Identifying Isl1 Genetic Lineage in the Developing Olfactory System and in Gnrh-1 Neurons 2 3 Ed Zandro M
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Cyclin D1 Is a Direct Transcriptional Target of GATA3 in Neuroblastoma Tumor Cells
Oncogene (2010) 29, 2739–2745 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 $32.00 www.nature.com/onc SHORT COMMUNICATION Cyclin D1 is a direct transcriptional target of GATA3 in neuroblastoma tumor cells JJ Molenaar1,2, ME Ebus1, J Koster1, E Santo1, D Geerts1, R Versteeg1 and HN Caron2 1Department of Human Genetics, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands and 2Department of Pediatric Oncology, Emma Kinderziekenhuis, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands Almost all neuroblastoma tumors express excess levels of 2000). Several checkpoints normally prevent premature Cyclin D1 (CCND1) compared to normal tissues and cell-cycle progression and cell division. The crucial G1 other tumor types. Only a small percentage of these entry point is controlled by the D-type Cyclins that can neuroblastoma tumors have high-level amplification of the activate CDK4/6 that in turn phosphorylate the pRb Cyclin D1 gene. The other neuroblastoma tumors have protein. This results in a release of the E2F transcription equally high Cyclin D1 expression without amplification. factor that causes transcriptional upregulation of Silencing of Cyclin D1 expression was previously found to numerous genes involved in further progression of the trigger differentiation of neuroblastoma cells. Over- cell cycle (Sherr, 1996). expression of Cyclin D1 is therefore one of the most Neuroblastomas are embryonal tumors that originate frequent mechanisms with a postulated function in neuro- from precursor cells of the sympathetic nervous system. blastoma pathogenesis. The cause for the Cyclin D1 This tumor has a very poor prognosis and despite the overexpression is unknown. -
Characterization of BRCA1-Deficient Premalignant Tissues and Cancers Identifies Plekha5 As a Tumor Metastasis Suppressor
ARTICLE https://doi.org/10.1038/s41467-020-18637-9 OPEN Characterization of BRCA1-deficient premalignant tissues and cancers identifies Plekha5 as a tumor metastasis suppressor Jianlin Liu1,2, Ragini Adhav1,2, Kai Miao1,2, Sek Man Su1,2, Lihua Mo1,2, Un In Chan1,2, Xin Zhang1,2, Jun Xu1,2, Jianjie Li1,2, Xiaodong Shu1,2, Jianming Zeng 1,2, Xu Zhang1,2, Xueying Lyu1,2, Lakhansing Pardeshi1,3, ✉ ✉ Kaeling Tan1,3, Heng Sun1,2, Koon Ho Wong 1,3, Chuxia Deng 1,2 & Xiaoling Xu 1,2 1234567890():,; Single-cell whole-exome sequencing (scWES) is a powerful approach for deciphering intra- tumor heterogeneity and identifying cancer drivers. So far, however, simultaneous analysis of single nucleotide variants (SNVs) and copy number variations (CNVs) of a single cell has been challenging. By analyzing SNVs and CNVs simultaneously in bulk and single cells of premalignant tissues and tumors from mouse and human BRCA1-associated breast cancers, we discover an evolution process through which the tumors initiate from cells with SNVs affecting driver genes in the premalignant stage and malignantly progress later via CNVs acquired in chromosome regions with cancer driver genes. These events occur randomly and hit many putative cancer drivers besides p53 to generate unique genetic and pathological features for each tumor. Upon this, we finally identify a tumor metastasis suppressor Plekha5, whose deficiency promotes cancer metastasis to the liver and/or lung. 1 Cancer Centre, Faculty of Health Sciences, University of Macau, Macau, SAR, China. 2 Centre for Precision Medicine Research and Training, Faculty of Health Sciences, University of Macau, Macau, SAR, China. -
Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients. -
The GATA2 Transcription Factor Negatively Regulates the Proliferation of Neuronal Progenitors
RESEARCH ARTICLE 2155 Development 133, 2155-2165 (2006) doi:10.1242/dev.02377 The GATA2 transcription factor negatively regulates the proliferation of neuronal progenitors Abeer El Wakil*, Cédric Francius*,†, Annie Wolff, Jocelyne Pleau-Varet† and Jeannette Nardelli†,§ Postmitotic neurons are produced from a pool of cycling progenitors in an orderly fashion that requires proper spatial and temporal coordination of proliferation, fate determination, differentiation and morphogenesis. This probably relies on complex interplay between mechanisms that control cell cycle, specification and differentiation. In this respect, we have studied the possible implication of GATA2, a transcription factor that is involved in several neuronal specification pathways, in the control of the proliferation of neural progenitors in the embryonic spinal cord. Using gain- and loss-of-function manipulations, we have shown that Gata2 can drive neural progenitors out of the cycle and, to some extent, into differentiation. This correlates with the control of cyclin D1 transcription and of the expression of the p27/Kip1 protein. Interestingly, this functional aspect is not only associated with silencing of the Notch pathway but also appears to be independent of proneural function. Consistently, GATA2 also controls the proliferation capacity of mouse embryonic neuroepithelial cells in culture. Indeed, Gata2 inactivation enhances the proliferation rate in these cells. By contrast, GATA2 overexpression is sufficient to force such cells and neuroblastoma cells to stop dividing but not to drive either type of cell into differentiation. Furthermore, a non-cell autonomous effect of Gata2 expression was observed in vivo as well as in vitro. Hence, our data have provided evidence for the ability of Gata2 to inhibit the proliferation of neural progenitors, and they further suggest that, in this regard, Gata2 can operate independently of neuronal differentiation. -
Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007). -
Development and Validation of a Novel Immune-Related Prognostic Model
Wang et al. J Transl Med (2020) 18:67 https://doi.org/10.1186/s12967-020-02255-6 Journal of Translational Medicine RESEARCH Open Access Development and validation of a novel immune-related prognostic model in hepatocellular carcinoma Zheng Wang1, Jie Zhu1, Yongjuan Liu3, Changhong Liu2, Wenqi Wang2, Fengzhe Chen1* and Lixian Ma1* Abstract Background: Growing evidence has suggested that immune-related genes play crucial roles in the development and progression of hepatocellular carcinoma (HCC). Nevertheless, the utility of immune-related genes for evaluating the prognosis of HCC patients are still lacking. The study aimed to explore gene signatures and prognostic values of immune-related genes in HCC. Methods: We comprehensively integrated gene expression data acquired from 374 HCC and 50 normal tissues in The Cancer Genome Atlas (TCGA). Diferentially expressed genes (DEGs) analysis and univariate Cox regression analysis were performed to identify DEGs that related to overall survival. An immune prognostic model was constructed using the Lasso and multivariate Cox regression analyses. Furthermore, Cox regression analysis was applied to identify independent prognostic factors in HCC. The correlation analysis between immune-related signature and immune cells infltration were also investigated. Finally, the signature was validated in an external independent dataset. Results: A total of 329 diferentially expressed immune‐related genes were detected. 64 immune‐related genes were identifed to be markedly related to overall survival in HCC patients using univariate Cox regression analysis. Then we established a TF-mediated network for exploring the regulatory mechanisms of these genes. Lasso and multivariate Cox regression analyses were applied to construct the immune-based prognostic model, which consisted of nine immune‐related genes. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga
doi:10.1111/j.1741-4520.2009.00266.x Congenital Anomalies 2010; 50, 1–7 1 REVIEW ARTICLE Birth defects caused by mutations in human GLI3 and mouse Gli3 genescga_ 266 1..71..7 Ichiro Naruse1, Etsuko Ueta1, Yoshiki Sumino1, Masaya Ogawa1, and Satoshi Ishikiriyama2 1School of Health Science, Faculty of Medicine, Tottori University, Yonago, and 2Division of Clinical Genetics and Cytogenetics, Shizuoka Children’s Hospital, Shizuoka, Japan ABSTRACT GLI3 is the gene responsible for Greig cepha- type-A (PAP-A) and preaxial polydactyly type-IV (PPD-IV). A lopolysyndactyly syndrome (GCPS), Pallister–Hall syndrome mimic phenomenon is observed in mice. Investigation of human (PHS) and Postaxial polydactyly type-A (PAP-A). Genetic poly- GLI3 and Gli3 genes has progressed using the knowledge of dactyly mice such as Pdn/Pdn (Polydactyly Nagoya), XtH/XtH Cubitus interruptus (Ci) in Drosophila, a homologous gene of GLI3 (Extra toes) and XtJ/XtJ (Extra toes Jackson) are the mouse and Gli3 genes. These genes have been highly conserved in the homolog of GCPS, and Gli3tmlUrtt/Gli3tmlUrt is produced as the animal kingdom throughout evolution. Now, a lot of mutant mice of mouse homolog of PHS. In the present review, relationships Gli3 gene have been known and knockout mice have been pro- between mutation points of GLI3 and Gli3, and resulting phe- duced. It is expected that the knowledge obtained from mutant and notypes in humans and mice are described. It has been con- knockout mice will be extrapolated to the manifestation mecha- firmed that mutation in the upstream or within the zinc finger nisms in human diseases to understand the diseases caused by the domain of the GLI3 gene induces GCPS; that in the post-zinc mutations in GLI3 gene. -
Ablation of Ezh2 in Neural Crest Cells Leads to Hirschsprung's Disease-Like Phenotype in Mice
bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Ablation of Ezh2 in neural crest cells leads to Hirschsprung’s disease-like phenotype in mice Hana Kim, Ingeborg M. Langohr, Mohammad Faisal, Margaret McNulty, Caitlin Thorn, Joomyeong Kim* Department of Biological Sciences, Louisiana State University, Baton Rouge, LA 70803, USA. Correspondence should be forwarded to: [email protected], 225-578-7692(ph), or 225-578-2597(fax) Running title: Function of Ezh2 in enteric neural crest cell development 1 bioRxiv preprint doi: https://doi.org/10.1101/265868; this version posted February 15, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract In the current study, we examined the role of Ezh2 as an epigenetic modifier for the enteric neural crest cell development through H3K27me3. Ezh2 conditional null mice were viable up to birth, but died within the first hour of life. In addition to craniofacial defects, Ezh2 conditional null mice displayed reduced number of ganglion cells in the enteric nervous system. RT-PCR and ChIP assays indicated aberrant up-regulation of Zic1, Pax3, and Sox10 and loss of H3K27me3 marks in the promoter regions of these genes in the myenteric plexus. Overall, these results suggest that Ezh2 is an important epigenetic modifier for the enteric neural crest cell development through repression of Zic1, Pax3, and Sox10. -
To Proliferate Or to Die: Role of Id3 in Cell Cycle Progression and Survival of Neural Crest Progenitors
Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors Yun Kee and Marianne Bronner-Fraser1 Division of Biology, California Institute of Technology, Pasadena, California 91125, USA The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix–loop–helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. [Keywords: Xenopus; Id3; neural crest; cell cycle; survival] Received September 1, 2004; revised version accepted January 19, 2005. The neural crest is an embryonic cell population that origi- et al. 2003), c-Myc (Bellmeyer et al. 2003), and Msx1 nates from the lateral edges of the neural plate during (Tribulo et al. 2003) have been identified in Xenopus nervous system formation. -
Whole-Genome Cartography of Estrogen Receptor a Binding Sites
Whole-Genome Cartography of Estrogen Receptor a Binding Sites Chin-Yo Lin1[¤, Vinsensius B. Vega1[, Jane S. Thomsen1, Tao Zhang1, Say Li Kong1, Min Xie1, Kuo Ping Chiu1, Leonard Lipovich1, Daniel H. Barnett2, Fabio Stossi2, Ailing Yeo3, Joshy George1, Vladimir A. Kuznetsov1, Yew Kok Lee1, Tze Howe Charn1, Nallasivam Palanisamy1, Lance D. Miller1, Edwin Cheung1,3, Benita S. Katzenellenbogen2, Yijun Ruan1, Guillaume Bourque1, Chia-Lin Wei1, Edison T. Liu1* 1 Genome Institute of Singapore, Singapore, Republic of Singapore, 2 Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of America, 3 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Republic of Singapore Using a chromatin immunoprecipitation-paired end diTag cloning and sequencing strategy, we mapped estrogen receptor a (ERa) binding sites in MCF-7 breast cancer cells. We identified 1,234 high confidence binding clusters of which 94% are projected to be bona fide ERa binding regions. Only 5% of the mapped estrogen receptor binding sites are located within 5 kb upstream of the transcriptional start sites of adjacent genes, regions containing the proximal promoters, whereas vast majority of the sites are mapped to intronic or distal locations (.5 kb from 59 and 39 ends of adjacent transcript), suggesting transcriptional regulatory mechanisms over significant physical distances. Of all the identified sites, 71% harbored putative full estrogen response elements (EREs), 25% bore ERE half sites, and only 4% had no recognizable ERE sequences. Genes in the vicinity of ERa binding sites were enriched for regulation by estradiol in MCF-7 cells, and their expression profiles in patient samples segregate ERa-positive from ERa-negative breast tumors. -
GATA Factors and Hindbrain Development 5525
Development 126, 5523-5531 (1999) 5523 Printed in Great Britain © The Company of Biologists Limited 1999 DEV2473 The transcription factor GATA3 is a downstream effector of Hoxb1 specification in rhombomere 4 Illar Pata1,‡, Michèle Studer2,‡, J. Hikke van Doorninck3,*, James Briscoe4, Sulev Kuuse1, J. Douglas Engel5, Frank Grosveld3 and Alar Karis1,3,¶ 1Institute of Molecular and Cell Biology, University of Tartu, 23 Riia St, 51010 Tartu, Estonia 2Department of Developmental Neurobiology, King’s College London, 4th Floor, New Hunts House, Guy’s Hospital, London SE1 9RT, UK 3Department of Cell Biology and Genetics, Erasmus University Rotterdam, PO Box 1738, 3000 DR Rotterdam, The Netherlands 4Department of Biochemistry and Molecular Biophysics, Howard Hughes Medical Institute, Columbia University, New York, NY10032, USA 5Department of Biochemistry, Molecular Biology and Cell Biology, North Western University, Evanston, IL 60208 USA *Present address: Rudolf Magnus Institute for Neurosciences, Utrecht University, The Netherlands ‡These authors contributed equally to this work ¶Author for correspondence at address 1 (e-mail: [email protected]) Accepted 15 September; published on WWW 9 November 1999 SUMMARY In this paper, we show that the transcription factor GATA3 Hoxb1-deficient mice. Ubiquitous expression of Hoxb1 in is dynamically expressed during hindbrain development. the hindbrain induces ectopic expression of GATA2 and Function of GATA3 in ventral rhombomere (r) 4 is GATA3 in ventral r2 and r3. These findings demonstrate dependent on functional GATA2, which in turn is under the that GATA2 and GATA3 lie downstream of Hoxb1 and control of Hoxb1. In particular, the absence of Hoxb1 provide the first example of Hox pathway transcription results in the loss of GATA2 expression in r4 and the factors within a defined population of vertebrate motor absence of GATA2 results in the loss of GATA3 expression.