DOCSLIB.ORG

Differentiation and Cell-Type-Restricted Expression of HOXC4, HOXCS and HOXC6 M Myeloid Leukemias and Normal Myeloid Cells

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Leukemia 11998) 12, 1724-1 732 © 1998 Stockton Press All rights reserved 0887-6924/98 $12.00 1724 http://www.stockton-press.eo.uk/leu Differentiation and cell-type-restricted expression of HOXC4, HOXCS and HOXC6 m myeloid leukemias and normal myeloid cells 1 2 1 2 1 JJ Bijl , JW van Oostveen , JMM Walboomers', ATP Brink', W Vos , GJ Ossenkoppele and C)LM Meijer ' Department of Pathology and 'Department of Hematology, Academic Hospital of the Vrije Universiteit, Amsterdam, The Netherlands HOX genes have shown a lineage-specific expression in hema­ eage-restricted expression pattern s of HOX genes were found topoiesis and are suggested as being involved in the 5 6 in hematopoietic cells. · HOXC genes are found to be expression of certain adhesion molecules. Recently, we have expressed in human and mouse lymphocytic and myeloid cell demonstrated that HOXC4 and HOXC6, but not HOXC5, are 5 7 9 expressed during lymphoid differentiation. Reports on the lines. • - It appeared that from these genes HOXC8 was expression of these genes in myeloid leukemias and normal ubiquitously expressed in lymphoid, myeloid, erythroid and myeloid cells are still scarce. Therefore, we have investigated megakaryocytic cell lines. Expression of HO XC4 was found the expression of HOXC4, HOXC5 and HOXC6 in purified sub­ to be restricted to lymphoid cells.7 However, the reported data populations of bone marrow in addition to 36 specimens of are obtained by techniques with different sensitivity levels, acute myeloid leukemias (AMLs), eight chronic myeloid leuke­ hindering a reliable comparison. Therefore, we applied a mias (CMLs), several myeloid cell lines and cutaneous localiza­ 10 tions of three myelomonocytic leukemias and one granulocytic sensitive RT-PCR specific for HOXC4, HOXCS and HOXC6. sarcoma by RT-PCR and partly by RNA in situ hybridization Using this specific RT-PCR, we have shown in a previous (RISH). HOXC4 and HOXC6 transcripts were both detected by study that both HOXC4 and HOXC6 are expressed in the RT-PCR in 22/36 and 24/36 AMLs, respectively. The distribution lymphoid lineage.10 HOXC4 mRNA was expressed earlier in of HOXC4 and HOXC6 gene expression over the different types 10 more undifferentiated cells (CD34+/CD38 w cells) th an of AML was largely similar and covered all types of AML In HOXC6 mRNA (prothymocytes and pre-pre B cells), but contrast, HOXC5 gene expression was found in only 6/32 AMLs. Expression of HOXC5 was restricted to AMLs of the granulo­ expression of both genes persisted to maturity. In contrast to cytic (FAB M1-M3), early monocytic (FAB M4) and early HOXC4 and HOXC6, HOXCS expression could not be erythroid (FAB M6) lineage. In general, except in one FAB M5b detected in normal cells of the lymphoid lineage, but only 10 1 1 case, no expression of HOXC5 was found in AMLs derived from in particular types of non-Hodgkin's lymphomas (NHL), , late stages of monocytic (FAB MS) and megakaryocytic (FAB implying a role for HOXCS in tissue positioning of these lym­ M7) lineages. As for HOXC4 and HOXC6, expression of HOXC5 phoma cells. Studies on HOXCS expression in myeloid cell was absent in CMLs. Using RISH significant HOXC4, HOXC5 and HOXC6 expression was found in a number of additionally lines, myeloid leukemias and normal myelo id ce lls are scarce. studied AML samples of different FAB classification (M2, M4, Expression of HOXCS has been found only in some erythroid 5 7 M5b and M5b), (M2 and M5b) (M2, M4, M5b), respectively. In and myeloid cell lines. · tissue localizations of leukemias a different expression pattern These interesting observations prompted us to investigate of HOXC4, HOXC5 and HOXC6 was found. In contrast to mature the expression of HOXCS and that of neighboring genes leukemic stages of myeloid differentiation, these skin localiza­ HOXC4 and HOXC6. For that purpose, we analyzed mono­ tions of leukemias expressed HOXC5 and HOXC6. HOXC4 expression was found both in leukemic cells derived from per­ nuclear cells (M C) derived from bone marrow (BM) aspirates ipheral blood and from cutaneous localizations. Besides obtained from patients with acute and chronic myeloid leuke­ HOXC4 expression in monocytes no expression of HOXC4, mia (AML and CML), myeloid cel l lines and normal granulo­ HOXC5 and HOXC6 was found in granulocytes and monocytes, cytes, monocytes, erythroid colonies of growth factor-induced colonies of growth factor-induced CD34+ bone marrow cells. In CD34+ ce lls and subpopulations of the megakaryocytic lin­ 10 nd earliest CD34·/CD38 w " high cell fractions of bone marrow only eage by RT-PCR and partly by RNA in situ hybrid ization HOXC4 and in megakaryocytic cells both HOXC4 and HOXC6 were found. Thus, the expression patterns of these HOXC (RISH) in order to confirm biologica lly significant expression. genes found in the limited number of cell fractions of normal To characterize the significance of HOXC4, HOXCS and bone marrow suggest that the expression patterns found in HOXC6 expression in tissue localizations we additional ly ana­ AMLs and CMLs might reflect the normal situation. Further­ lyzed cutaneous infiltrates of myelomonocytic leukemias and more, the presence of HOXC5 and HOXC6 expression specifi­ a granulocytic sarcoma. cally in skin infiltrates of late differentiation stages of myeloid leukemias, suggests an additional role for these genes in the positioning of these myeloid cells in skin tissue. Keywords: homeobox genes; expression; myelopoiesis; differen­ Materials and methods tiation; leukemias Isolation of granulocytes, monocytes, erythroid colonies and CFU-MEGA Introduction Blood from normal donors was centrifugated over a Lympho­ Evidence accumulated over the last few yea rs tends to suggest prep density gradient. The fraction containing granulocytes that HOX genes are important geneti c determinants of pro­ was incubated tw ice w ith ammonium-chloride on ice for 10 1 4 liferation an d differen tiation of hematopoietic cells. - Lin- min to lyse the erythrocytes, then washed and pelleted for RNA isolation. Frozen monocytes, isolated by elutriation up to at least 90% purity, were thawed, washed tw ice, counted an d used for RNA isolation. For the generation of erythroid Correspondence: CJLM Meijer, Dept of Pathology, Academic Hospital of the Vrije Universiteit, De Boelelaan 1117, 1081 HV Amsterdam, colonies, CD34+ cel ls isolated from normal bone marrow The Netherlands; Fax: 31 20 44 42964 using a miniM acs system (Miltenyi Biotec, Bergisch Gladbach, Received 17 July 1997; accepted 29 April 1998 Germany), were incubated in Methocult GF H4434 (StemCel l Expression of HOXC4, HOXC5 and HOXC6 in myelopoiesis JJ Bijl et al 1725 Technologies, Vancouver, Canada) a methylcellulose (0.9%) Table 1 RT-PCR ana lysis of expression of HOXC4, HOXC5 and containing lscove' s medium supplied with human recombi­ HOXC6 mRNA in bone marrow aspirates from patients with AML •, CML, cell lines and sk in localized myeloid neoplasia nant growth factors (erythropoietin: 3 U/ ml, stem cell factor (SCF) : 50 ng/ml, GM-CSF: 10 ng/ml, and IL-3: 10 ng/ml), at Case HOXC4 HOXC5 HOXC6 U1N 37°C for 2 weeks. Twenty erythroid colonies, recognized by their large red morphology, were picked for RNA isolation. In Undifferentiated cells order to obtain cells of the megakaryocytic lineage, co34+ AML MO 0/2° 0/2 1/2 2/2 cells derived from non-involved BM of a patient with T-NHL 1 + were isolated using miniMacs (Miltenyi Biotec) and cultured 2 + + in lscove's medium supplemented with monothioglycerol, deionised 1 .5% BSA, iron-saturated transferrin (Sigma, St Cells with evidence of granulocytic differentiation Louis, MO, USA), sonicated lipids, 20 ng/ml thrombopoietin AML M1 2/5 1/5 1/5 5/5 3 1 + + + (TPO) (Sigma) and 10 ng/m SCF at 37°C, 5% CO . After 6 2 4-6 + days, cells were harvested and sorted by FACS (Becton 7 + Dickinson, Mountain View, CA, USA) using the membrane AML M2 3/5 1/5 2/5 5/5 marker combinations CD34+/CD41-, CD34+/CD41 + and 8 + + + CD34-/CD41 +. 9 + + + + 10/11 + 12 + + AML M3 3/3 1/3 3/3 3/3 Myeloid leukemias and cell lines 13 + + + + 14 + + + Myeloid cell lines studied were K562 (CML-blast crises), 15 + + + KGla, KGl , THP-1 , promyelocytic cell line HL60 and megak­ CML 0/8 0/8 0/8 8/8 aryocytic cell line M-07e. All cell lines were obtained from 16-23 + American Type Cell Collection (ATCC, Rockville, MD, USA) Cells with evidence of monocytic differentiation and were cultured at 37°C in RPMl-1640 medium with 25 AML M4 3/5 2/5 5/5 5/5 mM Hepes buffer (Gibco BRL, Life Technologies, Gaithers­ 24 + + burg, MD, USA) supplemented with 10% (v/v) heat inacti­ 25 + + vated fetal calf serum (Hyclone Laboratories, Logan, UT, 26 + + + + USA), 1 mM glutamine, 100 U/ml natrium Penicillin G (G ist 27 + + + 28 Brocades NV, Delft, The Netherlands) and 100 U/ml + + + + AML M5a 3/4 0/4 4/4 4/4 Streptomycin Sulphate (Pharmachemie BV, Haarlem, The 29 + + + Netherlands). 30 + + + Snap-frozen or fresh mononuclear cells derived from bone 31 + + marrow aspirates of 36 patients with AML and eight patients 32 + + + with CML were collected from the Department of Hematology AML M5b 1/3 0/3 1/3 3/3 of the Vrije Universiteit Hospital. The AML samples were 33 + + + 34 + ordered according to the criteria adopted from the French­ 35 + American-British (FAB) cooperative group.12 AML samples were routinely characterized for the expression of several Cells with evidence of erythroid differentiation immunomarkers, such as CD34, CD33, CDl 3 and CDl 5 M6 2/4 1/4 3/4 4/4 (Becton Dickinson) by FACS analysis. Cytospins of the cell 36 + + 37 samples were stained with M ay-Grunwald-Giemsa and were + + + + 38 + + + analyzed light-microscopically for the presence of contami­ 39 + nating lymphocytes.
Recommended publications
  • HOXC4 Rabbit Pab

    HOXC4 Rabbit Pab

    Leader in Biomolecular Solutions for Life Science HOXC4 Rabbit pAb Catalog No.: A13856 Basic Information Background Catalog No. This gene belongs to the homeobox family of genes. The homeobox genes encode a A13856 highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox Observed MW gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different 30kDa chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC4, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three Calculated MW genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include 29kDa the shared exon spliced to the gene-specific exons, or they may include only the gene- specific exons. Two alternatively spliced variants that encode the same protein have Category been described for HOXC4. Transcript variant one includes the shared exon, and transcript variant two includes only gene-specific exons. Primary antibody Applications WB Cross-Reactivity Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 3221 P09017 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 30-130 of human HOXC4 (NP_055435.2). Synonyms HOXC4;HOX3;HOX3E;cp19 Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using HOXC4 antibody (A13856) at 1:3000 dilution.
  • Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells

    Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells

    The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells.
  • Effect of Testosterone and Hypoxia on the Expansion of Umbilical Cord Blood CD34+ Cells in Vitro

    Effect of Testosterone and Hypoxia on the Expansion of Umbilical Cord Blood CD34+ Cells in Vitro

    EXPERIMENTAL AND THERAPEUTIC MEDICINE 14: 4467-4475, 2017 Effect of testosterone and hypoxia on the expansion of umbilical cord blood CD34+ cells in vitro LIPING ZHOU1,2, XIAOWEI ZHANG2, PANPAN ZHOU1, XUE LI1, XUEJING XU1, QING SHI1, DONG LI1 and XIULI JU1 1Department of Pediatrics, Qilu Hospital, Shandong University, Jinan, Shandong 250012; 2Department of Pediatrics, The Sixth People's Hospital of Jinan, Jinan, Shandong 250200, P.R. China Received October 12, 2016; Accepted June 15, 2017 DOI: 10.3892/etm.2017.5026 Abstract. Successfully expanding hematopoietic stem cells Therefore, the results of the current study indicate that a combina- (HSCs) is advantageous for clinical HSC transplantation. The tion of hypoxia and testosterone may be a promising cultivation present study investigated the influence of testosterone on the condition for HSC/hemopoietic progenitor cell expansion ex vivo. proliferation, antigen phenotype and expression of hemato- poiesis-related genes in umbilical cord blood-derived cluster Introduction of differentiation (CD)34+ cells under normoxic or hypoxia conditions. Cord blood (CB) CD34+ cells were separated using Hematopoietic stem cell (HSC) transplantation is a poten- magnetic activated cell sorting. A cytokine cocktail and feeder tially life-saving procedure used to treat a broad spectrum cells were used to stimulate the expansion of CD34+ cells under of disorders, including hematological, immune and genetic normoxic (20% O2) and hypoxic (1% O2) conditions for 7 days diseases (1). It has been demonstrated that bone marrow and testosterone was added accordingly. Cells were identified reconstituting HSCs reside within a small subpopulation using flow cytometry and reconstruction capacity was deter- of bone marrow or blood-derived mononuclear cells that mined using a colony-forming unit (CFU) assay.
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent

    Homeobox Gene Expression Profile in Human Hematopoietic Multipotent

    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
  • Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis

    Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis

    Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma, Anna-Karin Ekman, Cecilia Bivik Eding and Charlotta Enerbäck The self-archived postprint version of this journal article is available at Linköping University Institutional Repository (DiVA): http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-147791 N.B.: When citing this work, cite the original publication. Verma, D., Ekman, A., Bivik Eding, C., Enerbäck, C., (2018), Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis, Journal of Investigative Dermatology, 138(5), 1088-1093. https://doi.org/10.1016/j.jid.2017.11.036 Original publication available at: https://doi.org/10.1016/j.jid.2017.11.036 Copyright: Elsevier http://www.elsevier.com/ Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma*a, Anna-Karin Ekman*a, Cecilia Bivik Edinga and Charlotta Enerbäcka *Authors contributed equally aIngrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Division of Dermatology, Linköping University, Linköping, Sweden Corresponding author: Charlotta Enerbäck Ingrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Linköping University SE-581 85 Linköping, Sweden Phone: +46 10 103 7429 E-mail: [email protected] Short title Differential methylation in psoriasis Abbreviations CGI, CpG island; DMS, differentially methylated site; RRBS, reduced representation bisulphite sequencing Keywords (max 6) psoriasis, epidermis, methylation, Wnt, susceptibility, expression 1 ABSTRACT Psoriasis is a chronic inflammatory skin disease with both local and systemic components. Genome-wide approaches have identified more than 60 psoriasis-susceptibility loci, but genes are estimated to explain only one third of the heritability in psoriasis, suggesting additional, yet unidentified, sources of heritability.
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 Enhances Cardiac Reprogramming

    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K

    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
  • Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3

    Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3

    ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Cyp24a1 Attenuation Limits Progression of Brafv600e-Induced Papillary Thyroid Cancer Cells and Sensitizes Them to BRAFV600E Inhibitor PLX4720 Minjing Zou1, Essa Y

    Cyp24a1 Attenuation Limits Progression of Brafv600e-Induced Papillary Thyroid Cancer Cells and Sensitizes Them to BRAFV600E Inhibitor PLX4720 Minjing Zou1, Essa Y

    Published OnlineFirst February 27, 2017; DOI: 10.1158/0008-5472.CAN-16-2066 Cancer Tumor and Stem Cell Biology Research Cyp24a1 Attenuation Limits Progression of BrafV600E-Induced Papillary Thyroid Cancer Cells and Sensitizes Them to BRAFV600E Inhibitor PLX4720 Minjing Zou1, Essa Y. Baitei1, Huda A. BinEssa1, Futwan A. Al-Mohanna2, Ranjit S. Parhar2,ReneSt-Arnaud3, Shioko Kimura4, Catrin Pritchard5, Ali S. Alzahrani6, Abdullah M. Assiri7, Brian F. Meyer1, and Yufei Shi1 Abstract CYP24A1, the primary inactivating enzyme for vitamin D, is nocompromised nude mice. This phenotype was associated with often overexpressed in human cancers, potentially neutralizing the downregulation of the MAPK, PI3K/Akt, and TGFb signaling path- antitumor effects of calcitriol, the active form of vitamin D. How- ways and a loss of epithelial–mesenchymal transition (EMT) in ever, it is unclear whetherCYP24A1expression serves asa functional BVECyp24a1-null cells, associated with downregulation of genes contributor versus only a biomarker for tumor progression. In this involved in EMT, tumor invasion, and metastasis. While calcitriol study, we investigated the role of CYP24A1 on malignant progres- treatment did not decrease cell proliferation in BVECyp24a1-null cells, sion of a murine model of BrafV600E-induced papillary thyroid it strengthened antitumor responses to the BRAFV600E inhibitor cancer (PTC). Mice harboring wild-type Cyp24a1 (BVECyp24a1-wt) PLX4720 in both BVECyp24a1-null and BVECyp24a1-wt cells. Our find- developed PTC at 5 weeks of age. Mice harboring a homozygous ings offer direct evidence that Cyp24a1 functions as an oncogene in deletion of Cyp24a1 (BVECyp24a1-null) exhibited a 4-fold reduction PTC, where its overexpression activates multiple signaling cascades in tumor growth.
  • Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer

    Genome-Wide DNA Methylation Analysis Reveals Molecular Subtypes of Pancreatic Cancer

    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 17), pp: 28990-29012 Research Paper Genome-wide DNA methylation analysis reveals molecular subtypes of pancreatic cancer Nitish Kumar Mishra1 and Chittibabu Guda1,2,3,4 1Department of Genetics, Cell Biology and Anatomy, University of Nebraska Medical Center, Omaha, NE, 68198, USA 2Bioinformatics and Systems Biology Core, University of Nebraska Medical Center, Omaha, NE, 68198, USA 3Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, 68198, USA 4Fred and Pamela Buffet Cancer Center, University of Nebraska Medical Center, Omaha, NE, 68198, USA Correspondence to: Chittibabu Guda, email: [email protected] Keywords: TCGA, pancreatic cancer, differential methylation, integrative analysis, molecular subtypes Received: October 20, 2016 Accepted: February 12, 2017 Published: March 07, 2017 Copyright: Mishra et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC-BY), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Pancreatic cancer (PC) is the fourth leading cause of cancer deaths in the United States with a five-year patient survival rate of only 6%. Early detection and treatment of this disease is hampered due to lack of reliable diagnostic and prognostic markers. Recent studies have shown that dynamic changes in the global DNA methylation and gene expression patterns play key roles in the PC development; hence, provide valuable insights for better understanding the initiation and progression of PC. In the current study, we used DNA methylation, gene expression, copy number, mutational and clinical data from pancreatic patients.