DOCSLIB.ORG

Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga doi:10.1111/j.1741-4520.2009.00266.x Congenital Anomalies 2010; 50, 1–7 1 REVIEW ARTICLE Birth defects caused by mutations in human GLI3 and mouse Gli3 genescga_ 266 1..71..7 Ichiro Naruse1, Etsuko Ueta1, Yoshiki Sumino1, Masaya Ogawa1, and Satoshi Ishikiriyama2 1School of Health Science, Faculty of Medicine, Tottori University, Yonago, and 2Division of Clinical Genetics and Cytogenetics, Shizuoka Children’s Hospital, Shizuoka, Japan ABSTRACT GLI3 is the gene responsible for Greig cepha- type-A (PAP-A) and preaxial polydactyly type-IV (PPD-IV). A lopolysyndactyly syndrome (GCPS), Pallister–Hall syndrome mimic phenomenon is observed in mice. Investigation of human (PHS) and Postaxial polydactyly type-A (PAP-A). Genetic poly- GLI3 and Gli3 genes has progressed using the knowledge of dactyly mice such as Pdn/Pdn (Polydactyly Nagoya), XtH/XtH Cubitus interruptus (Ci) in Drosophila, a homologous gene of GLI3 (Extra toes) and XtJ/XtJ (Extra toes Jackson) are the mouse and Gli3 genes. These genes have been highly conserved in the homolog of GCPS, and Gli3tmlUrtt/Gli3tmlUrt is produced as the animal kingdom throughout evolution. Now, a lot of mutant mice of mouse homolog of PHS. In the present review, relationships Gli3 gene have been known and knockout mice have been pro- between mutation points of GLI3 and Gli3, and resulting phe- duced. It is expected that the knowledge obtained from mutant and notypes in humans and mice are described. It has been con- knockout mice will be extrapolated to the manifestation mecha- firmed that mutation in the upstream or within the zinc finger nisms in human diseases to understand the diseases caused by the domain of the GLI3 gene induces GCPS; that in the post-zinc mutations in GLI3 gene. finger region including the protease cleavage site induces PHS; and that in the downstream of the GLI3 gene induces PAP-A. A Phenotype of GCPS mimicking phenomenon was observed in the mouse homolog. Greig cephalopolysyndactyly syndrome is a disorder that affects Therefore, human GLI3 and mouse Gli3 genes have a common the development of the limbs, head and face. The features of this structure, and it is suggested here that mutations in the same syndrome are highly variable, ranging from very mild to severe. functional regions produce similar phenotypes in human and GCPS might characterized by a set of craniofacial defects (e.g. mice. The most important issue might be that GCPS and PHS macrocephaly, broad nasal root, ocular hypertelorism and promi- exhibit an autosomal dominant trait, but mouse homologs, such nent forehead) (Fig. 1A,B), and one or more extra fingers or toes as Pdn/Pdn, XtH/XtH, XtJ/XtJ and Gli3tmlUrt/Gli3tmlUrt, are autoso- (polydactyly) (Fig. 1C,D) or having an abnormally wide thumb or mal recessive traits in the manifestation of similar phenotypes hallux. The skin between the fingers and toes might exhibit cuta- to human diseases. It is discussed here how the reduced neous syndactyly (Fig. 1C,D) (Greig 1926; Gollop and Fontes amounts of the GLI3 protein, or truncated mutant GLI3 1985; Biesecker, 2009). Rarely, affected individuals have more protein, disrupt development of the limbs, head and face. serious medical problems, including seizures, developmental delay, hydrocephalus and intellectual disability (Biesecker 2009). It is Key Words: GCPS, Gli3, PAP-A, Pdn,PHS,Xt impossible to determine the incidence of GCPS, because reliable clinical criteria and molecular diagnostics are not yet readily avail- able (Biesecker 2008). INTRODUCTION Phenotype of Pdn mouse A responsible gene can be identified using blood and/or fibroblast The Pdn (Polydactyly Nagoya) mouse (Gli3Pdn) was derived from cells of the human birth defects, but it is impossible to know how Jcl : ICR (Hayasaka et al. 1980) and has been inbred in Naruse’s the phenotypes appear. We can investigate the mechanisms of how laboratory. It is now of 146th generation (Mouse Genome Informat- the phenotype manifests in the animal homologous disease by ics, ID: MGI:1856282, http://www.informatics.jax.org) (RIKEN observing the phenomena during embryogenesis. In this review, we BioResource Center BRC no. 00387, http://www.brc.riken.jp). would like to describe the birth defects caused by the mutation of Pdn/+ mice exhibited broad thumbs of the first digit in the fore- the GLI3 gene in humans and the Gli3 gene in mice. GLI3 and Gli3 limb (Fig. 2A), preaxial polydactyly of distal phalangeal type in the genes have zinc finger domains (transcriptional regulation domains) hindlimb (Fig. 2B,F) (Hayasaka et al. 1980; Naruse and Kameyama and are peculiar genes; the full length of the GLI3 protein functions 1982) a normal brain with the olfactory bulb (Fig. 2I), normal as a transcriptional activator, and the N terminal part functions as a spaced eyes (Fig. 2K) and a normal forehead (Fig. 2M). Pdn/Pdn transcriptional repressor after cleavage into two parts. mice exhibited preaxial polydactyly of complete type and syn- According to the positions of mutation, various types of pheno- dactyly both in the fore- and hindlimbs (Fig. 2C,D,G,H) (Hayasaka type appear, such as Greig cephalopolysyndactyly syndrome et al. 1980; Naruse and Kameyama 1982), postaxial polydactyly in (GCPS), Pallister–Hall syndrome (PHS), postaxial polydactyly the forelimbs (Fig. 2C), absence of olfactory bulb (Fig. 2J), hydro- cephalus (Naruse et al. 1990), ocular hypertelorism (Fig. 2L), Correspondence: Ichiro Naruse, PhD, School of Health Science, Faculty prominent forehead (Fig. 2N) and retinal coloboma. They die soon of Medicine, Tottori University, Yonago 683-8503, Japan. Email: after birth because of suckling dysfunction (Hongo et al. 2000). The [email protected] similarity of the phenotype between GCPS and Pdn/Pdn is shown Received September 30, 2009; revised and accepted December 7, 2009. in Table 1. © 2010 The Authors Journal compilation © 2010 Japanese Teratology Society 2 I. Naruse et al. Fig. 1 Phenotype of Greig cephalopolysyndac- tyly syndrome (GCPS). GCPS exhibits broad nasal root, ocular hypertelorism, macrocephaly (A, B), and polysyndac- tyly in the hands (C) and feet (D). GLI3 gene in human and Gli3 gene in mice 2002). SUFU (Suppressor of fused) is essential for regulation of The official name of the GLI-Kruppel family member GLI3 gene is Gli/Ci processing, activity, and localization (Dunaeva et al. 2003). ‘GLI family zinc finger 3’ (Ruppert et al. 1988). Three homologs of Degron N is a specific sequence of amino acids in a protein that Cubitus interruptus (Ci) in Drosophila, Gli1, Gli2 and Gli3,have directs the starting place of degradation positioned in N-terminal been implicated in mediating responses to Sonic hedgehog (SHH) region (Huang et al. 1998). Around 14 cM of mouse chromosome in vertebrates (von Mering and Basler 1999). GLI3 gene is at 7p13 13 is the synteny region with 7p13 on the human chromosome 7 on human chromosome 7 (Ruppert et al. 1990). GLI3 protein has (Pettigrew et al. 1991; Lyon and Kirby 1992). Human GLI3 and been shown to be a sequence-specific DNA binding protein (Kinzler mouse Gli3 have 69% homology in DNA sequence, and 82% and Vogelstein 1990; Ruppert et al. 1990). It has been proposed that homology in amino acid sequence. GLI3 protein plays important roles in the embryonic development Proteins of the GLI family function in the same molecular (Ruppert et al. 1988; Schimmang et al. 1992). pathway as SHH protein. This pathway is essential for early devel- GLI family proteins attach to specific regions of DNA and opment (Ming et al. 1998). It plays a role in cell growth, cell control whether particular genes are turned on or off. Full length specialization and the patterning of structures such as the brain and GLI3 protein works as a transcriptional activator, and N terminal limbs (Genetics Home Reference: http://ghr.nlm.nih.gov). Depend- part of GLI3 protein works as a transcriptional repressor after ing on signals from SHH, the GLI3 protein can either activate or cleavage at nucleotide position 1988 in the protease cleavage site repress other genes such as Emx2, Wnt7b, Wnt8b and Msx (Ueta (Fig. 3A). Human GLI3 gene is constructed with 15 exons, and has et al. 2008; Lallemand et al. 2009). Hill et al. (2009) proposed that 5 zinc finger motifs at nucleotide number 1386–1935, protease unprocessed full-length GLI3 is dispensable for anteroposterior cleavage site, transactivation and CBP-binding regions (TA/CBP) at patterning of the limb bud. Instead, digit identities are most likely 2481–3396, transactivation domain 2 (TA2) at 3132–3966 and defined by GLI3 repressor activity alone. Anteroposterior grading transactivation domain 1 (TA1) at 4128–4740, a-helical region at of GLI3 activity by the action of SHH in digital pattering is 4482–4536 (Kalff-Suske et al. 1999), and the full length of struc- reported by Hill et al. (2009). ture gene is 4743 bp (Fig. 3A) (EMBL ID: AJ250408). CBP, CREB-binding protein, is ubiquitously expressed and is involved in GLI3 and Gli3 genes responsible for Greig the transcriptional coactivation of many different transcription cephalopolysyndactyly syndrome and Pdn mouse factors (Chrivia et al. 1993), and a-helix acts as an activation Different genetic changes involving the GLI3 gene can cause domain (Yoon et al. 1998). GCPS. In some cases, the condition results from a chromosomal Mouse Gli3 gene has also 5 zinc finger motifs at nucleotide abnormality, such as a large deletion or rearrangement of genetic position 1437–1914 and is constructed with 15 exons. It has tran- material, in the region of chromosome 7. In any case, deletion scriptional repressor region at 318–708, Ski binding site at 456– and/or mutations in the 5′ half of the GLI3 gene, in the open reading 1191, SUFU binding site at 984–1014, Degron N (Tsanev et al.
Load more

Recommended publications
  • Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
    Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients.
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Identifying Isl1 Genetic Lineage in the Developing Olfactory System and in Gnrh-1 Neurons 2 3 Ed Zandro M
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Identifying Isl1 genetic lineage in the developing olfactory system and in GnRH-1 neurons 2 3 Ed Zandro M. Taroc1, Raghu Ram Katreddi1 and Paolo E. Forni1*. 4 5 1Department of Biological Sciences; The RNA Institute, and the Center for Neuroscience 6 Research; University at Albany, State University of New York, Albany, NY 12222, USA. 7 8 * Corresponding Author 9 [email protected] 10 11 12 Keywords: Olfactory neurons, vomeronasal sensory neurons, GnRH neurons, Islet-1/Isl1, Isl1 13 Conditional knock-out; genetic lineage tracing, olfactory placode, neural crest. 14 15 Abstract (299, at 245 after editing) 16 During embryonic development, symmetric ectodermal thickenings (olfactory placodes) give rise 17 to several cell types that comprise the olfactory system, such as those that form the terminal nerve 18 ganglion (TN), gonadotropin releasing hormone-1 (GnRH-1) neurons and other migratory 19 neurons in rodents. Even though the genetic heterogeneity among these cell types are 20 documented, unidentified cell populations arising from the olfactory placode remain. One 21 candidate to identify placodal derived neurons in the developing nasal area is the transcription 22 factor Isl1, which was recently identified in GnRH-3 neurons of the terminal nerve in fish, as well 23 as expression in neurons of the nasal migratory mass. Here, we analyzed the Isl1 genetic lineage 24 in chemosensory neuronal populations in the nasal area and migratory GnRH-1 neurons in mice 25 using in-situ hybridization, immunolabeling a Tamoxifen inducible Isl1CreERT and a constitutive 26 Isl1Cre knock-in mouse lines.
    [Show full text]
  • Ablation of Ezh2 in Neural Crest Cells Leads to Hirschsprung's Disease-Like Phenotype in Mice
    bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ablation of Ezh2 in neural crest cells leads to Hirschsprung’s disease-like phenotype in mice Hana Kim, Ingeborg M. Langohr, Mohammad Faisal, Margaret McNulty, Caitlin Thorn, Joomyeong Kim* Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA. Correspondence should be forwarded to: [email protected], 225-578-7692(ph), or 225-578-2597(fax) Running title: Function of Ezh2 in enteric neural crest cell development 1 bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract In the current study, we examined the role of Ezh2 as an epigenetic modifier for the enteric neural crest cell development through H3K27me3. Ezh2 conditional null mice were viable up to birth, but died within the first hour of life. In addition to craniofacial defects, Ezh2 conditional null mice displayed reduced number of ganglion cells in the enteric nervous system. RT-PCR and ChIP assays indicated aberrant up-regulation of Zic1, Pax3, and Sox10 and loss of H3K27me3 marks in the promoter regions of these genes in the myenteric plexus. Overall, these results suggest that Ezh2 is an important epigenetic modifier for the enteric neural crest cell development through repression of Zic1, Pax3, and Sox10.
    [Show full text]
  • To Proliferate Or to Die: Role of Id3 in Cell Cycle Progression and Survival of Neural Crest Progenitors
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors Yun Kee and Marianne Bronner-Fraser1 Division of Biology, California Institute of Technology, Pasadena, California 91125, USA The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix–loop–helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. [Keywords: Xenopus; Id3; neural crest; cell cycle; survival] Received September 1, 2004; revised version accepted January 19, 2005. The neural crest is an embryonic cell population that origi- et al. 2003), c-Myc (Bellmeyer et al. 2003), and Msx1 nates from the lateral edges of the neural plate during (Tribulo et al. 2003) have been identified in Xenopus nervous system formation.
    [Show full text]
  • A Combination of GATA3 and SOX10 Is Useful for the Diagnosis of Metastatic Triple-Negative Breast Cancer☆ Gary H
    Human Pathology (2019) 85,221–227 www.elsevier.com/locate/humpath Original contribution A combination of GATA3 and SOX10 is useful for the diagnosis of metastatic triple-negative breast cancer☆ Gary H. Tozbikian MD⁎, Debra L. Zynger MD Department of Pathology, The Ohio State University Wexner Medical Center, Columbus, OH 43210, USA Received 9 July 2018; revised 2 November 2018; accepted 7 November 2018 Keywords: Summary In metastatic breast cancer (MBC), it can be difficult to establish the origin if the primary tumor is Triple negative; triple negative or if there is a loss of biomarker expression. SOX10 expression has been reported in primary Breast cancer; triple-negative breast cancer but is poorly studied in metastatic lesions. In this study, the diagnostic utility of SOX10; a panel of SOX10, GATA3, and androgen receptor (AR) in MBC negative for estrogen receptor, progester- GATA3; one receptor, and human epidermal growth factor receptor 2 was evaluated and compared with the expres- Metastatic; sion of these markers in the matched primary breast cancer. In a series of 57 triple-negative MBCs, 82% Primary were positive for GATA3, 58% for SOX10, and 25% for AR. Nearly all MBCs (95%) were positive for ei- ther GATA3 or SOX10, with 46% dual positive and 5% of cases negative for both markers. Most GATA3- negative MBC cases were SOX10 positive (70%). AR expression was only seen in GATA3-positive MBC (25%) and was significantly more frequent in SOX10-negative MBC (48%) versus SOX10-positive MBC (9%; P = .001). Concordance for GATA3, SOX10, and AR between the primary and metastasis was 89%, 88%, and 80%, respectively.
    [Show full text]
  • Spatial Distribution of Leading Pacemaker Sites in the Normal, Intact Rat Sinoa
    Supplementary Material Supplementary Figure 1: Spatial distribution of leading pacemaker sites in the normal, intact rat sinoatrial 5 nodes (SAN) plotted along a normalized y-axis between the superior vena cava (SVC) and inferior vena 6 cava (IVC) and a scaled x-axis in millimeters (n = 8). Colors correspond to treatment condition (black: 7 baseline, blue: 100 µM Acetylcholine (ACh), red: 500 nM Isoproterenol (ISO)). 1 Supplementary Figure 2: Spatial distribution of leading pacemaker sites before and after surgical 3 separation of the rat SAN (n = 5). Top: Intact SAN preparations with leading pacemaker sites plotted during 4 baseline conditions. Bottom: Surgically cut SAN preparations with leading pacemaker sites plotted during 5 baseline conditions (black) and exposure to pharmacological stimulation (blue: 100 µM ACh, red: 500 nM 6 ISO). 2 a &DUGLDFIoQChDQQHOV .FQM FOXVWHU &DFQDG &DFQDK *MD &DFQJ .FQLS .FQG .FQK .FQM &DFQDF &DFQE .FQM í $WSD .FQD .FQM í .FQN &DVT 5\U .FQM &DFQJ &DFQDG ,WSU 6FQD &DFQDG .FQQ &DFQDJ &DFQDG .FQD .FQT 6FQD 3OQ 6FQD +FQ *MD ,WSU 6FQE +FQ *MG .FQN .FQQ .FQN .FQD .FQE .FQQ +FQ &DFQDD &DFQE &DOP .FQM .FQD .FQN .FQG .FQN &DOP 6FQD .FQD 6FQE 6FQD 6FQD ,WSU +FQ 6FQD 5\U 6FQD 6FQE 6FQD .FQQ .FQH 6FQD &DFQE 6FQE .FQM FOXVWHU V6$1 L6$1 5$ /$ 3 b &DUGLDFReFHSWRUV $GUDF FOXVWHU $GUDD &DY &KUQE &KUP &KJD 0\O 3GHG &KUQD $GUE $GUDG &KUQE 5JV í 9LS $GUDE 7SP í 5JV 7QQF 3GHE 0\K $GUE *QDL $QN $GUDD $QN $QN &KUP $GUDE $NDS $WSE 5DPS &KUP 0\O &KUQD 6UF &KUQH $GUE &KUQD FOXVWHU V6$1 L6$1 5$ /$ 4 c 1HXURQDOPURWHLQV
    [Show full text]
  • Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
    Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2.
    [Show full text]
  • Distinct Activities of Gli1 and Gli2 in the Absence of Ift88 and the Primary Cilia
    Journal of Developmental Biology Article Distinct Activities of Gli1 and Gli2 in the Absence of Ift88 and the Primary Cilia Yuan Wang 1,2,†, Huiqing Zeng 1,† and Aimin Liu 1,* 1 Department of Biology, Eberly College of Sciences, Center for Cellular Dynamics, Huck Institute of Life Science, The Penn State University, University Park, PA 16802, USA; [email protected] (Y.W.); [email protected] (H.Z.) 2 Department of Occupational Health, School of Public Health, China Medical University, No.77 Puhe Road, Shenyang North New Area, Shenyang 110122, China * Correspondence: [email protected]; Tel.: +1-814-865-7043 † These authors contributed equally to this work. Received: 2 November 2018; Accepted: 16 February 2019; Published: 19 February 2019 Abstract: The primary cilia play essential roles in Hh-dependent Gli2 activation and Gli3 proteolytic processing in mammals. However, the roles of the cilia in Gli1 activation remain unresolved due to the loss of Gli1 transcription in cilia mutant embryos, and the inability to address this question by overexpression in cultured cells. Here, we address the roles of the cilia in Gli1 activation by expressing Gli1 from the Gli2 locus in mouse embryos. We find that the maximal activation of Gli1 depends on the cilia, but partial activation of Gli1 by Smo-mediated Hh signaling exists in the absence of the cilia. Combined with reduced Gli3 repressors, this partial activation of Gli1 leads to dorsal expansion of V3 interneuron and motor neuron domains in the absence of the cilia. Moreover, expressing Gli1 from the Gli2 locus in the presence of reduced Sufu has no recognizable impact on neural tube patterning, suggesting an imbalance between the dosages of Gli and Sufu does not explain the extra Gli1 activity.
    [Show full text]
  • Interspecies Difference in the Regulation of Melanocyte Development by SOX10 and MITF
    Interspecies difference in the regulation of melanocyte development by SOX10 and MITF Ling Hou*†, Heinz Arnheiter‡, and William J. Pavan*† *Genetic Disease Research Branch, National Human Genome Research Institute, and ‡Mammalian Development Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892-4472 Communicated by Francis S. Collins, National Institutes of Health, Bethesda, MD, April 17, 2006 (received for review March 10, 2006) There is increasing indication that interspecific phenotypic differ- gous for a targeted mutation in Sox10 (12). In humans, SOX10 ences result from variations in gene-regulatory interactions. Here mutations are associated with Waardenburg–Hirschsprung dis- we provide evidence that mice differ from zebrafish in the way ease [Online Mendelian Inheritance in Man (OMIM) accession they use homologous key components to regulate pigment cell no. 277580] (13) and a complex neurocristopathy that combines differentiation. In both zebrafish and mice, one transcription peripheral demyelinating neuropathy, central leukodystrophy, factor, SOX10, controls the expression of another, MITF (microph- Waardenburg syndrome, and Hirschprung disease (PCWH, thalmia-associated transcription factor), which in turn regulates a OMIM accession no. 609136) (14). MITF, on the other hand, is set of genes critical for pigment cell development and pigmenta- a basic helix–loop–helix leucine zipper transcription factor tion. Mutations in either Sox10 or Mitf impair pigment cell devel- whose mutations lead to pigmentary abnormalities and, depend- opment. In Sox10-mutant zebrafish, experimentally induced ex- ing on the species, deafness and eye abnormalities but none of pression of Mitf fully rescues pigmentation. Using lineage-directed the intestinal or demyelinating and dysmyelinating symptoms gene transfer, we show that, in the mouse, Mitf can rescue seen with Sox10 mutations (6, 15).
    [Show full text]
  • Underestimated PTCH1 Mutation Rate in Sporadic Keratocystic Odontogenic Tumors Q
    Oral Oncology 51 (2015) 40–45 Contents lists available at ScienceDirect Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology Underestimated PTCH1 mutation rate in sporadic keratocystic odontogenic tumors q Jiafei Qu a, Feiyan Yu a, Yingying Hong a, Yanyan Guo a, Lisha Sun b, Xuefen Li b, Jianyun Zhang a, ⇑ ⇑ Heyu Zhang b, Ruirui Shi b, Feng Chen b, , Tiejun Li a, a Department of Oral Pathology, Peking University School and Hospital of Stomatology, Beijing, China b Central Laboratory, Peking University School and Hospital of Stomatology, Beijing, China article info summary Article history: Objectives: Keratocystic odontogenic tumors (KCOTs) are benign cystic lesions of the jaws that occur spo- Received 11 July 2014 radically in isolation or in association with nevoid basal cell carcinoma syndrome (NBCCS). The protein Received in revised form 29 August 2014 patched homolog 1 gene (PTCH1) is associated with NBCCS development and tumor genesis associated Accepted 26 September 2014 with this syndrome. However, previous studies have revealed that more than 85% of syndromic KCOTs Available online 18 November 2014 and less than 30% of sporadic KCOTs harbor PTCH1 mutations. The significantly lower PTCH1 mutation rates observed in sporadic KCOTs suggest that they serve a minor role in pathogenesis. We aimed to Keywords: discern the importance of PTCH1 mutations in sporadic KCOTs. PTCH1 Materials and methods: PTCH1 mutational analysis was performed with 19 new sporadic KCOT cases by Mutation Keratocystic odontogenic tumors direct sequencing of epithelial lining samples separated from fibrous capsules. Using this approach, we further reexamined 9 sporadic KCOTs that were previously reported to lack PTCH1 mutations by our group.
    [Show full text]