DOCSLIB.ORG

Downregulation of Prdm16 Is Critical for HOXB4-Mediated Benign HSC Expansion in Vivo Hui Yu University of Tennessee Health Science Center

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downregulation of Prdm16 Is Critical for HOXB4-Mediated Benign HSC Expansion in Vivo Hui Yu University of Tennessee Health Science Center University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 12-2014 Downregulation of Prdm16 Is Critical for HOXB4-mediated Benign HSC Expansion In Vivo Hui Yu University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Medical Genetics Commons, and the Medical Molecular Biology Commons Recommended Citation Yu, Hui , "Downregulation of Prdm16 Is Critical for HOXB4-mediated Benign HSC Expansion In Vivo" (2014). Theses and Dissertations (ETD). Paper 307. http://dx.doi.org/10.21007/etd.cghs.2014.0367. This Dissertation is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. Downregulation of Prdm16 Is Critical for HOXB4-mediated Benign HSC Expansion In Vivo Document Type Dissertation Degree Name Doctor of Philosophy (PhD) Program Biochemistry Track Therapeutics and Cell Signaling Research Advisor Brian P. Sorrentino, MD Committee Suzanne J. Baker, PhD Wing H. Leung, MD, PhD Janet F. Partridge, PhD Lawrence M. Pfeffer, PhD DOI 10.21007/etd.cghs.2014.0367 This dissertation is available at UTHSC Digital Commons: https://dc.uthsc.edu/dissertations/307 DOWNREGULATION OF PRDM16 IS CRITICAL FOR HOXB4-MEDIATED BENIGN HSC EXPANSION IN VIVO A Dissertation Presented for The Graduate Studies Council The University of Tennessee Health Science Center In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy From The University of Tennessee By Hui Yu December 2014 Copyright © 2014 by Hui Yu All rights reserved ii DEDICATION This dissertation is dedicated to my parents, Guoquan Yu and Yan Xu, my husband, Satish Kumar Nandakumar and my precious daughter Emma Satish for all their love and support. My lovely parents raised me and trained me to be a happy, independent and brave girl to start my own life. I can never forget the sacrifices they have made for me, especially during their most difficult times. They loved me, trained me and supported me throughout my life and encouraged me to embrace life with an optimistic attitude, no matter life is easy or tough and no matter I succeed or lose. Satish and Emma are two important people in my life. They joined my journey half way and will accompany me till the end of this adventure. We have shared all the joys and tears together. We have witnessed and will witness all the minor or major events in our life and will support each other forever. I love you both. iii ACKNOWLEDGEMENTS I would like to thank my mentor, Dr. Brian Sorrentino for giving me the opportunity to work with him. His guidance and support has been invaluable. Graduate training under his mentorship was a great experience and has prepared me for my future endeavors. I also want to thank my lab members for sharing with me their experience and advise in and out the lab. I specially would like to thank Jie Jiang, former graduate student in our lab. She helped me start my project and trained me to be independent student before she left the lab. Even now we still exchange ideas about life and work. I would also like to thank my committee members, Dr. Suzanne Baker, Dr. Janet Partridge, Dr. Wing Leung and Dr. Lawrence Pfeffer for their guidance during graduate training. Their suggestions and corrections helped shape my project which finally gets published. I would like to acknowledge the Flow Cytometry and Cell Sorting core facility and Animal Resource Center in St. Jude Children’s Research Hospital. Without their professional assistance with cell sorting and animal care this project can’t be done. iv ABSTRACT Overexpression of HOXB4 in hematopoietic stem cells (HSCs) leads to increased self-renewal without causing hematopoietic malignancies in transplanted mice. The molecular basis of HOXB4-mediated benign HSC expansion in vivo is not well understood. To gain further insight into the molecular events underlying HOXB4- mediated HSC expansion, we analyzed gene expression changes at multiple time points in Lin-Sca1+c-kit+ (LSK) cells from mice transplanted with bone marrow (BM) cells transduced with a MSCV-HOXB4-ires-YFP vector. A distinct HOXB4 transcriptional program was reproducibly induced and stabilized by 12 weeks after transplant. Dynamic expression changes were observed in genes critical for HSC self-renewal as well as genes involved in myeloid and B cell differentiation. Prdm16, a transcription factor associated with human acute myeloid leukemia (AML), was markedly repressed by HOXB4 but upregulated by HOXA9 and HOXA10, suggesting that Prdm16 downregulation was involved in preventing leukemia in HOXB4 transplanted mice. Functional evidence to support this mechanism was obtained by enforcing co-expression of sPrdm16 and HOXB4, which led to myeloid expansion, and leukemia. Before the onset of leukemia decreased HSC frequency was observed in HOXB4and sPrdm16 co-expressing cells, suggesting sustained expression of Prdm16 abolished HOXB4-mediated HSC expansion. Altogether, these studies define the transcriptional pathways involved in HOXB4 HSC expansion in vivo and identify repression of Prdm16 transcription as a mechanism by which HOXB4 mediates a benign HSC expansion. v TABLE OF CONTENTS CHAPTER 1. INTRODUCTION .....................................................................................1 Hematopoiesis ..................................................................................................................1 Adult hematopoietic hierarchy .....................................................................................1 Embryonic hematopoiesis ............................................................................................1 Hematopoietic Stem Cell .................................................................................................3 Functional characteristics of HSCs ..............................................................................3 Self-renewal ............................................................................................................ 3 Multilineage differentiation potential ..................................................................... 5 Hematopoietic stem cell characterization ....................................................................5 Cell surface antigens/receptors ............................................................................... 5 Dye exclusion.......................................................................................................... 6 Functional assay ...................................................................................................... 6 Long-term repopulating assay ............................................................................ 6 Competitive repopulation assay .......................................................................... 8 Limiting-dilution assay ....................................................................................... 8 Serial transplantation assay ................................................................................. 8 Regulation of Hematopoietic Stem Cell Pool ..................................................................8 Transcription factors ....................................................................................................9 Epigenetic regulation ...................................................................................................9 Signaling pathways ....................................................................................................10 Wnt signaling pathway ......................................................................................... 10 Notch signaling pathway....................................................................................... 11 Phosphatidylinositol 3 kinase pathway ................................................................. 11 TGF/BMP signaling pathway ............................................................................... 11 MicroRNAs ................................................................................................................12 HOX Gene Family .........................................................................................................13 HOX gene upstream regulators ..................................................................................13 Hox cofactors .............................................................................................................15 Role of Hox genes in normal hematopoiesis .............................................................15 Role of Hox genes in acute leukemia ........................................................................16 HOXB4 ..........................................................................................................................20 HOXB4 role in embryonic stem cell derived hematopoiesis .....................................20 HOXB4 overexpression enhances adult HSC self-renewal .......................................20 HOXB4 role in leukemogenesis ................................................................................21 Prdm Gene Family .........................................................................................................21 PRDM16 protein domain ...........................................................................................25
Load more

Recommended publications
  • Role of Estrogen Receptor Beta and the Isoflavone Genistein
    WCP2018 OR28-3 Oral session White-to-brown adipose differentiation: role of estrogen receptor beta and the isoflavone genistein Alessandra Bitto, Federica Mannino, Natasha Irrera, Giovanni Pallio, Domenica Altavilla, Francesco Squadrito Clinical and experimental medicine, University of Messina, Italy The two types of fat cells in mammals brown and white have different functions. White adipose tissue (WAT) stores excess energy in the form of triglyceride and releases free fatty acids during caloric deficiency. Brown adipose tissue (BAT) on the other hand can dissipate energy through thermogenesis. Genistein can have an effect on energy expenditure UCP (uncoupling protein) expression and protect against the obesogenic effect of a high calorie diet. The effect of genistein in inducing white-to-brown transdifferentiation was investigated in 3T3-L1 cells differentiated into white adipocytes with a specific medium (DMEM 10% calf serum 1% penicillin/streptomycin 500 uM 3isobutyl1 methylxanthine 10ug/ml insulin 250 nM dexmethasone 8 ug/ml biotin and 4 ug/ml pantothenic acid). Fully differentiated white adipocytes were treated after 10 days with different genistein doses (10-50-100-200 uM) for 24-48h or left untreated. Two specific ER-beta and PPAR-gamma receptor inhibitors were also used to understand if genistein effects are mediated by the estrogen or the PPAR receptor. Also a CRISPR/Cas9 approach was used to delete either ER-beta or PPAR-gamma to clarify which receptor is involved in genistein action. Intracellular lipid accumulation was determined by oil-red-O staining after 24 and 48hours of treatment. The expression of UCP1 estrogen receptor alpha and beta PPARalpha and gamma DIO2 (Type II iodothyronine deiodinase) PRDM16 (PR domain containing 16) and CIDEA (cell death inducing DNA fragmentation factor) were evaluated by qPCR after 24 and 48hours of genistein treatment.
    [Show full text]
  • Letters to the Editor
    LETTERS TO THE EDITOR The closely related rare and severe acute myeloid leukemias carrying EVI1 or PRDM16 rearrangements share singular biological features In a recent issue of Haematologica , Matsuo et al .1 pinpoint the pejorative effect of EVI1 overexpression in 18 acute myeloid leukemias (AML) with MLL rearrangements. However, EVI1 overexpression has also been reported in patients with translocations involving chromosome 3 and the EVI1 gene. 2,3 Because of the poor prognosis associated to these anomalies, it is important to investigate them at an early stage in order to adapt patient management. Indeed, previous reports 4-6 and the 2008 WHO classification 7 indi - cate that EVI1-rearranged (EVI1-r) AML display typical fea - tures, such as absence of thrombopenia, atypical megakary - Figure 1. Algorithm for the suspicion of EVI1 and PRDM16 AMLs. ocytes and multilineage dysplasia 2-4 which can be detected by current diagnostic reference methods. In this line, we compared a cohort of 17 EVI1-r AML, aged between 8 and 79-years old (median 54 years) to 1822 other cases of AML months. diagnosed in the same laboratory over 14 years. At diagno - This study consolidates the unusual base-line character - sis, there were similar hemoglobin levels or white blood istics and clinical features of EVI1-r AML cases. Moreover, cell counts in both groups. Median platelet counts were it indicates a very low rate of MPO expression in EVI1-r 9 9 123x10 /L, higher than 100x10 /L in 53% of EVI1-r AML AML patients. It is interesting to note that relationships patients, compared to 25% in the control AML population have been reported between EVI1 expression and MPO (P=0.02).
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3
    ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal
    NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through ␤-catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania).
    [Show full text]
  • Coordination of Hox Identity Between Germ Layers Along the Anterior-To-Posterior Axis of the Vertebrate Embryo
    Coordination of Hox identity between germ layers along the anterior-to-posterior axis of the vertebrate embryo Ferran Lloret Vilaspasa PhD Developmental Biology Department of Anatomy and Developmental Biology University College of London (UCL) London, United Kingdom 2009 1 Coordination of Hox identity between germ layers along the anterior-to- posterior axis of the vertebrate embryo ‘ I, Ferran Lloret Vilaspasa confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. ' Thesis for the obtainment of a PhD in Development Biology at the University College of London under the supervision of Prof. dr. Claudio D. Stern and Prof. dr. Antony J. Durston (Leiden University). To be defended by Ferran Lloret Vilaspasa A la meva família… Born in Barcelona, 05-08-1977 2 Abstract During early embryonic development, a relatively undifferentiated mass of cells is shaped into a complex and morphologically differentiated embryo. This is achieved by a series of coordinated cell movements that end up in the formation of the three germ layers of most metazoans and the establishment of the body plan. Hox genes are among the main determinants in this process and they have a prominent role in granting identity to different regions of the embryo. The particular arrangement of their expression domains in early development corresponds to and characterises several future structures of the older embryo and adult animal. Getting to know the molecular and cellular phenomena underlying the correct Hox pattern will help us understand how the complexity of a fully-formed organism can arise from its raw materials, a relatively undifferentiated fertilised egg cell (zygote) and a large but apparently limited repertoire of molecular agents.
    [Show full text]
  • ETV6 Mutations in Early Immature Human T Cell Leukemias
    Published December 12, 2011 Brief Definitive Report ETV6 mutations in early immature human T cell leukemias Pieter Van Vlierberghe,1 Alberto Ambesi-Impiombato,1 Arianne Perez-Garcia,1 J. Erika Haydu,1 Isaura Rigo,1 Michael Hadler,1 Valeria Tosello,1 Giusy Della Gatta,1 Elisabeth Paietta,4 Janis Racevskis,4 Peter H. Wiernik,4 Selina M. Luger,5 Jacob M. Rowe,6 Montserrat Rue,7 and Adolfo A. Ferrando1,2,3 1Institute for Cancer Genetics, 2Department of Pediatrics, and 3Department of Pathology, Columbia University Medical Center, New York, NY 10032 4Montefiore Medical Center North, Bronx, New York, NY 10467 5Hematologic Malignancies and Stem Cell Transplant Program, Hematology-Oncology Division, University of Pennsylvania Medical Center, Philadelphia, PA 19104 6 Rambam Medical Center, Haifa 31096, Israel Downloaded from 7Department of Basic Medical Sciences, University of Lleida, Lleida 25003, Spain Early immature T cell acute lymphoblastic leukemias (T-ALLs) account for 5–10% of pediatric T-ALLs and are associated with poor prognosis. However, the genetic defects that drive the biology of these tumors remain largely unknown. In this study, analysis of micro- array gene expression signatures in adult T-ALL demonstrated a high prevalence of early immature leukemias and revealed a close relationship between these tumors and myeloid jem.rupress.org leukemias. Many adult immature T-ALLs harbored mutations in myeloid-specific oncogenes and tumor suppressors including IDH1, IDH2, DNMT3A, FLT3, and NRAS. Moreover, we identifiedETV6 mutations as a novel genetic lesion uniquely present in immature adult T-ALL. Our results demonstrate that early immature adult T-ALL represents a heterogeneous category of leukemias characterized by the presence of overlapping myeloid and T-ALL on May 30, 2015 characteristics, and highlight the potential role of ETV6 mutations in these tumors.
    [Show full text]
  • The Suppressive Effects of 1,25-Dihydroxyvitamin D3 and Vitamin D Receptor on Brown Adipocyte Differentiation and Mitochondrial Respiration
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Masters Theses Graduate School 8-2014 The Suppressive Effects of 1,25-dihydroxyvitamin D3 and Vitamin D Receptor on Brown Adipocyte Differentiation and Mitochondrial Respiration Carolyn Jeanne Ricciardi University of Tennessee - Knoxville, [email protected] Follow this and additional works at: https://trace.tennessee.edu/utk_gradthes Part of the Molecular, Genetic, and Biochemical Nutrition Commons Recommended Citation Ricciardi, Carolyn Jeanne, "The Suppressive Effects of 1,25-dihydroxyvitamin D3 and Vitamin D Receptor on Brown Adipocyte Differentiation and Mitochondrial Respiration. " Master's Thesis, University of Tennessee, 2014. https://trace.tennessee.edu/utk_gradthes/2876 This Thesis is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Masters Theses by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a thesis written by Carolyn Jeanne Ricciardi entitled "The Suppressive Effects of 1,25-dihydroxyvitamin D3 and Vitamin D Receptor on Brown Adipocyte Differentiation and Mitochondrial Respiration." I have examined the final electronic copy of this thesis for form and content and recommend that it be accepted in partial fulfillment of the equirr ements for the degree of Master of Science, with a major in Nutrition.
    [Show full text]