DOCSLIB.ORG

NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through ␤-catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania). NF-Ya cDNA was directionally cloned ogs, as well as Notch-1, LEF-1, and telomerase RNA. HSCs overex- into MigR1 vector by EcoRI and XhoI sites to form plasmid pressing NF-Ya are biased toward primitive hematopoiesis in vitro MigR1-NF-Ya. For the preparation of retroviruses, the ecotropic and show strikingly increased in vivo repopulating abilities after packaging cells EcoPack2–293 (Clontech) were transiently trans- single or sequential bone marrow transplantation. Thus, NF-Ya is fected by MigR1 or MigR1-NF-Ya plasmid with Superfect (Qia- a potent cellular regulator of HSC self-renewal. gen). Between 48 and 72 h after transfection, the retroviral particle- containing supernatants were collected and filtered through SCs produce myeloid and lymphoid precursors throughout 0.45-␮m filters (Millipore) stored at Ϫ80°C before use. Hthe lifetime of the organism. To sustain hematopoiesis over months and years, hematopoietic stem cells (HSCs) have the Primitive BM Cell Isolation, Retroviral Transfection, and Primary BM unique ability to balance committed differentiation with HSC Transplantation. Primitive mouse BM cells were isolated either by Ϫ ϩ ϩϩ self-renewal. The self-renewal process, in which HSCs generate phenotype-sorting of Lin /lo Sca-1 c-Kit (LSK) BM cells or by one or two HSC daughter cells per division, is thus central for pretreating the donor mice with 5-fluorouracil (5-FU, Amersham maintaining HSC pool size throughout life. At the level of the Pharmacia and Upjohn) at a concentration of 150 mg͞kg for 4 days HSCs themselves, several genetic regulatory programs have been before BM cell harvesting. Then, 2 ϫ 106 5-FU-treated BM cells per identified to play important roles in self-renewal decisions, ml were first preincubated in 15% FBS͞DMEM (GIBCO͞BRL) including HOXB4, Notch1, Bmi-1, and the ␤-catenin pathway supplemented with 6 ng of IL-3, 10 ng of IL-6, and 100 ng of stem (1–4). Determining whether, and how, these subprograms are cell factor (SCF) per ml (R & D Systems) overnight. One milliliter coordinated at the molecular level is a central issue in under- of viral supernatant (Ϸ1 ϫ 106 viruses per ml) was added to these standing HSC biology. How these diverse intracellular biochem- cytokine-stimulated cells the next morning, along with 4 ␮g͞ml ical pathways are integrated remains largely obscure (5). Polybrene (Sigma), before the spin infection was done as described The Homeobox gene family member HOXB4 was the first by Pui (15). The infection was repeated once 24 h later. Six to 8 h transcription factor demonstrated to promote the expansion of after the second infection, the nonadherent cells were harvested HSCs both in vivo and in vitro while still retaining the HSCs’ and washed in PBS once. Then, 2 ϫ 105 live nonadherent cells were ability to differentiate into normal mature lymphoid and myeloid injected into the tail vein of one syngeneic recipient that had cells (1). Recently, we demonstrated that the trimeric transcrip- received a split 10-Gy whole-body ␥-ray irradiation. Six to 12 weeks tion factor NF-Y activates the HOXB4 promoter in cooperation after primary BMT, tissue samples were collected from the recip- with upstream͞ubiquitous stimulating factor 1 and 2 (USF1͞2) ient mice and analyzed. in normal and malignant hematopoietic cells (6, 7). Studies from other laboratories suggested that NF-Y is also a potent inducer Competitive Long-Term Lymphomyeloid Repopulation Assay. For for numerous other genes whose function likely influences stem secondary BMT, pooled BM samples from vector or NF-Ya cell (SC) function, including HOXB7, JunB, p27, CDK1, MDR1, primary recipients were sorted out into pure transduced cells by and TGF␤R-II (8–13). Such a broad role for NF-Y in early tissue GFP-activated cell sorting. Then, the vector- or NF-Ya-transduced development was also intimated by studies in Drosophila in which cells were prepared into three or four dosage levels by serial ϩ a homologue of NF-Y was shown to regulate dorsal–ventral dilutions with PBS. Next, each dosage of GFP cells was mixed with patterning (14). Thus, we reasoned that NF-Y might act as a a fixed amount of compromised (via BMT) competing B6 BM cells master gene among the network regulating HSC self-renewal and differentiation. Abbreviations: BM, bone marrow; BMT, bone marrow transplantation; ChIP, chromatin Materials and Methods immunoprecipitation; CRU, competitive repopulating units; HSC, hematopoietic stem cell; SC, stem cell; SCF, stem cell factor. a b͞ ϩ Mice. Female and male B6.SJL-Ptprc Pep3 BoyJ (SJL, CD45.1 ) ͞ ϩ *To whom correspondence should be addressed at: Division of Hematology Oncology, and C57BL͞6J (B6, CD45.2 ) mice at 8–16 weeks of age were used University of Pennsylvania School of Medicine, Maloney 510, 3600 Spruce Street, Phila- as donors͞primary recipients and secondary recipients for the bone delphia, PA 19104. E-mail: [email protected]. marrow transplantation (BMT) experiments. The mice were pur- © 2005 by The National Academy of Sciences of the USA 11728–11733 ͉ PNAS ͉ August 16, 2005 ͉ vol. 102 ͉ no. 33 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0503405102 Downloaded by guest on October 1, 2021 Fig. 1. NF-Ya overexpression induces the expression of HOX and other HSC regulatory genes in primitive hematopoietic compartment. (A) GFPϩLinϪSca-1ϩ cells were isolated by FACS from vector- or NF-Ya-trans- duced BM cells 10 weeks after primary transplanta- tion. RNA was extracted from the same amount of vector- or NF-Ya-transduced cells (1 ϫ 105), and mRNA for the indicated genes was measured by RT-PCR re- actions. (B) Four promoter regions of murine HOX4 paralogs are aligned via the conserved Y-box–E box structure. The CCAAT box-containing sequences iden- tified within the promoters of p27 and telomerase RNA gene are shown at the bottom (10, 26). The numbers in bracket indicate the distances of shown sequences from the presumed transcription start site. (C) The cobinding of NF-Y and USF1͞2 to the endoge- nous HOXB4, HOXD4, and HOXC4 promoters within leukemia cell line K562, as detected by ChIP assay. before being infused into the 10-Gy ␥-ray-irradiated B6 mice antisense 5Ј-AAATCGTCCACCTTCACCACG-3Ј; mouse (CD45.2ϩ). The secondary recipients were killed 12–16 weeks later HOXA4 primers: sense 5Ј-CCCAAGTTCCCTCCTTTCG-3Ј and for collection of hematopoietic tissues. antisense 5Ј-ATTCCTTCTCCAGTTCCAAGAC-3Ј; HOXC4 primers: sense 5Ј-GCCAGCAAGCAACCCATAGTCTAC-3Ј and CELL BIOLOGY Flow Cytometry. Freshly harvested hematopoietic tissue cells were antisense 5Ј-TCGGTGGTCCTTCTTCCATTTC-3Ј; HOXD4 suspended in 1% FCS͞PBS (GIBCO͞BRL), with or without 0.1% primers: 5Ј-GCCTACACCAGACAGCAAGTCC-3Ј and anti- NaN3 (Sigma). The nucleated cells were then stained by fluores- sense 5Ј-AAGGTCGTCAGGTCCGTATGG-3Ј; LEF-1 primers: cence-labeled antibodies (Pharmingen). The flow cytometry data sense 5Ј-GCCGACATCAAGTCATCTTTGG-3Ј and antisense were collected by using a FACScan or FACSCalibur machine 5Ј-GGGTAGAAGGTGGGGATTTCAG-3Ј; Bmi-1 primers: (Becton Dickinson) and analyzed by using FLOWJO or CELLQUEST sense 5Ј-AATGTGTGTCCTGTGTGGAGGG-3Ј and antisense software. 5Ј-TTGCTGCTGGGCATCGTAAG-3Ј; telomerase RNA prim- ers: sense 5Ј-GCTGTGGGTTCTGGTCTTTTGTTC-3Ј and 5Ј- Western Blotting. Nuclear extracts were prepared as described in ref. CGTTTGTTTTTGAGGCTCGGG-3Ј. 7. Ten micrograms of lysate was loaded onto each lane of SDS͞12% PAGE for separation and then blotted to Immobilon-P transfer In Vitro LSK Cell Culture and CFC Assay. The LSK BM cells were membranes (Millipore). The membrane was sequentially stained infected in vitro by MigR1 or MigR1-NF-Ya retroviruses by fol- with a rabbit polyclonal anti-NF-Ya IgG (Rockland, Gilbertsville, lowing the protocol of Varnum-Finney et al. (16). Then, 1 ϫ 103 PA), secondary antibodies (Santa Cruz Biotechnology), and ECL transduced cells were plated into 1 ml of 0.9% methylcellulose reagents (Amersham Pharmacia Biosciences) before the signals culture medium (StemCell Technologies, Vancouver) with 50 were developed on X-OMAT film (Kodak). ng͞ml SCF and 10 ng͞ml IL-3 and IL-6 in triplicate (17). After 7–8 days of cultivation at 37°C, the primary colonies were counted (Ͼ25 RT-PCR. Total RNAs from 1 ϫ 105 phenotypically sorted primary cells per colony). The cells retrieved from sample primary and HSCs and their progeny cells, or 1 ϫ 106 purified GFPϩ cells sorted secondary colonies were stained with Hema 3 (Fisher Scientific) for out of pooled BM samples from recipients, were isolated by using morphology examination.
Load more

Recommended publications
  • Overlap of Vitamin a and Vitamin D Target Genes with CAKUT- Related Processes [Version 1; Peer Review: 1 Approved with Reservations]
    F1000Research 2021, 10:395 Last updated: 21 JUL 2021 BRIEF REPORT Overlap of vitamin A and vitamin D target genes with CAKUT- related processes [version 1; peer review: 1 approved with reservations] Ozan Ozisik1, Friederike Ehrhart 2,3, Chris T Evelo 2, Alberto Mantovani4, Anaı̈s Baudot 1,5 1Aix Marseille University, Inserm, MMG, Marseille, 13385, France 2Department of Bioinformatics - BiGCaT, Maastricht University, Maastricht, 6200 MD, The Netherlands 3Department of Bioinformatics, NUTRIM/MHeNs, Maastricht University, Maastricht, 6200 MD, The Netherlands 4Istituto Superiore di Sanità, Rome, 00161, Italy 5Barcelona Supercomputing Center (BSC), Barcelona, 08034, Spain v1 First published: 18 May 2021, 10:395 Open Peer Review https://doi.org/10.12688/f1000research.51018.1 Latest published: 18 May 2021, 10:395 https://doi.org/10.12688/f1000research.51018.1 Reviewer Status Invited Reviewers Abstract Congenital Anomalies of the Kidney and Urinary Tract (CAKUT) are a 1 group of abnormalities affecting the kidneys and their outflow tracts, which include the ureters, the bladder, and the urethra. CAKUT version 1 patients display a large clinical variability as well as a complex 18 May 2021 report aetiology, as only 5% to 20% of the cases have a monogenic origin. It is thereby suspected that interactions of both genetic and 1. Elena Menegola, Università degli Studi di environmental factors contribute to the disease. Vitamins are among the environmental factors that are considered for CAKUT aetiology. In Milano, Milan, Italy this study, we collected vitamin A and vitamin D target genes and Any reports and responses or comments on the computed their overlap with CAKUT-related gene sets.
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Spatiotemporal DNA Methylome Dynamics of the Developing Mouse Fetus
    Article Spatiotemporal DNA methylome dynamics of the developing mouse fetus https://doi.org/10.1038/s41586-020-2119-x Yupeng He1,2, Manoj Hariharan1, David U. Gorkin3, Diane E. Dickel4, Chongyuan Luo1, Rosa G. Castanon1, Joseph R. Nery1, Ah Young Lee3, Yuan Zhao2,3, Hui Huang3,5, Received: 9 August 2017 Brian A. Williams6, Diane Trout6, Henry Amrhein6, Rongxin Fang2,3, Huaming Chen1, Bin Li3, Accepted: 11 June 2019 Axel Visel4,7,8, Len A. Pennacchio4,7,9, Bing Ren3,10 & Joseph R. Ecker1,11 ✉ Published online: 29 July 2020 Open access Cytosine DNA methylation is essential for mammalian development but Check for updates understanding of its spatiotemporal distribution in the developing embryo remains limited1,2. Here, as part of the mouse Encyclopedia of DNA Elements (ENCODE) project, we profled 168 methylomes from 12 mouse tissues or organs at 9 developmental stages from embryogenesis to adulthood. We identifed 1,808,810 genomic regions that showed variations in CG methylation by comparing the methylomes of diferent tissues or organs from diferent developmental stages. These DNA elements predominantly lose CG methylation during fetal development, whereas the trend is reversed after birth. During late stages of fetal development, non- CG methylation accumulated within the bodies of key developmental transcription factor genes, coinciding with their transcriptional repression. Integration of genome- wide DNA methylation, histone modifcation and chromatin accessibility data enabled us to predict 461,141 putative developmental tissue-specifc enhancers, the human orthologues of which were enriched for disease-associated genetic variants. These spatiotemporal epigenome maps provide a resource for studies of gene regulation during tissue or organ progression, and a starting point for investigating regulatory elements that are involved in human developmental disorders.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3
    ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Coordination of Hox Identity Between Germ Layers Along the Anterior-To-Posterior Axis of the Vertebrate Embryo
    Coordination of Hox identity between germ layers along the anterior-to-posterior axis of the vertebrate embryo Ferran Lloret Vilaspasa PhD Developmental Biology Department of Anatomy and Developmental Biology University College of London (UCL) London, United Kingdom 2009 1 Coordination of Hox identity between germ layers along the anterior-to- posterior axis of the vertebrate embryo ‘ I, Ferran Lloret Vilaspasa confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. ' Thesis for the obtainment of a PhD in Development Biology at the University College of London under the supervision of Prof. dr. Claudio D. Stern and Prof. dr. Antony J. Durston (Leiden University). To be defended by Ferran Lloret Vilaspasa A la meva família… Born in Barcelona, 05-08-1977 2 Abstract During early embryonic development, a relatively undifferentiated mass of cells is shaped into a complex and morphologically differentiated embryo. This is achieved by a series of coordinated cell movements that end up in the formation of the three germ layers of most metazoans and the establishment of the body plan. Hox genes are among the main determinants in this process and they have a prominent role in granting identity to different regions of the embryo. The particular arrangement of their expression domains in early development corresponds to and characterises several future structures of the older embryo and adult animal. Getting to know the molecular and cellular phenomena underlying the correct Hox pattern will help us understand how the complexity of a fully-formed organism can arise from its raw materials, a relatively undifferentiated fertilised egg cell (zygote) and a large but apparently limited repertoire of molecular agents.
    [Show full text]
  • 1 HOXB7 Is an Erα Cofactor in the Activation Of
    HOXB7 is an ERα cofactor in the activation of HER2 and multiple ER target genes leading to endocrine resistance Kideok Jin, Sunju Park, Wei Wen Teo, Preethi Korangath, Sean Soonweng Cho, Takahiro Yoshida, Balázs Győrffy, Chirayu Pankaj Goswami, Harikrishna Nakshatri, Leigh-Ann Cruz, Weiqiang Zhou, Hongkai Ji, Ying Su, Muhammad Ekram, Zhengsheng Wu, Tao Zhu, Kornelia Polyak, and Saraswati Sukumar Supplemental Methods Plasmids Full-length promoter region including ER and one of two different HOXB7 binding sites of CA12 was cloned into the pGL3 promoter luciferase construct. Full length miR196a cDNA was cloned into the pcDNA3.1 vector. Full-length promoter region including MYC binding region of miR-196a gene was cloned into pGL3 promoter luciferase plasmid. 3’UTR region of HOXB7 was cloned into pGL2 promoter luciferase plasmid. The full-length human HER2 plasmid was a generous gift from Daniel Leahy (Johns Hopkins University, Baltimore, MD) and the HER2 cDNA was cloned to pLPCX vector. EGFR WT, pRetrosuper Myc shRNA, Lenti-sh1368 knockdown c-myc were purchased at Addgene (1-3). siRNAs against HOXB7 were purchased at Invitrogen and shRNAs against HOXB7 was purchased at Thermo scientific. Immunohistochemistry Immunohistochemical analysis of HOXB7 and HER2 protein expression was performed using monoclonal antibodies against HOXB7 (Santa Cruz Biotechnology) and HER2 (Cell signaling). After blocking with 5% goat serum in PBST for 1 hour at room temperature, the sections were treated with the HOXB7 or HER2 antibodies overnight at 4°C, then the peroxidase conjugated streptavidin 1 complex method was performed, followed by the 3, 3' diaminobenzidine (DAB) procedure according to manufacturer’s protocols (VECTASTAIN Elite ABC Kit, Vector Lab).
    [Show full text]
  • Beta Protein 1 Homeoprotein Induces Cell Growth and Estrogen-Independent Tumorigenesis by Binding to the Estrogen Receptor in Breast Cancer
    Himmelfarb Health Sciences Library, The George Washington University Health Sciences Research Commons Medicine Faculty Publications Medicine 7-16-2016 Beta protein 1 homeoprotein induces cell growth and estrogen-independent tumorigenesis by binding to the estrogen receptor in breast cancer. Sidney W Fu George Washington University Saurabh P Kirolikar Erika Ginsburg Xiaohui Tan Arnold Schwartz See next page for additional authors Follow this and additional works at: http://hsrc.himmelfarb.gwu.edu/smhs_medicine_facpubs Part of the Medicine and Health Sciences Commons APA Citation Fu, S., Kirolikar, S., Ginsburg, E., Tan, X., Schwartz, A., Simmens, S., Man, Y., & Pinzone, J. (2016). Beta protein 1 homeoprotein induces cell growth and estrogen-independent tumorigenesis by binding to the estrogen receptor in breast cancer.. Oncotarget, (). http://dx.doi.org/10.18632/oncotarget.10633 This Journal Article is brought to you for free and open access by the Medicine at Health Sciences Research Commons. It has been accepted for inclusion in Medicine Faculty Publications by an authorized administrator of Health Sciences Research Commons. For more information, please contact [email protected]. Authors Sidney W Fu, Saurabh P Kirolikar, Erika Ginsburg, Xiaohui Tan, Arnold Schwartz, Samuel J Simmens, Yan- Gao Man, and Joseph J Pinzone This journal article is available at Health Sciences Research Commons: http://hsrc.himmelfarb.gwu.edu/smhs_medicine_facpubs/ 793 www.impactjournals.com/oncotarget/ Oncotarget, Advance Publications 2016 Beta protein 1 homeoprotein induces cell growth and estrogen- independent tumorigenesis by binding to the estrogen receptor in breast cancer Sidney W. Fu1,*, Saurabh P. Kirolikar2,*, Erika Ginsburg3, Xiaohui Tan1, Arnold Schwartz4, Samuel J. Simmens5, Yan-gao Man6, Joseph J.
    [Show full text]
  • HOXB7 Is an Erα Cofactor in the Activation of HER2 and Multiple ER Target Genes Leading
    Author Manuscript Published OnlineFirst on July 15, 2015; DOI: 10.1158/2159-8290.CD-15-0090 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. HOXB7 is an ERα cofactor in the activation of HER2 and multiple ER target genes leading to endocrine resistance Kideok Jin1, Sunju Park1, Wei Wen Teo1, Preethi Korangath1, Sean Soonweng Cho1, Takahiro Yoshida1*, Balázs Győrffy2, Chirayu Pankaj Goswami3#, Harikrishna Nakshatri3, Leigh-Ann Cruz1, Weiqiang Zhou4, Hongkai Ji4, Ying Su5, Muhammad Ekram5, Zhengsheng Wu6, Tao Zhu6, Kornelia Polyak5, and Saraswati Sukumar1≠ 1Breast Cancer Program, Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD, 22nd Department of Pediatrics, MTA TTK Lendület Cancer Biomarker Research Group, Semmelweis University, Budapest, Hungary, 3Center for Computational Biology and Bioinformatics, Indiana University, IN, 4Department of Biostatistics, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD and 5Dana- Farber Cancer Institute, Boston, MA. 6Hefei National Laboratory for Physical Sciences at Microscale and School of Life Sciences, University of Science and Technology of China, Hefei, Anhui, People's Republic of China. Current address: *Department of Surgery, Tokushima University, 3-18-15 Kuramoto-cho, Tokushima 770-8503, Japan #Thomas Jefferson University Hospital, Philadelphia, PA 19107, USA ≠ To whom correspondence may be addressed: Saraswati Sukumar, PhD Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins, 1650 Orleans Street, CRB 1, Room 143, Baltimore, MD 21231-1000. Phone: 410-614-2479 1 Downloaded from cancerdiscovery.aacrjournals.org on September 28, 2021. © 2015 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 15, 2015; DOI: 10.1158/2159-8290.CD-15-0090 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]