DOCSLIB.ORG

Motor Neuron Columnar Fate Imposed by Sequential Phases of Hox-C Activity

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Motor Neuron Columnar Fate Imposed by Sequential Phases of Hox-C Activity articles Motor neuron columnar fate imposed by sequential phases of Hox-c activity Jeremy S. Dasen1, Jeh-Ping Liu2 & Thomas M. Jessell1 1Howard Hughes Medical Institute, Department of Biochemistry and Molecular Biophysics, Center for Neurobiology and Behavior, Columbia University, 701 West 168th Street, New York, New York 10032, USA 2University of Virginia School of Medicine, Department of Neuroscience, Lane Road extended, MR4, Room 5032, Charlottesville, Virginia 22908, USA ........................................................................................................................................................................................................................... The organization of neurons into columns is a prominent feature of central nervous system structure and function. In many regions of the central nervous system the grouping of neurons into columns links cell-body position to axonal trajectory, thus contributing to the establishment of topographic neural maps. This link is prominent in the developing spinal cord, where columnar sets of motor neurons innervate distinct targets in the periphery. We show here that sequential phases of Hox-c protein expression and activity control the columnar differentiation of spinal motor neurons. Hox expression in neural progenitors is established by graded fibroblast growth factor signalling and translated into a distinct motor neuron Hox pattern. Motor neuron columnar fate then emerges through cell autonomous repressor and activator functions of Hox proteins. Hox proteins also direct the expression of genes that establish motor topographic projections, thus implicating Hox proteins as critical determinants of spinal motor neuron identity and organization. Columns are basic units of neuronal organization in the vertebrate neural Hox protein expression, and the establishment of spinal MN central nervous system (CNS)1,2, but the mechanisms that control columnar identity, if any, remains obscure. their assembly remain unclear. One region of the CNS in which neuronal columnar organization has been studied intensively is the Hox protein expression segregates with MN columnar subtype spinal cord, where distinct columnar subtypes of motor neurons are To explore the link between Hox expression and MN columnar known to innervate different muscle and neuronal targets in the 3 identity, we focused initially on Hox-c proteins, because members periphery . All spinal motor neurons (MNs) derive from progenitor 11 4 of this Hox cluster are prominently expressed by MNs .We cells located at a constant dorso-ventral position in the neural tube , examined how the expression of Hoxc5, Hoxc6, Hoxc8 and but motor neurons appear to acquire their discrete columnar Hoxc9 at brachial and thoracic levels of the spinal cord is matched identities as a function of position along the rostrocaudal axis of to the differentiation of LMC and CT neurons5,16. 5–8 the spinal cord (Supplementary Fig. S1a–c). Limb levels of the Hoxc6 expression by MNs (defined by Isl1/2 expression) was spinal cord generate lateral motor column (LMC) neurons, whereas confined to brachial levels, whereas Hoxc9 expression by MNs was intervening thoracic levels give rise to autonomic MNs (termed restricted to thoracic levels (Fig. 1a). Hoxc6þ and Hoxc9þ MNs were 5–8 Column of Terni (CT) neurons in chick) . Along the dorsoventral interspersed at the border of the brachial and thoracic spinal cord, but axis, the graded signalling activity of Sonic hedgehog (Shh) deter- very few neurons expressed both proteins (Fig. 1a, g). The rostro- mines the position of MN generation by regulating the spatial caudal domains of expression of Hoxc5 and Hoxc8 by MNs were also expression of a set of homeodomain transcription factors within segregated (Fig. 1b, h), but in contrast to Hoxc6 and Hoxc9, the 4,9 neural progenitors . The constancy of Shh signalling along the transition from Hoxc5þ to Hoxc8þ MNs mapped to the mid-brachial rostrocaudal axis, however, implies that other signalling pathways level (Fig. 1c; Supplementary Fig. S2c). Thus, rostral brachial LMC control the diversification of MNs into distinct columnar subtypes. neurons co-express Hoxc5 and Hoxc6, whereas caudal brachial LMC One source of signals that can influence the columnar fate of neurons co-express Hoxc6 and Hoxc8 (Fig. 1c, e, f, i, k). At rostral spinal motor neurons is the paraxial mesoderm. The transposition thoracic levels, many MNs initially co-expressed Hoxc8 and Hoxc9 of paraxial mesoderm between limb and thoracic levels soon after (Fig. 1d, j). neural tube closure results in the respecification of LMC and CT MN columnar subtypes located at different rostrocaudal posi- identity, and a similar switch in columnar fates is observed after tions can be delineated by LIM homeodomain transcription factor transposition of the neural tube10. However, before neural tube expression17. In addition, CT neurons can be distinguished by closure, signals from axial mesodermal tissues—the node and expression of BMP5, a transforming growth factor-b family mem- nascent notochord—have been shown to regulate the molecular ber18, and LMC neurons by expression of retinaldehyde dehydro- identity of MNs along the rostrocaudal axis of the spinal cord11.In genase-2 (RALDH2), a key enzyme in retinoic acid synthesis19,20 particular, members of the Hox-c homeodomain protein cluster are (Supplementary Fig. S1d). We therefore examined whether the expressed by post-mitotic MNs generated at distinct rostrocaudal profile of Hox-c protein expression by MNs corresponds to the positions11, and profiles of Hox-c protein expression characteristic position of newly generated brachial LMC neurons and of CT of brachial, thoracic and lumbar MNs can be induced in vitro by neurons. At brachial levels, the rostral and caudal boundaries of early exposure of neural cells to increasing levels of fibroblast growth RALDH2 expression coincided closely with the domain of Hoxc6þ, factor (FGF) signalling11,12. Moreover, the pattern of Hox-c protein Hoxc92 MNs (Fig. 1l, m, o; Supplementary Fig. S2a, b). At thoracic expression changes along with columnar identity after early trans- levels, the rostral and caudal boundaries of BMP5 expression position of brachial and thoracic neural tube10.Hoxproteins coincided with the domain of Hoxc9þ,Hoxc62 MNs (Fig. 1n–p; influence MN diversification in the hindbrain13–15, and thus a role Supplementary Fig. S2d, e). Together, these data indicate that Hoxc6 for Hox proteins in the assignment of spinal MN columnar identity and Hoxc9 expression within MNs coincides with brachial LMC is plausible. Nevertheless, the link between axial FGF signalling, and thoracic CT columns, respectively (Fig. 1q). 926 © 2003 Nature Publishing Group NATURE | VOL 425 | 30 OCTOBER 2003 | www.nature.com/nature articles Regulation of Hox-c protein expression by FGF signalling neural tube influences MN columnar identity. Brachial expression þ The exposure of neural progenitor cells in vitro to increasing FGF of FGF8 did not suppress the generation of Isl1/2 MNs, but levels induces the differentiation of MNs with a progressively more reduced the total MN number by ,30% at stage 29 (Fig. 2i, j), a caudal Hox-c profile, suggesting a model in which the positional finding consistent with observations that the number of MNs identity of MNs at brachial and thoracic levels is established by generated at brachial levels of the spinal cord normally exceeds graded FGF signalling11. that at thoracic levels20. The number of medial MMC neurons, To test this model in vivo, we examined whether an increase in the assessed by Lim3 expression17 was not altered (Supplementary Fig. level of FGF signalling in the neural tube elicits a rostral to caudal S3i), consistent with the presence of this motor column at both switch in the profile of Hox-c protein expression. In ovo electro- brachial and thoracic levels. poration was used to co-express FGF8 and the green fluorescent After FGF8 expression, however, brachial MNs lacked RALDH2 protein gene GFP (as an indicator of transfected cells) unilaterally in expression (Fig. 2k). The expression of RALDH2 by LMC neurons brachial and thoracic regions of the stage 12 neural tube (Fig. 2a). directs lateral LMC divisional identity, defined by co-expression of The concentration of FGF8 plasmid was titrated to a level that did Isl2 and Lim117. Consistent with this, we detected a virtually þ þ not perturb neural tube morphology or change the dorsoventral complete loss of Isl2 , Lim1 MNs (Fig. 2j). Thus, increased pattern of progenitor homeodomain proteins (see Methods). FGF8 signalling in brachial neural tube suppresses LMC differen- Expression of FGF8 resulted in the extinction of Hoxc6 expression tiation in a manner that parallels the suppression of Hoxc6 and the onset of Hoxc9 expression at brachial levels (Fig. 2b–f). expression. Similarly, exposure of rostral brachial levels to FGF8 led to the We examined whether the loss of LMC columnar identity is extinction of Hoxc5 and to a rostral expansion in Hoxc8 expression accompanied by the emergence of a thoracic programme of MN (Fig. 2 g, h). Thus, brachial FGF expression results in a brachial to columnar differentiation. After brachial FGF8 expression and thoracic switch in the profile of Hox-c expression. analysis at stage 29, the characteristic ovoid clustering of MNs Because profiles of Hox-c protein expression characteristic of typical of the LMC was lost, and instead MNs were clustered in a lumbar levels of the spinal cord can be induced by early
Load more

Recommended publications
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3
    ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Cyp24a1 Attenuation Limits Progression of Brafv600e-Induced Papillary Thyroid Cancer Cells and Sensitizes Them to BRAFV600E Inhibitor PLX4720 Minjing Zou1, Essa Y
    Published OnlineFirst February 27, 2017; DOI: 10.1158/0008-5472.CAN-16-2066 Cancer Tumor and Stem Cell Biology Research Cyp24a1 Attenuation Limits Progression of BrafV600E-Induced Papillary Thyroid Cancer Cells and Sensitizes Them to BRAFV600E Inhibitor PLX4720 Minjing Zou1, Essa Y. Baitei1, Huda A. BinEssa1, Futwan A. Al-Mohanna2, Ranjit S. Parhar2,ReneSt-Arnaud3, Shioko Kimura4, Catrin Pritchard5, Ali S. Alzahrani6, Abdullah M. Assiri7, Brian F. Meyer1, and Yufei Shi1 Abstract CYP24A1, the primary inactivating enzyme for vitamin D, is nocompromised nude mice. This phenotype was associated with often overexpressed in human cancers, potentially neutralizing the downregulation of the MAPK, PI3K/Akt, and TGFb signaling path- antitumor effects of calcitriol, the active form of vitamin D. How- ways and a loss of epithelial–mesenchymal transition (EMT) in ever, it is unclear whetherCYP24A1expression serves asa functional BVECyp24a1-null cells, associated with downregulation of genes contributor versus only a biomarker for tumor progression. In this involved in EMT, tumor invasion, and metastasis. While calcitriol study, we investigated the role of CYP24A1 on malignant progres- treatment did not decrease cell proliferation in BVECyp24a1-null cells, sion of a murine model of BrafV600E-induced papillary thyroid it strengthened antitumor responses to the BRAFV600E inhibitor cancer (PTC). Mice harboring wild-type Cyp24a1 (BVECyp24a1-wt) PLX4720 in both BVECyp24a1-null and BVECyp24a1-wt cells. Our find- developed PTC at 5 weeks of age. Mice harboring a homozygous ings offer direct evidence that Cyp24a1 functions as an oncogene in deletion of Cyp24a1 (BVECyp24a1-null) exhibited a 4-fold reduction PTC, where its overexpression activates multiple signaling cascades in tumor growth.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Accelerated High-Yield Generation of Limb-Innervating Motor Neurons from Human Stem Cells
    574 • The Journal of Neuroscience, January 9, 2013 • 33(2):574–586 Cellular/Molecular Accelerated High-Yield Generation of Limb-Innervating Motor Neurons from Human Stem Cells Mackenzie W. Amoroso,1,2* Gist F. Croft,1,2* Damian J. Williams,3 Sean O’Keeffe,4 Monica A. Carrasco,4 Anne R. Davis,5 Laurent Roybon,1,2 Derek H. Oakley,1,2 Tom Maniatis,4 Christopher E. Henderson,1,2 and Hynek Wichterle1,2 1Project A.L.S./Jenifer Estess Laboratory for Stem Cell Research, New York, New York 10032; 2Departments of Pathology, Neurology, and Neuroscience, Center for Motor Neuron Biology and Disease and Columbia Stem Cell Initiative, Columbia University, New York, New York 10032; 3Department of Physiology and Cellular Biophysics, Columbia University, New York, New York 10032; 4Department of Biochemistry and Biophysics, Columbia University, New York, New York 10032; 5Department of Obstetrics and Gynecology, Columbia University Medical Center, New York, New York 10032 Human pluripotent stem cells are a promising source of differentiated cells for developmental studies, cell transplantation, disease modeling, and drug testing. However, their widespread use even for intensely studied cell types like spinal motor neurons is hindered by the long duration and low yields of existing protocols for in vitro differentiation and by the molecular heterogeneity of the populations generated. We report a combination of small molecules that within 3 weeks induce motor neurons at up to 50% abundance and with defined subtype identities of relevance to neurodegenerative disease. Despite their accelerated differentiation, motor neurons expressed combinations of HB9, ISL1, and column-specific markers that mirror those observed in vivo in human embryonic spinal cord.
    [Show full text]
  • Molecules in Focus the HOXC6 Homeodomain-Containing Proteins
    The International Journal of Biochemistry & Cell Biology PERGAMON The International Journal of Biochemistry & Cell Biology 30 (1998) 651±655 Molecules in focus The HOXC6 homeodomain-containing proteins Alain Chariot *, Jacques Gielen Laboratory of Medical Chemistry and Medical Oncology, Pathology, +3, B-23, C.H.U., Sart-Tilman, University of Liege, 4000 Liege, Belgium Received 24 July 1997; accepted 9 October 1997 Abstract The HOXC6 homeodomain-containing proteins act as transcription factors in the genetic control of multiple genes involved in development and cell dierentiation. Two HOXC6 polypeptides are encoded by a single homeobox (`HOX') gene described as `master gene' for the crucial role it plays in the patterning and axial morphogenesis of multiple species. Transcription of the HOXC6 gene is initiated from two promoters and generates two proteins that share the same DNA-binding domain but harbor a distinct N-terminal region. Recent studies have demonstrated that both HOXC6 products can activate or repress transcription, depending on the cellular context. Functional in vivo speci®city of HOXC6 proteins may be achieved through combinatorial interactions with other members of the HOX family as well as with co-factors whose identities are largely unknown. Disruption of this `HOX code' may lead to pathology such as developmental defects. # 1998 Elsevier Science Ltd. All rights reserved. Keywords: Homeodomain; Transcription; Development 1. Introduction as transcription factors [4]. Their chromosomal localization is associated with their spatio±tem- Molecular characterization of actors regulating poral pattern of expression in the developing the genetic programs involved in development embryo (`colinearity') [5]. A human HOXC6 have lead to the identi®cation of the homeobox cDNA clone, previously named HOXc8.5111, region de®ned as a 183 bp highly conserved has been isolated from SV-40 transformed sequence [1] that is shared by 39 members of the ®broblasts [6] whereas a second HOXC6 cDNA has been recently obtained from a human breast HOX gene family (see Ref.
    [Show full text]
  • Supplementary Material Computational Prediction of SARS
    Supplementary_Material Computational prediction of SARS-CoV-2 encoded miRNAs and their putative host targets Sheet_1 List of potential stem-loop structures in SARS-CoV-2 genome as predicted by VMir. Rank Name Start Apex Size Score Window Count (Absolute) Direct Orientation 1 MD13 2801 2864 125 243.8 61 2 MD62 11234 11286 101 211.4 49 4 MD136 27666 27721 104 205.6 119 5 MD108 21131 21184 110 204.7 210 9 MD132 26743 26801 119 188.9 252 19 MD56 9797 9858 128 179.1 59 26 MD139 28196 28233 72 170.4 133 28 MD16 2934 2974 76 169.9 71 43 MD103 20002 20042 80 159.3 403 46 MD6 1489 1531 86 156.7 171 51 MD17 2981 3047 131 152.8 38 87 MD4 651 692 75 140.3 46 95 MD7 1810 1872 121 137.4 58 116 MD140 28217 28252 72 133.8 62 122 MD55 9712 9758 96 132.5 49 135 MD70 13171 13219 93 130.2 131 164 MD95 18782 18820 79 124.7 184 173 MD121 24086 24135 99 123.1 45 176 MD96 19046 19086 75 123.1 179 196 MD19 3197 3236 76 120.4 49 200 MD86 17048 17083 73 119.8 428 223 MD75 14534 14600 137 117 51 228 MD50 8824 8870 94 115.8 79 234 MD129 25598 25642 89 115.6 354 Reverse Orientation 6 MR61 19088 19132 88 197.8 271 10 MR72 23563 23636 148 188.8 286 11 MR11 3775 3844 136 185.1 116 12 MR94 29532 29582 94 184.6 271 15 MR43 14973 15028 109 183.9 226 27 MR14 4160 4206 89 170 241 34 MR35 11734 11792 111 164.2 37 52 MR5 1603 1652 89 152.7 118 53 MR57 18089 18132 101 152.7 139 94 MR8 2804 2864 122 137.4 38 107 MR58 18474 18508 72 134.9 237 117 MR16 4506 4540 72 133.8 311 120 MR34 10010 10048 82 132.7 245 133 MR7 2534 2578 90 130.4 75 146 MR79 24766 24808 75 127.9 59 150 MR65 21528 21576 99 127.4 83 180 MR60 19016 19049 70 122.5 72 187 MR51 16450 16482 75 121 363 190 MR80 25687 25734 96 120.6 75 198 MR64 21507 21544 70 120.3 35 206 MR41 14500 14542 84 119.2 94 218 MR84 26840 26894 108 117.6 94 Sheet_2 List of stable stem-loop structures based on MFE.
    [Show full text]
  • Mammalian-Specific Ectodermal Enhancers Control the Expression of Hoxc Genes in Developing Nails and Hair Follicles
    Mammalian-specific ectodermal enhancers control the expression of Hoxc genes in developing nails and hair follicles Marc Fernandez-Guerreroa, Nayuta Yakushiji-Kaminatsuib,1, Lucille Lopez-Delisleb, Sofía Zdrala, Fabrice Darbellayb,2, Rocío Perez-Gomeza, Christopher Chase Boltb, Manuel A. Sanchez-Martinc, Denis Dubouleb,d,e,3, and Marian A. Rosa,f,3 aInstituto de Biomedicina y Biotecnología de Cantabria, Consejo Superior de Investigaciones Científicas–Universidad de Cantabria–Sociedad para el Desarrollo de Cantabria, 39011 Santander, Spain; bSchool of Life Sciences, Federal Institute of Technology, Lausanne, 1015 Lausanne, Switzerland; cDepartment of Medicine, University of Salamanca, 37007 Salamanca, Spain; dDepartment of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland; eCollège de France, Paris, France; and fDepartamento de Anatomía y Biología Celular, Facultad de Medicina, Universidad de Cantabria, 39011 Santander, Spain Contributed by Denis Duboule, October 6, 2020 (sent for review June 1, 2020; reviewed by Nadav Ahituv and Robert Hill) Vertebrate Hox genes are critical for the establishment of structures and thus to show less functional redundancy. Examples of this during the development of the main body axis. Subsequently, they situation may be found either in the function of some Hoxa genes play important roles either in organizing secondary axial structures in uterine physiology (9–11) or in the apparent specialization of such as the appendages, or during homeostasis in postnatal stages some Hoxc genes for epidermal derivatives (12, 13), while other and adulthood. Here, we set up to analyze their elusive function in clusters apparently do not play any detectable function there. the ectodermal compartment, using the mouse limb bud as a model.
    [Show full text]
  • Aberrant HOXC Expression Accompanies the Malignant Phenotype in Human Prostate1
    [CANCER RESEARCH 63, 5879–5888, September 15, 2003] Aberrant HOXC Expression Accompanies the Malignant Phenotype in Human Prostate1 Gary J. Miller,2 Heidi L. Miller, Adrie van Bokhoven, James R. Lambert, Priya N. Werahera, Osvaldo Schirripa,3 M. Scott Lucia, and Steven K. Nordeen4 Department of Pathology, University of Colorado Health Sciences Center, Denver, Colorado 80262 ABSTRACT breast (13, 14), and renal (15) carcinomas; melanomas (16); and squamous carcinomas of the skin (17). Because the genes implicated Dysregulation of HOX gene expression has been implicated as a factor show little consensus, the dysregulation may be a tissue-specific in malignancies for a number of years. However, no consensus has perturbation of the existing HOX expression pattern rather than a emerged regarding specific causative genes. Using a degenerate reverse transcription-PCR technique, we show up-regulation of genes from the single causative gene. Tissue-specific expression patterns have been HOXC cluster in malignant prostate cell lines and lymph node metastases. reported in kidney and colon, by Northern blot analysis (12, 15). When relative expression levels of the four HOX clusters were examined, Primary tumors in both kidney and colon showed variations in spe- lymph node metastases and cell lines derived from lymph node metastases cific HOX gene expression from the corresponding normal tissue, but exhibited very similar patterns, patterns distinct from those in benign cells overall expression patterns for individual tumors were not reported. or malignant cell lines derived from other tumor sites. Specific reverse Only primary kidney tumors were examined (15), but liver metastases transcription-PCR for HOXC4, HOXC5, HOXC6, and HOXC8 confirmed from colon tumors reportedly displayed expression of specific HOX overexpression of these genes in malignant cell lines and lymph node genes similar to that seen in either primary colon tumors or normal metastases.
    [Show full text]