DOCSLIB.ORG

Identifying Isl1 Genetic Lineage in the Developing Olfactory System and in Gnrh-1 Neurons 2 3 Ed Zandro M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identifying Isl1 Genetic Lineage in the Developing Olfactory System and in Gnrh-1 Neurons 2 3 Ed Zandro M bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Identifying Isl1 genetic lineage in the developing olfactory system and in GnRH-1 neurons 2 3 Ed Zandro M. Taroc1, Raghu Ram Katreddi1 and Paolo E. Forni1*. 4 5 1Department of Biological Sciences; The RNA Institute, and the Center for Neuroscience 6 Research; University at Albany, State University of New York, Albany, NY 12222, USA. 7 8 * Corresponding Author 9 [email protected] 10 11 12 Keywords: Olfactory neurons, vomeronasal sensory neurons, GnRH neurons, Islet-1/Isl1, Isl1 13 Conditional knock-out; genetic lineage tracing, olfactory placode, neural crest. 14 15 Abstract (299, at 245 after editing) 16 During embryonic development, symmetric ectodermal thickenings (olfactory placodes) give rise 17 to several cell types that comprise the olfactory system, such as those that form the terminal nerve 18 ganglion (TN), gonadotropin releasing hormone-1 (GnRH-1) neurons and other migratory 19 neurons in rodents. Even though the genetic heterogeneity among these cell types are 20 documented, unidentified cell populations arising from the olfactory placode remain. One 21 candidate to identify placodal derived neurons in the developing nasal area is the transcription 22 factor Isl1, which was recently identified in GnRH-3 neurons of the terminal nerve in fish, as well 23 as expression in neurons of the nasal migratory mass. Here, we analyzed the Isl1 genetic lineage 24 in chemosensory neuronal populations in the nasal area and migratory GnRH-1 neurons in mice 25 using in-situ hybridization, immunolabeling a Tamoxifen inducible Isl1CreERT and a constitutive 26 Isl1Cre knock-in mouse lines. In addition, we also performed conditional Isl1 ablation in developing 27 GnRH neurons. We found Isl1 lineage across non sensory cells of the respiratory epithelium and 28 sustentacular cells of OE and VNO. We identified a population of transient embryonic Isl1+ 29 neurons in the olfactory epithelium and sparse Isl1+ neurons in postnatal VNO. Isl1 is expressed 30 in almost all GnRH neurons and in approximately half of the other neuron populations in the 31 Migratory Mass. However, Isl1 conditional ablation alone does not significantly compromise 32 GnRH-1 neuronal migration or GnRH-1 expression, suggesting compensatory mechanisms. 33 Further studies will elucidate the functional and mechanistic role of Isl1 in development of 34 migratory endocrine neurons. 35 36 1) Introduction (1044) bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 37 Cranial placodes are specialized regions of ectoderm, that give rise to the pituitary gland, 38 sensory organs and ganglia of the vertebrate head [1; 2]. They form as a result of specific 39 expression patterns of transcription factors in pre-placodal ectoderm surrounding the anterior 40 neural plate [2; 3]. In mice, the olfactory placodes (OPs) are morphologically identifiable at 41 embryonic day 9.5 (E9.5), as a bilateral ectoderm thickening in the antero-lateral region of the 42 head (fig1). The transcription factors Oct1, Sox2, Pou2f1, Pax6, Eya1, Six1, Six4, Ngnr1,Hes1, 43 Hes5, MASH1/Ascl1, Ngn1 and Gli3 have been identified to control various steps of olfactory 44 placode induction/formation, neurogenesis, neuronal development, and expression of olfactory 45 specific genes [4; 5; 6; 7; 8; 9; 10]. 46 The olfactory pit of vertebrates generates neurogenic and non-neurogenic progenitors. The non- 47 neurogenic portions of the olfactory pit give rise to the respiratory epithelium, which is located in 48 the rostral olfactory pit, while the neurogenic portions give rise to specific neuronal and 49 glial/support cells (Fig.1,2). The respiratory epithelium, which is the main source of Fgf8, controls 50 the development of the neural crest derived nasal mesenchyme and bones [11]. Neurogenic 51 waves in the olfactory pit of mice first gives rise to mostly migratory neurons [11; 12] such as early 52 pioneer olfactory neurons, neurons of the terminal nerve, including Gonadotropin releasing 53 hormone neurons (GnRHns), NPY positive migratory neurons, and other neurons with unknown 54 identity and function or neurons of the migratory mass (MM) [13; 14; 15; 16]. The nasal area of 55 mice contains several other neuronal cell types that include specialized olfactory sensory neurons 56 such as the guanylyl cyclase-D (GC-D) neurons of the necklace olfactory system [17; 18; 19], 57 microvillar cells (MVCs)[20], sensory neurons of the septal organ (SO) [21], the Grueneberg 58 ganglion (GG) [22; 23; 24; 25; 26], and cells forming the terminal nerve ganglion (TN) [27; 28; 29; 59 30; 31; 32; 33; 34] including the GnRH-1 ns [14; 15]. The mechanisms and molecules that drive 60 progenitors of the developing olfactory pit into early migratory cells types remains largely 61 unknown. 62 Between E 9.5 and E10.5, the OPs begin to ingress to form the olfactory pits that give rise to 63 various cellular components of the nose during development [6; 35]. The olfactory pit is largely 64 populated by proliferative progenitors expressing the transcription factors Hes1+/Hes5. These 65 early progenitors undergo mitosis in the apical portion of the epithelium and give rise over time 66 to neurogenic progenitors positive for the bHLH transcription factor Ascl-1 [35; 36; 37; 38]. Gli3 67 influences proliferative Hes1+ positive progenitors to give rise to Ascl-1+ neurogenic progenitors 68 that eventually generate olfactory sensory neurons (OSNs) and vomeronasal sensory neurons 69 (VSNs) [36; 37]. Notably, Gli3 loss of function does not prevent neurogenesis of GnRH-1 70 neurons (GnRH-1ns), suggesting that these have a distinct lineage from the olfactory neurons. bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 71 GnRH-1ns are the initial neuronal population to form in the developing olfactory pit [12; 14]. 72 During embryonic development, GnRH1ns migrate along the axons of the terminal nerve [28] 73 from the nasal area to the basal forebrain. Once in brain the GnRH-1ns control the release of 74 gonadotropins from the pituitary gland [39]. Aberrant development or function of GnRH-1ns 75 causes hypogonadotropic hypogonadism (HH) [40], that can lead to a spectrum of reproductive 76 disorders [41]. GnRH-1 neuronal migration strictly depends on correct development and 77 maturation of the neural crest derived olfactory ensheathing cells [42; 43; 44; 45]. Cre genetic 78 lineage tracing and bac transgenic reporters have revealed extensive genetic heterogeneity 79 among neurons that originate in the olfactory area of mice including the GnRHns, suggesting a 80 potential integration of neural crest cells in the developing OP [28; 46; 47; 48; 49]. However, the 81 mechanisms that give rise to the GnRH neurons and the required transcription factors for these 82 regulatory processes remain unresolved. 83 The LIM-homeodomain transcription factor Isl1 has been recently identified in subsets of neuronal 84 derivatives forming from the olfactory placode [49; 50; 51]. Isl1/2 expression occurs in GnRH 85 expressing neurons and other putative neurons of the terminal nerve [49; 50; 51; 52] in chick, 86 zebrafish, mouse, and humans. In zebrafish [50], Isl1/2 is expressed in terminal nerve GnRH-3 87 neurons associated with the olfactory epithelium. These neuro-modulatory cells, which are non- 88 migratory in fish, exert the same physiological function as migratory GnRH-1 neurons in mice [39]. 89 The terminal nerve and migratory mass in birds contains heterogeneous populations of cells that 90 1) express GnRH-1 but are negative for Isl1/2 and Lhx2, 2) cells only expressing Lhx2, 3) cells 91 only positive for Isl1, and 4) cells that co-express Lhx2, Isl1/2, GnRH-1 [51]. In birds, cells from 92 the terminal nerve ganglion (TN) are also positive for Isl1 and Lhx2 that differ from the GnRH- 93 1ns. A third study in mouse [49] also confirmed Isl1/2 immuno-reactivity GnRH-1ns at early stages 94 of GnRH neuronal development (E11.5). A subset of GnRH-1ns, positive for Wnt1Cre genetic 95 lineage [46], were negative for Isl1 immunoreactivity. 96 One prediction is that Wnt1Cre tracing, a controversial neural crest marker, and Isl1 97 immunoreactivity define two distinct embryonic lineages for GnRH-1ns. The rival hypothesis is 98 that the Wnt1Cre positive subpopulation of GnRH-1ns differ in its timing and/or expression levels 99 of Isl1 from the majority of GnRH-1ns [46; 49]. Understanding the molecular cascade that 100 establishes the genetic lineage of different cell types is a fundamental step to identify potential 101 cellular differences between cell types and to unravel the molecular mechanisms underlying 102 neurodevelopmental pathologies. Here, we examined which regions in the OP express Isl1/2 and 103 and analyzed Isl1 genetic lineage in different neuronal types in the nasal area of mice. We further 104 generated Isl1 conditional KO mice to study the role of Isl1 in GnRH development . bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.276360; this version posted August 31, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 105 106 MATERIAL AND METHODS 107 108 Animals: Isl1flox(Isl1tm2Sev/J) [53]; Isl1CreERT(Isl1tm1(cre/Esr1*)Krc/SevJ) [54], Isl1Cre 109 (Isl1tm1(cre)Sev/J) [55] Rosa26tdTomato (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J) 110 [56] and GnRH-Cre (Gnrh1-cre 1Dlc/J) [57] mouse lines were all purchased from JAX.
Load more

Recommended publications
  • Cyclin D1 Is a Direct Transcriptional Target of GATA3 in Neuroblastoma Tumor Cells
    Oncogene (2010) 29, 2739–2745 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc SHORT COMMUNICATION Cyclin D1 is a direct transcriptional target of GATA3 in neuroblastoma tumor cells JJ Molenaar1,2, ME Ebus1, J Koster1, E Santo1, D Geerts1, R Versteeg1 and HN Caron2 1Department of Human Genetics, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands and 2Department of Pediatric Oncology, Emma Kinderziekenhuis, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands Almost all neuroblastoma tumors express excess levels of 2000). Several checkpoints normally prevent premature Cyclin D1 (CCND1) compared to normal tissues and cell-cycle progression and cell division. The crucial G1 other tumor types. Only a small percentage of these entry point is controlled by the D-type Cyclins that can neuroblastoma tumors have high-level amplification of the activate CDK4/6 that in turn phosphorylate the pRb Cyclin D1 gene. The other neuroblastoma tumors have protein. This results in a release of the E2F transcription equally high Cyclin D1 expression without amplification. factor that causes transcriptional upregulation of Silencing of Cyclin D1 expression was previously found to numerous genes involved in further progression of the trigger differentiation of neuroblastoma cells. Over- cell cycle (Sherr, 1996). expression of Cyclin D1 is therefore one of the most Neuroblastomas are embryonal tumors that originate frequent mechanisms with a postulated function in neuro- from precursor cells of the sympathetic nervous system. blastoma pathogenesis. The cause for the Cyclin D1 This tumor has a very poor prognosis and despite the overexpression is unknown.
    [Show full text]
  • Characterization of BRCA1-Deficient Premalignant Tissues and Cancers Identifies Plekha5 As a Tumor Metastasis Suppressor
    ARTICLE https://doi.org/10.1038/s41467-020-18637-9 OPEN Characterization of BRCA1-deficient premalignant tissues and cancers identifies Plekha5 as a tumor metastasis suppressor Jianlin Liu1,2, Ragini Adhav1,2, Kai Miao1,2, Sek Man Su1,2, Lihua Mo1,2, Un In Chan1,2, Xin Zhang1,2, Jun Xu1,2, Jianjie Li1,2, Xiaodong Shu1,2, Jianming Zeng 1,2, Xu Zhang1,2, Xueying Lyu1,2, Lakhansing Pardeshi1,3, ✉ ✉ Kaeling Tan1,3, Heng Sun1,2, Koon Ho Wong 1,3, Chuxia Deng 1,2 & Xiaoling Xu 1,2 1234567890():,; Single-cell whole-exome sequencing (scWES) is a powerful approach for deciphering intra- tumor heterogeneity and identifying cancer drivers. So far, however, simultaneous analysis of single nucleotide variants (SNVs) and copy number variations (CNVs) of a single cell has been challenging. By analyzing SNVs and CNVs simultaneously in bulk and single cells of premalignant tissues and tumors from mouse and human BRCA1-associated breast cancers, we discover an evolution process through which the tumors initiate from cells with SNVs affecting driver genes in the premalignant stage and malignantly progress later via CNVs acquired in chromosome regions with cancer driver genes. These events occur randomly and hit many putative cancer drivers besides p53 to generate unique genetic and pathological features for each tumor. Upon this, we finally identify a tumor metastasis suppressor Plekha5, whose deficiency promotes cancer metastasis to the liver and/or lung. 1 Cancer Centre, Faculty of Health Sciences, University of Macau, Macau, SAR, China. 2 Centre for Precision Medicine Research and Training, Faculty of Health Sciences, University of Macau, Macau, SAR, China.
    [Show full text]
  • Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
    Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients.
    [Show full text]
  • The GATA2 Transcription Factor Negatively Regulates the Proliferation of Neuronal Progenitors
    RESEARCH ARTICLE 2155 Development 133, 2155-2165 (2006) doi:10.1242/dev.02377 The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors Abeer El Wakil*, Cédric Francius*,†, Annie Wolff, Jocelyne Pleau-Varet† and Jeannette Nardelli†,§ Postmitotic neurons are produced from a pool of cycling progenitors in an orderly fashion that requires proper spatial and temporal coordination of proliferation, fate determination, differentiation and morphogenesis. This probably relies on complex interplay between mechanisms that control cell cycle, specification and differentiation. In this respect, we have studied the possible implication of GATA2, a transcription factor that is involved in several neuronal specification pathways, in the control of the proliferation of neural progenitors in the embryonic spinal cord. Using gain- and loss-of-function manipulations, we have shown that Gata2 can drive neural progenitors out of the cycle and, to some extent, into differentiation. This correlates with the control of cyclin D1 transcription and of the expression of the p27/Kip1 protein. Interestingly, this functional aspect is not only associated with silencing of the Notch pathway but also appears to be independent of proneural function. Consistently, GATA2 also controls the proliferation capacity of mouse embryonic neuroepithelial cells in culture. Indeed, Gata2 inactivation enhances the proliferation rate in these cells. By contrast, GATA2 overexpression is sufficient to force such cells and neuroblastoma cells to stop dividing but not to drive either type of cell into differentiation. Furthermore, a non-cell autonomous effect of Gata2 expression was observed in vivo as well as in vitro. Hence, our data have provided evidence for the ability of Gata2 to inhibit the proliferation of neural progenitors, and they further suggest that, in this regard, Gata2 can operate independently of neuronal differentiation.
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]
  • Development and Validation of a Novel Immune-Related Prognostic Model
    Wang et al. J Transl Med (2020) 18:67 https://doi.org/10.1186/s12967-020-02255-6 Journal of Translational Medicine RESEARCH Open Access Development and validation of a novel immune-related prognostic model in hepatocellular carcinoma Zheng Wang1, Jie Zhu1, Yongjuan Liu3, Changhong Liu2, Wenqi Wang2, Fengzhe Chen1* and Lixian Ma1* Abstract Background: Growing evidence has suggested that immune-related genes play crucial roles in the development and progression of hepatocellular carcinoma (HCC). Nevertheless, the utility of immune-related genes for evaluating the prognosis of HCC patients are still lacking. The study aimed to explore gene signatures and prognostic values of immune-related genes in HCC. Methods: We comprehensively integrated gene expression data acquired from 374 HCC and 50 normal tissues in The Cancer Genome Atlas (TCGA). Diferentially expressed genes (DEGs) analysis and univariate Cox regression analysis were performed to identify DEGs that related to overall survival. An immune prognostic model was constructed using the Lasso and multivariate Cox regression analyses. Furthermore, Cox regression analysis was applied to identify independent prognostic factors in HCC. The correlation analysis between immune-related signature and immune cells infltration were also investigated. Finally, the signature was validated in an external independent dataset. Results: A total of 329 diferentially expressed immune‐related genes were detected. 64 immune‐related genes were identifed to be markedly related to overall survival in HCC patients using univariate Cox regression analysis. Then we established a TF-mediated network for exploring the regulatory mechanisms of these genes. Lasso and multivariate Cox regression analyses were applied to construct the immune-based prognostic model, which consisted of nine immune‐related genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga
    doi:10.1111/j.1741-4520.2009.00266.x Congenital Anomalies 2010; 50, 1–7 1 REVIEW ARTICLE Birth defects caused by mutations in human GLI3 and mouse Gli3 genescga_ 266 1..71..7 Ichiro Naruse1, Etsuko Ueta1, Yoshiki Sumino1, Masaya Ogawa1, and Satoshi Ishikiriyama2 1School of Health Science, Faculty of Medicine, Tottori University, Yonago, and 2Division of Clinical Genetics and Cytogenetics, Shizuoka Children’s Hospital, Shizuoka, Japan ABSTRACT GLI3 is the gene responsible for Greig cepha- type-A (PAP-A) and preaxial polydactyly type-IV (PPD-IV). A lopolysyndactyly syndrome (GCPS), Pallister–Hall syndrome mimic phenomenon is observed in mice. Investigation of human (PHS) and Postaxial polydactyly type-A (PAP-A). Genetic poly- GLI3 and Gli3 genes has progressed using the knowledge of dactyly mice such as Pdn/Pdn (Polydactyly Nagoya), XtH/XtH Cubitus interruptus (Ci) in Drosophila, a homologous gene of GLI3 (Extra toes) and XtJ/XtJ (Extra toes Jackson) are the mouse and Gli3 genes. These genes have been highly conserved in the homolog of GCPS, and Gli3tmlUrtt/Gli3tmlUrt is produced as the animal kingdom throughout evolution. Now, a lot of mutant mice of mouse homolog of PHS. In the present review, relationships Gli3 gene have been known and knockout mice have been pro- between mutation points of GLI3 and Gli3, and resulting phe- duced. It is expected that the knowledge obtained from mutant and notypes in humans and mice are described. It has been con- knockout mice will be extrapolated to the manifestation mecha- firmed that mutation in the upstream or within the zinc finger nisms in human diseases to understand the diseases caused by the domain of the GLI3 gene induces GCPS; that in the post-zinc mutations in GLI3 gene.
    [Show full text]
  • Ablation of Ezh2 in Neural Crest Cells Leads to Hirschsprung's Disease-Like Phenotype in Mice
    bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ablation of Ezh2 in neural crest cells leads to Hirschsprung’s disease-like phenotype in mice Hana Kim, Ingeborg M. Langohr, Mohammad Faisal, Margaret McNulty, Caitlin Thorn, Joomyeong Kim* Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA. Correspondence should be forwarded to: [email protected], 225-578-7692(ph), or 225-578-2597(fax) Running title: Function of Ezh2 in enteric neural crest cell development 1 bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract In the current study, we examined the role of Ezh2 as an epigenetic modifier for the enteric neural crest cell development through H3K27me3. Ezh2 conditional null mice were viable up to birth, but died within the first hour of life. In addition to craniofacial defects, Ezh2 conditional null mice displayed reduced number of ganglion cells in the enteric nervous system. RT-PCR and ChIP assays indicated aberrant up-regulation of Zic1, Pax3, and Sox10 and loss of H3K27me3 marks in the promoter regions of these genes in the myenteric plexus. Overall, these results suggest that Ezh2 is an important epigenetic modifier for the enteric neural crest cell development through repression of Zic1, Pax3, and Sox10.
    [Show full text]
  • To Proliferate Or to Die: Role of Id3 in Cell Cycle Progression and Survival of Neural Crest Progenitors
    Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors Yun Kee and Marianne Bronner-Fraser1 Division of Biology, California Institute of Technology, Pasadena, California 91125, USA The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix–loop–helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. [Keywords: Xenopus; Id3; neural crest; cell cycle; survival] Received September 1, 2004; revised version accepted January 19, 2005. The neural crest is an embryonic cell population that origi- et al. 2003), c-Myc (Bellmeyer et al. 2003), and Msx1 nates from the lateral edges of the neural plate during (Tribulo et al. 2003) have been identified in Xenopus nervous system formation.
    [Show full text]
  • Whole-Genome Cartography of Estrogen Receptor a Binding Sites
    Whole-Genome Cartography of Estrogen Receptor a Binding Sites Chin-Yo Lin1[¤, Vinsensius B. Vega1[, Jane S. Thomsen1, Tao Zhang1, Say Li Kong1, Min Xie1, Kuo Ping Chiu1, Leonard Lipovich1, Daniel H. Barnett2, Fabio Stossi2, Ailing Yeo3, Joshy George1, Vladimir A. Kuznetsov1, Yew Kok Lee1, Tze Howe Charn1, Nallasivam Palanisamy1, Lance D. Miller1, Edwin Cheung1,3, Benita S. Katzenellenbogen2, Yijun Ruan1, Guillaume Bourque1, Chia-Lin Wei1, Edison T. Liu1* 1 Genome Institute of Singapore, Singapore, Republic of Singapore, 2 Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of America, 3 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Republic of Singapore Using a chromatin immunoprecipitation-paired end diTag cloning and sequencing strategy, we mapped estrogen receptor a (ERa) binding sites in MCF-7 breast cancer cells. We identified 1,234 high confidence binding clusters of which 94% are projected to be bona fide ERa binding regions. Only 5% of the mapped estrogen receptor binding sites are located within 5 kb upstream of the transcriptional start sites of adjacent genes, regions containing the proximal promoters, whereas vast majority of the sites are mapped to intronic or distal locations (.5 kb from 59 and 39 ends of adjacent transcript), suggesting transcriptional regulatory mechanisms over significant physical distances. Of all the identified sites, 71% harbored putative full estrogen response elements (EREs), 25% bore ERE half sites, and only 4% had no recognizable ERE sequences. Genes in the vicinity of ERa binding sites were enriched for regulation by estradiol in MCF-7 cells, and their expression profiles in patient samples segregate ERa-positive from ERa-negative breast tumors.
    [Show full text]
  • GATA Factors and Hindbrain Development 5525
    Development 126, 5523-5531 (1999) 5523 Printed in Great Britain © The Company of Biologists Limited 1999 DEV2473 The transcription factor GATA3 is a downstream effector of Hoxb1 specification in rhombomere 4 Illar Pata1,‡, Michèle Studer2,‡, J. Hikke van Doorninck3,*, James Briscoe4, Sulev Kuuse1, J. Douglas Engel5, Frank Grosveld3 and Alar Karis1,3,¶ 1Institute of Molecular and Cell Biology, University of Tartu, 23 Riia St, 51010 Tartu, Estonia 2Department of Developmental Neurobiology, King’s College London, 4th Floor, New Hunts House, Guy’s Hospital, London SE1 9RT, UK 3Department of Cell Biology and Genetics, Erasmus University Rotterdam, PO Box 1738, 3000 DR Rotterdam, The Netherlands 4Department of Biochemistry and Molecular Biophysics, Howard Hughes Medical Institute, Columbia University, New York, NY10032, USA 5Department of Biochemistry, Molecular Biology and Cell Biology, North Western University, Evanston, IL 60208 USA *Present address: Rudolf Magnus Institute for Neurosciences, Utrecht University, The Netherlands ‡These authors contributed equally to this work ¶Author for correspondence at address 1 (e-mail: [email protected]) Accepted 15 September; published on WWW 9 November 1999 SUMMARY In this paper, we show that the transcription factor GATA3 Hoxb1-deficient mice. Ubiquitous expression of Hoxb1 in is dynamically expressed during hindbrain development. the hindbrain induces ectopic expression of GATA2 and Function of GATA3 in ventral rhombomere (r) 4 is GATA3 in ventral r2 and r3. These findings demonstrate dependent on functional GATA2, which in turn is under the that GATA2 and GATA3 lie downstream of Hoxb1 and control of Hoxb1. In particular, the absence of Hoxb1 provide the first example of Hox pathway transcription results in the loss of GATA2 expression in r4 and the factors within a defined population of vertebrate motor absence of GATA2 results in the loss of GATA3 expression.
    [Show full text]