, and AF424788) were obtained for four eastern and two western isolates. The IGS of eastern isolates was about 600 bp longer than that of western isolates, and there was a fixed 5-bp indel between the western and eastern isolates at positions 342-346. From position 459 to 600, the sequences were too variable between the western and eastern isolates to be aligned; however, variation was not detected within the EAST or the WEST clades. The 3’ end of the IGS region was invariant.
74 DISCUSSION Population Structure. One of our primary goals was to investigate the population structure of D. destructiva. A number of reports and papers have been published on the progression of the dogwood anthracnose epidemic since its first appearance in the 1970s, but only a handful of these were population studies. Trigiano et al. (1995) used DAF markers to find that the D. destructiva isolates were highly homogeneous across different collection localities and host species. Caetano-Anollés et al. (1996) used ASAP markers and reported a genetic difference between the western and eastern isolates collected a decade ago and even subpopulation structure in the east. However, they arbitrarily combined as many as eight fungal isolates in one sample according to their geographical location, which may have resulted in bias in presumed geographical variation. Moreover, some additional analyses are impossible based on results of pooled samples. One experiment with unpooled material included only a limited number of isolates, but variation of the ITS sequences also was detected in a more recent study (Caetano-Anollés et al., 2001). They identified five distinct ITS sequences among 18 D. destructiva isolates, but neither host nor geographical locations were reflected in the groupings. In our study, we included 72 D. destructiva isolates from a wide geographical range, 17 of which were collected during 1999 and 2000 and the others were collected about a decade ago. The AFLP markers identified twenty genotypes, but most of the isolates belonged to one of the five wide spread clones. The western and eastern isolates were clearly separated, a finding that agrees with the results of Caetano-Anollés et al. (1996). We also found that the western isolates had a remarkably lower Genetic Diversity than eastern isolates (Table 4.2). These results could be caused by sampling bias; however, the relatively sample size insensitive diversity index, Fisher’s α, also indicated a significantly higher diversity in the eastern isolates (9.07) than in the western
75 isolates (0.93) (DeWalt et al., 2000). In addition, the two Oregon collections from the year 2000 fell into one of the three genotypes found in Washington isolates collected a decade ago, indicating that the western population may have been less diverse. In the EAST clade, most of the isolates also belonged to one of the three wide spread clones. However, nine genotypes were found among 11 isolates collected in 1990 from an area of only approximately ten square kilometers in CMNP, Maryland. Within the 11 collections made in the same area nine years later, five genotypes were identified as new (Fig. 4.2). Moreover, a more recent study revealed that the eastern isolates contained a greater diversity of dsRNA than did western isolates (Rong et al., 2001). These results all corroborate the finding that the eastern D. destructiva population is more genetically diverse than the western population. Host plant diversity is an important consideration in pathogen genetic diversity. Although D. destructiva has not been reported from all species of Cornus, a search is needed to determine if it is present on other Cornus species. The generally broader distribution of the known eastern host C. florida from Maine to Florida in a variety of ecosystems and habitats (Little, 1971) would suggest greater intraspecific as well as interspecific diversity of Cornus in the eastern, compared to western North America; there is, however, no study to support this intuitive conclusion (Xiang, J., personal communication, 2001). Higher host genetic diversity would be expected to be correlated with the high diversity that was detected in the eastern D. destructiva isolates. Dogwood anthracnose was first noticed in the east in the southeastern New York- southwestern Connecticut region, from which the disease spread subsequently both northward and southward. It has been hypothesized that the disease was introduced from the port of New York (Daughtrey, 1993). We divided the eastern isolates into two groups, a central group from the area around New York City and the frontal group from regions radiating outward from New York. The more recent isolates (1999-2000) were excluded
76 from this comparison. Although the central group was from a smaller area and had fewer isolates, its much higher Genetic Diversity compared to that of the frontal group (0.94 vs. 0.56) supports the New York area as the epidemic center, and indicates that a search for the origin of the pathogen abroad might be productive. Because kousa dogwood (C. kousa), which has been imported to the U.S. from Asia since 1875, is usually more resistant to the disease than the native dogwoods (Ranney et al., 1995; Santamour et al., 1989), Asia might be a productive region to begin to search for D. destructiva or its ancestors if the disease was, in fact, introduced. Pathogenicity. Although the decade-old group of isolates centered around New York City had higher Genetic Diversity, its pathogenicity was not significantly different from that of the frontal group. The western isolates were more virulent on average than the eastern ones, but this difference also was not significant (Table 4.2). The 1999 CMNP isolates were significantly more virulent than the 1990 isolates, with a P-value of 0.0007. The length of time that the cultures were preserved might have influenced reduced culture viability and/or virulence of the pathogen, but one should not ignore the experimentally high infection rate of western isolates in culture since 1990 or before on the flowering dogwood leaves. In fact, this experimental evidence also signals the potential for spread of western fungal population members to the eastern native flowering dogwoods, causing a new wave of disease. Our cultural studies indicated that temperature is critical to pathogenicity. The fungus was unable to affect dogwood leaves at 28 ˚C or above in the laboratory, a factor that helps to explain its restricted geographical distribution in nature. Discula destructiva occurs at high elevation and/or northern coast areas, and its southern-most distribution is in northern California in the west and northern Alabama in the east (Daughtrey et al., 1996; Hagan and Mullen, 1999).
77 Many different fungal plant pathogens contain dsRNAs in their cytoplasm, some of which are related to reduced or enhanced virulence of the fungal hosts (Nuss and Koltin, 1990). The dsRNAs can be disseminated by spores; lateral transmission requires somatic anastomosis (Ghabrial, 1998), and vegetative compatibility, therefore, is important for the spread of dsRNAs between fungal individuals. The apparent vegetative compatibility among all the 72 D. destructiva isolates inferred that the dsRNA factors may be able to be transfered across all the isolates. Caetano-Anollés et al. (2001) also found vegetative compatibility among their D. destructiva isolates. The effect of dsRNAs on virulence of D. destructiva has not been determinded, but the difficulty in spreading dsRNAs in the chestnut blight fungal population (Anagnostakis, 1982) probably would not be encountered in D. destructiva. Episodic Selection and Speciation. In both eastern and western isolates, a few highly fit clones were wide spread, and the genetic diversity of this apparently asexual fungus was remarkably low compared to that of many other asexual fungal species (Caetoano- Anollés et al., 2001; González et al., 1998). This led us to suggest that D. destructiva is still under intense selection pressure and that episodic selection is still in effect. Further support was from the Genetic Diversity comparison of the CMNP isolates. From 1990 to 1999, the CMNP samples did not show more diversity or less virulence (Table 4.2). However, the relatively high Genetic Diversity at the possible epidemic center (Fig. 4.1 and Table 4.2) might indicate the beginning of a transition to routine selection. Future studies on the population dynamics will be needed to determine if D. destructiva is in fact taking this direction and to predict how long it will take to become a less virulent, highly heterogeneous population. We cannot provide a definite reason for the observed variation either between or among isolates of the eastern and western groups. The western and eastern isolates were easily distinguished from each other by AFLP and sequence analysis, and our data
78 suggest that the two large independent clades might be the result of separate introductions. This explanation also has been suggested by other researchers (Caetano- Anollés et al., 1996; Yao et al., 1997). In our opinion the degree of diversity between the eastern and western clades does not merit recognition of two distinct species although the detected polymorphisms in IGS, EF1-α, and β-tubulin gene sequences occurred between, not within the two large clades. The variation within each of the groups also could be due to past multiple introductions. At this time we cannot answer the question of how much genetic divergence might have occurred over the intervening twenty years since the recognition of the disease in the presumed absence of sexual reproduction. Several mechanisms besides multiple introductions into each geographical region might, however, help to explain the levels, albeit low, of variation. These include drift due to mutation and selection and undetected genetic recombination. More evidence is needed before firmer conclusions can be made, but our work should serve as a baseline study for monitoring the fungus in the future. REFERENCES Anagnostakis, S. L. 1982. Biological control of chestnut blight. Science 215: 466-471. Brasier, C. M. 1987. The dynamics of fungal speciation. In: Evolutionary Biology of the Fungi. Edited by Rayner, A. D. M., Brasier, C. M., and Moore, D. Cambridge University Press, England. pp. 231-260. Brasier, C. M. 1995. Episodic selection as a force in fungal microevolution, with special reference to clonal speciation and hybrid introgression. Can. J. Bot. 73 (Suppl. 1): S1213-S1221. Byther, R. S. and Davidson, R. M. Jr. 1979. Dogwood anthracnose. Ornamentals Northwest Newsl. 3: 20-21. Caetano-Anollés, G., Trigiano, R. N., and Windham, M. T. 1996. Sequence signatures from DNA amplification fingerprints reveal fine population structure of the dogwood pathogen Discula destructiva. FEMS Microbiol. lett. 145: 377-383. Caetano-Anollés, G., Trigiano, R. N., and Windham, M. T. 2001. Patterns of evolution in Discula fungi and the origin of dogwood anthracnose in North America, studied using arbitrarily amplified and ribosomal DNA. Curr. Genet. 39: 346-354.
79 Carbone, I. and Kohn, L. M. 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553-556. Cowell, R. K. 2000. EstimateS, Statistical Estimation of Species Richness and Shared Species from Samples. Version 6.0b1. University of Connecticut. http://viceroy.eeb.uconn.edu/estimates. Daughtrey M. L. 1993. Dogwood anthracnose disease: native fungus or exotic invader? In: Biological Pollution: The Control and Impact of Invasive Exotic Species. Ed. McKnight B. N. pp. 23-33. Indianapolis: IN Acad. Sci. Daughtrey, M. L., and Hibben, C. R. 1994. Dogwood anthracnose: a new disease threatens two native Cornus species. Annu. Rev. Phytopathol. 32: 61-73. Daughtrey, M. L., Hibben, C. R., Britton, K. O., Windham, M. T., and Redlin, S. C. 1996. Dogwood anthracnose--Understanding a disease new to North America. Plant Disease 80: 349-358. DeWalt, S. J., Schnitzer, S. A., and Denslow, J. S. 2000. Density and diversity of lianas along a chronosequence in a central Panamanian lowland forest. J. Tropical Ecology 16: 1-19. Farr, D. F., Bills, G. F., Chamuris, G. P., and Rossman, A. Y. 1989. Fungi on Plants and Plant Products in the United States. APS Press, St. Paul, Minnesota. 1252pp. Ghabrial, S. 1998. Origin, adaptation and evolutionary pathways of fungal viruses. Virus Genes 16: 119-131. Glass, N. L. and Donaldson, G. C. 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 61: 1323-1330. González, M., Rodríguez, R., Zavala, M. E., Jacobo, J. L., Hernández, F., Acosta, J., Martínez, O., and Simpson, J. 1998. Characterization of Mexican isolates of Colletotrichum lindemuthianum by using differential cultivars and molecular markers. Phylopathology 88: 292-299. Hagan, A. K. and Mullen, J. M. 1999. Occurrence of diseases in native stands of flowering dogwood in north Alabama. Alabama Agricultural Experiment Station Bulletin 639: 1-15. Hibben, C. R. and Daughtrey, M. L. 1988. Dogwood anthracnose in northeastern United States. Plant Disease 72: 199-203. Little, E. L., Jr. 1971. Atlas of United States Trees. Vol. 1. Conifers and Important Hardwoods: U.S. Department of Agriculture Miscellaneous Publication 1146. Washington, DC. Magurran, A. E. 1988. Ecological Diversity and Its Measurement. Princeton University Press, Princeton, New Jersey. 179pp. Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New York.
80 Nei, M. and Li., W.-H. 1979. Mathematical model for studying genetic variation in terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA 76: 5269-5273. Nuss, D. L. and Koltin, Y. 1990. Significance of dsRNA genetic elements in plant pathogenic fungi. Annu. Rev. Phytopathol. 28: 37-58. Pirone, P. P. 1980. Parasitic fungus affects region’s dogwood. New York: New York Times, Feb. 24, pp. 34, 37. Prochazka, M., Walder, K., and Xia, J. 2001. AFLP fingerprinting of the human genome. Human Genetics 108: 59-65. Rademaker, J. L. W., Hoste, B., Louws, F. J., Kersters, K., Swings, J., Vauterin, L., Vauterin, P., and de Bruijn, F. J. 2000. Comparison of AFLP and rep-PCR genomic fingerprinting with DNA-DNA homology studies: Xanthomonas as a model system. International Journal of Systematic and Evolutionary Microbiology 50: 665-677. Ranney, T. G., Grand, L. F., and Knighten, J. L. 1995. Susceptibility of cultivars and hybrids of kousa dogwood to dogwood anthracnose and powdery mildew. Journal of Arboriculture 21: 11-16. Redlin, S. C. 1991. Discula destructiva sp. nov., cause of dogwood anthracnose. Mycologia 83: 633-642. Rehner, S. A. and Samuels, G. J. 1995. Molecular systematics of the Hypocreales: a teleomorph gene phylogeny and the status of their anamorphs. Can. J. Bot. 73 (Suppl.1): S816-S823. Reineke, A., Karlovsky, P, Zebitz, C. P. W. 1999. Amplified fragment length polymorphism analysis of different geographic populations of the gypsy moth, Lymantria dispar (Lepidoptera: Lymantriidae). Bulletin of Entomological Research 89: 79-88. Rizwana, R. and Powell, W. A. 1992. Ultraviolet light-induced instability of vegetative compatibility groups of Cryphonectria parasitica. Phytopathology 82: 1206-1211. Rohlf, F. J. 1993. NTSYS-pc. Numerical taxonomy and multivariate analysis system. New York: Exeter Software. Rong, R., Rao, S., Scott, S. W., and Tainter, F. H. 2001. Common multiple dsRNAs are present in populations of the fungus Discula destructiva originating from widely separated geographic locations. Curr. Microbiol. 42: 144-148. Santamour, F. S. Jr., McArdle, A. J., and Strider, P. V. 1989. Susceptibility of flowering dogwood of various provenances to dogwood anthracnose. Plant Disease 73: 590-591. Schneider, S., Kueffer, J., Roessli, D., and Excoffier L. 1997. Arlequin ver. 1.1. A software for population genetic data analysis. Geneticds and Biometry Laboratory, University of Geneva, Switzerland.
81 Sharma, S. K., Knox, M. R., and Ellis, T. H. N. 1996. AFLP analysis of the diversity and phylogeny of Lens and its comparison with RAPD analysis. Theor. Appl. Genet. 93: 751-758. Tredway, L. P., White, J. F., Gaut, B. S., Reddy, P. V., Richardson, M. D., and Clarke, B. B. 1999. Phylogenetic relationships within and between Epichloë and Neotyphodium endophytes as estimated by AFLP markers and rDNA sequences. Mycological Research 103: 1593-1603. Trigiano, R. N., Caetano-Anollés, G., Bassam, B. J., and Windham, M. T. 1995. DNA amplification fingerprinting provides evidence that Discula destructiva, the cause of dogwood anthracnose in North America, is an Introduced pathogen. Mycologia. 87: 490- 500. Van Der Hulst, R.G. M., Mes, T. H. M., Den Nijs, J. C. M., and Bachmann, K. 2000. Amplified fragment length polymorphism (AFLP) markers reveal that population structure of triploid dandelions (Taraxacum officinale) exhibits both clonality and recombination. Molecular Ecology 9: 1-8. White, T. J., Bruns, T. D., Lee, S. B., and Taylor, J. W. 1990. Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal DNA genes. In: PCR Protocols: A Guide to Methods and Applications. Innis., M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., eds. New York: Academic Press. pp 315-322. Yao, J. M., McElreath, S. D., and Tainter, F. H. 1997. Double-stranded RNA in isolates of Discula destructiva from the Pacific northwestern United States and British Columbia, Canada. Curr. Microbiol. 34: 67-69. Yee, E., Kidwell, K. K., Sills, G. R., and Lumpkin, T. A., 1999. Diversity among selected Vigna angularis (Azuki) accessions on the basis of RAPD and AFLP markers. Crop Sci. 39: 268-275. Zhang, N. and Blackwell, M. 2001. Molecular phylogeny of dogwood anthracnose fugnus (Discula destructiva) and the Diaporthales. Mycologia 93: 355-365.
82 CHAPTER 5. SUMMARY AND CONCLUSIONS This dissertation investigated phylogenetic relationships of problematic pyrenomycetes and population genetics of an asexual member of this complex group of fungi. Traditional classifications of pyrenomycetes were based on phenotypic features. The fact that conflicting classifications exist is due primarily to a different choice of characters by investigators and the common occurrence of convergence in certain selected phenotypic features. In many recent systematics studies, as well as the results presented here, molecular characters have been used to infer the evolutionary history of fungal taxa in order to apply the results to devise a phylogenetic classification. In addition to their abundance and ubiquity, an important advantage of molecular data is that they are usually less biased in homology determination. The phylogenetic studies presented here were obtained by analysis of molecular sequence data and are aimed at resolving some long-standing problems of pyrenomycete classification, including the phylogenetic placement of Melanospora and allies and the monophyly of the genus Melanospora (Chapter 2), and the delimitation of families within the order of Diaporthales (Chapter 3). Another part of the research sought to access the population structure and pathogenicity of the dogwood anthracnose fungus in order to infer its origin and evolutionary mechanisms (Chapter 4). In Chapter 2 of the dissertation, the second largest subunit of RNA polymerase II gene (RPB2) and nuclear encoded small and large subunit ribosomal RNA genes (SSU and LSU nrDNA) were used to infer the phylogenetic position of Melanospora and other morphologically similar taxa. The phylogeny based on SSU nrDNA sequences from 31 pyrenomycetes species with Saccharomycetales as outgroup placed four species of Melanospora and five morphologically similar species of other genera in the Hypocreales (Fig. 2.1). The phylogeny based on deduced amino acid sequences of RPB2 gene supported these results (Fig. 2.3). Six groups were recognized in the LSU
83 nrDNA phylogeny including 36 species of Hypocreales and nine Melanospora and similar species with Xylariales as outgroup (Fig. 2.2). Four morphologically similar species of Melanospora were placed within or close to groups in the Hypocreales. Melanospora and one of its allies Sphaerodes, however, formed a monophyletic basal clade outside of Hypocreales with 100% bootstrap value. The phylogeny also helped in understanding the evolutionary pathway of centrum types found in these taxa. The third chapter focused on the phylogenetic relationships of the taxa in the Diaporthales and the origin of the dogwood anthracnose fungus Discula destructiva. With taxa from other orders of pyrenomycetes as outgroup, 20 species of Diaporthales including five asexual Discula species clearly formed three clades, both with the LSU nrDNA and the combined LSU and SSU nrDNA phylogeny (Figs. 3.2 and 3.3). Characters of pigmentation and anamorph type also correspond to the molecular phylogeny to some extent. These results rejected family concepts based on perithecium orientation, ascus persistence, and ascospore morphology. The Discula species, including D. destructiva, did not form a monophyletic grouping, but all of them were placed in a clade of the Diaporthales (clade III, Figs. 3.2 and 3.3). The placement of D. destructiva within the Diaporthales was corroborated by the phylogenies from the SSU nrDNA sequence and the deduced amino acid sequence of RPB2 gene (Figs. 3.1 and 3.4). Taxa of the Magnaporthaceae have some similarity with certain Diaporthalean species in that they are plant parasites, but the SSU nrDNA phylogeny excluded them from the Diaporthales and suggested their close relationship with the Ophiostomatales (Fig. 3.1). Without support of high bootstrap value and from other gene phylogenies, however, the ordinal placement of Maganaporthaceae is not proposed here. Evolutionary studies at the population level were a part of the dissertation research. In the fourth chapter, the population structure of D. destructiva was investigated in order to infer the evolutionary mechanism and geographical origin of this
84 dogwood pathogen that emerged suddenly and spread rapidly in the North America. Two groups of D. destructiva isolates were distinguished with amplified fragment length polymorphism (AFLP) markers and sequences of the intergenic spacer of nuclear ribosomal DNA, translation elongation factor, and the β-tubulin gene (Fig. 4.2). These groups corresponded to the disjunct distribution of the pathogen. Twenty genotypes were identified in 72 fungal isolates, 17 genotypes present in the eastern U.S. (n=50), and only three from the western coast (n=22), revealing a higher genetic diversity among the eastern isolates. Although genetic diversity was detected in both populations of D. destrucitva, it was remarkably low compared to that of many other asexual fungi, a finding that indicated D. destructiva is still under intense selection pressure and that episodic selection may still be in effect. However, the transition to a less virulent, heterogeneous population might have begun in the New York City area, a possible epidemic center in the east, which had relatively higher genetic diversity than the samples from other areas (Table 4.2). In conclusion, 1) the molecular phylogenetic studies presented in the dissertation supported the placement of Melanospora and allies (Ceratostomataceae) in the Hypocreales but 2) the monophyly of Melanospora and Ceratostomataceae, Sordariales were rejected. 3) Results also inferred that the asexual dogwood anthracnose fungus (D. destructiva) was derived from within Diaporthales, and that 4) the family delimitations of the Diaporthales based on morphological characters were artificial. Including more taxa and more genes in the phylogenetic studies has helped understand the evolutionary history of the organisms as well as their phenotypic characters. 5) The population studies revealed genetic differences between the disjunct eastern and the western isolates of D. destructiva, from both DNA sequence data and AFLP results. 6) Genetic diversity was greater among the eastern isolates than the western isolates. The remarkably low genetic diversity of D. destructiva populations compared to other asexual fungal pathogens
85 indicated that D. destructiva is still under episodic selection. However, 7) the transition to a less virulent, heterogeneous population might have begun in the New York City area, which also was the probable epidemic center in the eastern U. S. based on the AFLP results.
86 APPENDIX LETTERS OF PERMISSION
87
VITA Ning Zhang was born in Qingdao, People’s Republic of China, on the twenty- second of March, 1972. She completed her pre-college education in Gaomi. In 1989, she attended Shandong University in Jinan, and earned a Bachelor of Science degree in microbiology in 1993. Afterwards, she began her graduate studies under the supervision of J.-Y. Zhuang at the Institute of Microbiology, Chinese Academy of Sciences, where she obtained her Master of Science degree in mycology in 1996. In the fall of 1996, Ning joined the doctoral program of the Department of Plant Biology, Lousiana State Univeristy and Agricultural and Mechanical College, under the direction of M. Blackwell, in order to continue her education in evolutionary biology. She will receive the degree of Doctor of Philosophy at the May 2002 Commencement.
90