Aberrant HOXC Expression Accompanies the Malignant Phenotype in Human Prostate1
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
HOXC4 Rabbit Pab
Leader in Biomolecular Solutions for Life Science HOXC4 Rabbit pAb Catalog No.: A13856 Basic Information Background Catalog No. This gene belongs to the homeobox family of genes. The homeobox genes encode a A13856 highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox Observed MW gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different 30kDa chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC4, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three Calculated MW genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include 29kDa the shared exon spliced to the gene-specific exons, or they may include only the gene- specific exons. Two alternatively spliced variants that encode the same protein have Category been described for HOXC4. Transcript variant one includes the shared exon, and transcript variant two includes only gene-specific exons. Primary antibody Applications WB Cross-Reactivity Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 3221 P09017 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 30-130 of human HOXC4 (NP_055435.2). Synonyms HOXC4;HOX3;HOX3E;cp19 Contact Product Information www.abclonal.com Source Isotype Purification Rabbit IgG Affinity purification Storage Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.02% sodium azide,50% glycerol,pH7.3. Validation Data Western blot analysis of extracts of various cell lines, using HOXC4 antibody (A13856) at 1:3000 dilution. -
Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells. -
Effect of Testosterone and Hypoxia on the Expansion of Umbilical Cord Blood CD34+ Cells in Vitro
EXPERIMENTAL AND THERAPEUTIC MEDICINE 14: 4467-4475, 2017 Effect of testosterone and hypoxia on the expansion of umbilical cord blood CD34+ cells in vitro LIPING ZHOU1,2, XIAOWEI ZHANG2, PANPAN ZHOU1, XUE LI1, XUEJING XU1, QING SHI1, DONG LI1 and XIULI JU1 1Department of Pediatrics, Qilu Hospital, Shandong University, Jinan, Shandong 250012; 2Department of Pediatrics, The Sixth People's Hospital of Jinan, Jinan, Shandong 250200, P.R. China Received October 12, 2016; Accepted June 15, 2017 DOI: 10.3892/etm.2017.5026 Abstract. Successfully expanding hematopoietic stem cells Therefore, the results of the current study indicate that a combina- (HSCs) is advantageous for clinical HSC transplantation. The tion of hypoxia and testosterone may be a promising cultivation present study investigated the influence of testosterone on the condition for HSC/hemopoietic progenitor cell expansion ex vivo. proliferation, antigen phenotype and expression of hemato- poiesis-related genes in umbilical cord blood-derived cluster Introduction of differentiation (CD)34+ cells under normoxic or hypoxia conditions. Cord blood (CB) CD34+ cells were separated using Hematopoietic stem cell (HSC) transplantation is a poten- magnetic activated cell sorting. A cytokine cocktail and feeder tially life-saving procedure used to treat a broad spectrum cells were used to stimulate the expansion of CD34+ cells under of disorders, including hematological, immune and genetic normoxic (20% O2) and hypoxic (1% O2) conditions for 7 days diseases (1). It has been demonstrated that bone marrow and testosterone was added accordingly. Cells were identified reconstituting HSCs reside within a small subpopulation using flow cytometry and reconstruction capacity was deter- of bone marrow or blood-derived mononuclear cells that mined using a colony-forming unit (CFU) assay. -
Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes. -
Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis
Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma, Anna-Karin Ekman, Cecilia Bivik Eding and Charlotta Enerbäck The self-archived postprint version of this journal article is available at Linköping University Institutional Repository (DiVA): http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-147791 N.B.: When citing this work, cite the original publication. Verma, D., Ekman, A., Bivik Eding, C., Enerbäck, C., (2018), Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis, Journal of Investigative Dermatology, 138(5), 1088-1093. https://doi.org/10.1016/j.jid.2017.11.036 Original publication available at: https://doi.org/10.1016/j.jid.2017.11.036 Copyright: Elsevier http://www.elsevier.com/ Genome-Wide DNA Methylation Profiling Identifies Differential Methylation in Uninvolved Psoriatic Epidermis Deepti Verma*a, Anna-Karin Ekman*a, Cecilia Bivik Edinga and Charlotta Enerbäcka *Authors contributed equally aIngrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Division of Dermatology, Linköping University, Linköping, Sweden Corresponding author: Charlotta Enerbäck Ingrid Asp Psoriasis Research Center, Department of Clinical and Experimental Medicine, Linköping University SE-581 85 Linköping, Sweden Phone: +46 10 103 7429 E-mail: [email protected] Short title Differential methylation in psoriasis Abbreviations CGI, CpG island; DMS, differentially methylated site; RRBS, reduced representation bisulphite sequencing Keywords (max 6) psoriasis, epidermis, methylation, Wnt, susceptibility, expression 1 ABSTRACT Psoriasis is a chronic inflammatory skin disease with both local and systemic components. Genome-wide approaches have identified more than 60 psoriasis-susceptibility loci, but genes are estimated to explain only one third of the heritability in psoriasis, suggesting additional, yet unidentified, sources of heritability. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Accompanies CD8 T Cell Effector Function Global DNA Methylation
Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M. -
Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3
ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Identification of Potential Key Genes and Pathway Linked with Sporadic Creutzfeldt-Jakob Disease Based on Integrated Bioinformatics Analyses
medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Identification of potential key genes and pathway linked with sporadic Creutzfeldt-Jakob disease based on integrated bioinformatics analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. medRxiv preprint doi: https://doi.org/10.1101/2020.12.21.20248688; this version posted December 24, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Abstract Sporadic Creutzfeldt-Jakob disease (sCJD) is neurodegenerative disease also called prion disease linked with poor prognosis. The aim of the current study was to illuminate the underlying molecular mechanisms of sCJD. The mRNA microarray dataset GSE124571 was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) were screened. -
Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,