DOCSLIB.ORG

Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3 ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients. In the BC cell lines T24 and 5637, silencing of and differentiation of cells in the embryo and morphogenesis. HOXA10 by small interfering RNA transfection suppressed An increasing number of studies have demonstrated that HOX the proliferation, migration and invasion of BC cells, and led genes, including HOXA10, serve important roles in oncology to decreased matrix metalloproteinase-3 expression. Taken and in the development of various tumors (7). Previous studies together, overexpression of HOXA10 may be associated with have identified abnormal HOXA10 expression and reported poor prognosis in BC, and may serve as a novel antitumor the cancer-promoting activities of HOXA10 in various malig- therapy target for the treatment of this disease. nant disorders, including endometrial, nasopharyngeal, gastric and breast cancer (7-11). However, the expression and role of Introduction HOXA10 in BC has not been previously reported. Based on the abnormal expression and cancer-promoting Bladder cancer (BC) is the most common malignancy of roles of HOXA10 in the development of various cancers, the urinary system and its incidence presents an increasing we hypothesized that HOXA10 may play vital roles in the trend (1). Urothelial carcinoma is the most common subtype development of BC. Initially, immunohistochemistry was of bladder cancer and is categorized as muscle invasive or used to determine the expression of HOXA10 in BC and non-muscle invasive (2). Despite the advances in surgical adjacent normal tissues. After revealing the high expression techniques and the use of chemotherapy as a treatment option, level of HOXA10 in BC, cell proliferation, migration and a great number of patients experience little clinical benefit due invasion assays were performed in T24 and 5637 cells with to the likelihood of recurrence and early tumor infiltration (3). HOXA10 knocked down by small interfering RNA (siRNA). Furthermore, western blotting analysis was carried out to explore the mechanism by which HOXA10 promotes BC progression and facilitates the malignant behavior of BC cells. Correspondence to: Dr Yanhui Zhao or Dr Tao Cui, Department of Materials and methods Urology, Qingdao Central Hospital, 127 Si Liu Nan Road, Qingdao, Shandong 266042, P.R. China Patients and specimens. A total of 78 paired fresh specimens E-mail: [email protected] of BC and adjacent normal tissues) were obtained from E-mail: [email protected] patients diagnosed with BC and underwent total cystectomy *Contributed equally in Qingdao Central Hospital (Qingdao, China) between March 2011 and August 2015. None of the patients underwent any Key words: homeobox A10, bladder cancer, cell invasion, matrix preoperative therapy, such as chemotherapy or radiation metalloproteinase-3 therapy. The exclusion criteria also included presence of tumors with histologically identified extensive necrosis. The diagnosis and pathological grades of the patients were verified 50 LIU et al: HOXA10 PROMOTES BLADDER CANCER VIA MMP-3 REGULATION using hematoxylin and eosin (H&E) staining, according to Ltd., (Suzhou, China). The siRNA sequences were as follows: the World Health Organization classification guidelines (12). si-HOXA10, 5'-CAC GGA CAG ACA AGT GAA ATT-3' (sense) Patients were assigned to three pathological grades (GI-III) and 5'-GTG CCT GTC TGT GTT CAC TTT TT-3' (antisense); according to the differential degree of tumor differen- si-Ctrl, 5'-UUC UCC GAA CGU GUC ACG UTT-3' (sense) tiation (12), and the patient population included 17, 25 and 36 and 5'-ACG UGA CAC GUU CGG AGA ATT-3' (antisense). cases with a pathological grade of I, II and III, respectively. T24 and 5637 cells were transfected with the siRNAs using The clinical stage of BC patients was determined according Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, to the American Joint Committee on Cancer guidelines (13), Inc.) according to the manufacturer's protocol. Western blot- including stages I, II, III and IV. The patient population in the ting was subsequently used to assess the silencing efficiency of present study consisted of 38 and 40 cases with clinical stages si‑HOXA10. Initially, the silencing efficiency of si‑HOXA10 of I+II and III+IV, respectively. All patients agreed to the use on HOXA10 expression in T24 and 5637 cells compared with of their samples in the present study and signed an informed si-Ctrl and untreated control groups was detected. As si-Ctrl consent prior to surgery. The current study was approved by the had little effect on HOXA10 and was similar to the untreated Ethical Reviewing Committee of Qingdao Central Hospital. group, cells were treated only using si-HOXA10 and si-Ctrl in Patient characteristics are listed in Table I. subsequent experiments. Immunohistochemical analysis. HOXA10 expression was Western blotting. Cells were lysed for 30 min on ice using detected in the 78 paired fresh specimens using immuno- radioimmunoprecipitation assay buffer (Beijing Solarbio histochemistry. Briefly, the fresh specimens were fixed in Science & Technology Co., Ltd., Beijing, China), and total 10% formalin for 24 h at room temperature and routinely protein was quantified using the BCA Protein Assay kit processed for paraffin embedding. Serial histologic sections (Beijing Solarbio Science & Technology Co., Ltd.) according were cut to a thickness of 4 µm, initially stained with hema- to the manufacturer's protocol. For western blot analysis, a toxylin for 5 min and eosin for 1 min at room temperature, total of 20 µg total protein was loaded per lane and separated and then analyzed by a senior pathologist to identify the in a 12% gel by SDS-PAGE. Subsequent to transferring the diagnosis and pathological grades of the patients. Subsequent proteins onto a nitrocellulose membrane (EMD Millipore, to dewaxing and rehydration, the sections were washed three Billerica, MA,USA), the membrane was blocked with 5% times with 1X phosphate-buffered saline (5 min/wash). fat-free milk for 1.5 h at room temperature and incubated with Next, the sections were blocked with normal goat serum for primary antibodies at 4˚C overnight. The primary antibodies 25 min at room temperature and subsequently incubated with used in the present study were as follows: Anti-HOXA10 HOXA10 monoclonal antibodies (1:50 dilution; Santa Cruz monoclonal antibody (cat. no. sc-271428; 1:500 dilution; Santa Biotechnology, Inc., Santa Cruz, CA, USA) in a moisture Cruz Biotechnology, Inc.); and anti-MMP-3 (cat. no. 14351), chamber overnight at 4˚C. Following incubation, immunode- anti-MMP-2 (cat. no. 40994), anti-MMP-7 (cat. no. 3801), tection was performed using the Envision ABC kit (Genetech anti-MMP-9 (cat. no. 15561) and anti-GAPDH (cat. no. 2118) Co., Ltd., Shanghai, China). Subsequently, the HOXA10 monoclonal antibodies (all 1:1,000 dilution), obtained from staining score of the specimens was assigned as previously Cell Signaling Technology, Inc., (Danvers, MA, USA). Next, described (9). Initially, the staining intensity score was the membrane was incubated with goat anti-rabbit IgG (H+L) assigned as follows: 0, negative staining; 1, weak staining; horseradish peroxidase-conjugated secondary antibody for 2, moderate staining; and 3, strong staining. In addition, the 2 h at room temperature (cat. no. GAR0072; 1:5,000 dilu- percentage of stained tumor cells was scored as follows: 0, tion; Multisciences Lianke Biotech Co., Ltd., Hangzhou, negative; 1, 1-10%; 2, 10-50%; 3, 50-80%; and 4, 80-100%. China). Subsequently, the proteins were detected by enhanced The HOXA10 staining score was then calculated as the sum chemiluminescence using a chemiluminescent and fluorescent of the scores for the staining intensity and percentage of imaging system (Sagecreation, Hangzhou, China). GAPDH stained tumor cells. Finally, BC and adjacent normal tissues was used as an internal control. were categorized into the high HOXA10 expression group when the total staining score was 5-7 and the low HOXA10 Cell proliferation assays. Subsequent to cell transfection with expression group when the score was 0-4. siRNAs for 24 h, a total of 1.5x103 cells in 200 µl RPMI-1640 medium were seeded into 96-well plates and maintained for Cell lines and cell culture. T24 and 5637 cell lines were used 5 days. Between days 1 and 5, cell proliferation was exam- in the current study.
Load more

Recommended publications
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal
    NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through ␤-catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania).
    [Show full text]
  • Coordination of Hox Identity Between Germ Layers Along the Anterior-To-Posterior Axis of the Vertebrate Embryo
    Coordination of Hox identity between germ layers along the anterior-to-posterior axis of the vertebrate embryo Ferran Lloret Vilaspasa PhD Developmental Biology Department of Anatomy and Developmental Biology University College of London (UCL) London, United Kingdom 2009 1 Coordination of Hox identity between germ layers along the anterior-to- posterior axis of the vertebrate embryo ‘ I, Ferran Lloret Vilaspasa confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. ' Thesis for the obtainment of a PhD in Development Biology at the University College of London under the supervision of Prof. dr. Claudio D. Stern and Prof. dr. Antony J. Durston (Leiden University). To be defended by Ferran Lloret Vilaspasa A la meva família… Born in Barcelona, 05-08-1977 2 Abstract During early embryonic development, a relatively undifferentiated mass of cells is shaped into a complex and morphologically differentiated embryo. This is achieved by a series of coordinated cell movements that end up in the formation of the three germ layers of most metazoans and the establishment of the body plan. Hox genes are among the main determinants in this process and they have a prominent role in granting identity to different regions of the embryo. The particular arrangement of their expression domains in early development corresponds to and characterises several future structures of the older embryo and adult animal. Getting to know the molecular and cellular phenomena underlying the correct Hox pattern will help us understand how the complexity of a fully-formed organism can arise from its raw materials, a relatively undifferentiated fertilised egg cell (zygote) and a large but apparently limited repertoire of molecular agents.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Human HOXA10 Peptide (DAG-P0642) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Human HOXA10 peptide (DAG-P0642) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Antigen Description In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor that may regulate gene expression, morphogenesis, and differentiation. More specifically, it may function in fertility, embryo viability, and regulation of hematopoietic lineage commitment. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the downstream homeobox A9 (HOXA9) gene. [provided by RefSeq, Mar 2011] Nature Synthetic Expression System N/A Conjugate Unconjugated Sequence Similarities Belongs to the Abd-B homeobox family.Contains 1 homeobox DNA-binding domain. Cellular Localization Nucleus. Procedure None Format Liquid Preservative None Storage Shipped at 4°C. Upon delivery aliquot and store at -20°C or -80°C. Avoid repeated freeze / thaw cycles. Information available upon request. ANTIGEN GENE INFORMATION Gene Name HOXA10 homeobox A10 [ Homo sapiens (human) ] Official Symbol HOXA10 Synonyms HOXA10; homeobox A10; PL; HOX1; HOX1H; HOX1.8; homeobox protein Hox-A10; homeo box A10; homeobox protein 1H; homeobox protein HOXA10; homeobox protein Hox-1H; homeobox
    [Show full text]