Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial

Transcription factor gene expression profiling and analysis of SOX gene family transcription factors

in human limbal epithelial progenitor cells

Der Naturwissenschaftlichen Fakultät

der Friedrich-Alexander-Universität Erlangen-Nürnberg

zur

Erlangung des Doktorgrades Dr. rer. nat.

vorgelegt von

Dr. med. Johannes Menzel-Severing

aus Bonn

Als Dissertation genehmigt

von der Naturwissenschaftlichen Fakultät

der Friedrich-Alexander-Universität Erlangen-Nürnberg

Tag der mündlichen Prüfung: 7. Februar 2018

Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer

Gutachter: Prof. Dr. Andreas Feigenspan

Prof. Dr. Ursula Schlötzer-Schrehardt

INDEX

1. ABSTRACTS Page

1.1. Abstract in English 4

1.2. Zusammenfassung auf Deutsch 7

2. INTRODUCTION

2.1. Anatomy and histology of the cornea and the corneal surface 11

2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13

2.3. The limbal stem cell niche 15

2.4. Cell therapeutic strategies in ocular surface disease 17

2.5. Alternative cell sources for transplantation to the corneal surface 18

2.6. Transcription factors in cell differentiation and reprogramming 21

2.7. Transcription factors in limbal epithelial cells 22

2.8. Research question 25

3. MATERIALS AND METHODS

3.1. Human donor corneas 27

3.2. Laser Capture Microdissection (LCM) 28

3.3. RNA amplification and RT2 profiler PCR arrays 29

3.4. Real-time PCR analysis 33

3.5. Immunohistochemistry 34

3.6. Limbal epithelial cell culture 38

3.7. Transcription-factor knockdown/overexpression in vitro 39

3.8. Proliferation assay 40

3.9. Western blot 40

3.10. Statistical analysis 41

4. RESULTS

4.1. Quality control of LCM-isolated and amplified RNA 42

4.2. Transcription factor gene expression profiling in basal limbal and corneal 46

epithelium

4.3. SOX family gene expression profiling in basal limbal and corneal epithelium 48

4.4. Localisation of SoxE proteins in situ 51

4.5. SOX9-expression during corneal epithelial wound healing 55

4.6. SOX9-expression during differentiation of limbal epithelial cells in culture 56

4.7. Overexpression of SOX9 in cultured limbal epithelial cells 58

4.8. Knockdown of SOX9 in cultured limbal epithelial cells 63

5. DISCUSSION

5.1. LCM for differential gene expression analysis of corneal surface epithelia 71

5.2. Transcription factor expression in limbal and corneal basal epithelium 74

5.3. SOX family transcription factors in limbal epithelial cells 77

5.4. SOX9 functional analysis in limbal epithelial cells 80

5.5. Summary 85

5.6. Outlook 86

6. ACKNOWLEDGEMENTS 90

7. REFERENCES 91

8. ABBREVIATIONS 104

1. ABSTRACTS

1.1 Abstract in English

To function as our “window to the world”, the cornea requires an intact epithelial surface. Epithelial stem/progenitor cells at the corneoscleral limbus are a reservoir for corneal epithelial homeostasis and repair. When these cells are lost, delayed wound healing, vascularisation and scarring may lead to painful loss of vision. Current treatment options include expansion of limbal epithelial progenitor cells (LEPCs) from a healthy donor eye through ex vivo culture and transplantation of these cells to the diseased ocular surface. However, the availability of autologous LEPCs for transplantation is limited in cases of systemic and/or bilateral disease. This has raised interest in the use of induced pluripotent cells or direct transdifferentiation of non-ocular cells towards a corneal epithelial phenotype. Transcription factors (TFs) are key players both in establishing pluripotency and in direct reprogramming. Understanding TF regulation of LEPCs and corneal epithelial homeostasis may aid in successfully using non-ocular cell sources to regenerate the corneal surface. Hence, this study aimed to identify differentially expressed TF genes in human limbal and corneal epithelial cells and to characterise their role for proliferation and differentiation of limbal epithelial cells.

LEPC clusters and central corneal epithelial cells were excised from cryosections of snap-frozen human post-mortem donor eyes using laser capture microdissection (LCM). RNA extracted from these specimens underwent linear amplification. Limbal and central corneal samples were screened for levels of expression of a panel of stem cell TF genes using real-time polymerase chain reaction

(PCR) arrays. Four genes showed preferential limbal expression (at least two-fold elevated in limbal specimens compared to central cornea): DACH1, HOXA11, SOX9, and PPARG. Eleven genes were preferentially expressed in central corneal epithelial cells: FOXP2, RB1, MSX2, JUN, PCNA, SP1, SIX2,

PAX6, FOXP3, SMAD2, and FOXP1. Validation experiments using real-time PCR hydrolysis probe assays confirmed statistically significant preferential limbal expression of SOX9 (with the highest fold change value of 428), DACH1 (272.5), HOXA11 (104.7) and PPARG (29.3).

Because SOX genes (Sry-related high mobility group box) encode TFs known to regulate cell fate and differentiation, a complete screen of SOX transcription factor gene expression was performed on LCM samples using real-time PCR. Preferential limbal expression was found for a number of SOX family genes, including all members of the SoxE, SoxF and SoxH groups.

Intracellular localization of their respective gene products was assessed using in-situ immunofluorescence. Here, SoxE proteins showed distinctive staining patterns, with predominantly cytoplasmic staining in basal limbal epithelial cells suggesting inhibition of its transcriptional program, and predominantly nuclear localisation in suprabasal and central corneal epithelial cells suggesting DNA binding and transcriptional activity. SOX9 was selected for further analyses given its strong expression and taking into consideration previous reports from other progenitor cell types.

Using double-labeling, partial co-localisation was observed between SOX9 and putative limbal progenitor cell markers (Bmi1, OCT4, p63α, N-cadherin and Keratin 15).

SOX9 protein expression was also assessed in human corneas that had been subjected to a central epithelial wound in vitro. Increased expression and nuclear translocation of SOX9 was found in activated LEPCs and re-grown corneal epithelial cells compared to unwounded control eyes.

Next, mRNA expression of SOX9 was analyzed in primary cultures of limbal epithelial cells at different passages. Expression levels increased from P0 to P1 and P2. Immunofluorescent labeling of SOX9 in LEPC clones showed a nuclear staining pattern, with immunopositive cells being located predominantly towards the proliferating periphery of the clones.

Knockdown of SOX9-expression in cultured LEPCs was achieved using RNAi, and at 24 hours after transfection, effects on target gene regulation were monitored by real-time PCR. Expression of the progenitor cell marker gene KRT15 (Cytokeratin 15) was significantly reduced in cells after knockdown of SOX9. No significant changes were seen in expression of other progenitor cell marker genes such as CEBPD, ABCG2, p63α or CDH2. We did observe a trend towards upregulation of differentiation markers KRT3 and IVL but found no effect on expression of KRT12, PAX6 or MUC1.

Also, we observed a trend towards upregulation of cyclin-dependent kinase inhibitors p21 and p57 and a trend towards downregulation of proliferation marker PCNA (Proliferating cell nuclear antigen). Using Western blot, reduced levels of Cytokeratin 15 and PCNA were detected in cultured cells following siRNA-mediated knockdown of SOX9. In line with downregulation of PCNA, proliferation rates (analyzed by BrdU incorporation) significantly decreased following knockdown of

SOX9, in comparison to cells transfected with scramble siRNA.

In a nutshell, this study identified a number of TFs not previously known to be preferentially expressed in LEPCs. It also provided some evidence that SOX9, and potentially other SOX-family TFs, are expressed in LEPCs and may regulate corneal epithelial homeostasis. Our results suggest that

SOX9 promotes proliferation and differentiation in transient amplifying cells following nuclear translocation, while supporting a progenitor cell phenotype and the continued expression of marker genes of putative LEPC by means of its cytoplasmic retention. Activation of SOX9 may assist clonal expansion, proliferation and differentiation of limbal epithelial cells in vitro for clinical applications. Therefore, SOX9 is a strong candidate gene, which, in combination with other factors, may form part of a strategy to achieve transdifferentiation and expansion of cells from non-ocular sources towards a corneal epithelial phenotype. The functional mechanisms underlying cytoplasmic retention and nuclear shuttling of SOX9 require further investigations.

1.2 Zusammenfassung auf Deutsch

Die Hornhaut des Auges ist unser “Fenster zur Welt”. Um diese Funktion zu erfüllen, ist eine intakte epitheliale Oberfläche erforderlich. Homöostase und Reparaturvorgänge des Hornhautepithels werden aus epithelialen Stamm- oder Vorläuferzellen am korneoskleralen Limbus gespeist. Gehen sie verloren kommt es durch verzögerte Wundheilung, Neovaskularisation und Narbenbildung zu

Schmerzen und Visusverlust. Derzeitige Therapieoptionen beinhalten die Vermehrung von limbalen epithelialen Progenitorzellen (LEPC) eines gesunden Spenderauges durch Kultivierung ex vivo und die Transplantation dieser Zellen auf die erkrankte Augenoberfläche. Die Verfügbarkeit von autologen LEPC zur Transplantation ist jedoch limitiert, z.B. bei systemischer und/oder bilateraler

Erkrankung. Dies nährt Interesse an der Verwendung induzierter, pluripotenter Zellen oder der direkten Transdifferenzierung nicht-okulärer Zellen hin zu einem kornealen epithelialen Phänotyp.

Transkriptionsfaktoren (TF) nehmen eine Schlüsselrolle ein sowohl bei der Induktion von

Pluripotenz als auch bei der direkten Umprogrammierung von Zellen. Um nicht-okuläre Zellen für die Regeneration der Hornhautoberfläche erfolgreich einzusetzen kann es hilfreich sein, die

Regulation von LEPC und Hornhautepithelzellen durch TF zu verstehen. Ziel der vorliegenden Arbeit war daher, differentiell exprimierte TF-Gene in humanen Limbusprogenitor- und

Hornhautepithelzellen zu identifizieren und ihre Rolle für Proliferation und Differenzierung von

LEPC zu charakterisieren.

LEPC-Cluster sowie basale Epithelzellen der zentralen Hornhaut wurden mittels Laser Capture

Mikrodissektion (LCM) aus Gefrierschnitten humaner Spenderhornhäute isoliert. Aus diesen Proben extrahierte RNA wurde linear amplifiziert. Die Expressionsstärke einer Reihe von Stammzell-TF-

Genen in diesen Proben wurde mittels Real-Time Polymerase Kettenreaktion (PCR) Arrays untersucht. Vier Gene zeigten eine konstant erhöhte Expression in LEPC (mindestens 2-fach erhöht im Vergleich zu Epithelzellen der zentralen Hornhaut): DACH1, HOXA11, SOX9, und PPARG. Elf Gene 7

zeigten eine erhöhte Expression in Epithelzellen der zentralen Hornhaut: FOXP2, RB1, MSX2, JUN,

PCNA, SP1, SIX2, PAX6, FOXP3, SMAD2, und FOXP1. Validierungs-Experimente mit Real-Time PCR

Hydrolyse-Sonden bestätigten die statistisch signifikant erhöhte Expression von SOX9 (428-fach erhöht), DACH1 (272.5-fach erhöht), HOXA11 (104.7-fach erhöht) und PPARG (29.3-fach erhöht) in

LEPC.

SOX-Gene (Sry-related high mobility group box) kodieren TF, die die Entwicklung und

Differenzierung von Zellen regulieren. Daher wurde mittels Real-Time PCR die Expressionsstärke aller SOX TF-Gene in den LCM-Proben untersucht. Erhöhte Expression in LEPC wurde für einige

Mitglieder der SOX-Genfamilie festgestellt, einschließlich aller Gene der SoxE, SoxF und SoxH-

Gruppen. Anschließend wurde die intrazelluläre Lokalisation der jeweiligen Genprodukte mittels in- situ Immunfluoreszenz beurteilt. Hier zeigten SoxE-Proteine eine überwiegend zytoplasmatische

Anfärbung in basal gelegenen Limbusepithelzellen, was eine Inhibition der TF-Aktivität nahelegt.

Überwiegend nukleäre Anfärbung in suprabasal gelegenen Limbusepithelzellen und in zentralen

Hornhautepithelzellen weist auf TF-Aktivität im Nukleus hin.

SOX9 wurde aufgrund seiner starken Expression in LEPC und aufgrund von Hinweisen aus der

Literatur hinsichtlich seiner Bedeutung in anderen Vorläuferzell-Typen für weitere Untersuchungen ausgewählt. Mittels Doppelmarkierung konnte eine partielle Ko-Lokalisation zwischen SOX9 und etablierten LEPC-Markern (Bmi1, OCT4, p63α, N-Cadherin und Keratin 15) beobachtet werden. Die

Expression von SOX9 wurde auch in einem Organkultur-Wundheilungsmodell an isolierten humanen Hornhäuten untersucht, deren Epithel im zentralen Bereich abladiert wurde. Hierbei zeigte sich eine verstärkte Expression und nukleäre Translokation von SOX9 in aktivierten LEPC sowie in proliferierenden und regenerierenden Hornhautepithelzellen in vitro. Damit

übereinstimmend konnte auch eine zunehmende Expression und nukleäre Lokalisation von SOX9 in kultivierten primären LEPC mit steigender Passage und Differenzierung gezeigt werden. 8

Zur weiteren Analyse der durch SOX9 regulierten Zielgene wurde ein Knockdown von SOX9 in kultivierten LEPC mittels RNAi erzielt, und 24 Stunden nach der Transfektion die Expression

Proliferations- und Differenzierungs-assoziierter Kandidatengene mittels Real-Time PCR analysiert.

Die Expression des Vorläuferzell-Markers KRT15 (Cytokeratin 15) war nach Knockdown von SOX9 im

Vergleich mit Mock-transfizierten Zellen signifikant reduziert. Die Expressionsstärke anderer

Progenitorzell-Marker-Gene wie CEBPD, ABCG2, p63α oder CDH2 war jedoch nicht signifikant verändert. Weiterhin wurde ein Trend zur Hochregulation der Differenzierungs-Marker KRT3 und

IVL, nicht jedoch von KRT12, PAX6 oder MUC1, beobachtet. Des Weiteren wurde ein Trend zur

Hochregulation der Cyclin-abhängigen Kinase-Inhibitoren p21 und p57 beobachtet sowie ein Trend zur Herunterregulation des Proliferations-Markers PCNA (Proliferating cell nuclear antigen). Mittels

Western Blot wurden nach Knockdown von SOX9 geringere Proteinmengen von Cytokeratin 15 und

PCNA in kultivierten LEPC detektiert. In Übereinstimmung mit einer Herunterregulation von PCNA war auch die Proliferationsrate der LEPC (gemessen anhand der Aufnahme von BrdU) nach

Knockdown von SOX9 signifikant verringert.

Zusammengefasst konnte diese Studie TF identifizieren, deren verstärkte Expression in LEPC bisher nicht bekannt war. Die erhobenen Daten deuten an, dass SOX9 (und eventuell andere TF der SOX-

Familie) in LEPCs reguliert wird und zur Homöostase des Hornhautepithels beiträgt. Unsere

Ergebnisse legen nahe dass SOX9 nach nukleärer Translokation Proliferations- und

Differenzierungsprogramme in den LEPC aktiviert, während durch seine cytoplasmatische Retention in LEPC ein undifferenzierter Phänotyp und die Expression von Progenitorzell-Markern aufrechterhalten wird. Die gezielte Aktivierung von SOX9 könnte die klonale Expansion und

Differenzierung von LEPC in vitro für klinische Anwendungen fördern SOX9 ist daher ein vielversprechender Schlüsselfaktor, welcher, in Kombination mit anderen Transkriptionsfaktoren, die Transdifferenzierung von nicht-okulären Zellen in einen kornealen epithelialen Phänotyp

steuern könnte. Die funktionellen Mechanismen der cytoplasmatischen Retention und nukleären

Translokation von SOX9 müssen allerdings in weiterführenden Untersuchungen geklärt werden.

2. INTRODUCTION

2.1 Anatomy and histology of the cornea and the corneal surface

The cornea forms the most anterior anatomical structure of the eye and has been described as our

“window to the world” [1]: It transmits light, allowing it to enter the eye to facilitate vision, while it constitutes a barrier to exogenous physical and infectious noxae. In addition, the cornea makes an important contribution to the overall refractive power of the human eye. These functions rely heavily on the presence of an intact corneal surface. An important component of this surface is a stratified, non-keratinised, squamous epithelium. Its 5-7 layers of cells amount to a total thickness of approximately 50 μm centrally [2]. Basal cells show a columnar morphology, more superficial cells form an intermediate layer of “wing”-shaped cells, and the outermost layer is typically composed of flat, scale-like (squamous) cells (Figure 1). Microvilli on the apical plasma membrane of superficial cells support the presence of mucin glycoproteins which form the so-called glycocalyx and allow the hydrophobic cell surface to be smoothly covered by the aqueous phase of the tear film. Laterally and basally, junctional complexes (including tight junctions) and hemidesmosomes represent typical specialisations of epithelial cells [3]. An underlying basement membrane anchors the epithelial sheet to Bowman's membrane, a prominent, acellular layer of corneal stroma [4].

The corneal surface is an integral part of a larger anatomical region referred to as ocular surface, which is comprised of the corneal and conjunctival epithelia, separated by a transition zone referred to as the corneoscleral limbus (Figure 2). A number of appendages such as lids, lacrimal glands, meibomian glands and goblet cells of the conjunctiva make important contributions to maintaining a healthy ocular surface, for instance by providing components of the tear film.

Corneal epithelium

Bowman’s layer

Stroma

Descemet’s Membrane

Endothelium

Figure 1: Light micrograph of a cross section of the human cornea. The typical corneal architecture with its five principal layers can be appreciated. Hematoxylin and eosin stain; magnification x50.

Conjunctiva

Cornea

Limbus

Figure 2: Bulbar areas of the ocular surface. The limbus is an annular transition zone (dashed circle) between the cornea and the conjunctiva.

2.2 Homeostasis of corneal epithelium and the limbal stem cell paradigm

As is typical for epithelia, cells on the corneal surface are continuously regenerated to replace any loss due to superficial debridement [3]. The cell reservoir that generates new corneal epithelium was first proposed to reside in the limbal region by Davanger and Evensen in 1971 [5]. This notion is supported by data showing that corneal wound healing occurs by centripetal movement of epithelial cells from the limbus [6]. Centripetal migration of basal corneal epithelium also in unwounded corneas was confirmed by in-vivo confocal microscopy [7]. Several additional lines of evidence point towards the existence of unipotent corneal epithelial stem cells located at the limbus. To conform to the common concept of stem cells, these would be expected to have a large proliferative capacity, be self-renewing, slow cycling and poorly differentiated [8]. Indeed, limbal epithelial basal cells show higher proliferative potential in vitro than other ocular surface epithelial cells [9]. In vivo, limbal basal cells are usually slow cycling, but proliferation can be induced in response to corneal wounding, as shown through cell-labelling by prolonged administration of methyl-3H thymidine [10]. This label was not retained in resting corneal epithelial cells once administration was discontinued. However, upon inflicting a small central corneal wound, the label persisted for extended periods of time in limbal basal cells but not central corneal epithelium. This suggests that a distinct population of previously non-proliferative basal limbal cells passes through

S-phase as it expands in response to stimulation, but then returns to its slow cycling stage. In addition, cytokeratin 3 (CK3), which is regarded as a differentiation marker of corneal epithelium, was found to be expressed in both suprabasal and basal cell layers in central human cornea. Limbal epithelium expresses this marker only in suprabasal but not basal layers, suggesting limbal basal cells remain at a less differentiated stage [11].

The study of putative limbal epithelial progenitor cells (LEPCs) is hindered by the fact that currently a single specific phenotypic marker is not available [12,13]. Hence, indirect methods need to be 13

relied upon. Phenotypic features which indicate differentiation are used to characterise cells less likely to be stem cells, while a combination of markers hinting towards stem cell identity are used to approximate this important sub-population. Differentiation markers for corneal epithelial cells include the cytoskeletal protein CK3 (vide supra) as well as other cytokeratin isoforms such as CK12, and also involucrin and E-cadherin [14]. Also, studies of human post-mortem corneal specimens have suggested that connexin 43 is expressed only in the more differentiated suprabasal limbal and central corneal epithelium [14,15]. In contrast, ABCG2 is a member of the ATP binding cassette family of membrane transporter proteins which has been referred to as a universal stem cell marker [16]. In corneal epithelium, it is expressed primarily by basal cells at the limbus, and has therefore been proposed as a positive LEPC marker [14,17]. The transcription factor (TF) p63 is expressed by basal limbal cells which have a large nucleus/cytoplasm ratio and are small, slow- cycling, and able to form holoclone colonies, all of which are features commonly associated with stem cells [18]. Of the three isoforms of p63, particularly p63-α has been associated with stem cell properties in corneal epithelium [19]. CK15 was found to be expressed in the basal limbal but not central epithelium by immunohistochemistry [20] as well as ribonucleic acid [21] and protein [22] analysis, suggesting that CK15 may characterise LEPCs. N-cadherin is expressed in human basal limbal epithelial cells and may play a functional role for maintaining a progenitor cell phenotype in these cells [23]. Finally, expression of the CCAAT enhancer binding protein δ (C/EBPδ) TF was restricted to a mitotically quiescent subset of human limbal basal cells in vivo and in vitro [24].

Furthermore, LEPCs have been suggested to feature small cell size with a high nuclear/cytoplasmic ratio [18,25,26]. Different combinations of these negative or positive phenotypic markers may be used to facilitate the identification and isolation of LEPCs.

2.3 The limbal stem cell niche

Rather than being a mere transition zone between cornea and sclera, the limbus provides some unique anatomical specialisations, which are believed to be important for maintaining the stem cell population. It contains melanocytes, which have been proposed to shield LEPCs from ultraviolet radiation [5]. It also contains the palisades of Vogt, radially oriented epithelial ridges and stromal projections possessing a distinct vasculature [27]. Basal epithelial cells buried between these stromal palisades may therefore be shielded also from mechanical stress, while nutrition is provided via the rich capillary network. Indeed, in-vivo confocal microscopy revealed these cells to be smaller than those in the central cornea, hinting towards a stem cell identity [28]. Dua et al. have identified a further anatomical sub-specialisation around the palisades, which they termed

„limbal epithelial crypts“ [8]. These are invaginations of epithelial cells into the undersurface of the interpalisade space. Cells within these crypts stained positive for the putative LEPC marker ABCG2.

In a similar vein, Shortt et al. reported the presence of two distinct limbal structures, termed

“limbal crypts” and “focal stromal projections” [29]. Crypts are described as invaginations of peripheral corneal epithelium into a highly vascularised area of limbal stroma, while focal stromal projections are upward projections of limbal stroma. Again, cells in close association with these structures expressed the putative LEPC marker ABCG2, as well as p63.

In addition to a protective limbal anatomy, signals received from extracellular matrix and surrounding cells are believed to be important regulators of LEPC function and fate [29-31]. Type IV collagen, being the most prominent structural component of epithelial basement membranes, and laminin, which is the most abundant non-collagenous component, were both found to be expressed differentially in limbal and corneal regions [30,31]. Likewise, soluble factors secreted by limbal fibroblasts have been proposed to have regulatory effects on limbal basal epithelial cells [32]. The

notion of adjacent matrix structures and cells influencing stem cell behaviour corresponds well to what Schofield termed the “stem cell niche” [33].

Figure 3 summarises the current concept of LEPC growth and differentiation. LEPCs, presumably located at the limbus, divide asymmetrically to produce transient amplifying cells (TACs) which leave the stem cell niche, where an altered environment contributes to directing their fate towards differentiation [1]. Signalling pathways which may be involved in regulating LEPC fate include sonic hedgehog, Wnt and Notch [34]. Ongoing efforts to define this niche more clearly are motivated by the idea that this may allow replication of its specific parameters to improve LEPC-based therapies, such as those described in the following section.

Figure 3: Limbal stem cell maintenance, expansion and differentiation. Asymmetrical division of LEPC located in the basal epithelial layer at the limbus gives rise to transient amplifying cells which migrate centripetally. Further proliferation and differentiation of these cells gives rise to terminally differentiated epithelial cells found in more superficial layers of the epithelium. Note some of the limbal specialisations that may contribute to supporting and retaining stem cells: Ridges, vascularisation, melanocytes and limbal fibroblasts. St, stroma; BL, Bowman's layer; Ep, epithelium. (Reproduced from Ref. [34].)

2.4 Cell therapeutic strategies in ocular surface disease

When the capacity for self-renewal of corneal epithelium by LEPC is lost, a pathologic state of the corneal surface may emerge which is characterised by ingrowth of conjunctival epithelium

(containing goblet cells), delayed wound healing, vascularisation and scarring [13,35]. A number of different disease entities are held responsible for a deficiency in numbers of functional LEPC, which may lead to painful loss of vision [36]. These diseases include thermal or chemical burns, Stevens-

Johnson syndrome, ocular cicatricial pemphigoid, contact lens wear and aniridia, among others

[36,37]. To provide a causal treatment for severe or total limbal stem cell deficiency (LSCD), Kenyon and Tseng in 1989 pioneered the concept of limbal stem cell transplantation [38]. They used autologous tissue; the cell source was the contralateral, healthy eye. Pellegrini and colleagues modified their technique by expanding autologous limbal epithelium through ex vivo culture of

LEPCs before transplantion [39]. This technique increases cell yield and reduces the need for large biopsies and the risk of inducing morbidity at the donor site [40,41]. In bilateral disease however, allogeneic tissue needs to be relied upon. Here, limbal rings discarded after penetrating keratoplasty can be used to obtain limbal epithelial cells for culture [42]. Two different techniques are available for isolation and ex vivo-expansion of corneal epithelium: The explant culture system and the suspension culture system. Particularly the latter, in which cells are enzymatically released from donor tissue and then seeded onto a suitable substrate, was found to be efficient in obtaining

LEPC and retaining their proliferative properties [41]. However, favourable clinical results have been obtained in a number of studies using either method (reviewed by Shortt et al. [43]). Despite these studies showing that a functional corneal epithelium can be successfully restored using limbal stem cell transplantation, the exact mechanism of how this is achieved remains somewhat unclear.

Daya et al. determined the genotype of corneal epithelial cells following their transplantation to the corneal surface in humans, and were unable to detect donor-DNA from as early as 1 month

postoperatively [44]. This may mean that rather than integrating into the recipient corneal surface, transplanted corneal epithelium may stimulate the recovery of an endogenous stem cell population. Indeed, it has been suggested that bone-marrow derived mesenchymal stem cells can show an epithelial phenotype on the ocular surface [45], and that bone-marrow derived cells can be found in the normal mouse corneal stroma [46]. These findings have contributed to the concept of using non-ocular and/or non-epithelial, autologous cell sources for cell therapy of ocular surface disease. Relevant works in this field are summarised in the next section.

2.5 Alternative cell sources for transplantation to the corneal surface

Availability of autologous limbal epithelial cells for transplantation is limited, particularly in patients with systemic and/or bilateral disease. Also, there is some concern regarding the potential to induce limbal stem cell deficiency at the donor site (although until now this risk has not been formally quantified). Therefore, research efforts have been directed towards transdifferentiation of cells of different lineages towards a corneal epithelial phenotype. This would allow the use of autologous, adult cells from a non-ocular donor site that (ideally) would be easily accessible and provide large numbers of cells.

Like corneal epithelial cells, oral mucosal epithelial cells express CK3. This has prompted interest in using them for corneal surface reconstruction. Nakamura et al. harvested epithelial cells from the buccal cavity of rabbits to create a sheet of stratified, non-keratinized epithelium with strong morphological resemblance to corneal epithelium, which they used for autologous transplantation in a rabbit model of limbal stem cell deficiency [47]. Clinical results demonstrated that transplantation of cultured human oral mucosal epithelium can serve to reconstruct ocular surface integrity and improve visual acuity in patients for up to 90 months [48]. However, varying degrees

of corneal neovascularization, albeit stable, were commonly seen following the use of this technique, possibly due to a lack of antiangiogenic factors [49]. In addition, at no time during culture or following transplantation, expression of cornea-specific marker KRT12 was observed. This indicates that the cultivated oral epithelial cells have not fully adopted a corneal epithelial cell phenotype.

Hair follicle bulge-derived stem cells have been used and approved for tissue engineering of epidermal equivalents in the treatment of skin ulcers [50], making them an attractive candidate also for ocular surface reconstruction. During development of ocular surface epithelium from the head ectoderm, the main phenotypic differences with the epidermis occur in the late differentiation stages [51]. This may make adult epidermal progenitor cells particularly prone to transdifferentiate towards the corneal epithelial lineage. Works at the University of Erlangen have shown that hair follicle stem cells can be induced to express markers characteristic of corneal epithelium by exposing them to a limbus-specific environment using conditioned medium from limbal stromal fibroblasts and laminin-332 coated culture dishes [52]. Using a transgenic reporter mouse model, which allowed for the detection of KRT12 expression in vivo, the transplanted corneal epithelial constructs provided direct evidence of transdifferentiation towards a corneal epithelial phenotype in vivo [52].

Considerable attention has also been given to the induction of corneal epithelial-like cells from mesenchymal stromal cells (MSCs) [53,54]. MSCs are pluripotent and, under appropriate conditions, have the capacity to differentiate into mesodermal and non-mesodermal cell lineages

[55-57]. Data from Gu and colleagues suggested that rabbit bone marrow-derived MSCs can differentiate into corneal epithelial cells in vivo and ex vivo [58]. Rabbit MSCs cultured in the presence of supernatant from limbal stem cells differentiated into cells that showed morphological characteristics of corneal epithelial cells and expressed CK3. In a similar vein, it was demonstrated 19

that co-cultivation of rat bone-marrow derived MSCs with corneal stromal cells in a transwell system induced MSCs that display corneal epithelial cell characteristics including expression of

KRT12 [59]. Katikireddy and colleagues contributed further evidence that supports the ability of

MSCs to transdifferentiate into corneal epithelial-like cells [60]. Transplantation of human bone marrow-derived MSCs onto the chemically burned rat ocular surface supported corneal wound healing and contributed to the reconstruction of the damaged cornea [45]. The therapeutic potential of MSCs was confirmed in studies using subconjunctival administration of rat MSCs in a rat model of chemically burned ocular surface [61] or transplantation of rat MSCs on to the ocular surface using Amniotic membrane (AM) [59]. Studies of the mechanisms underlying the therapeutic action of MSCs on the damaged ocular surface have shown that a variety of mechanisms can contribute to the beneficial effect of MSCs. Liu and coworkers suggested that transferred MSCs can persist on the ocular surface for more than three months after transplantation [62], but direct epithelial transdifferentiation from MSCs did not seem to be the main mechanism of the therapeutic action of MSCs in vivo. Rather, beneficial effects of MSC transplantation onto the damaged ocular surface may consist of their anti-inflammatory and anti-angiogenic effects. Analysis of gene expression in injured corneas after MSC transplantation showed a significant reduction in the expression of genes for the proinflammatory cytokines interferon-γ, interleukin-2, tumor necrosis factor-α, macrophage inflammatory protein-1α and for vascular endothelial growth factor

[61,63].

Induced pluripotent stem cells (iPSCs) derived from human dermal fibroblasts and corneal limbal epithelium could also be differentiated into corneal epithelial-like cells [64]. While transdifferentiation entails direct transition from one adult cell type into another without passing through a stable intermediate state of pluripotency, in iPSCs differentiation is reversed under the influence of exogenous factors but once pluripotency is reached this is maintained via an

endogenous program [65,66]. Induction of pluripotency in adult, somatic cells was first achieved by

Takahashi and Yamanaka by the induction of a defined set of TFs [67]. In 2012, Shinya Yamanaka was awarded the Nobel Prize in Physiology or Medicine “for the discovery that mature cells can be reprogrammed to become pluripotent”. The crucial role of TF expression in this process is laid out in the following section.

2.6 Transcription factors in cell differentiation and reprogramming

Adult human tissues have limited regenerative potential, awarded by the presence of somatic stem cells. Examples include the limbal stem cell hypothesis described above, as well as haematopoiesis and liver regeneration. Other species have regenerative capacities that go well beyond those encountered in humans, the most prominent examples being the replacement of lost limbs [68] or lens regeneration [69,70] in some amphibians. It is assumed that these naturally occurring processes involve transdifferentiation, where terminally differentiated cells transiently regress to a less differentiated stage, allowing them to proliferate and potentially switch to a different lineage before re-establishing a differentiated state [65]. By contrast, full regression to a state of pluripotency has not yet been shown to occur as part of any regenerative process in vivo. It has however been achieved in vitro by forced expression of a defined set of TFs [67]. This process holds promise to become highly relevant to regenerative medicine, since it abolishes the need for using embryonic stem cells, provides autologous cells for cell therapy, and may allow correction of disease-inducing mutations in vitro prior to transplantation.

TFs are intracellular proteins which bind to DNA by their specific DNA-binding domains and thereby control (i.e., activate or repress) the transcription of individual genes into mRNA [71]. TFs are key players both in establishing pluripotency and in directing cells towards a new lineage [66]. Since the

first report that reprogramming of fibroblasts to pluripotency can be achieved using only the four

TFs OCT4, SOX2, KLF4 and MYC [67], others have successfully reprogrammed fibroblasts with only

OCT4, SOX2 and KLF4 [72], cord blood cells with only OCT4 and SOX2 [73], and neural stem cells with only OCT4 [74]. These cell type-specific differences may be due to endogenous expression of some of the factors [66]. Once pluripotency is achieved, this state is maintained by establishing an endogenous programme in which another TF, NANOG, plays a stabilising role. Together with OCT4 and SOX2, it inhibits differentiation by repressing lineage-specific genes [75].

In addition to their roles in inducing and maintaining pluripotency, TFs also direct the establishment of cell identity during differentiation. Yamamizu et al. used overexpression of combinations of TFs to direct embryonic stem cells towards different lineages [76]. Also, direct transdifferentiation of mesenchymal stromal cells has been achieved using forced expression of single TFs (reviewed in

Ref. [77]). Here, lineage conversion is achieved without passing through a stable, intermediate state of pluripotency, which may be advantageous with regards to cell yield, simplicity of the protocol, and potential risk of teratoma formation [78].

Regardless which technical approach may become most useful for potential clinical applications in the future, it is likely to require detailed knowledge of the TF networks that specify the target cell population. The following section reviews the current knowledge of the role of TFs in LEPCs and corneal epithelial cells.

2.7 Transcription factors in limbal epithelial cells

A central role of the homeobox TF gene PAX6 in ocular surface epithelia is well recognised. During development, expression of PAX6 in head ectoderm is the earliest noticeable change in gene expression occurring in the region of apposition of the optic vesicle [51]. It is followed by 22

establishment of the lens placode and invagination of the lens vesicle. As the lens vesicle detaches from the surface, ectodermal cells that continue to express PAX6 establish corneal and conjunctival epithelia, whereas cells that lack PAX6 expression become epidermis. PAX6 knockdown in LEPCs in vitro leads to upregulation of keratin markers specific for epidermis [79]. This is in line with the observation that down-regulation of PAX6 is associated with abnormal differentiation of corneal surface epithelium in patients with ocular surface disease, whereas transient activation of PAX6 transgenes re-established normal CK12 expression in vitro [80]. Pax6+/- mice showed disruption of centripetal epithelial cell migration and fewer LEPCs than wild type animals [81], while in

Pax6+/+/Pax6-/- chimeras, Pax6-/- cells do not contribute to formation of corneal epithelium [82]. In humans, loss of one PAX6 allele results in aniridia, with associated changes of the corneal epithelium that suggest LSCD [83]. Collectively, these findings suggest an important role of PAX6 in lineage determination and homeostasis of corneal epithelium. Indeed, it has recently been suggested that forced expression of PAX6 in human skin epithelial cells induces a corneal-like phenotype in vitro [84].

Recent studies have suggested links between the function of PAX6 and p63 [79], which is a member of the p53 family of TFs, and is commonly seen as a master regulator of epithelial cell self-renewal and differentiation [85]. In LEPCs, p63 has been suggested to convey the potential for proliferation and migration during corneal wound healing [19]. In particular, the isoform ΔNp63 (lacking the amino terminal transactivation domain) was suggested to sustain the proliferative activity of TACs, while the isoform TAp63 (containing the transactivation domain) seemed to be restricted to slow- cycling limbal basal cells, maintaining them in a more undifferentiated state [86,87].

While proliferative potential is fostered by ΔNp63, mitotic quiescence of putative LEPCs is regulated by C/EBPδ, and this effect could be harnessed in vitro to achieve sustained self-renewal by forced expression of C/EBPδ [24]. Krüppel-like factor (KLF)-4 has been shown to play a role in postnatal 23

maturation and maintenance (but not embryonic morphogenesis) of corneal epithelium in mice, possibly by regulating KRT12 and aquaporin-5 expression [88]. In a similar vein, the TF EHF (Ets homologous factor) is selectively expressed in mouse corneal epithelium and activates the expression of epithelial differentiation-related genes, possibly in collaboration with KLF4 and KLF5

[89]. Many other TFs have been identified in corneal epithelium and characterised with regards to their role in development and/or homeostasis, such as Activating Protein-2 (AP-2) α, which regulates cadherin expression [90], Pbx1, which is appears to be required for corneal epithelial cell fate determination and differentiation [91], and Hox-7.1 and Hox-8.1, two homeodomain- containing TFs that may be involved in compartmentalisation of the ocular surface epithelia during eye development [92]. Similar to Hox-genes, Wolosin et al. suggest that Id (inhibitor of DNA) family

TFs, and particularly Id1, may be important in specifying and patterning corneal surface epithelia during development [51].

TFs can act as downstream targets of signalling cascades. In human limbal basal epithelium, cytoplasmic localisation of the homeobox TF PITX2 was observed by immunofluorescent staining

[93]. PITX2 is a downstream target of Wnt signalling, and in mice Wnt signalling was suggested to be a regulator of corneal cell fate determination and differentiation during development [94]. In human basal limbal epithelium, evidence was found for expression and a functional role of TCF4, another TF crucially involved in Wnt signalling [95]. Similarly, the Notch signalling-related basic helix-loop-helix transcriptional repressor Hes1 (hairy and enhancer of split-1) was detected in LEPCs in mice, where it seems to keep these cells in a slow-cycling, undifferentiated state [96]. Expression of HES1 was also observed in human limbal epithelial crypts [97].

The available body of evidence suggests multiple roles for TFs in LEPC function and fate. The following section will highlight the need for further study of TF networks in limbal and corneal epithelium. 24

2.8 Research question

Full success in transplantation of LEPCs is currently hampered by our limited understanding of the processes that govern self-renewal and differentiation of limbal stem cells [98]. In a similar vein, the molecular cues that will direct non-ocular adult cells or induced pluripotent cells towards adopting a corneal phenotype remain elusive. Efforts to dissect TF networks in corneal epithelial cells and in cells of the limbal stem cell compartment may aid in improving the efficacy of emerging therapeutic approaches, such as direct reprogramming of autologous cells into functional corneal epithelial cells for novel treatment strategies in bilateral ocular surface disease [78]. This notion is based on the concept that cell identity is a reflection of its transcriptional profile [77], and that a stem cell’s decision for self-renewal or differentiation is governed by TFs [99]. Understanding the structure and dynamics of this profile may therefore be a sensible first step towards achieving effective cell differentiation in the context of pluripotent stem cell use for regenerative medicine [76]. Indeed, genes that have been used to induce dedifferentiation, transdifferentiation or reprogramming predominantly encode TFs [65]. However, many of the TFs identified in limbal and corneal epithelial cells, such as p63 [85], EHF [89], AP-2α [90], and KLF4 [88] have been found in other epithelial lineages as well and may on their own not be sufficiently specific for corneal epithelial lineage determination. Also, a large number of previous studies on TFs in corneal epithelium have been conducted in mice [82,88-92,96] or in Xenopus [70], while data from human cells is scarce [100]. It has been suggested that gene expression profiling and comparison of different ocular surface epithelial areas may aid to identify relevant subsets of genes and expression patterns [101]. We have therefore performed a comprehensive screening to identify differentially expressed TFs in human limbal and corneal epithelium. Our data identified elevated expression of members of the

“Sry-related HMG box” (SOX) gene family (SRY = sex-determining region on the Y chromosome; 25

HMG = high mobility group domain) in limbal basal epithelial cells. SOX genes encode TFs that regulate cell fate and differentiation during development and in the adult [102,103]. Hence, we also explored the anatomical distribution and functional relevance of selected members of this TF gene family in human limbal epithelium.

3. METHODS

3.1 Human donor corneas

Human donor corneas with appropriate research consent not suitable for corneal transplantation were procured by the cornea bank at the Department of Ophthalmology, University of Erlangen-

Nürnberg. All experiments with human tissue adhered to institutional ethical standards and to the tenets of the Declaration of Helsinki. Only eyes with intact corneal epithelium and absence of ocular surface disease were collected. Specimens destined for Laser Capture Microdissection (LCM) were obtained from five donors (ages 56, 64, 69, 76, and 83 years; mean age 69.6 years; two female, three male) within 15 hours of death. After labeling of superior, inferior, nasal, and temporal quadrants, corneas were embedded in optimal cutting temperature (OCT) compound

(Tissue-Tek®, Sakura Finetek Europe), snap frozen in liquid nitrogen and stored at -80°C until further processing (see section 3.2). Additional specimens were used for immunohistochemistry (see section 3.5).

Specimens destined for limbal epithelial cell cultures were prepared according to national and

European regulations for eye banking and in agreement with national guidelines established by the

German Medical Association (Bundesärztekammer) [104]. Following clinical use for corneal endothelial transplantation, corneal rims obtained from 20 donors (mean age 66.7 ± 9.2 years) were used for limbal epithelial cell isolation as described below (section 3.6).

Pairs of whole donor corneas (n=5) were used in in vitro wound healing experiments. A central epithelial debridement zone with a diameter of 6 mm was created in one cornea. The contralateral donor eye served as untreated control. Both corneas were incubated using standard European eye bank conditions for 24 hours. Following incubation, epithelial cells were removed from the entire

corneal surface by scraping and lysed in buffer RLT (Qiagen) supplemented with 1% β- mercaptoethanol. Further processing for real-time PCR was performed as described within section

3.4. Alternatively, corneas were excised, embedded in OCT compound, snap frozen in liquid nitrogen and further processed for immunohistochemistry as described in section 3.5.

3.2 Laser Capture Microdissection (LCM)

Serial cryosections of 12 μm thickness were obtained from superior or inferior corneolimbal quadrants under RNAse-free conditions. Sections were placed onto nuclease-free PEN NF

MembraneSlides (Carl Zeiss MicroImaging) that had been UV-irradiated (3000 mJ/cm2 for 30 minutes) using a UV Stratalinker® 1800 (Stratagene) to enhance adhesion. Slides were stored in 50 ml conical tubes with hygroscopic sachets at -80°C for a maximum of two weeks. Shortly before use, sections were stained using 1% cresyl violet as described by Cummings et al. [105]. Briefly, OCT compound was removed by submerging slides in 95% ethanol for 30 seconds, followed by rinsing with RNase-free water. 1% cresyl violet in 50% ethanol was added using a pipette and excess staining solution was washed away immediately by immersion in progressively more concentrated ethanol solutions for 30 seconds each. Following 5 minutes of final immersion in 100% ethanol, slides were placed on ice to air-dry and used immediately for LCM.

From each donor eye, roughly 100 cryosections were used for LCM. The PALM MicroBeam LCM system (“Positioning and Ablation in Laser Microdissection”, Carl Zeiss MicroImaging) was used to isolate basal clusters of putative limbal epithelial progenitor cells identified by their small size, dense packing and high nuclear to cytoplasmic ratio. Basal epithelial cells from central cornea were obtained to serve as control. The area of interest was identified on the screen and delineated digitally (Figure 4). The cutting and the Robo LPC (laser pressure catapult) functions were then used

sequentially to excise and catapult the target tissue into the collection tubes. Samples were lysed in buffer RLT (Qiagen) supplemented with 1% β-mercaptoethanol, and stored at -80°C until RNA isolation (see following section).

A B

Figure 4: Cryosections of human limbal specimens stained with cresyl violet. Basal limbal progenitor cell clusters shown in A were excised using Laser Capture Microdissection, as shown in B. Basal epithelium from central cornea was obtained using the same technique (not shown). Specimens then underwent RNA isolation and amplification, followed by real-time PCR analysis and comparison of TF gene expression (see section 3.3).

3.3 RNA amplification and RT2 profiler PCR arrays

RNA isolation from LCM-dissected specimens was achieved using the RNeasy Micro Kit (Qiagen), according to the manufacturer’s instructions. This procedure included an on-column DNase digestion step to remove genomic DNA. During the final step, purified RNA was eluted from the silica-membrane spin column using a volume of 14 μl RNAse-free water.

Subsequently, total RNA quantification and integrity check was performed by electrophoresis on a

2100 Bioanalyzer using the RNA 6000 Pico Kit (both from Agilent Technologies). RNA was heat denatured for 2 minutes at 70°C prior to measurements. The RNA Pico Chip was pre-loaded with gel 29

matrix and RNA dye according to the manufacturer’s protocol. 1 μl of each RNA sample was used per measurement. Samples with a resulting RNA concentration of 650-2,000 pg/µl and an RNA integrity number (RIN [106]) of ≥ 7.0 were used for amplification.

RNA amplification was performed using the MessageAmp II aRNA Amplification Kit (Life

Technologies). This entails reverse transcription using an oligo(dT) primer bearing a T7 promoter.

Following second strand synthesis, resulting cDNA was purified using spin columns provided with the MessageAmp II aRNA Amplification Kit. In vitro transcription could then be performed by T7

RNA polymerase (RNA polymerase from the T7 bacteriophage, a DNA virus). Following amplification, aRNA (amplified RNA) was cleaned up using another dedicated set of spin columns, concentration was measured on a Nanodrop ND1000 spectrophotometer (Thermo Fisher

Scientific), and quality control was again performed using Agilent technology, as described above.

To maximise yield, all samples underwent two rounds of amplification.

Following the second round of mRNA amplification, differential gene expression analysis for a large panel of TFs could be performed using the RT2 Profiler PCR Array Human Stem Cell Transcription

Factors (Qiagen). Corneal and limbal LCM samples from 5 different donors were used. Initially, cDNA synthesis was carried out from 5 µg of aRNA per sample using the RT2 First Strand Kit

(Qiagen) according to the manufacturer’s instructions. Real-time PCR on a CFX Connect Real-Time

PCR Detection System (BioRad) was done following addition of RT2 SYBR Green qPCR master mix

(Qiagen). Samples were analysed using Human Stem Cell Transcription Factors RT² Profiler PCR

Arrays Version 4.0 (Qiagen; Product details available at http://www.sabiosciences.com/rt_pcr_product/HTML/PAHS-501Z.html). PCRs were run using the following program: 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for

60 seconds. Data were analysed using the Excel-based RT2 Profiler PCR array data analysis tool, version 4.0. This algorithm routinely included comparison of gene expression between samples or 30

groups of samples following normalisation of individual cycle threshold values by the use of the housekeeping genes ACTB, B2M, GAPDH, HPRT1 and RPLP0 (ΔΔCT-method [107]). Table 1 shows

Reference Sequence numbers (RefSeq) of the respective transcript as well as symbols and names of all 84 genes examined.

Table 1: Full listing of all TF gene assays contained in the RT2 Profiler qPCR arrays used for analysis of LCM specimens.

RefSeq Gene symbol Gene name NM_001265 CDX2 Caudal type homeobox 2 NM_004392 DACH1 Dachshund homolog 1 NM_178120 DLX1 Distal-less homeobox 1 NM_004405 DLX2 Distal-less homeobox 2 NM_006892 DNMT3B DNA (cytosine-5-)-methyltransferase 3 beta NM_004430 EGR3 Early growth response 3 NM_000125 ESR1 Estrogen receptor 1 NM_004456 EZH2 Enhancer of zeste homolog 2 NM_004496 FOXA1 Forkhead box A1 NM_021784 FOXA2 Forkhead box A2 NM_032682 FOXP1 Forkhead box P1 NM_014491 FOXP2 Forkhead box P2 NM_014009 FOXP3 Forkhead box P3 NM_002049 GATA1 GATA binding protein 1 NM_005257 GATA6 GATA binding protein 6 NM_005270 GLI2 GLI family zinc finger 2 NM_004821 HAND1 Heart and neural crest derivatives expressed 1 NM_018951 HOXA10 Homeobox A10 NM_005523 HOXA11 Homeobox A11 NM_006735 HOXA2 Homeobox A2 NM_030661 HOXA3 Homeobox A3 NM_006896 HOXA7 Homeobox A7 NM_152739 HOXA9 Homeobox A9 NM_002144 HOXB1 Homeobox B1 NM_006361 HOXB13 Homeobox B13 NM_002146 HOXB3 Homeobox B3 NM_002147 HOXB5 Homeobox B5

Table 1 (continued)

NM_024016 HOXB8 Homeobox B8 NM_017409 HOXC10 Homeobox C10 NM_173860 HOXC12 Homeobox C12 NM_153633 HOXC4 Homeobox C4 NM_018953 HOXC5 Homeobox C5 NM_004503 HOXC6 Homeobox C6 NM_006897 HOXC9 Homeobox C9 NM_024501 HOXD1 Homeobox D1 NM_002148 HOXD10 Homeobox D10 NM_014621 HOXD4 Homeobox D4 NM_000872 HTR7 5-hydroxytryptamine receptor 7 NM_016358 IRX4 Iroquois homeobox 4 NM_002202 ISL1 ISL LIM homeobox 1 NM_002228 JUN Jun proto-oncogene NM_016270 KLF2 Kruppel-like factor 2 NM_004235 KLF4 Kruppel-like factor 4 NM_001004317 LIN28B Lin-28 homolog B NM_002316 LMX1B LIM homeobox transcription factor 1, beta NM_002449 MSX2 Msh homeobox 2 NM_002467 MYC V-myc myelocytomatosis viral oncogene homolog NM_024865 NANOG Nanog homeobox NM_002500 NEUROD1 Neurogenic differentiation 1 NM_172390 NFATC1 Nuclear factor of activated T-cells NM_002509 NKX2-2 NK2 homeobox 2 NM_024408 NOTCH2 Notch 2 NM_021005 NR2F2 Nuclear receptor subfamily 2, group F, member 2 NM_005806 OLIG2 Oligodendrocyte lineage transcription factor 2 NM_006192 PAX1 Paired box 1 NM_016734 PAX5 Paired box 5 NM_000280 PAX6 Paired box 6 NM_006194 PAX9 Paired box 9 NM_182649 PCNA Proliferating cell nuclear antigen NM_000325 PITX2 Paired-like homeodomain 2 NM_005029 PITX3 Paired-like homeodomain 3 NM_006237 POU4F1 POU class 4 homeobox 1 NM_004575 POU4F2 POU class 4 homeobox 2 NM_002701 POU5F1 POU class 5 homeobox 1 NM_015869 PPARG Peroxisome proliferator-activated receptor gamma NM_000321 RB1 Retinoblastoma 1 NM_001754 RUNX1 Runt-related transcription factor 1 NM_016932 SIX2 SIX homeobox 2 NM_005901 SMAD2 SMAD family member 2 NM_003106 SOX2 SRY (sex determining region Y)-box 2 NM_033326 SOX6 SRY (sex determining region Y)-box 6

Table 1 (continued)

NM_000346 SOX9 SRY (sex determining region Y)-box 9 NM_138473 SP1 Sp1 transcription factor NM_007315 STAT1 Signal transducer and activator of transcription 1 NM_003150 STAT3 Signal transducer and activator of transcription 3 NM_181486 TBX5 T-box 5 NM_003212 TDGF1 Teratocarcinoma-derived growth factor 1 NM_198253 TERT Telomerase reverse transcriptase NM_021025 TLX3 T-cell leukemia homeobox 3 NM_000376 VDR Vitamin D receptor NM_000553 WRN Werner syndrome, RecQ helicase-like NM_000378 WT1 Wilms tumor 1 NM_012082 ZFPM2 Zinc finger protein, multitype 2 NM_003412 ZIC1 Zic family member 1

3.4 Real-time PCR analysis

Since RNA-amplification may produce 5’-truncated cDNA [108], array results were confirmed and complemented using custom-designed quantitative real-time PCR (qRT-PCR) assays. The procedure described hereafter was used for all real-time PCR assays used in this study. First-strand cDNA synthesis was performed using Superscript II reverse transcriptase (Invitrogen). PCR reactions were run in duplicate with Universal ProbeLibrary probes (Roche Diagnostics) and primers targeting the

3’-region for LCM specimens, and intron-spanning primers for all other specimens. The Roche

Universal ProbeLibrary Assay Design Center* was used to determine primer sequences and probes

(Table 2 and Table 3). The following real-time PCR-program was used: 95°C for 10 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds. For normalisation of gene expression, ratios relative to the housekeeping gene GAPDH were calculated by the comparative

CT method (ΔΔCT).

*available at: https://lifescience.roche.com/shop/en/de/overviews/brand/universal-probe-library

Table 2: Primer sequences used in combination with hydrolysis reporter probes (Roche Diagnostics) for gene expression analysis using amplified RNA (aRNA) samples. These assays target the 3’-region of their respective transcript.

Accession Gene Forward primer Reverse primer Probe number symbol no. NM_002275.3 KRT15 cattggcatcagggaagc ttgatgtggaaattgctgct 10

NM_005195.3 CEBPD ggacataggagcgcaaagaa gcttctctcgcagtttagtgg 64

NM_000165.3 CX43 tgtagaaagtgcaccaggtgtt gcctcatgaataaggctgttg 10

NM_057088.2 KRT3 gaaggcttgtggcctcttg aattctcgtgactgggcttg 12

NM_015869.4 PPARG aaccaccctgagtcctcaca tgttccgtgacaatctgtctg 50

NM_000280.3 PAX6 agagtgtcgcttccttctaaagta agccaccatacaatatctacttttct 10 gt c NM_002592.2 PCNA tggcgctagtatttgaagca cagaaggcatctttactacacagc 2

NM_014491.3 FOXP2 agcaaattttaaactgtagcacaa cgtcagagaattcaaagtatgaaca 31 ac NM_005523.5 HOXA11 ttggaaagagttagggaaatgc ggctttcccagatgagatcc 34

NM_004392.5 DACH1 tgtgtcaagctttttgcatca tccacataacaaacaggtgactcta 68

NM_003140.1 SRY ccagctaggccacttaccg agctttgtccagtggctgtag 71

NM_005986.2 SOX1 gagattcatctcaggattgagatt ggcctactgtaatcttttctccac 3 cta NM_003106.3 SOX2 gggggaatggaccttgtatag gcaaagctcctaccgtacca 65

NM_005634.2 SOX3 gagaaacatagtatcgggtgagg aaaacagacgcgacacgac 78

NM_003107.2 SOX4 ttaacctgccaccagtgtcc tcttaaaagcttacagtgtttggcta 52

NM_152989.2 SOX5 aaggtatttttcacccctccat catatggcccacacttctga 39

NM_001145811. SOX6 tcactgacatgctggactgac cccaacagccctacacaaac 71 1 NM_031439.2 SOX7 ttcctcaccagccaggtc atttgcgggaagttgctcta 30

NM_014587.3 SOX8 gaggacgcaccctcactc caaaagttagcgttgcttggt 8

NM_000346.3 SOX9 ttggtttgtgttcgtgttttg ttcacggagagaacaaaaggtt 23

NM_006941.3 SOX10 ccaataacctcattctttgtctga cgtctcaaggtcatggaggt 25

NM_003108.3 SOX11 ggtaaagctacctgaggcagtg cgaaactttgccatgcattt 88

NM_006943.2 SOX12 gggacggacactgacagac cctgggcataggaagtcaaa 40

Table 2 (continued)

NM_005686.2 SOX13 tggaagaggttgagaagactcc ggctgagatccagtccctagt 41

NM_004189.3 SOX14 cacgctacggccatgtaa agaggacagggtgcagacc 23

NM_006942.1 SOX15 caaccctttctcctgttgga ctggctatcatgggaggact 34

NM_022454.3 SOX17 gctttgaatgtgtcccaaaac cacacccaggacaacatttct 69

NM_018419.2 SOX18 tgccagggttacatttttga ctggttgtagaaaatacactgcaag 68

NM_007084.2 SOX21 cgcttggatttctgacacag tgaactcagccataagggaaa 68

NM_178424.1 SOX30 ccccgacatcaactccttc tcttcctcctcatcactgtcg 42

Table 3: Primer sequences used in combination with hydrolysis reporter probes (Roche Diagnostics) for gene expression analysis using RNA samples from cell culture experiments. These assays may target any region along their respective transcript.

Accession Gene Forward primer Reverse primer Probe number symbol no. NM_057088.2 KRT3 tgagctgaagaacatggagga tcattctcagcagctgtacgtt 31

NM_000223.3 KRT12 gacctggagatgcagatcg cggaagctttggagctcat 17

NM_002275.3 KRT15 gaagagctccgggacaaga agcctggcattgtcgatct 77

NM_001792.3 CDH2 ggtggaggagaagaagaccag ggcatcaggctccacagt 66

NM_004827.2 ABCG2 gcacacaaaagcctactcagc aacccaggggtaaggaagg 14

NM_005547.2 IVL acccatcaggagcaaatgaa agctcgacaggcaccttct 16

NM_000280.4 PAX6 ggcacacacacattaacacactt ggtgtgtgagagcaattctcag 9

NM_002417.4 KI-67 ttacaagactcggtccctgaa ttgctgttctgcctcagtctt 50

NM_002592.2 PCNA tggcgctagtatttgaagca cagaaggcatctttactacacagc 2

NM_053056.2 CCND1 agaacacggctcacgcttac cagacaaagcgtccctcaag 71

NM_000389.4 P21 cgaagtcagttccttgtggag catgggttctgacggacat 82

NM_001114978. P63 ggaaaacaatgcccagactc ctgctggtccatgctgttc 45 1 NM_000076.2 P57 ctcctttccccttcttctcg tccatcgtggatgtgctg 55

3.5 Immunohistochemistry

For immunofluorescent staining, tissue samples obtained from 10 normal human donor eyes (mean age 78.7 ± 9.7 years) were embedded in optimal cutting temperature (OCT) compound and snap frozen in liquid nitrogen. Cryosections of 5 μm thickness were fixed with cold acetone or 4% paraformaldehyde/PBS for 10 minutes, washed in PBS, and permeabilised using 0.1% Triton X-100 in PBS for 10 minutes. After blocking with 10% normal goat serum, sections were incubated over night at 4°C in primary antibodies (Table 4) diluted in PBS. Antibody binding was detected by Alexa

Fluor® 488- or 555-conjugated secondary antibodies (Life Technologies). Nuclear counterstaining was achieved using 4 ́,6 ́-diamino-2-phenylindole (DAPI). Slides were washed and coverslipped with

Vectashield mounting medium (Vector Laboratories) prior to evaluation on a fluorescence microscope (BX51, Olympus). In negative control experiments, the primary antibody was replaced by PBS or equimolar concentrations of unspecific rabbit or mouse IgG.

Table 4: Primary antibodies used for immunofluorescent staining of cryosections of human corneoscleral specimens.

Antigen Clone Raised in Concentration Supplier SOX8 4E4.1 Mouse 1:50 Merck Millipore SOX9 N/A Rabbit 1:2000 Dr. Sock, Institute of Biochemistry, University of Erlangen-Nuremberg SOX9 3C10 Mouse 1:150 Bio-Rad (formerly Serotec) SOX10 BC34 Mouse 1:100 Abcam SOX7 S5-1216 Mouse 1:300 BD Pharmingen SOX17 P7-969 Mouse 1:500 BD Pharmingen SOX18 N/A Rabbit 1:300 Sigma SOX30 N/A Rabbit 1:100 Sigma Melan-A EP1422Y Rabbit 1:500 Abcam Bmi1 N/A Rabbit 1:2000 Abcam N-cadherin 6G11 Mouse 1:50 DAKO Keratin 3/76 AE5 Mouse 1:50 Merck Millipore Keratin 15 LHK15 Mouse 1:500 Abcam Oct-4 N/A Rabbit 1:100 Cell Signaling P63α N/A Rabbit 1:100 Cell Signaling Pax6 N/A Rabbit 1:200 Abcam Ki-67 SP6 Rabbit 1:1000 Abcam

3.6 Limbal epithelial cell culture

All cell culture experiments were conducted under aseptic conditions at a sterile laminar flow workbench. To isolate human limbal epithelial cells, corneal rims were cut into 12 one-clock-hour sectors, from which limbal segments were obtained by incisions made at 1 mm before and beyond the anatomical limbus. Each limbal segment was enzymatically digested with 2 mg/mL collagenase

A (Roche Diagnostics) in Keratinocyte Serum Free Medium (KSFM; Invitrogen) for 16 hours at 37°C.

KSFM contains bovine pituitary gland extract 50 μg/ml and human recombinant epidermal growth factor 5 ng/ml; no antibiotic was added. Subsequently, the tissue was triturated gently using a pipette, and then centrifuged at 200 g for 5 minutes. The resulting pellet was resuspended in KSFM, and passed through a 40 μm reversible cell strainer (Stem Cell Technologies) to remove single cells.

The filter was then reversed and cell clusters containing epithelial stem/progenitor cells were washed out using PBS. Following centrifugation (200 rcf for 5 minutes), 2 ml of 0.05% trypsin /

0.02% EDTA (Pan Biotech) was added to the pellet and incubated at 37°C for 10 minutes. A single cell suspension was obtained by gently pipetting up and down. Trypsin activity was inhibited using culture medium supplemented with 10% fetal bovine serum (FBS, Pan Biotech). The suspension was centrifuged, and the pellet was resuspended in 12 ml KSFM and distributed to a 6 well cell culture plate for cells destined to be used in transfection experiments. For experiments without transfection (i.e., unstimulated expression analysis and antibody staining; see Results section 4.3), a phase of clonal expansion on a feeder layer of growth-arrested murine 3T3 fibroblasts (ACC 173;

Deutsche Sammlung von Mikroorganismen und Zellkulturen) was intercalated. Feeder cells had been exposed to 4μg/ml Mitomycin C (Kyowa) for two hours to stimulate production of growth factors and extracellular matrix constituents that support stem cell growth [3]. These cells were cultured in either KSFM, or equal parts of Dulbecco´s modified Eagle´s medium and Ham´s F12 medium (DMEM/F12; Pan Biotech) supplemented with 10% FBS, 1% Human Corneal Growth

Supplement (Thermo Fisher Scientific), EGF (Invitrogen; final concentration 5 ng/ml) and

Gentamycin (Invitrogen; final concentration 50 µg/ml). Cells were incubated at 37°C under 5% CO2 and 95% humidity. Media were changed three times per week.

3.7 Transcription factor knockdown/overexpression in vitro

Primary limbal epithelial cells from passage 0 were used for transfection experiments. Before transfection, cells were detached from culture plates using 0.05% trypsin-EDTA. Trypsin was inactivated using medium supplemented with 10% FBS. Cells were counted on a CASY Cell Counter and Analyzer (Schärfe System), and the required amount of cells per reaction was centrifuged at 90 rcf for 10 minutes. For each well of a 6-well plate, 3 x 105 cells were used. Cells were resuspended in nucleofection reagents (82 μl Nucleofector Solution and 18 μl Supplement per reaction) from the

Amaxa Cell Line Nucleofector Kit V (Lonza). For overexpression experiments, a cDNA clone containing the SOX9 open reading frame (accession number NM_000346) inserted into a pCMV6 expression vector (OriGene) was used. The pCMV6-Entry vector was used in control specimens. For knockdown experiments, SOX9 gene-specific ON-TARGETplus siRNA (Thermo Fisher Scientific) was used. Scramble siRNA was used in control specimens. Suspended cells and reagents were transferred to cuvettes for the Nucleofector (Lonza), taking care not to introduce any air bubbles, and transfection was performed using program Q-001. Subsequently, cells were carefully resuspended in pre-warmed KSFM and cultured as described above (see section 3.5). Cells were harvested after 24, 48 and 72 hours by aspiration of the culture medium, addition of 350 μl of buffer RLT (Qiagen) containing 1% β-mercaptoethanol and detachment of the cells from the culture plates by the use of a cell scraper. Samples were stored at -80°C until further analysis. Expression analysis with real-time PCR assays was performed as described in section 3.4; however in this case the RNeasy Mini Kit (Qiagen) was used for RNA extraction and no RNA amplification was required.

3.8 Proliferation assay

To determine the effects of SOX9 on cell proliferation, siRNA-mediated knockdown of SOX9 was performed as described above (see section 3.7). Following transfection, cells were seeded in a 24- well plate at a density of 3 x 105 cells per well and left to attach for 24 hours. At 48, 72 and 96 hours, medium was aspirated and fresh medium (KSFM) was added containing 10μM

Bromodeoxyuridine (BrdU) from the Cell Proliferation ELISA (Roche). Following incubation for 2 hours, cells were fixed and DNA denatured using FixDenat reagent (all reagents from Cell

Proliferation ELISA, Roche) for 30 minutes. This and the following steps were all performed at room temperature. Anti-BrdU working solution (monoclonal antibody conjugated with peroxidase) was added and left to incubate for 90 seconds. Cells were then rinsed using PBS, and substrate solution

(tetramethyl-benzidine) was added for 10 minutes. After this, the reaction was stopped by adding sulfuric acid. Colorimetric analysis was performed by measuring absorbance at 450 nm using an SLT

Spectra ELISA reader (SLT Labinstruments).

3.9 Western Blot

Total protein was isolated from SOX9-transfected cultured cells using RIPA buffer

(Radioimmunoprecipitation assay buffer; Sigma-Aldrich). Protein concentration was measured using the Micro BCA Protein Assay kit (Thermo Fisher Scientific). Bovine serum albumin served as standard. 15 μg of total protein was separated by SDS-PAGE under reducing conditions using Mini-

PROTEAN TGX Stain-Free Precast Gels (Bio-Rad). It was transferred onto nitrocellulose membranes with a semidry blotting unit (Trans-Blot Turbo, Bio-Rad). Membranes were blocked with SuperBlock

T20 Blocking Buffer (Thermo Fisher Scientific) for 1 hour and incubated overnight using rabbit

antibodies against Sox9 (1:5000; Millipore), CK15 (1:1000; clone EPR1614Y; Abcam) and PCNA

(1:5000; clone PC10; Abcam). Equal loading was verified with anti-β-actin antibodies (1:5000; clone

AC-15; Sigma). In negative control experiments, primary antibody was replaced with PBS.

Immunodetection was performed with horseradish peroxidase-conjugated secondary antibodies

(Biolegend) diluted 1:20.000 and chemiluminescence (SuperSignal West Femto Maximum

Sensitivity Substrate, Thermo Fisher Scientific). For normalisation of protein levels, signal intensity ratios relative to the housekeeping gene β-actin were determined.

3.10 Statistical analysis

For statistical analysis of PCR array results, the proprietary Excel-based analysis tool (version 4.0) reported p-values based on Student’s t-test. Statistical analysis of individual qRT-PCR assay data from LCM samples, wound healing experiments, and cell cultures was performed by Microsoft Excel using Student’s t-test. A p value of <0.05 was considered statistically significant.

4. RESULTS

4.1 Quality control of LCM-isolated and amplified RNA

From each donor eye, roughly 100 cryosections of 12 μm thickness were dissected further using

LCM. Following excision of basal limbal progenitor (Figure 4) and basal corneal epithelial cells, approximately 9 – 28 ng of total RNA with RIN values ≥ 7.0 were isolated and amplified over two rounds to yield approximately 25 - 30 μg of amplified RNA (aRNA). Because by this point the samples had been extensively processed, we performed quality control experiments to ensure that our analysis would yield valid data. Molecular size distribution of successfully amplified aRNA ranged in length from 100 - 4000 nt with a peak around 750 nt (Figure 5). It had been reported that amplification may yield RNA lacking the 5‘ region [109]. We hypothesised that this was dependent on the input quantity. To confirm this, we used three different primer assays specific for the same gene, but located within three different regions along the transcript: Towards the 3’-end, approximately in the middle, and towards the 5’-end of the transcript (Figure 6). For this experiment, the transcripts of LTBP1 (>6000 nt in length) and TGFB3 (>3000 nt in length) were chosen arbitrarily. For each gene, we used the three assays on a sample where large amounts of total RNA (>1 µg) from cultured epithelial cells had been subjected to linear RNA amplification.

Here, according to our primer design strategy, the primer assay that hybridizes within the 5‘-region enabled higher efficiency of the PCR reaction than the primer assay that binds within the 3‘-region.

The primer set that binds in the middle of the transcript yielded intermediate reaction efficiency.

However, when using these three primer sets on a sample where small amounts of total RNA

(approx. 10 ng) from cultured epithelial cells had been subjected to amplification, we found that only the assay that is targeted to the 3‘-region will work, while the other two produce negative

results. This prompted us to use only primer assays targeting the 3’-region for analysis of our LCM samples.

a) Good RNA integrity prior to amplification

b) Amplified RNA is truncated

Figure 5: a) The integrity of RNA isolated from epithelial specimens was deemed acceptable with 40S RNA (middle peak) and 60S RNA (right peak) clearly visible, no presence of degradation products, and a resultant RNA integrity number above 6 for all specimens that entered amplification and analysis. b) Following linear amplification of mRNA, the size distribution of the resulting aRNA has its peak somewhat below the 1000 nucleotide mark. nt: nucleotides; FU: fluorescence units; marker peak at 25 nt used for unit alignment.

Figure 6: Primer assays that bind at different regions along (in this example) the TGFB3 gene (top) were used on amplified RNA from a large amount of starting material (left) and from a small amount of starting material (right). When not more than nanogram amounts of starting material are available, the amplified RNA molecules are successfully detected only with primers binding towards the 3’ end. RFU = relative fluorescence units.

To further verify the quality of LCM-dissected cell populations and the validity of our analytical approach, we analysed the expression profiles of established marker genes for limbal epithelial progenitor cells, i.e., keratin 15 (KRT15 [20]) and CCAAT/enhancer-binding protein delta (CEBPD

[24]) as well as signature genes for corneal epithelial cells, i.e., connexin 43 (CX43 [15]) and keratin

3 (KRT3 [11]), by means of real-time PCR primer assays. LCM-isolated LEPC clusters showed significantly higher expression of limbal markers KRT15 and CEBPD whereas BCECs showed higher expression of CX43 and KRT3 (Figure 7), confirming that our experimental approach is capable of detecting gene expression levels characteristic for each of the cell types aimed at.

KRT15 CEBPD 30 2000 p = 0.04 p = 0.009 1500 20 1000 10

500 Relative mRNA expression mRNA Relative 0 expression mRNA Relative 0 LEPC BCEC LEPC BCEC

CX43 KRT3

0,12 300 p = 0.27 p = 0.16 0,1 250 0,08 200 0,06 150 0,04 100

0,02 50 Relative mRNA expression mRNA Relative Relative mRNA expression mRNA Relative 0 0 LEPC BCEC LEPC BCEC

Figure 7: Epithelial specimens isolated from the limbal area and from the central corneal area using laser capture microdissection were compared with regards to their levels of expression of putative limbal stem cell markers (KRT15, CEBPD) and corneal epithelial differentiation markers (CX43, KRT3) using qRT-PCR assays (n=5; Mean ± SEM). Abbreviations: LEPC, limbal epithelial progenitor cells; BCEC, basal corneal epithelial cell.

4.2 Transcription factor gene expression profiling in basal limbal and corneal epithelium

As a first step to assess differential TF gene expression patterns in LCM-dissected LEPC cluster and

BCEC populations, pre-manufactured RT2 profiler PCR arrays were used to simultaneously monitor the expression of 84 TF genes (for full listing, see Table 1, section 3.4) in five different samples.

Table 5 lists all 29 genes for which expression was detected at a reliable level (i.e. by a cycle threshold of ≤ 35 in both limbal and central corneal samples) and/or differential expression was observed. Genes were considered as differentially expressed when their expression levels exceeded a two-fold difference in all five specimens analysed. This was the case in four genes which were upregulated in LEPC clusters compared to BCECs (DACH1, HOXA11, SOX9, PPARG) and 11 genes that were downregulated (FOXP2, RB1, MSX2, JUN, PCNA, SP1, SIX2, PAX6, FOXP3, SMAD2, FOXP1).

Results were validated by specific qRT-PCR assays using primers designed to bind close to the 3’ end of their target transcript. All genes for which array screening indicated upregulation in LEPC clusters were validated using this technique, given the notion that upregulated genes may endow the cells with distinct properties. Due to limited sample material, only five out of eleven down-regulated genes were exemplarily validated. Results are also shown in Table 5. Validation experiments confirmed that SOX9 was upregulated in LEPC clusters with the highest fold change value of 428, followed by DACH1 (272.5) and HOXA11 (104.7) and PPARG (29.3).

Table 5: Differentially expressed genes in limbal epithelial stem/progenitor cell clusters compared to basal corneal epithelial cells isolated by laser capture microdissection (n=5).

Gene name Gene Fold change symbol (mean ± standard deviation)

RT2 Profiler qRT-PCR PCR array primer assays

Dachshund family transcription factor 1 DACH1 73.2 ± 27.3* 272.5 ± 91.1*

Homeobox A11 HOXA11 66.3 ± 24.5* 104.7 ± 59.4*

Peroxisome proliferator-activated receptor gamma PPARG 35.36 ± 15.6* 29.3 ± 10.3*

Sex determining region Y-box 9 SOX9 29.5 ± 13.4* 428.0 ± 282.4*

Forkhead box P2 FOXP2 -33.6 ± 5.7* -2.6 ± 1.7

Retinoblastoma susceptibility protein RB1 -13.1 ± 6.1* NT

Msh homeobox 2 MSX2 -11.1 ± 5.5* NT

Jun proto-oncogene JUN -8.5 ± 7.6 NT

Proliferating cell nuclear antigen PCNA -7.8 ± 3.5* -2.6 ± 0.2*

Sp1 transcription factor SP1 -6.8 ± 4.1 NT

SIX homeobox 2 SIX2 -5.8 ± 5.5 NT

Paired box 6 PAX6 -5.4 ± 3.3 ND

Forkhead box P3 FOXP3 -4.5 ± 2.7* -44.4 ± 36.5*

SMAD family member 2 SMAD2 -3.6 ± 1.4* NT

Forkhead box P1 FOXP1 -2.6 ± 0.6* NT

Enhancer of zeste homolog 2 EZH2 ND NT

Kruppel-like Factor 2 KLF2 ND NT

Kruppel-like Factor 4 KLF4 ND NT

V-myc avian myelocytomatosis viral oncogene MYC ND NT homolog

Nuclear factor of activated T-cells 1 NFATC1 ND NT

Notch2 NOTCH2 ND NT

Table 5 (continued)

Nuclear receptor subfamily 2 group F member 2 NR2F2 ND NT

POU domain, class 5 homeobox 1 POU5F1 ND NT

Runt related transcription factor 1 RUNX1 ND NT

Sex determining region Y-box 6 SOX6 ND ND

Signal transducer and activator of transcription 1 STAT1 ND NT

Signal transducer and activator of transcription 3 STAT3 ND NT

Werner syndrome RecQ like helicase WRN ND NT

GATA binding protein 6 GATA6 ND NT

Asterisks indicate statistical significance (*p<0.05). Abbreviations: ND, no difference; NT, not tested.

4.3 SOX family gene expression profiling in basal limbal and corneal epithelium

Because our data suggested pronounced differential expression of SOX family member SOX9, further analysis concentrated on the SOX family of TFs. Again, we used specific qRT-PCR assays with primers designed to bind close to the 3’ end of their target transcript to analyse expression of all 20

SOX genes in limbal and corneal basal epithelium isolated by LCM (n=5). Table 6 summarises data from all assays performed. The prototype Sox gene, SRY, showed no differential expression between LEPCs and BCECs. Genes of the SoxB1 group (SOX1, SOX2, SOX3) were not detected by our analysis. Only some genes of the SoxB2 group and the SoxC group were detected: SOX14 and SOX4 were differentially expressed (i.e. expressed more strongly in LEPCs than in BCECs). In the SoxD group, SOX5 and SOX13 were differentially expressed, while SOX6 showed no differential expression. In the SoxE and SoxF groups, all genes were differentially expressed. Here, the strongest differences were observed for SOX9, which was expressed 428 times more strongly in LEPCs than in

BCECs, and for SOX17, which was expressed 448 times more strongly in LEPCs than in BCECs. The

SoxG gene SOX15 was not detected by our assay. The SoxH gene SOX30 however was expressed

284.7 times more strongly in LEPCs than in BCECs. Based on these data, we next selected the SoxE group, the SoxF group and the SoxH group for immunohistochemical analysis, given that all their respective members were upregulated in LEPCs.

Table 6: Differential expression of SOX family genes in limbal epithelial progenitor cell clusters compared to basal corneal epithelial cells isolated by laser capture microdissection (n=5).

Fold change Sox group Gene name Gene symbol (mean ± standard deviation)

SoxA Sex determining region Y SRY ND Sex determining region 1 SOX1 UD SoxB1 Sex determining region 2 SOX2 UD Sex determining region 3 SOX3 UD SoxB2 Sex determining region 14 SOX14 49.0 ± 30.3 * Sex determining region 21 SOX21 UD Sex determining region 4 SOX4 3.1 ± 0.8 * SoxC Sex determining region 11 SOX11 UD Sex determining region 12 SOX12 UD Sex determining region 5 SOX5 15.9 ± 2.1 ** SoxD Sex determining region 6 SOX6 ND Sex determining region 13 SOX13 4.2 ± 1.3 * Sex determining region 8 SOX8 110 ± 51.0 ** SoxE Sex determining region 9 SOX9 428.0 ± 282.4 ** Sex determining region 10 SOX10 219.6 ± 22.6 *** Sex determining region 7 SOX7 7.5 ± 1.6 * SoxF Sex determining region 17 SOX17 448 ± 89.1 ** Sex determining region 18 SOX18 15.7 ± 10.0 * SoxG Sex determining region 15 SOX15 ND SoxH Sex determining region 30 SOX30 284.7 ± 108.6 ** Asterisks indicate statistical significance (*p<0.05; **p˂0.01; ***p˂0.001). Abbreviations: UD, undetected; ND, no difference.

4.4 Localisation of SoxE proteins in situ

All genes of the SoxE group (SOX8, SOX9 and SOX10), of the SoxF group (SOX7, SOX17, SOX18) and of the SoxH group (SOX30) were shown to be significantly upregulated in LEPC clusters by qRT-PCR assays (Table 6). These genes were selected for analysis at protein level by immunolabelling of corneoscleral tissue sections to confirm this differential expression pattern (n=10). In contrast to the mRNA data, immunostaining for the SoxF group and SoxH group showed no convincing preferential staining for these proteins at the limbus. The staining pattern appeared, however, completely different for the SoxE group. Figure 8 demonstrates immunofluorescent staining patterns for the SoxE protein products in limbal epithelial cells and in central corneal epithelial cells together with differences in mRNA expression levels. Predominantly nuclear localization of all SoxE proteins is observed in suprabasal and central corneal epithelial cells, while basal LEPC clusters show mainly cytoplasmic staining. Sox8 antibody predominantly stains suprabasal limbal epithelial cells and corneal epithelial cells throughout all cell layers. Sox9 antibody strongly labels basal and suprabasal cells at the limbus and all cell layers of the corneal epithelium. By contrast, Sox10 is observed only in a small number of cell nuclei in basal limbal epithelium and occasionally in the subepithelial limbal stroma, but not in the central cornea.

Limbal distribution of SoxE proteins is represented in more detail in Figure 9. Whereas Sox8 is mainly immuno-localized to cell nuclei of suprabasal epithelial cells, where it co-localizes with Sox9,

Sox9 is also observed in the cytoplasm of basal epithelial cells before nuclear translocation in suprabasal layers. Co-labelling further suggests that expression of Sox9 and Sox10 does not overlap.

Instead, further characterisation by double labelling experiments demonstrates that Sox10- expressing cells are Melan A-positive melanocytes.

Given the low expression levels (Figure 8a) and the assumed redundancy of Sox8 with Sox9 as well as the possible restriction of Sox10 expression to melanocytes, SOX9 was selected for further analyses since this TF was deemed most promising in terms of potential involvement in LEPC biology. In fact, partial co-localisation was observed between SOX9 and putative LEPC markers

(Bmi1, OCT-4, p63α, N-cadherin and Keratin 15) in basal limbal epithelial cells (Figure 10). Co- localisation of SOX9 with PAX6 and Keratin 3 was only seen in suprabasal epithelial cells. No co- localisation but close association was observed between SOX9-positive cells and cells positive for proliferation-associated marker Ki-67.

Limbus Central cornea b

SOX8

SOX9

SOX10

Figure 8: a) Differential expression of SoxE genes between LEPC and BCEC isolated by LCM. Mean mRNA levels of SOX9 were highest and expression of SOX8 was weakest in limbal epithelial progenitor cell clusters (*p<0.05; **p˂0.01; Mean ± SD; n=5). b) Immunofluorescence microscopy demonstrates nuclear staining for Sox8 and Sox9 in suprabasal limbal epithelial cells and in central corneal epithelial cells, whereas Sox10 is confined to few cells in the basal limbal epithelium. Nuclear counterstaining: DAPI. Magnification: x 100.

a b c

SOX8 SOX9 SOX10 d e f

SOX8 / SOX9 SOX10 / SOX9 Melan-A / SOX10

Figure 9: SOX-8 is found mainly in nuclei of suprabasal cells of the limbal epithelium (a). SOX9 is more abundantly expressed, mainly in the cytoplasm of basal cells and in nuclei of suprabasal cells at the limbus (b). SOX10 is observed in single cell nuclei within the basal limbal epithelium (c). SOX8 shows complete nuclear co-localisation (d), and SOX10 shows no co-localisation with SOX9 (e). SOX10 is mainly expressed in Melan A-positive melanocytes (f). Nuclear counterstaining: DAPI. Magnification: x 250.

a b

Bmi1 OCT4

c d

p63α N-cadherin

e f

Keratin 15 Keratin 3

g h

PAX6 Ki-67

Figure 10: Double-labelling demonstrates co-localisation of SOX9 (red) with putative stem cell markers Bmi1, OCT4, p63α, N-cadherin and Keratin 15 in basal limbal epithelial cells (a-e) and with differentiation marker Keratin 3 (f) and PAX6 (g) in suprabasal cells. SOX9 positive cells are in close association with Ki-67 positive proliferating cells (h). Nuclear staining: DAPI. Magnification: x 250.

4.5 SOX9 expression during corneal epithelial wound healing

Next, the involvement of SoxE group TFs in corneal epithelial wound healing was assessed using a human corneal organ culture wound healing model. Real-time PCR analysis of epithelial cells re- grown on organ cultured corneas following superficial debridement showed mean SOX9-expression

1.5 times higher than in cells from untreated contralateral control corneas (Figure 11a). In addition, expression of SOX10 was also 1.5 times higher following wound healing, while expression of SOX8 was lower. These results were not statistically significant; however, they prompted us to examine the antibody-staining pattern of SOX9 in cryosections of human donor corneas post-wounding.

These show a pattern that is in agreement with the mRNA level data, with increased immunolabeling of SOX9 in activated limbal and re-grown corneal epithelial cells compared to control corneas (Figure 11b). While resting LEPCs showed cytoplasmic staining for SOX9, wounding induced relocation of SOX9 to the nucleus (Figure 11c). These findings suggest that when LEPCs are activated to proliferate and differentiate, this occurs concurrently with a change in sub-cellular localisation of SOX9.

a control wound healing

p = 0.54

2,5

2 p = 0.15

1,5 p = 0.14 1

0,5

relative normalised mRNA expression mRNA normalised relative 0 SOX8 SOX9 SOX10

b control wound healing

Cornea

Limbus

Figure 11 (previous page): a) Real-time PCR analysis demonstrates that, following epithelial wound healing, expression of SOX9 and SOX10 is increased by 1.5-fold relative to control corneas, and expression of SOX8 is diminished (n=3; Mean ± SD). b) Immunofluorescent staining equally suggests increased levels of SOX9-protein (red) in suprabasal limbal epithelial cells and central corneal epithelial cells (representative images of three independent experiments). Magnification: x 100. c) Nuclear retention of SOX9 in LEPCs (left) is abrogated during wound healing, where nuclear localisation of SOX9 is observed also in LEPCs (right). Magnification: x 250. Nuclear staining: DAPI.

4.6 SOX9-expression during differentiation of limbal epithelial cells in culture

Next, a number of functional assays were performed to further delineate the potential role of SOX9 in the maintenance, proliferation and/or differentiation of LEPCs.

First, we aimed to analyse SOX9 expression in LEPC cultivated in proliferation (KSFM) or differentiation media (DMEM), as clones on a growth-arrested 3T3 feeder layer or as monolayers up to two passages (P0-P2). Real-time PCR analysis of primary human cultured limbal epithelial cells showed that clonal growth in the presence of feeder cells induced expression of highest levels of

SOX9 compared to cells grown as monolayers in the absence of feeder cells (Figure 12a). In monolayer cultures, expression levels increased from P0 to P1 and P2 in both proliferation and differentiation media. Immunofluorescent labeling of SOX9 in LEPC clones showed a nuclear staining pattern, with immunopositive cells being located predominantly towards the proliferating periphery of the clones (Figure 12b). These findings indicate upregulation and nuclear translocation of SOX9 under culture conditions that promote proliferation and differentiation of LEPCs.

a b

LEPC 3T3

LEPC

3T3

Figure 12: a) qRT-PCR analysis of SOX9 in LEPCs grown in either DMEM or KSFM with (Cl. = Clones) or without 3T3 feeder cells to different passages (n=3; Mean ± SD; *p<0.01). b) Clonal LEPC cells that stain positive for SOX9 (red, area confined by dashed line) are preferentially located towards the proliferating border of the clone. Nuclear staining: DAPI. Magnification: x 25 / x 100.

4.7 Overexpression of SOX9 in cultured limbal epithelial cells

To delineate the downstream effects and gene regulatory changes induced by SOX9 in LEPC during cell growth, we overexpressed SOX9 in cultured limbal epithelial cells (n=3). Real-time PCR and

Western blot analysis demonstrate successful overexpression of SOX9 (mRNA and protein levels increased) 24 hours following transient transfection of cultured limbal epithelial cells (Figure 13).

However, rapid decay of SOX9 mRNA and protein can be observed, and at 72 hours following transfection, levels have dropped to almost those of endogenous expression. To assess an influence of SOX9 overexpression on cell differentiation and proliferation, real-time PCR analysis was performed at 24, 48, 72 and 96 hours post-transfection for the following list of genes: KRT3, KRT12,

KRT15, CDH2, ABCG2, IVL, PAX6, Ki-67, PCNA, CCND1, p21, p63, p57 (Refer to Table 3 for gene accession numbers, primer sequences and probes used). Despite the fact that SOX9 was successfully overexpressed up to 48 hours, this did not result in any significant changes to the expression of any genes from this list (data not shown).

p = 0.01 700

600

500

400

300

200

Relative normalised mRNA expression mRNA normalised Relative p = 0.03 p = 0.15 p = 0.01 100 p = 0.1

0 - + - + - + - + 24h 48h 72h 96h

- 70 kd

Figure 13: Real-time PCR (top) and Western blot analysis (bottom) of SOX9 mRNA and protein in lysate of cultured limbal epithelial cells transiently transfected with an expression vector containing the cloned SOX9 open reading frame (+) or empty vector (-). At 24 hours following transfection, marked increase of SOX9 mRNA and protein levels is observed. Detection at 48 hours demonstrates rapid decrease of mRNA and protein levels. 72 and 96 hours following transfection, levels have dropped further to almost those of the endogenous gene. Mean ± SEM (mRNA) and representative data (protein) from three independent experiments are shown.

4.8 Knockdown of SOX9 in cultured limbal epithelial cells

It was considered that TF overexpression in a tissue which endogenously expresses this gene at relatively high levels may not lead to gene regulatory changes, particularly in the case of a TF which has been reported to function in interaction with a number of co-factors [103,110]. Hence, it was decided to knockdown the function of SOX9 in cultured limbal epithelial cells by the use of RNA interference (RNAi). At 24 hours following siRNA-mediated knockdown of SOX9 expression in cultured limbal epithelial cells (n=6), SOX9 mRNA levels were reduced by 80-86% compared to mock-transfected cells (Figure 14). Over the subsequent 1-3 days, SOX9 mRNA levels slowly recovered but remained low. The SOX9 expression differences induced by the knockdown were statistically highly significant (p<0.001).

Next, we measured expression levels for a panel of genes that were deemed suitable for indicating an influence of SOX9 silencing on limbal progenitor marker genes (KRT15, CEBPD, ABCG2, p63α,

CDH2), on differentiation-related genes (KRT3, KRT12, IVL, PAX6, MUC1), on genes related to control of proliferation (p21, p57, PCNA, CCND1) or on other genes of the SoxE group (SOX8,

SOX10). Expression of the progenitor cell marker gene KRT15 was significantly downregulated up to

3-fold in cells with reduced expression of SOX9 (Figure 15a). No significant changes were seen in expression of other progenitor cell markers such as CEBPD, ABCG2, p63α or CDH2. We did observe a trend towards upregulation of differentiation markers KRT3 and IVL but found no effect on expression of KRT12, PAX6 or MUC1 (Figure 15b). Also, we observed a trend towards upregulation of cyclin-dependent kinase inhibitors p21 and p57 and a trend towards downregulation of proliferation marker PCNA (Figure 15c). However, no effect was seen on the expression of CCND1.

No effect was observed on expression of SOX10 (not shown). Transcripts for SOX8 were below detection limit in these cultures; therefore no effect of SOX9-knockdown on this related gene could be measured. 63

At protein level, efficient knockdown of SOX9 protein (specific band at 70 kDa) was confirmed by

Western blot analysis compared to scramble siRNA-transfected control cells up to 96 hours post- transfection (Figure 16). In accordance with qRT-PCR results, reduced levels of CK15 protein

(specific band at 45 kDa) were detected in cultured cells following siRNA-mediated knockdown of

SOX9 protein. Western blot analysis of proliferation marker PCNA (specific band at 30 kDa) indicates that this protein was down-regulated in LEPCs following siRNA-mediated knockdown of

SOX9, despite minimal changes (but trend) at mRNA level.

Accordingly, proliferation rates analyzed by BrdU incorporation decreased following knockdown of

SOX9, in comparison to cells transfected with scramble siRNA. These findings became statistically significant after 72 and 96 hours (Figure 17).

p = 0.0002

p = 0.1 1,5 p = 0.00001

p = 0.0001 p = 0.0001 1,0

0,5

normalised normalised relative mRNA expression 0,0 24h 48h 72h 96h Control siRNA

Figure 14: Results of qRT-PCR showing reduction of SOX9 mRNA transcripts in cultured limbal epithelial cells following transfection of siRNA to SOX9 relative to control cells transfected with scramble siRNA (Control) (n=6; Mean ± SD).

Figure 15 (pages 68-70): Results of qRT-PCR to determine changes in gene expression in cultured limbal epithelial cells following transfection of siRNA to SOX9 relative to control cells transfected with scramble siRNA (n=6; Mean ± SD). a) The observed downregulation of progenitor cell marker KRT15 was statistically significant. No significant changes were seen in expression of other progenitor cell marker genes (CEBPD, ABCG2, p63α, and CDH2) b) A trend towards upregulation was observed for KRT3 and IVL, but not for other differentiation-related genes (KRT12, PAX6, MUC1). c) A trend towards upregulation was also observed for proliferation inhibitors p21 and p57, and a trend towards downregulation was observed for proliferation marker PCNA. There was no visible effect on expression levels of CCND1.

1,5 p = 0.1

p = 0.004 p = 0.1 2,0 p = 0.02

p = 0.1 1,0 1,5

1,0 0,5

0,5 normalised normalised relative mRNA expression 0,0 0,0 24h 48h 72h 96h normalised relative mRNA expression 24h 48h 72h 96h Control KRT15 Control CEBPD

2,0

3,0

2,5 1,5 2,0

1,5 1,0

1,0 0,5

0,5 normalised normalised relative mRNA expression

normalised normalised relative mRNA expression 0,0 0,0 24h 48h 72h 96h 24h 48h 72h 96h Control ABCG2 Control p63

1,5

1,0

0,5 normalised normalised relative mRNA expression 0,0 24h 48h 72h 96h Control CDH2

Figure 15 a

8,0

2,0 7,0

6,0 1,5 5,0

4,0 1,0 3,0

2,0 0,5 1,0

normalised normalised relative mRNA expression 0,0 0,0 24h 48h 72h 96h normalised relative mRNA expression 24h 48h 72h 96h Control KRT3 Control KRT12

2,5

4,0 3,5 2,0 3,0 2,5 1,5 2,0 1,0 1,5 1,0 0,5

0,5 normalised normalised relative mRNA expression 0,0 0,0 normalised normalised relative mRNA expression 24h 48h 72h 96h 24h 48h 72h 96h Control IVL Control PAX6

2,5

2,0

1,5

1,0

0,5

0,0 normalised normalised relative mRNA expression 24h 48h 72h 96h Control MUC1

Figure 15b

3,0

2,5 2,5

2,0 2,0

1,5 1,5

1,0 1,0

0,5 0,5 normalised normalised relative mRNA expression normalised normalised relative mRNA expression 0,0 0,0 24h 48h 72h 96h 24h 48h 72h 96h Control p21 Control p57

1,5

1,0 1,0

0,5 0,5 normalised normalised relative mRNA expression 0,0 normalised relative mRNA expression 0,0 24h 48h 72h 96h 24h 48h 72h 96h Control PCNA Control CCND1

Figure 15c

Figure 16: Western blot analysis of LEPCs transfected with either siRNA that targets SOX9 or non- targeting, scrambled siRNA as a control (Ctrl). Protein levels were normalised to the house-keeping gene ß-actin and are expressed as percent of the protein levels in control cells (n=2; Mean ± SD).

Brdu Proliferation Assay 1.0 ** Si-Sox9 Scr-Ctrl 0.8 *

0.6

(OD 450(OD value) CellProliferation 0.4

24 48 72 96 Hours (After Transfection)

Figure 17: BrdU proliferation assay. BrdU incorporation (i.e. cell proliferation) was determined by measuring absorbance at 450 nm. Statistically significant differences were observed at 72 (*p=0.0059) and 96 hours (**p=0.0091) between cells transfected with siRNA that targets SOX9 (Si- Sox9) and control cells transfected with scramble siRNA (Scr-Crtl) (n=3; Mean ± SD).

5. DISCUSSION

5.1 LCM for differential gene expression analysis of corneal surface epithelia

To better understand cellular behaviour in the context of heterogeneous tissues, analysis of isolated cells in culture is not always informative. This is not least because the altered environment impacts on the transcriptional state of cells in vitro. LCM offers the technological means to harvest distinct cell populations directly from their complex tissue microenvironment for downstream analysis using different techniques including mRNA profiling and proteomics [111]. As genes expressed at very low levels (such as TFs) may not be measurable at protein level [101], mRNA transcript profiling was chosen in this study. Kulkarni et al. have proposed a protocol for collecting ocular surface epithelial cell samples from frozen sections of human donor eyes using LCM [112].

Their methods are similar to those used here in that the PALM MicroBeam system was used for

LCM, the Bioanalyzer was used for RNA quality control, and the MessageAmp II aRNA Amplification

Kit was used for RNA amplification. They have successfully used these techniques to perform transcriptional profiling of limbal crypt cells, thereby demonstrating putative stem cell characteristics of cells contained therein [97]. However, in their study LCM was used to isolate the entire thickness of corneal and limbal epithelium. In contrast, the study described herein isolated only basal epithelial cells from cornea and limbus. More specifically, clusters of small cells with a high nuclear/cytoplasm ratio were selected for limbal specimens (Figure 4). Recently, the density of small basal cells at the limbus has been suggested as a clinical parameter to diagnose and grade the severity of LSCD [113]. The authors of this report observed a loss of the smaller basal cell population at the limbus in LSCD, and suggest that larger cells represent more differentiated cells with limited regenerative potential. This lends further support to the currently prevailing notion that small size and high nuclear/cytoplasm ratio are distinguishing features of LEPCs [18,25,26],

which formed the rationale for our approach of using this histomorphological trait to isolate a subgroup of limbal cells enriched in putative progenitors.

To further ensure that the selected cell population conforms to the current concept of LEPCs, we performed expression analysis to detect and quantify mRNA levels of known phenotypic markers of limbal and corneal epithelial cells. Interestingly, we were unable to detect any significant expression of ABCG2 in our limbal specimens. The same finding was reported from a previous study using LCM to isolate limbal crypts [114]. The authors of this publication suggest that their result may either be due to a true lack of expression in the cryosections used, or that this transcript escaped downstream analysis, which was performed using deep RNA sequencing. Our data supports the considerations by Bath and co-authors, who argue that the first alternative is more likely, since we reproduced their result using an entirely different method for downstream analysis.

Relative overexpression of putative limbal stem cell marker genes (KRT15 and CEBPD) was observed in our limbal specimens, and (again similar to the study by Bath et al. [114]) up-regulation of corneal epithelial differentiation markers (CX43 and KER3) was found in corneal specimens (Figure

7). These results build confidence that differences in TF genes encountered may likewise be representative of these respective cell populations. This notion is also supported by results of an older study in mice, in which only basal epithelial cells from limbal and corneal areas were isolated using LCM, and transcriptome analysis was performed using Affymetrix GeneChip microarrays

[115]. This report names 50 genes that were differentially regulated, some of which had previously been reported as being up-regulated in epithelial cell populations from other stem cell-enriched areas such as the hair follicle. This lends further credence to our shared approach of using LCM and

RNA amplification to isolate relatively pure cell populations with a minimum of perturbation in order to obtain gene profiles that reflect closely the natural in vivo state of these cells. A twofold signal difference is considered significant for gene arrays [111], and we have used this threshold to

identify genes differentially expressed between limbal and corneal basal epithelial cells in five independent experiments.

The RIN algorithm has been suggested as the method of choice to assess the quality of RNA isolated from LCM samples [116,117]. Using this tool, we based our PCR analyses on RNA samples with RIN values above 7. Other authors who have used samples obtained from corneal epithelium using LCM report that RIN values above 6 are of sufficient quality for quantitative analyses of mRNA expression [112]. Our Agilent microcapillary electrophoresis data suggest that when using picogram amounts of RNA isolated from laser microdissected samples, the median size of aRNA is around 750 nt (Figure 5). However, the median length of mammalian mRNA was reported to be about 1400 nucleotides [118]. This suggests that, despite good initial RNA integrity, transcripts may have been shortened during amplification. The primary step of the amplification procedure is reverse transcription (see section 3.3), and it has been reported that this may yield cDNA lacking the 5‘ region [108], particularly for mRNAs longer than 2 kb [109] and when using small input quantities.

Hence, we hypothesised that the 5’-information of our original mRNAs was underrepresented in aRNA. This was confirmed by our analysis using primers targeted towards the 5’-end, the middle, and the 3’-end of their respective target gene. Our results further confirm that shortening was dependent on input quantity (Figure 6). Other authors have also reported that the oligo-dT-T7 RNA amplification (in vitro-transcription) method used here does not produce optimal results (in terms of aRNA yield and accuracy of hybridisation arrays) when working with picogram amounts of total

RNA [119]. However, their data does support the use of in vitro-transcription for genes with high evidence for differential expression [108], particularly when using real-time PCR to validate hybridisation array results [119]. In the context of our analysis, these considerations form the rationale behind using real-time PCR assays for validation despite the fact that our TF gene array is also based on real-time PCR technology. However, it also becomes clear that the usefulness of our

array data to rule out expression of individual genes in either specimen is limited. Genes that were not detected by the array may indeed be absent from both limbal and corneal specimens, or the primer pairs used on the array may be positioned towards the 5’-end of this transcript, meaning that they are not suitable for detecting the transcript in amplified RNA samples. For the purpose of screening the transcriptome for the expression of TF genes, it may well be that serial analysis of gene expression (SAGE) would offer some advantages over the techniques used in this study [120].

Notwithstanding, a number of previous works used LCM to obtain ocular surface epithelial specimens for analysis of differential gene expression by gene expression array technology

[97,114,115]. The following section compares results of these and other differential gene expression studies to our expression data.

5.2 Transcription factor expression in limbal and corneal basal epithelium

An earlier study of differential gene expression in corneal and conjunctival epithelium identified cornea-specific expression of DKK3 as an example for a gene that may be of developmental relevance in the cornea [101]. In a similar vein, Figueira et al. reported preferential expression of

KRT15, KRT14, CDH3 and WNT4 in basal limbal epithelial cells; they identified these genes using gene microarrays [21]. However, from these studies no TF genes were reported to be preferentially or exclusively expressed by limbal or corneal epithelium. Another report does suggest expression of numerous TF genes in adult mouse corneas, including SOX7 [120]. However, this study analysed whole thickness corneas, so the anatomical and cellular provenance of the transcripts remains vague. Human genome microarray analysis suggested preferential expression of TCF4 in cultured human corneal epithelial progenitor cells [121], and further analysis revealed involvement of this factor in corneal epithelial cell migration and proliferation [95]. A previous LCM-study of human

limbus suggested preferential expression of TF HES1 in limbal epithelial crypts [97]. We need to acknowledge that our analysis failed to detect TCF4 or HES1 because these genes were not present on the PCR array. The same is true for EHF, which is selectively expressed in corneal epithelium and may be involved in specifying cornea epithelial cell identity [89], and PBX1, which is required for normal corneal epithelial cell differentiation in mice [91]. These studies exemplify once more that our approach is not suitable to rule out the presence or relevance of a particular TF in limbal or corneal epithelium, as was discussed in section 5.1. Also, we are using a “shotgun approach” to identify a large number of potentially relevant TF genes, and then progressively narrow down the analysis on the basis of experimental results but also theoretical considerations and available information from the literature. While it is both sensible and necessary to do so owing to practical and economic reasons, it may well be that we are missing important players with significant gene regulatory impact in limbal and corneal epithelium. The decision which genes to exclude from further analysis was guided by their potential usefulness in therapeutic application. For instance, transplantation of differentiated corneal epithelial cells is not likely to restore a healthy corneal surface effectively in the long term. This is supported by the finding that cultured limbal epithelial cell grafts perform better clinically if they contain a higher number of cells staining positive for p63

[122]. Hence, finding TFs that (a) may help to attain a limbus-like phenotype and/or (b) may help to maintain the stem cell state in these cells was at the focus of our work. This led to our selection of

TF genes that showed marked preferential expression in LEPC clusters compared to BCECs.

In the initial array profiling and subsequent validation experiments (Table 5), marked overexpression of SOX family member SOX9 was detected and confirmed in limbal specimens. This was in agreement with a recent report on LCM specimens from human corneal tissue which proposed a regulatory role of SOX9 in LESCs but did not present any data to formally support this

hypothesis [114]. Thus, the SOX family of TFs was chosen for further analysis; results are discussed in section 5.3.

The second place in preferential expression in LEPC clusters is occupied by DACH1. The Drosophila dac gene forms part of a gene network that induces retinal fates [123]. Its mammalian homologue,

Dach1, has also been suggested to play a role in cell fate determination [124]. Expression of DACH1 was described in human retinal progenitor cells [125]; however, to our knowledge it has not previously been detected in human adult corneal epithelial cells. In human cancer cells, DACH1 was reported to repress expression of SOX2 and KLF4 [126]. If a similar effect was to be confirmed in limbal epithelial cells, this could provide one suitable explanation for our findings that expression of

KLF4 is not markedly increased in putative LEPCs and SOX2 was not detected. Furthermore, it has been reported that DACH1 can repress cellular proliferation through interaction with c-Jun, while also repressing c-Jun expression itself [124]. Transcripts of JUN were downregulated in LEPCs according to our array-analysis; a causal link to DACH1 upregulation and a functional relevance of this finding with respect to LEPC self-renewal is yet to be demonstrated. Thus, further research is warranted to elucidate the potential role of DACH1 in corneal epithelial cell fate determination and regulation of the stem cell state.

Preferential limbal expression was also found for homeobox TF gene HOXA11. HOX genes are known as master regulators during embryonic morphogenesis and in stem cell self-renewal and homeostasis in the adult [127]. Homeobox proteins Hox-8-1 and Hox-7-1 have been linked to patterning of the optic cup during development [92]. To our knowledge, involvement of HOXA11 in ocular or corneal morphogenesis has not been established so far. However, it was shown that TF

Pbx1 is required for normal corneal epithelial cell differentiation in mice [91]. During development,

Pbx1 has been shown to control the spatial expression of Hox genes [128]. This invites to speculate whether HOXA11 expression may under the influence of PBX1 in LEPCs. It has been suggested that 76

further analysis of Hox gene expression and function may allow targeted expansion of selected cellular compartments, either alone or in combination with additional TFs [127].

Array results and qRT-PCR assay data also suggest that Peroxisome proliferator-activated receptor gamma (PPARG) may be a good candidate gene for further analysis because this factor showed robust preferential expression in limbal basal clusters in all specimens tested, with mean values of

35-fold according to array data, and 29-fold according to repeat assay, plus the array result showed highest statistical significance among all genes tested (p=0.09). However, PPARG is a ligand- activated TF of the steroid receptor superfamily [129]. Works on PPARG were therefore transferred into a separate project and results are not reported here (see Meyer E et al., ARVO Annual Meeting,

Denver 2015; Manuscript in preparation).

In summary, the works described herein identify TFs not previously known to be preferentially expressed in human basal limbal epithelial cells. In view of the known characteristics of these TFs and their reported roles in other systems and cell types, they constitute interesting candidate genes for further analysis in the context of LEPC homeostasis and identity. The following section discusses our efforts to examine the expression pattern of other SOX family TFs and explore the potential functional role of SOX9 in LEPCs.

5.3 SOX family transcription factors in limbal epithelial cells

Further analysis concentrated on the SOX family of TFs, because expression data suggested most pronounced differential expression for SOX family member SOX9. Also, family member SOX2 is known to be of high relevance in the context of adult stem cells [99] and reprogramming

[67,72,73,130]. In our epithelial samples however, expression was not detected for SOX2 in limbal or central epithelium by qRT-PCR assays.

The twenty mammalian SOX genes are divided into eight groups according to sequence similarities

(70-95% within each group) [99,102]. Members within a group have overlapping functions due to shared biochemical properties [103]. Our real-time PCR expression data indicates that all members of the SoxE group (comprised of SOX8, SOX9 and SOX10), of the SoxF group (comprised of SOX7,

SOX17 and SOX18) and of the SoxH group (comprised of only SOX30) show preferential expression in limbal basal cells. The SoxF group has roles in endoderm formation, vascular and hair development [102,131] but their expression or functions in stem cells remains largely undefined

[99], with the exception of an involvement in fetal hematopoietic stem cells [132]. Hence, at current the roles of SOX7, SOX17 and SOX18 in LEPCs remain elusive. The same is the case for

SOX30 [99,110]. It may well be that these factors are involved in limbal stem cell regulation, and that the lack of previous reports from other stem cell populations merely reflects our current lack of knowledge. In our hands, immunofluorescent staining using antibodies for SOX7, SOX17, SOX18 and SOX30 did not detect these proteins at the human limbus at significant amounts, with the possible exception of SOX17, which labelled suprabasal nuclei. It was reported that in gut epithelium, SOX17 antagonises the proliferative effect of Wnt signals by increasing degradation of the β-catenin/TCF complex [103]. In human corneal epithelial cells, activation of Wnt [133] and

TCF4 [95] promote proliferation of human corneal epithelial cells. The notion that SOX17 may contribute to maintaining the balance between Wnt-mediated activation and stem cell quiescence warrants further research.

Unlike SoxF and SoxH, a plethora of reports (vide infra) indicate relevance of members of the SoxE group in the context of stem cells. Hence, this group was chosen for further analysis in LEPCs. Our immunofluorescence data confirms preferential limbal localisation of SoxE proteins, as seen also in our aRNA analysis (Figure 8). At the protein level, SOX8 is present in the nuclei of suprabasal limbal cells, SOX9 is abundant in the cytoplasm of basal and nuclei of suprabasal limbal cells, and SOX10 is

detected in the nuclei of individual cells within the basal limbal epithelium (Figure 9). Results from our co-labeling experiments are in agreement with studies in mice that have suggested most Sox8- expressing cells are also positive for Sox9 or Sox10 [134]. Previous studies have suggested functional redundancy within the SoxE group, with loss of Sox8 being compensated for by Sox9 or

Sox10 but not vice-versa [135]. Among other mechanisms, it has been suggested that differences in levels of expression could at least partly explain these differences [136]. Indeed, relative expression levels of SOX8 in limbal cells were much lower than levels of SOX9 and SOX10 (Figure 8a). However,

O’Bryan et al. reported that Sox9 cannot compensate for the role of Sox8 in spermatogenesis, where it regulates interaction between germ cells and adult Sertoli cells [137]. This invites to speculate that SOX8 may play a role in adult limbal stem cell (niche) regulation. On the other hand, we observed that histologically, Sox8-deficient mice show no overt phenotype at the corneal surface at the age of six months (data not shown), supporting the notion of Sox8 redundancy.

Other authors had reported that SOX10 is expressed in human adult limbal epithelium [21,114]; however, microarray data from these studies was not validated in situ and any functional relevance was not investigated. Studies on neural crest stem cells studies have suggested that SOX10 contributes to maintenance of multipotency in these cells [138]. On the other hand, oligodendrocyte precursor cells require Sox10 for terminal differentiation [139]. In a similar vein,

Sox10 participates in melanocyte differentiation during mouse development [140]. Our immunofluorescent staining of limbal sections demonstrates that SOX10 protein is expressed in

Melan-A positive (i.e. differentiated) melanocytes (Figure 9). In postnatal mice, melanocytes maintain and are maintained by expression of high levels of Sox10, while Sox10 activity in melanocyte stem cells is decreased [141]. It is commonly accepted that melanocytes at the limbus serve to shield LEPCs from ultraviolet radiation. However, further involvement of these cells in limbal stem cell biology has not yet been thoroughly investigated. A recent report from Dziasko et

al. suggests human limbal melanocytes may have additional functions in the maintenance of LEPCs

[142]. Ongoing works aim at characterising the niche function of limbal melanocytes.

Given the low expression and the assumed redundancy of SOX8 and possible restriction of SOX10 to limbal melanocytes, SOX9 was selected for further analyses because it has been shown to possess regulatory functions in several epithelial stem cell compartments in mammals, including hair follicles, neural progenitor cells, intestinal progenitor cells, and mammary stem cells [99,143-146].

Preferential expression of SOX9 in human limbal epithelial specimens has been found using microarray hybridisation experiments, but this previous report did not include real-time PCR validation or immunohistochemistry to determine the presence and sub-cellular localisation of

SOX9 protein [147]. Our immunofluorescence microscopy studies demonstrate that basal LEPC clusters show mainly cytoplasmic staining indicative of protein synthesis, while supra-basal and central corneal epithelial cells show nuclear localisation suggestive of TF activity. The cytoplasmic localisation shows partial overlap with that of putative LEPC phenotypic markers, while nuclear localisation shows overlap with differentiation markers CK3 and PAX6 (Figure 10). SOX9-positive cells are also seen in close association with Ki-67-positive proliferating cells. This supports the notion that SOX9 may be of relevance for progenitor cell functions and/or fate in this cell type and it invites to speculate whether SOX9 may be active somewhere in between stem cell maintenance and early differentiation. Therefore, we carried out functional analyses of SOX9 to further characterise its role. Results from these assays are discussed in the following section.

5.4 SOX9 functional analysis in limbal epithelial cells

Upregulation of SOX9 following wound healing (Figure 11) and during clonal cell expansion in vitro

(Figure 12) support the notion that this TF may be functionally involved in regulating adult limbal

and/or corneal epithelial cell proliferation and maintenance of an undifferentiated phenotype.

Similar to our results, increased expression of SOX9 was observed during cell growth in endometrial carcinoma [148]. In addition to pre- and post-transcriptional regulation, the activity of TFs of the

SoxE group, and particularly SOX9, has been shown to depend on their sub-cellular localisation

[149,150]. Two nuclear localisation signals have been identified within the DNA-binding high mobility group (HMG) domain that characterises SOX proteins: One in the N-terminus and one in the C-terminus [149]. A nuclear export signal has also been characterised both in SOX9 and SOX10.

Our observation that nuclear translocation of SOX9 occurs upon activation of LEPCs to proliferate and differentiate suggests that activity of this TF may be involved at least in some parts of the transcriptional programs controlling these processes.

To delineate more clearly gene regulatory changes that could reveal specific roles of SOX9 in limbal epithelial cells, we overexpressed SOX9 in cultured limbal epithelial cells by the use of an expression vector carrying the open reading frame for SOX9. The half-life of SOX9 mRNA was reported to be in the range of 2-7 hours [151] and the half-life of SOX9 protein is also in the range of a few hours [148]. This is in line with the results of our real-time PCR and Western blot analysis, which detected very high SOX9 mRNA and protein levels early after transfection but demonstrates rapid decay. Despite successful overexpression of SOX9 in cultured limbal epithelial cells, we could not detect any consistent downstream effect on regulation of relevant genes. Target genes of SOX9 differ between cells and depend on the specific cellular process it controls and the molecular status of the cell [152]. Our analysis included a panel of genes typically associated with limbal progenitor status (such as ABCG2, p63, KRT15, CDH2), corneal epithelial cell differentiation (such as KRT12 and

KRT3), cell proliferation (such as Ki-67, CCND1, PCNA, p21, p57). We speculate that the failure to induce changes in gene expression by overexpressing SOX9 may be due to un-physiologically high levels of SOX protein, which may interfere with transcriptional activation [103]. Indeed, the effect

of Sox2 on self-renewal and differentiation in mouse embryonic stem cells [153] and retinal progenitor cells [99] was shown to be highly dosage dependent. Seymour et al. demonstrated dosage dependent effects of SOX9 in pancreatic cell fate determination during development [154], and a report from Formeister et al. describes dosage dependent effects of SOX9 on proliferation/proliferative capacity of intestinal progenitor cells [155]. Another possible reason why overexpression of SOX9 would not induce transcriptional changes is because SOX proteins interact with various cofactors to enhance their affinity to DNA and assemble transcriptional complexes

[103,110]. For example, despite the fact that Sox9 was required for anagen induction in outer root sheath cells, introduction of adenovirus expressing Sox9 at the catagen stage was not sufficient to induce transition to anagen [156], suggesting that additional conditions need to be met apart from

SOX9 expression. Yet another possible reason may be that our cells already express SOX9 in culture.

Other authors have argued that only a minor fraction of a TF is involved in gene regulation at a certain time [157]; hence, additional protein may not lead to any additional transcriptional activity.

Finally, post-transcriptional modifications may also play a role, as suggested by the finding that phosphorylation enhances SOX9-activity in fetal chondrocytes [158].

After considering the possible reasons for a lack of response to SOX9 overexpression that were outlined above, we decided to knock down the expression of SOX9 in cultured limbal epithelial cells. Other studies have reported successful knockdown of TF gene expression in limbal epithelium: Stephens et al. also used RNA interference (RNAi) to knock down the expression of TF gene EHF in primary human corneal epithelial cells in vitro and found subsequent down-regulation of epithelium-related genes [89]. Also, Lu et al. used RNAi to knock down the expression of TF TCF4 in primary human corneal epithelial cells in vitro and found subsequent down-regulation of proliferation-associated genes, including p63 [95]. Kitazawa and co-workers knocked down the expression of TF PAX6 in primary human corneal epithelial cells in vitro and detected down-

regulation of cornea-specific genes and up-regulation of genes related to epidermis [159]. These authors also present data suggesting that TF gene knockdown using siRNA may lead to less drastic downstream changes in expression of TF target genes than when using other techniques. This may help to interpret our finding that a number of genes showed only a slight tendency towards up- or down-regulation following SOX9 knockdown. Furthermore, it has been suggested that changes in levels of intracellular proteins can occur following Sox9-knockdown without detectable changes in gene expression, possibly due to post-transcriptional regulation [160]. This may be a possible reason why PCNA protein was downregulated in LEPCs following siRNA-mediated knockdown of

SOX9 (Figure 16), despite no significant changes at RNA level. Our finding that interference with the expression of SOX9 in limbal epithelial cells decreases the expression of PCNA and the rate of cellular proliferation (Figure 17) corresponds well with reports from studies that used RNAi to silence Sox9 in murine adipose-derived stem cells, which also led to decreased proliferation [160].

Furthermore, SOX9-deletion inhibited proliferation in human mammary epithelial cells [161] and in matrix cells of the hair bulge [162]. Importantly, it was recently reported that Wnt signalling can lead to downregulation of SOX9 in cultured human limbal epithelial cells and that this can lead to a reduction of proliferative capacity in these cells [163]. In our analysis, we observed a trend towards upregulation of p21 and p57 following knockdown of SOX9 expression using siRNA. Hence, the observed inhibitory effect of SOX9 knockdown on proliferation may be mediated via an increased expression of these negative regulators of the cell cycle.

The important finding that knockdown of SOX9 in limbal epithelial cells results in a significant down-regulation of limbal marker gene KRT15, together with additional observations such as slight down-regulation of progenitor cell marker CDH2 and upregulation of differentiation markers, supports the concept that SOX9 may preclude terminal differentiation in limbal epithelial cells while promoting proliferation and therefore serves as a marker for TACs. This is backed by the finding

that SOX9 is upregulated during wound healing. It has been suggested that SoxB1 genes (such as

SOX2) control stem cells, while SoxE genes work downstream to control differentiation, which is in line with our results [102]. However, this notion is in contrast with findings from other studies, which found evidence that Sox9 maintains adult murine hair follicle stem cells by returning them to quiescence but is not involved in their activation or differentiation [162,164]. SOX9 also maintains pancreatic progenitor cells during development [165]. In our samples, limbal basal cells show cytoplasmic expression of SOX9 while suprabasal and central corneal epithelial cells show nuclear staining. This suggests TF activity in TACs, thereby supporting the concept that SOX9 is involved in controlling proliferation and differentiation of these cells.

In the developing mouse olfactory bulb, cells require Sox9 to progress to multipotent neural stem cells; cells lacking Sox9 remain in the less mature neuroblast stage [143]. This serves as an example where Sox9 seems to be required for a cell to attain regenerative potential. Evidence that this can potentially be used in the context of cell reprogramming comes from a study reporting that co- expression of Sox9 and Slug in differentiated murine luminal cells of mammary duct produced induced multipotent cells with mammary gland reconstituting potential [144]. Further evidence suggesting that this can potentially be used in the context of cell reprogramming for corneal epithelial regeneration comes from a study reporting that SOX9 is a crucial member of a group of

TFs required for the activation of corneal epithelial cell-specific genes in cultured human fibroblasts

[100]. To move further towards the use of SOX9 in regenerative procedures for corneal epithelium, its binding specificities, protein levels, posttranslational modifications and cofactors require further study to determine how the same TF can regulate progenitor cell maintenance and differentiation depending on the cellular context [99,103].

5.5 Summary

This study identified a number of TFs not previously known to be preferentially expressed in limbal epithelial cells. These factors should undergo further functional analysis. The study also provided some evidence that SOX9, and potentially other SOX TFs, are active in limbal epithelial cells and may regulate their regenerative potential.

Our results suggest that SOX9 promotes proliferation and differentiation in limbal epithelial cells upon nuclear translocation, while supporting the continued expression of signature genes of putative limbal progenitor cells and precluding the expression of differentiation-related genes upon cytoplasmic retention. These identified effects of SOX9 in limbal epithelial cells contrast with those of PAX6, which induces expression of KRT12 [80], while knockdown of PAX6 diminished expression of KRT12 and KRT3 and induced expression of keratins specific for epidermis [79,159]. SOX9 also contrasts with Klf4, which was reported to sustain expression of Krt12 in mice [88], and with

C/EBPδ, which was reported to slow cell cycle progression through p57 [24]. On the other hand,

ΔNp63 was suggested to sustain the proliferative activity of TACs [86,87], and in that respect may have similar functions to SOX9. This underscores the potential functional and clinical relevance of

SOX9, considering that p63 is one of the major predictors of success of a cultured limbal epithelial graft [122]. In a tissue-engineering context, activation of SOX9 in vitro may allow clonal expansion, proliferation and differentiation of LEPC, thereby facilitating the efficient creation of functional epithelial grafts to restore the ocular surface. Vice versa, the inhibition of nuclear translocation and acrivation of SOX9 may allow expansion of LEPC while sustaining their stem cell phenotype without inducing terminal differentiation. Eventually, in combination with other factors, SOX9 may form part of a strategy to achieve (direct) reprogramming of cells from non-ocular sources towards a corneal epithelial phenotype.

5.6 Outlook

The functional mechanisms determining cytoplasmic retention and nuclear shuttling of SOX9, which could be utilized for tissue engineering purposes to control LEPC maintenance, proliferation and differentiation, have to be investigated in future studies. Nucleocytoplasmic shuttling of SOX9 can be modulated experimentally, for instance through inhibition of SOX9 nuclear export by leptomycin

B [149]. This may constitute a viable means to further assess the functional role of SOX9 in LEPCs in future studies. In addition, analysis of co-expression of components of nuclear import and export machinery may help to better understand the regulation of SOX transcription factors in these cells.

Despite functional redundancy reported for SoxE genes, it may be worthwhile to undertake functional analysis also of SOX10. This is not least because of proposed role of melanocytes as a critical niche cell population and reported interaction between SOX10 and components of bone morphogenetic protein (BMP) signalling [138]. Previous LCM works from our lab have unveiled the expression of components of the BMP pathway at the human limbus [166]. The influence of BMP signalling and whether SOX10 may play an antagonistic role, as reported from neural crest stem cells, warrants further investigation. BMP2 also resulted in upregulation of SOX9 in chondrocytes pre- [167] and post-natally [168]. The expression of Sox9 in the developing gastrointestinal tract

(where it specifies pyloric sphincter epithelium and thereby patterns the stomach/duodenum boundary) is under control of BMP4, while Sox9 indirectly modulates the BMP pathway by controlling expression of Gremlin [169]. Therefore, the question whether interplay of BMP signalling and SOX9 act to determine and maintain the distinct patterning of ocular surface epithelia (i.e. corneal vs. limbal vs. conjunctival epithelium) becomes an intriguing question. Even more so, since SOX9 directly represses vascular endothelial growth factor (VEGF) expression in

cartilage tissue [170], while BMP4 can stimulate VEGF synthesis [171], allowing for the notion that

SOX9 may be involved in maintaining corneal avascularity.

In a similar vein, Sonic hedgehog (Shh) induces Sox9 expression in adult murine neural stem cells

[143] and in developing hair germs (stem cell-containing region at the base of the hair bulge)

[162,172]. Previous work from our group indicated that Shh acts on LEPCs by stimulating the cell cycle while maintaining progenitor cell markers (Menzel-Severing et al., manuscript in preparation).

It remains to be determined whether cross-talk occurs between Shh and SOX9 in LEPCs.

Upregulation of SOX9 transcription was also reported for Yes-associated protein 1 (YAP1) [173], which is a downstream effector of the Hippo signalling pathway but has also been suggested to act as a transducer of extracellular mechanical cues, enabling cells to react to different levels of matrix stiffness. Foster et al. have suggested that differences in substrate stiffness across the cornea may act upon epithelial cells by regulating YAP1 [174]. It remains open to speculation (or further analysis) whether regulation of SOX9 may be involved in YAP-mediated effects of the mechanical environment on LEPCs.

Another signalling pathway that has been shown to regulate SOX9 is Notch [175]. This pathway has also been implicated in the regulation of LEPCs [34]. Knowledge regarding a functional link between

Notch signalling and SOX9 in LEPCs is currently lacking and warrants further research.

So far, a corneal epithelial phenotype has been induced in cultured cells using different media formulations [176], putative niche factors [177], small molecules [178], or other environmental cues [64]. It currently remains unclear whether provision of external signals (like IL6 to activate

STAT3 [179]) or direct interaction with TF expression will provide the most viable means of harnessing proliferation and differentiation to direct a cell towards the desired corneal epithelial lineage. Nakamura and colleagues showed that constitutive activation of STAT3 results in a cell fate

switch from transparent corneal epithelium to keratinized skin-like epithelium in mice [180]. This underscores the need to carefully titrate interference with TF levels of activity. Guo et al. showed that transient induction of only two TFs (Slug and Sox9) is sufficient to establish stem-like functional properties in previously differentiated adult murine epithelial cells [144]. However, the additional requirement for activation of epithelial-mesenchymal transition by co-expression of Slug suggests that, rather than one master TF, an autoregulatory TF network is in place. Guo and colleagues speculate that certain signals from the tissue microenvironment may be able to trigger stem cell formation by inducing expression of these factors. We need to keep in mind that eventually, cells are to be transferred to a diseased ocular surface where they may not find the limbal niche conditions that are present under physiological conditions due to destruction of the stem cell niche.

A recent review of current works on transdifferentiation of somatic cell types towards the corneal or limbal epithelial cell lineage also highlights the key role of the cellular microenvironment or niche

[78]. These authors emphasise the requirement for a better understanding of the molecular mechanisms for differentiation into various cell types for these efforts to lead towards clinical success in ocular surface regenerative medicine. This notion is supported by the finding that SOX9 can govern expression of a number of extracellular factors, thereby exerting effects on adjacent stem cells by altering their niche environment [164]. Therefore, cell culture models alone may not always be sensitive enough to reveal all functions of TFs and TF networks in heterogeneous tissues.

Rather, in-vivo models may at times be more informative to fully reveal functions and interactions of SOX family members in putative limbal stem cells. SOX9-heterozytous mice display perinatal lethality [181], which precludes them from analysis of ocular surface epithelia in the adult. It may be for this reason that the contribution of SOX9 activity to adult tissue homeostasis is still relatively unexplored [164]. Conditional knock-out mice have been created to study Klf4 functions in corneal epithelial homeostasis [88]. Conditional deletion of Sox9 has also been achieved; this was recently

reported in the context of mammary gland development [161] and adult hair follicle stem cells

[164]. In a similar vein, a Sox9(EGFP) mouse model has aided in the identification of CD24 as a surface marker for small intestine epithelial stem cells [182]. Such genetically engineered models may constitute helpful tools also for in-vivo studies of SOX9 functions at the ocular surface throughout development and in the adult stage.

Kitazawa et al. have recently shown that PAX6 and OVOL2 can cooperatively induce transcriptional changes that establish a corneal epithelial lineage in human fibroblasts, aided by a pool of TFs including SOX9 [100]. When SOX9 was removed from this pool, some of these effects on expression of genes specific for corneal epithelial cells were abolished. Their study also indicated differences with respect to the transcriptional program and the TF requirements for maintaining an epithelial cell lineage between surface ectoderm and neuroectodermal cells. This may mean that the concept of one master TF to induce one specific cell fate needs to be revisited. Instead, an “inner circle” of

TFs is likely required to achieve lineage transition. Which factors and how many of these factors are required likely depends on the transcriptional program that is endogenously active in the cells at the outset [66]. The results from Kitazawa et al. [100], together with findings reported here, lend further credence to the notion that SOX9 may play a role as part of a protocol that induces TF expression in non-ocular cells for use in regenerative therapies for ocular surface reconstruction.

However, additional work is required to establish the number of co-factors and the timing of expression in a given non-ocular cell type.

6. ACKNOWLEDGEMENTS

I thank Dr Elisabeth Sock (Department of Biochemistry, University of Erlangen-Nuremberg) for kindly donating SOX9 antibody and Sox8-/- mice. I gratefully acknowledge the contributions of Dr

Matthias Zenkel, who provided valuable guidance and advice regarding molecular biology methods, and Dr Naresh Polisetti who performed important cell culture works and analyses. I also thank

Angelika Mößner, Elke Meyer, Ekaterina Gedova and Jasmine Onderka for expert technical advice and assistance. I am particularly grateful to Professor Friedrich E. Kruse for generously providing lab space, lab time and materials. Most importantly, I thank Professor Ursula Schlötzer-Schrehardt for allowing me to participate in this research project, for her mentorship, for fruitful discussions and for her indispensable guidance throughout this work.

7. REFERENCES

1. Daniels. Limbal epithelial stem cells of the cornea. StemBook. Harvard Stem Cell Institute; 2009.

2. Reinstein DZ, Archer TJ, Gobbe M. Epithelial thickness in the normal cornea: three- dimensional display with very high frequency ultrasound. Journal of refractive Surgery. 2008; 24:571.

3. Freshney RI, Freshney MG. Culture of Epithelial Cells. Wiley & Sons; 2002.

4. Forrester J, Dick A, McMenamin P, Roberts F. The eye - basic sciences in practice. Third Edition. Saunders; 2008.

5. Davanger M, Evensen A. Role of the pericorneal papillary structure in renewal of corneal epithelium. Nature. 1971;229: 560–561.

6. Dua HS, Forrester JV. The corneoscleral limbus in human corneal epithelial wound healing. Am J Ophthalmol. 1990;110: 646–656.

7. Auran JD, Koester CJ, Kleiman NJ, Rapaport R, Bomann JS, Wirotsko BM, et al. Scanning slit confocal microscopic observation of cell morphology and movement within the normal human anterior cornea. Ophthalmology. 1995;102:33-41.

8. Dua HS, Shanmuganathan VA, Powell-Richards AO, Tighe PJ, Joseph A. Limbal epithelial crypts: a novel anatomical structure and a putative limbal stem cell niche. British Journal of Ophthalmology. 2005;89: 529–532.

9. Pellegrini G, Golisano O, Paterna P, Lambiase A, Bonini S, Rama P, et al. Location and clonal analysis of stem cells and their differentiated progeny in the human ocular surface. J Cell Biol. 1999;145: 769–782.

10. Cotsarelis G, Cheng SZ, Dong G, Sun TT, Lavker RM. Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: implications on epithelial stem cells. Cell. 1989;57: 201–9.

11. Schermer A, Galvin S, Sun TT. Differentiation-related expression of a major 64K corneal keratin in vivo and in culture suggests limbal location of corneal epithelial stem cells. J Cell Biol. 1986;103: 49–62.

12. Chee KYH, Kicic A, Wiffen SJ. Limbal stem cells: the search for a marker. Clin Experiment Ophthalmol. 2006;34: 64–73.

13. Dua HS, Joseph A, Shanmuganathan VA, Jones RE. Stem cell differentiation and the effects of deficiency. Eye (Lond). 2003;17: 877–885.

14. Chen Z, De Paiva CS, Luo L, Kretzer FL, Pflugfelder SC, Li D-Q. Characterization of putative stem cell phenotype in human limbal epithelia. Stem Cells. 2004;22: 355–366.

15. Matic M, Petrov IN, Chen S, Wang C, Dimitrijevich SD, Wolosin JM. Stem cells of the corneal epithelium lack connexins and metabolite transfer capacity. Differentiation. 1997;61: 251– 260.

16. Ding X-W, Wu J-H, Jiang C-P. ABCG2: a potential marker of stem cells and novel target in stem cell and cancer therapy. Life Sci. 2010;86: 631–637.

17. Schlötzer-Schrehardt U, Kruse FE. Identification and characterization of limbal stem cells. Exp Eye Res. 2005;81: 247–264.

18. Arpitha P, Prajna NV, Srinivasan M, Muthukkaruppan V. A subset of human limbal epithelial cells with greater nucleus-to-cytoplasm ratio expressing high levels of p63 possesses slow- cycling property. Cornea. 2008;27: 1164–1170.

19. Di Iorio E, Barbaro V, Ruzza A, Ponzin D, Pellegrini G, De Luca M. Isoforms of DeltaNp63 and the migration of ocular limbal cells in human corneal regeneration. Proc Natl Acad Sci USA. 2005;102: 9523–9528.

20. Yoshida S, Shimmura S, Kawakita T, Miyashita H, Den S, Shimazaki J, et al. Cytokeratin 15 can be used to identify the limbal phenotype in normal and diseased ocular surfaces. Invest Ophthalmol Vis Sci. 2006;47: 4780–4786.

21. Figueira EC, Di Girolamo N, Coroneo MT, Wakefield D. The phenotype of limbal epithelial stem cells. Invest Ophthalmol Vis Sci. 2007;48: 144–56.

22. Lyngholm M, Vorum H, Nielsen K, Østergaard M, Honoré B, Ehlers N. Differences in the protein expression in limbal versus central human corneal epithelium--a search for stem cell markers. Exp Eye Res. 2008;87: 96–105.

23. Higa K, Shimmura S, Miyashita H, Kato N, Ogawa Y, Kawakita T, et al. N-cadherin in the maintenance of human corneal limbal epithelial progenitor cells in vitro. Invest Ophthalmol Vis Sci. 2009;50: 4640–5.

24. Barbaro V, Testa A, Di Iorio E, Mavilio F, Pellegrini G, De Luca M. C/EBPdelta regulates cell cycle and self-renewal of human limbal stem cells. J Cell Biol. 2007;177: 1037–1049.

25. Barrandon Y, Green H. Three clonal types of keratinocyte with different capacities for multiplication. Proc Natl Acad Sci USA. 1987;84: 2302–6.

26. Romano AC, Espana EM, Yoo SH, Budak MT, Wolosin JM, Tseng SCG. Different cell sizes in human limbal and central corneal basal epithelia measured by confocal microscopy and flow cytometry. Invest Ophthalmol Vis Sci. 2003;44: 5125–5129.

27. Goldberg MF, Bron AJ. Limbal palisades of Vogt. Trans Am Ophthalmol Soc. 1982; 80: 155– 171.

28. Kobayashi A, Sugiyama K. In Vivo Corneal Confocal Microscopic Findings of Palisades of Vogt and Its Underlying Limbal Stroma. Cornea. 2005;24:435.

29. Shortt AJ, Secker GA, Munro PM, Khaw PT, Tuft SJ, Daniels JT. Characterization of the limbal epithelial stem cell niche: novel imaging techniques permit in vivo observation and 92

targeted biopsy of limbal epithelial stem cells. Stem Cells. 2007;25:1402-9.

30. Schlötzer-Schrehardt U, Dietrich T, Saito K, Sorokin L, Sasaki T, Paulsson M, et al. Characterization of extracellular matrix components in the limbal epithelial stem cell compartment. Exp Eye Res. 2007;85: 845–860.

31. Ljubimov AV, Burgeson RE, Butkowski RJ, Michael AF, Sun TT, Kenney MC. Human corneal basement membrane heterogeneity: topographical differences in the expression of type IV collagen and laminin isoforms. Lab Invest. 1995;72:461–73.

32. Shimmura S, Miyashita H, Higa K, Yoshida S, Shimazaki J, Tsubota K. Proteomic analysis of soluble factors secreted by limbal fibroblasts. Mol Vis. 2006;12: 478–484.

33. Schofield R. The relationship between the spleen colony-forming cell and the haemopoietic stem cell. Blood Cells. 1978;4:7–25.

34. Secker GA, Daniels JT. Corneal Epithelial Stem Cells: Deficiency and Regulation. Stem Cell Rev. 2008;4:159–68.

35. Liang L, Sheha H, Li J, Tseng SCG. Limbal stem cell transplantation: new progresses and challenges. Eye. Nature Publishing Group; 2008;23:1946–53.

36. Puangsricharern V, Tseng S. Cytologlogic Evidence of Corneal Diseases with Limbal Stem Cell Deficiency. Ophthalmology. 1995;102:1476–85.

37. Tseng SCG. Amniotic Membrane Transplantation With or Without Limbal Allografts for Corneal Surface Reconstruction in Patients With Limbal Stem Cell Deficiency. Arch Ophthalmol. American Medical Association; 1998;116:431–41.

38. Kenyon KR, Tseng SC. Limbal autograft transplantation for ocular surface disorders. Ophthalmology. 1989;96:709–22.

39. Pellegrini G, Traverso CE, Franzi AT, Zingirian M, Cancedda R, De Luca M. Long-term restoration of damaged corneal surfaces with autologous cultivated corneal epithelium. Lancet. 1997;349: 990–993.

40. Notara M, Alatza A, Gilfillan J, Harris AR, Levis HJ, Schrader S, et al. In sickness and in health: Corneal epithelial stem cell biology, pathology and therapy. 2010;90: 188–195.

41. Shortt AJ, Tuft SJ, Daniels JT. Ex vivo cultured limbal epithelial transplantation. A clinical perspective. Ocul Surf. 2010;8: 80–90.

42. James SE, Rowe A, Ilari L, Daya S, Martin R. The potential for eye bank limbal rings to generate cultured corneal epithelial allografts. Cornea. 2001;20: 488–494.

43. Shortt AJ, Secker GA, Notara MD, Limb GA, Khaw PT, Tuft SJ, et al. Transplantation of Ex Vivo Cultured Limbal Epithelial Stem Cells: A Review of Techniques and Clinical Results. Surv Ophthalmol. 2007;52: 483–502.

44. Daya SM, Watson A, Sharpe JR, Giledi O, Rowe A, Martin R, et al. Outcomes and DNA analysis of ex vivo expanded stem cell allograft for ocular surface reconstruction. 93

Ophthalmology. 2005;112: 470–477.

45. Ma Y, Xu Y, Xiao Z, Yang W, Zhang C, Song E, et al. Reconstruction of chemically burned rat corneal surface by bone marrow-derived human mesenchymal stem cells. Stem Cells. 2006;24: 315–321.

46. Nakamura T. Characterization and Distribution of Bone Marrow-Derived Cells in Mouse Cornea. Invest Ophthalmol Vis Sci. 2005;46: 497–503.

47. Nakamura T. The Successful Culture and Autologous Transplantation of Rabbit Oral Mucosal Epithelial Cells on Amniotic Membrane. Invest Ophthalmol Vis Sci. 2002;44: 106– 116.

48. Nakamura T, Takeda K, Inatomi T, Sotozono C, Kinoshita S. Long-term results of autologous cultivated oral mucosal epithelial transplantation in the scar phase of severe ocular surface disorders. British Journal of Ophthalmology. 2011;95: 942–946.

49. Chen H-CJ, Yeh L-K, Tsai Y-J, Lai C-H, Chen C-C, Lai J-Y, et al. Expression of angiogenesis- related factors in human corneas after cultivated oral mucosal epithelial transplantation. Invest Ophthalmol Vis Sci. 2012;53: 5615–5623.

50. Ortega-Zilic N, Hunziker T, Läuchli S, Mayer DO, Huber C, Baumann Conzett K, et al. EpiDex® Swiss Field Trial 2004–2008. Dermatology. 2010;221:365–72.

51. Wolosin JM, Budak MT, Akinci MAM. Ocular surface epithelial and stem cell development. Int J Dev Biol. 2004;48: 981–991.

52. Blazejewska EA, Schlötzer-Schrehardt U, Zenkel M, Bachmann B, Chankiewitz E, Jacobi C, et al. Corneal limbal microenvironment can induce transdifferentiation of hair follicle stem cells into corneal epithelial-like cells. Stem Cells. 2009;27: 642–652.

53. Ho JH-C, Ma W-H, Tseng T-C, Chen Y-F, Chen M-H, Lee OK-S. Isolation and characterization of multi-potent stem cells from human orbital fat tissues. Tissue Eng Part A. 2011;17: 255– 66.

54. Nieto-Miguel T, Galindo S, Reinoso R, Corell A, Martino M, Pérez-Simón JA, et al. In Vitro Simulation of Corneal Epithelium Microenvironment Induces a Corneal Epithelial-like Cell Phenotype from Human Adipose Tissue Mesenchymal Stem Cells. Curr Eye Res. 2013.

55. Koppula PR, Polisetti N, Vemuganti GK. Unstimulated diagnostic marrow tap--a minimally invasive and reliable source for mesenchymal stem cells. Cell Biol Int. 2010;34: 275–281.

56. Kotton DN, Ma BY, Cardoso WV, Sanderson EA, Summer RS, Williams MC, et al. Bone marrow-derived cells as progenitors of lung alveolar epithelium. Development. 2001;128: 5181–5188.

57. Wang T, Xu Z, Jiang W, Ma A. Cell-to-cell contact induces mesenchymal stem cell to differentiate into cardiomyocyte and smooth muscle cell. Int J Cardiol. 2006;109: 74–81.

58. Gu S, Xing C, Han J, Tso MOM, Hong J. Differentiation of rabbit bone marrow mesenchymal stem cells into corneal epithelial cells in vivo and ex vivo. Mol Vis. 2009;15: 99–107. 94

59. Jiang T-S, Cai L, Ji W-Y, Hui Y-N, Wang Y-S, Hu D, et al. Reconstruction of the corneal epithelium with induced marrow mesenchymal stem cells in rats. Mol Vis. 2010;16: 1304– 1316.

60. Katikireddy KR, Dana R, Jurkunas UV. Differentiation potential of limbal fibroblasts and bone marrow mesenchymal stem cells to corneal epithelial cells. Stem Cells. 2014;32: 717– 729.

61. Yao L, Li Z-R, Su W-R, Li Y-P, Lin M-L, Zhang W-X, et al. Role of mesenchymal stem cells on cornea wound healing induced by acute alkali burn. PLoS ONE. 2012;7: e30842.

62. Liu H, Zhang J, Liu C-Y, Wang I-J, Sieber M, Chang J, et al. Cell therapy of congenital corneal diseases with umbilical mesenchymal stem cells: lumican null mice. PLoS ONE. 2010;5: e10707.

63. Zajicova A, Pokorna K, Lencova A, Krulova M, Svobodova E, Kubinova S, et al. Treatment of ocular surface injuries by limbal and mesenchymal stem cells growing on nanofiber scaffolds. Cell Transplant. 2010;19: 1281–1290.

64. Hayashi R, Ishikawa Y, Ito M, Kageyama T, Takashiba K, Fujioka T, et al. Generation of corneal epithelial cells from induced pluripotent stem cells derived from human dermal fibroblast and corneal limbal epithelium. PLoS ONE. 2012;7: e45435.

65. Jopling C, Boue S, Belmonte JCI. Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol. Nature Publishing Group; 2011;12: 79– 89.

66. Masip M, Veiga A, Izpisua Belmonte JC, Simon C. Reprogramming with defined factors: from induced pluripotency to induced transdifferentiation. Molecular Human Reproduction. 2010;16: 856–868.

67. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126: 663–676.

68. Brockes JP, Kumar A. Plasticity and reprogramming of differentiated cells in amphibian regeneration. Nat Rev Mol Cell Biol. 2002;3: 566–574.

69. Yamada T, McDevitt DS. Direct evidence for transformation of differentiated iris epithelial cells into lens cells. Dev Biol. 1974;38:104–18.

70. Perry KJ, Thomas AG, Henry JJ. Developmental Biology. Dev Biol. 2013;374: 281–294.

71. Latchman DS. Transcription factors: an overview. Int J Biochem Cell Biol. 1997;29: 1305– 1312.

72. Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T, et al. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nature Biotechnology. 2007;26: 101–106.

73. Giorgetti A, Montserrat N, Aasen T, Gonzalez F, Rodríguez-Pizà I, Vassena R, et al. Generation of induced pluripotent stem cells from human cord blood using OCT4 and SOX2. 95

Cell Stem Cell. 2009;5: 353–357.

74. Kim JB, Greber B, Araúzo-Bravo MJ, Meyer J, Park KI, Zaehres H, et al. Direct reprogramming of human neural stem cells by OCT4. Nature. 2009;461: 649–643.

75. Jaenisch R, Young R. Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell. 2008;132: 567–582.

76. Yamamizu K, Piao Y, Sharov AA, Zsiros V, Yu H, Nakazawa K, et al. Stem Cell Reports. STEMCR. Elsevier; 2013;1: 545–559.

77. Barzilay R, Melamed E, Offen D. Introducing Transcription Factors to Multipotent Mesenchymal Stem Cells: Making Transdifferentiation Possible. Stem Cells. 2009;27: 2509– 2515.

78. Casaroli-Marano R, Nieto-Nicolau N, Martínez-Conesa E, Edel M, B Álvarez-Palomo A. Potential Role of Induced Pluripotent Stem Cells (IPSCs) for Cell-Based Therapy of the Ocular Surface. JCM. 2015;4: 318–342.

79. Li G, Xu F, Zhu J, Krawczyk M, Zhang Y, Yuan J, et al. Transcription factor Paired Box 6 controls limbal stem cell lineage in development and disease. Journal of Biological Chemistry. 2015.

80. Li W, Chen YT, Hayashida Y, Blanco G, Kheirkah A, He H, et al. Down-regulation ofPax6 is associated with abnormal differentiation of corneal epithelial cells in severe ocular surface diseases. J Pathol. 2007;214: 114–122.

81. Collinson JM. Corneal Development, Limbal Stem Cell Function, and Corneal Epithelial Cell Migration in the Pax6+/- Mouse. Invest Ophthalmol Vis Sci. 2004;45:1101–8.

82. Collinson JM. Corneal Development, Limbal Stem Cell Function, and Corneal Epithelial Cell Migration in the Pax6+/- Mouse. Invest Ophthalmol Vis Sci. 2004;45: 1101–1108.

83. Ramaesh K, Ramaesh T, Dutton GN, Dhillon B. Evolving concepts on the pathogenic mechanisms of aniridia related keratopathy. Int J Biochem Cell Biol. 2005;37: 547–57.

84. Ouyang H, Xue Y, Lin Y, Zhang X, Xi L, Patel S, et al. WNT7A and PAX6 define corneal epithelium homeostasis and pathogenesis. Nature. 2014;511: 358–361.

85. Koster MI, Roop DR. p63 and epithelial appendage development. Differentiation. 2004;72: 364–70.

86. Wang D-Y, Cheng C-C, Kao M-H, Hsueh Y-J, Ma DHK, Chen J-K. Regulation of Limbal Keratinocyte Proliferation and Differentiation by TAp63 and ΔNp63 Transcription Factors. Invest Ophthalmol Vis Sci. 2005;46: 3102.

87. Cheng C-C, Wang D-Y, Kao M-H, Chen J-K. The growth-promoting effect of KGF on limbal epithelial cells is mediated by upregulation of DeltaNp63alpha through the p38 pathway. J Cell Sci. 2009;122: 4473–80.

88. Swamynathan SK, Katz JP, Kaestner KH, Ashery-Padan R, Crawford MA, Piatigorsky J. 96

Conditional Deletion of the Mouse Klf4 Gene Results in Corneal Epithelial Fragility, Stromal Edema, and Loss of Conjunctival Goblet Cells. Mol Cell Biol. 2006;27: 182–194.

89. Stephens DN, Klein RH, Salmans ML, Gordon W, Ho H, Andersen B. The Ets Transcription Factor EHF as a Regulator of Cornea Epithelial Cell Identity. Journal of Biological Chemistry. 2013;288: 34304–34324.

90. West-Mays JA, Sivak JM, Papagiotas SS, Kim J, Nottoli T, Williams T, et al. Positive influence of AP-2alpha transcription factor on cadherin gene expression and differentiation of the ocular surface. Differentiation. 2003;71: 206–216.

91. Murphy MJ, Polok BK, Schorderet DF, Cleary ML. Essential Role for Pbx1 in Corneal Morphogenesis. Invest Ophthalmol Vis Sci. 2010;51: 795.

92. Monaghan AP, Davidson DR, Sime C, Graham E, Baldock R, Bhattacharya SS, et al. The Msh- like homeobox genes define domains in the developing vertebrate eye. Development. 1991;112: 1053–1061.

93. Nakatsu MN, Vartanyan L, Vu DM, Ng MY, Li X, Deng SX. Preferential biological processes in the human limbus by differential gene profiling. PLoS ONE. 2013;8: e61833.

94. Mukhopadhyay M, Gorivodsky M, Shtrom S, Grinberg A, Niehrs C, Morasso MI, et al. Dkk2 plays an essential role in the corneal fate of the ocular surface epithelium. Development. 2006;133: 2149–2154.

95. Lu R, Qu Y, Ge J, Zhang L, Su Z, Pflugfelder SC, et al. Transcription factor TCF4 maintains the properties of human corneal epithelial stem cells. Stem Cells. 2012;30: 753–761.

96. Nakamura T, Ohtsuka T, Sekiyama E, Cooper LJ, Kokubu H, Fullwood NJ, et al. Hes1 Regulates Corneal Development and the Function of Corneal Epithelial Stem/Progenitor Cells. Stem Cells. 2008;26: 1265–1274.

97. Kulkarni BB, Tighe PJ, Mohammed I, Yeung AM, Powe DG, Hopkinson A, et al. Comparative transcriptional profiling of the limbal epithelial crypt demonstrates its putative stem cell niche characteristics. BMC Genomics. 2010;11: 526.

98. Menzel-Severing J, Kruse FE, Schlötzer-Schrehardt U. Stem cell-based therapy for corneal epithelial reconstruction: present and future. Canadian journal of ophthalmology Journal canadien d'ophtalmologie. 2013;48: 13–21.

99. Sarkar A, Hochedlinger K. The sox family of transcription factors: versatile regulators of stem and progenitor cell fate. Cell Stem Cell. 2013;12: 15–30.

100. Kitazawa K, Hikichi T, Nakamura T, Mitsunaga K, Tanaka A, Nakamura M, et al. OVOL2 Maintains the Transcriptional Program of Human Corneal Epithelium by Suppressing Epithelial-to-Mesenchymal Transition. CellReports. 2016; 1–11.

101. Turner HC, Budak MT, Akinci MAM, Wolosin JM. Comparative Analysis of Human Conjunctival and Corneal Epithelial Gene Expression with Oligonucleotide Microarrays. Invest Ophthalmol Vis Sci. 2007;48: 2050.

102. Lefebvre V, Dumitriu B, Penzo-Méndez A, Han Y, Pallavi B. Control of cell fate and differentiation by Sry-related high-mobility-group box (Sox) transcription factors. Int J Biochem Cell Biol. 2007;39: 2195–214.

103. Wegner M. All purpose Sox: The many roles of Sox proteins in gene expression. Int J Biochem Cell Biol. 2010;42: 381–90.

104. Richtlinie zur Gewinnung von Spenderhornhäuten und zum Führen einer Augenhornhautbank. Deutsches Ärzteblatt. 2014 Aug 4:1–18.

105. Cummings M, McGinley CV, Wilkinson N, Field SL, Duffy SR, Orsi NM. A robust RNA integrity-preserving staining protocol for laser capture microdissection of endometrial cancer tissue. Analytical Biochemistry. 2011;416: 123–125.

106. Schroeder A, Mueller O, Stocker S, Salowsky R, Leiber M, Gassmann M, et al. The RIN: an RNA integrity number for assigning integrity values to RNA measurements. BMC Mol Biol. 2006;7: 3.

107. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25: 402–408.

108. Wilhelm J. Systematic Comparison of the T7-IVT and SMART-Based RNA Preamplification Techniques for DNA Microarray Experiments. Clinical Chemistry. 2006;52: 1161–1167.

109. Zhu YY, Machleder EM, Chenchik A, Li R, Siebert PD. Reverse transcriptase template switching: a SMART approach for full-length cDNA library construction. BioTechniques. 2001;30: 892–7.

110. Kamachi Y, Kondoh H. Sox proteins: regulators of cell fate specification and differentiation. Development. 2013;140: 4129–4144.

111. Espina V, Wulfkuhle JD, Calvert VS, VanMeter A, Zhou W, Coukos G, et al. Laser-capture microdissection. Nature Protocols. 2006;1: 586–603.

112. Kulkarni BB, Powe DG, Hopkinson A, Dua HS. Optimised laser microdissection of the human ocular surface epithelial regions for microarray studies. BMC Ophthalmol. 2013;13: 62.

113. Chan EH, Chen L, Rao JY, Yu F, Deng SX. Accepted Manuscript. Am J Ophthalmol. Elsevier Ltd; 2015;: 1–25.

114. Bath C, Muttuvelu D, Emmersen J, Vorum H, Hjortdal J, Zachar V. Transcriptional dissection of human limbal niche compartments by massive parallel sequencing. PLoS ONE. 2013;8: e64244.

115. Zhou M, Li X-M, Lavker RM. Transcriptional profiling of enriched populations of stem cells versus transient amplifying cells. A comparison of limbal and corneal epithelial basal cells. J Biol Chem. 2006;281: 19600–9.

116. Kerman IA, Buck BJ, Evans SJ, Akil H, Watson SJ. Combining laser capture microdissection with quantitative real-time PCR: Effects of tissue manipulation on RNA quality and gene expression. Journal of Neuroscience Methods. 2006;153: 71–85. 98

117. Espina V, Wulfkuhle JD, Calvert VS, VanMeter A, Zhou W, Coukos G, et al. Laser-capture microdissection. Nature Protocols. 2006;1:586–603.

118. Sommer SS, Cohen JE. The size distributions of proteins, mRNA, and nuclear RNA. J Mol Evol. 1980;15: 37–57.

119. Ezhilan, Lang JE, Magbanua M, Scott JH, Makrigiorgos GM, Wang G, et al. A comparison of RNA amplification techniques at sub-nanogram input concentration. BMC Genomics. 2009;10: 326.

120. Norman B, Davis J, Piatigorsky J. Postnatal gene expression in the normal mouse cornea by SAGE. Invest Ophthalmol Vis Sci. 2004;45: 429–440.

121. Bian F, Liu W, Yoon K-C, Lu R, Zhou N, Ma P, et al. Molecular signatures and biological pathway profiles of human corneal epithelial progenitor cells. Int J Biochem Cell Biol. 2010;42: 1142–1153.

122. Rama P, Matuska S, Paganoni G, Spinelli A, De Luca M, Pellegrini G. Limbal stem-cell therapy and long-term corneal regeneration. N Engl J Med. 2010;363: 147–155.

123. Silver SJ, Rebay I. Signaling circuitries in development: insights from the retinal determination gene network. Development. 2005;132: 3–13.

124. Wu K, Liu M, Li A, Donninger H, Rao M, Jiao X, et al. Cell fate determination factor DACH1 inhibits c-Jun-induced contact-independent growth. Mol Biol Cell. 2007;18: 755–767.

125. Klassen H, Ziaeian B, Kirov II, Young MJ, Schwartz PH. Isolation of retinal progenitor cells from post-mortem human tissue and comparison with autologous brain progenitors. J Neurosci Res. 2004;77: 334–343.

126. Wu K, Jiao X, Li Z, Katiyar S, Casimiro MC, Yang W, et al. Cell fate determination factor Dachshund reprograms breast cancer stem cell function. Journal of Biological Chemistry. 2011;286: 2132–2142.

127. Kamkar F, Xaymardan M, Asli NS. Hox-Mediated Spatial and Temporal Coding of Stem Cells in Homeostasis and Neoplasia. Stem Cells Dev. 2016;25: 1282–1289.

128. Capellini TD. Pbx1/Pbx2 requirement for distal limb patterning is mediated by the hierarchical control of Hox gene spatial distribution and Shh expression. Development. 2006;133: 2263–2273.

129. Paciello O, Borzacchiello G, Varricchio E, Papparella S. Expression of peroxisome proliferator-activated receptor gamma (PPAR-gamma) in canine nasal carcinomas. Journal of veterinary medicine A, Physiology, pathology, clinical medicine. 2007;54: 406–10.

130. Maucksch C, Jones KS, Connor B. Concise Review: The Involvement of SOX2 in Direct Reprogramming of Induced Neural Stem/Precursor Cells. Stem Cells Translational Medicine. 2013;2: 579–583.

131. Matsui T. Redundant roles of Sox17 and Sox18 in postnatal angiogenesis in mice. J Cell Sci. 2006;119: 3513–3526. 99

132. Kim I, Saunders TL, Morrison SJ. Sox17 dependence distinguishes the transcriptional regulation of fetal from adult hematopoietic stem cells. Cell. 2007;130: 470–483.

133. Nakatsu MN, Ding Z, Ng MY, Truong TT, Yu F, Deng SX. Wnt/beta-catenin signaling regulates proliferation of human cornea epithelial stem/progenitor cells. Invest Ophthalmol Vis Sci. 2011;52: 4734–4741.

134. Sock E, Schmidt K, Hermanns-Borgmeyer I, Bosl MR, Wegner M. Idiopathic Weight Reduction in Mice Deficient in the High-Mobility-Group Transcription Factor Sox8. Mol Cell Biol. 2001;21: 6951–6959.

135. Pozniak CD, Langseth AJ, Dijkgraaf GJ, Choe Y, Werb Z, Pleasure SJ. Sox10 directs neural stem cells toward the oligodendrocyte lineage by decreasing Suppressor of Fused expression. Proc Natl Acad Sci USA. 2010;107: 21795–800.

136. Stolt CC, Lommes P, Friedrich RP, Wegner M. Transcription factors Sox8 and Sox10 perform non-equivalent roles during oligodendrocyte development despite functional redundancy. Development. 2004;131: 2349–2358.

137. O'Bryan M, Takada S, Kennedy C, Scott G, Harada S-I, Ray M, et al. Sox8 is a critical regulator of adult Sertoli cell function and male fertility. Dev Biol. 2008;316: 359–370.

138. Kim J, Lo L, Dormand E, Anderson DJ. SOX10 maintains multipotency and inhibits neuronal differentiation of neural crest stem cells. Neuron. 2003;38: 17–31.

139. Stolt CC, Rehberg S, Ader M, Lommes P, Riethmacher D, Schachner M, et al. Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor Sox10. Genes & development. 2002;16: 165–170.

140. Mollaaghababa R, Pavan WJ. The importance of having your SOX on: role of SOX10† in the development of neural crest-derived melanocytes and glia. Oncogene. 2003;22: 3024– 3034.

141. Harris ML, Buac K, Shakhova O, Hakami RM, Wegner M, Sommer L, et al. A Dual Role for SOX10 in the Maintenance of the Postnatal Melanocyte Lineage and the Differentiation of Melanocyte Stem Cell Progenitors. Steingrimsson E, editor. PLoS Genet. 2013;9: e1003644.

142. Dziasko MA, Tuft SJ, Daniels JT. Accepted Manuscript. Exp Eye Res. Elsevier Ltd; 2015;: 1– 27.

143. Scott CE, Wynn SL, Sesay A, Cruz C, Cheung M, Gaviro M-VG, et al. SOX9 induces and maintains neural stem cells. Nat Neurosci. 2010;13: 1181–9.

144. Guo W, Keckesova Z, Donaher JL, Shibue T, Tischler V, Reinhardt F, et al. Slug and Sox9 Cooperatively Determine the Mammary Stem Cell State. Cell. Elsevier Inc; 2012;148: 1015– 1028.

145. Furuyama K, Kawaguchi Y, Akiyama H, Horiguchi M, Kodama S, Kuhara T, et al. Continuous cell supply from a Sox9-expressing progenitor zone in adult liver, exocrine pancreas and intestine. Nature Publishing Group. Nature Publishing Group; 2010;43: 34–41.

100

146. Bastide P, Darido C, Pannequin J, Kist R, Robine S, Marty-Double C, et al. Sox9 regulates cell proliferation and is required for Paneth cell differentiation in the intestinal epithelium. J Cell Biol. 2007;178: 635–48.

147. Takacs L, Toth E, Losonczy G, Szanto A, Bahr-Ivacevic T, Benes V, et al. Differentially Expressed Genes Associated with Human Limbal Epithelial Phenotypes: New Molecules That Potentially Facilitate Selection of Stem Cell-Enriched Populations. Invest Ophthalmol Vis Sci. 2011;52: 1252–1260.

148. Saegusa M, Hashimura M, Suzuki E, Yoshida T, Kuwata T. Transcriptional Up-Regulation of Sox9 by NF. AJPA. Elsevier Inc; 2012;181: 684–692.

149. Malki S, Boizet-Bonhoure B, Poulat F. Shuttling of SOX proteins. Int J Biochem Cell Biol. 2010;42: 411–416.

150. Smith JM, Koopman PA. The ins and outs of transcriptional control: nucleocytoplasmic shuttling in development and disease. Trends Genet. 2004;20: 4–8.

151. Tew SR, Clegg PD. Analysis of Post Transcriptional Regulation of SOX9 mRNA During In VitroChondrogenesis. Tissue Eng Part A. 2011;17: 1801–1807.

152. Blache P, van de Wetering M, Duluc I, Domon C, Berta P, Freund J-N, et al. SOX9 is an intestine crypt transcription factor, is regulated by the Wnt pathway, and represses the CDX2 and MUC2 genes. J Cell Biol. 2004;166: 37–47.

153. Kopp JL, Ormsbee BD, Desler M, Rizzino A. Small increases in the level of Sox2 trigger the differentiation of mouse embryonic stem cells. Stem Cells. 2008;26: 903–911.

154. Seymour PA, Freude KK, Dubois CL, Shih H-P, Patel NA, Sander M. Developmental Biology. Dev Biol. Elsevier B.V; 2008;323: 19–30.

155. Formeister EJ, Sionas AL, Lorance DK, Barkley CL, Lee GH, Magness ST, et al. Distinct SOX9 levels differentially mark stem/progenitor populations and enteroendocrine cells of the small intestine epithelium. Am J Physiol Gastrointest Liver Physiol. American Physiological Society; 2009;296: G1108–G1118.

156. Shi G, Sohn K-C, Kim S-Y, Ryu E-K, Park Y-S, Lee Y, et al. Sox9 Increases the Proliferation and Colony-forming Activity of Outer Root Sheath Cells Cultured In Vitro. Annals of dermatology. 2011;23: 138–43.

157. Aigner T, Gebhard PM, Schmid E, Bau B, Harley V, Pöschl E. SOX9 expression does not correlate with type II collagen expression in adult articular chondrocytes. Matrix Biology. 2003;22: 363–372.

158. Huang W, Zhou X, Lefebvre V, de Crombrugghe B. Phosphorylation of SOX9 by cyclic AMP- dependent protein kinase A enhances SOX9's ability to transactivate a Col2a1 chondrocyte- specific enhancer. Mol Cell Biol. 2000;20: 4149–4158.

159. Kitazawa K, Hikichi T, Nakamura T, Sotozono C, Kinoshita S, Masui S. Experimental Eye Research. 2016: 1–9.

101

160. Stöckl S, Göttl C, Grifka J, Grässel S. Sox9 Modulates proliferation and expression of osteogenic markers of adipose-derived stem cells (ASC). Cell Physiol Biochem. 2013;31: 703–717.

161. Malhotra GK, Zhao X, Edwards E, Kopp JL, Naramura M, Sander M, et al. The role of Sox9 in mouse mammary glanddevelopment and maintenance of mammarystem and luminal progenitor cells. BMC Dev Biol. 2014;14:47.

162. Vidal VP, Chaboissier M-C, Lützkendorf S, Cotsarelis G, Mill P, Hui C-C, et al. Sox9 is essential for outer root sheath differentiation and the formation of the hair stem cell compartment. Current biology : CB. 2005;15: 1340–51.

163. Peng H, Park JK, Katsnelson J, Kaplan N, Yang W, Getsios S, et al. microRNA-103/107 Family Regulates Multiple Epithelial Stem Cell Characteristics. Stem Cells. 2015;33:1642–56.

164. Kadaja M, Keyes BE, Lin M, Pasolli HA, Genander M, Polak L, et al. SOX9: a stem cell transcriptional regulator of secreted niche signaling factors. Genes & development. 2014;28: 328–341.

165. Seymour PA, Freude KK, Tran MN, Mayes EE, Jensen J, Kist R, et al. SOX9 is required for maintenance of the pancreatic progenitor cell pool. Proc Natl Acad Sci USA. 2007;104: 1865–1870.

166. Menzel-Severing J, Zenkel M, Mößner A, Kruse FE, Schlötzer-Schrehardt U. TGF-beta/BMP Pathway Specific Expression Profiling of Limbal Epithelial Progenitor Cells. Association for Research in Vision and Ophthalmology, Annual Meeting, Fort Lauderdale, FL; 2012.

167. Healy C, Uwanogho D, Sharpe PT. Regulation and role of Sox9 in cartilage formation. Dev Dyn. 1999;215: 69–78.

168. Gao L, Sheu TJ, Dong Y, Hoak DM, Zuscik MJ, Schwarz EM, et al. TAK1 regulates SOX9 expression in chondrocytes and is essential for postnatal development of the growth plate and articular cartilages. J Cell Sci. 2013;126: 5704–5713.

169. Moniot B. SOX9 specifies the pyloric sphincter epithelium through mesenchymal-epithelial signals. Development. 2004;131: 3795–3804.

170. Hattori T, Muller C, Gebhard S, Bauer E, Pausch F, Schlund B, et al. SOX9 is a major negative regulator of cartilage vascularization, bone marrow formation and endochondral ossification. Development. 2010;137: 901–911.

171. Kozawa O, Matsuno H, Uematsu T. Involvement of p70 S6 kinase in bone morphogenetic protein signaling: vascular endothelial growth factor synthesis by bone morphogenetic protein-4 in osteoblasts. J Cell Biochem. 2001;81: 430–436.

172. Fantauzzo KA, Kurban M, Levy B, Christiano AM. Trps1 and its target gene Sox9 regulate epithelial proliferation in the developing hair follicle and are associated with hypertrichosis. PLoS Genet. 2012;8: e1003002.

173. Song S, Ajani JA, Honjo S, Maru DM, Chen Q, Scott AW, et al. Hippo coactivator YAP1 upregulates SOX9 and endows esophageal cancer cells with stem-like properties. Cancer 102

Res. 2014;74: 4170–4182.

174. Foster JW, Jones RR, Bippes CA, Gouveia RJ, Connon CJ. Differential nuclear expression of Yap in basal epithelial cells across the cornea and substrates of differing stiffness. Exp Eye Res. 2014;127:37–41.

175. Muto A, Iida A, Satoh S, Watanabe S. Experimental Eye Research. Exp Eye Res. 2009;89: 549–558.

176. Hashmani K, Branch MJ, Sidney LE, Dhillon PS, Verma M, McIntosh OD, et al. Characterization of corneal stromal stem cellswith the potential for epithelialtransdifferentiation. Stem Cell Research & Therapy. Stem Cell Research & Therapy; 2013;4: 75.

177. Sareen D, Saghizadeh M, Ornelas L, Winkler MA, Narwani K, Sahabian A, et al. Differentiation of human limbal-derived induced pluripotent stem cells into limbal-like epithelium. Stem Cells Translational Medicine. 2014;3: 1002–1012.

178. Mikhailova A, Ilmarinen T, Uusitalo H, Skottman H. Small-molecule induction promotes corneal epithelial cell differentiation from human induced pluripotent stem cells. STEMCR. 2014;2: 219–231.

179. Notara M, Shortt AJ, Galatowicz G, Calder V, Daniels JT. IL6 and the human limbal stem cell niche: A mediator of epithelial–stromal interaction. Stem Cell Res. Elsevier B.V; 2010;5: 188–200.

180. Nakamura T, Hamuro J, Takaishi M, Simmons S, Maruyama K, Zaffalon A, et al. LRIG1 inhibits STAT3-dependent inflammation to maintain corneal homeostasis. J Clin Invest. 2014;124: 385–397.

181. Stockl S, Bauer RJ, Bosserhoff AK, Gottl C, Grifka J, Grassel S. Sox9 modulates cell survival and adipogenic differentiation of multipotent adult rat mesenchymal stem cells. J Cell Sci. 2013;126: 2890–2902.

182. Gracz AD, Ramalingam S, Magness ST. Sox9 expression marks a subset of CD24-expressing small intestine epithelial stem cells that form organoids in vitro. Gastrointestinal and Liver Physiology. 2010;298: G590–G600.

103

8. ABBREVIATIONS

3T3 “3-day transfer, inoculum 3 x 105 cells” – fibroblast cell line established from embryonic mice

AM amniotic membrane aRNA amplified RNA

ARVO Association for Research in Vision and Ophthalmology

BCEC basal corneal epithelial cell

BMP bone morphogenetic protein

BrdU Bromodeoxyuridine cDNA complementary DNA

CEBPD CCAAT enhancer binding protein δ (C/EBPδ)

CK cytokeratin

Ct cycle threshold

DAPI 4 ́,6 -́ diamino-2-phenylindole dCt delta Ct (cycle threshold normalised to housekeeping gene/genes)

DMEM Dulbecco’s modified Eagle’s medium

DNA deoxyribonucleic acid

EDTA ethylenediaminetetraacetic acid

EGFP enhanced green fluorescent protein

ELISA enzyme-linked immunosorbent assay

ESC embryonic stem cell

FBS fetal bovine serum

GAPDH Glyceraldehyde 3-phosphate dehydrogenase

HMG high-mobility group

IL interleukin iPSC induced pluripotent stem cell 104

KLF Krüppel-like factor

KSFM keratinocyte serum free medium

LCM laser capture microdissection

LEPC limbal epithelial progenitor cell

LSCD limbal stem cell deficiency mRNA messenger RNA

MSC mesenchymal stromal cell / mesenchymal stem cell nt nucleotides

PBS phosphate buffered saline

PCNA Proliferating cell nuclear antigen

PCR polymerase chain reaction

PPARG peroxisome proliferator-activated receptor gamma qRT-PCR quantitative real-time polymerase chain reaction

RIN RNA integrity number

RNA ribonucleic acid

RNAi RNA interference

SAGE serial analysis of gene expression

SD standard deviation

Shh Sonic hedgehog siRNA small interfering RNA

SOX Sry-related HMG box (gene family)

SRY sex-determining region on the Y chromosome (first SOX gene to be identified)

TAC transient amplifying cell

TF transcription factor

VEGF vascular endothelial growth factor

YAP1 Yes-associated protein 1

105