Sox10 Has a Broad Expression Pattern in Gliomas and Enhances Platelet-Derived Growth Factor-B–Induced Gliomagenesis

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Sox10 Has a Broad Expression Pattern in Gliomas and Enhances Platelet-Derived Growth Factor-B–Induced Gliomagenesis Maria Ferletta, Lene Uhrbom, Tommie Olofsson, Fredrik Ponte´n, and Bengt Westermark Department of Genetics and Pathology, Rudbeck Laboratory, Uppsala, Sweden Abstract without any known intermediate stages of the tumor, whereas In a previously published insertional mutagenesis screen secondary glioblastoma arises by progression from a lower for candidate brain tumor genes in the mouse using a grade to a higher tumor grade. Common genetic alterations in Moloney mouse leukemia virus encodingplatelet-derived primary glioblastoma are amplification of EGFR and MDM2 growth factor (PDGF)-B, the Sox10 gene was tagged in and deletions of the INK4A gene (1, 2). During the progression five independent tumors. The proviral integrations of secondary glioblastoma, mutations accumulate over time suggest an enhancer effect on Sox10. All Moloney murine and more than 65% of the tumors have mutations in TRP53. leukemia virus/PDGFB tumors had a high protein Overexpression of the platelet-derived growth factor receptor-a expression of Sox10 independently of malignant grade (PDGFRA) and PDGFA are characteristic for secondary glio- or tumor type. To investigate the role of Sox10 in blastoma (3). Constitutive expression of growth factors and gliomagenesis, we used the RCAS/tv-a mouse model in their receptors has been shown to be necessary for the develop- which the expression of retroviral-encoded genes can be ment of brain tumors resulting in autocrine stimulation and directed to glial progenitor cells (Ntv-a mice). Both Ntv-a increased activity of downstream pathways (4). Inactivation transgenic mice, wild-type, and Ntv-a p19Arf null mice of the tumor suppressor gene phosphatase and tensin homo- were injected with RCAS-SOX10 alone or in combination logue (PTEN; refs. 5, 6) is another common trait of glio- with RCAS-PDGFB. Infection with RCAS-SOX10 alone blastoma. PTEN signals through Akt and many glioblastomas did not induce any gliomas. Combined infection of have an increased activity of Akt (7). RCAS-SOX10 and RCAS-PDGFB in wild-type Ntv-a mice To better understand the role of PDGF in gliomagenesis, we yielded a tumor frequency of 12%, and in Ntv-a ArfÀ/À have generated a mouse glioma model in which a Moloney mice the tumor frequency was 30%. This indicates that murine leukemia virus (MMLV)/PDGFB–containing retrovirus Sox10 alone is not sufficient to induce gliomagenesis but (MMLV/PDGFB) together with a replication-competent helper acts synergistically with PDGFB in glioma development. virus was injected into newborn mouse brains, which resulted All induced tumors displayed characteristics of in malignant brain tumors (8). All tumors grew invasively and PNET-like structures and oligodendroglioma. The tumors diffusely, and most of them had areas of necrosis and had a strongand widely distributed expression of angiogenesis. The tumors stained positively for nestin, Sox10 and PDGFR-A. We investigated the expression suggesting that they had evolved from an immature neuroglial of Sox10 in other human tumors and in a number of progenitor cell (8). We have postulated that the tumors gliomas. The Sox10 expression was restricted to gliomas developed through an autocrine PDGF receptor activation in and melanomas. All glioma types expressed Sox10, combination with insertional mutagenesis through proviral and tumors of low-grade glioma had a much broader integrations. A number of common proviral integration sites distribution of Sox10 compared with high-grade gliomas. were identified, targeting candidate tumor-causing genes (9). (Mol Cancer Res 2007;5(9):891–7) One of the tagged genes was Sox10. Sox10 is a transcription factor and belongs to the Sox superfamily, which all contain a Introduction DNA binding motif known as the high-mobility group domain. Glioblastoma is the most common and malignant primary During development, Sox10 first appears in the developing brain tumor in the adult, with a mean survival time after neural crest and is expressed during the formation of the diagnosis of 1 year. Primary glioblastoma develops de novo peripheral nervous system (10). In central nervous system, Sox10 was first found on glial progenitor cells but later also detected in oligodendrocytes in the adult brain (11). Sox10 Received 3/6/07; revised 5/7/07; accepted 5/31/07. precedes the expression of PDGFR-a in oligodendrocyte Grant support: The Swedish Cancer Society and the Swedish Children’s Cancer precursors, but once the PDGFR-a is expressed, they are Foundation. Sox10 null The costs of publication of this article were defrayed in part by the payment of found in the same cells (12). Homozygous mice die page charges. This article must therefore be hereby marked advertisement in before or at birth. The entire peripheral nervous system is accordance with 18 U.S.C. Section 1734 solely to indicate this fact. defective and motor neurons are absent (13). The levels of Requests for reprints: Maria Ferletta, Department of Genetics and Pathology, Uppsala University, Rudbeck Laboratory C11, Dag Hammarskjoldsv 20, S-751 PDGFR-a are reduced, suggesting that Sox10 influences the 85 Uppsala, Sweden. Phone: 46-18-611-1174; Fax: 46-18-55-89-31. E-mail: expression of PDGFR-a (12). In human, mutations in the [email protected] SOX10 Copyright D 2007 American Association for Cancer Research. gene have been linked to Waardenburg-Shah syndrome doi:10.1158/1541-7786.MCR-07-0113 type IV, which is characterized by depigmentation of hair and Mol Cancer Res 2007;5(9). September 2007 891 Downloaded from mcr.aacrjournals.org on September 29, 2021. © 2007 American Association for Cancer Research. 892 Ferletta et al. FIGURE 1. Schematic illustration of proviral integrations upstream of Sox10. Five proviral integrations were tagged upstream of the transcriptional start site of Sox10 in five different tumors. Arrows illustrate the position and the transcriptional orientation of the proviral genome. Data were adapted from the Ensembl Mouse Genome Browser and exact positions of the integrations can be found in the Retrovirus Tagged Cancer Gene Database (http:// RTCGD.ncifcrf.gov/). skin, and Hirschsprung’s disease (megacolon; ref. 14). PDGFB–induced tumors (9). The proviral integration sites Mutations in SOX10 in combination with Waardenburg-Shah were at both transcriptional orientations and located upstream syndrome type IV have also been associated with severe of Sox10 within an area of 60 kb (Fig. 1). The upstream dysmyelination syndromes (PCWH; ref. 14). Further, Sox10 is localization of the proviral insertions suggests an enhancer expressed in, and during the development of, melanocytes, effect on Sox10. which also are derived from the neural crest. During The brain tumors induced by the MMLV/PDGFB viruses melanocyte specification, Sox10 is responsible for activating were of different malignancy grades and could be divided the melanocyte transcription regulator Mitf, which controls into glioblastoma-like, oligodendroglioma-like, and PNET-like melanocyte survival and differentiation (15, 16). (primitive neuroectodermal tumor) tumors. When analyzing the In the present investigation, we have studied the role of MMLV/PDGFB tumors for Sox10 expression, we found that all Sox10 in human and mouse gliomas. For studies in the mouse, analyzed tumors had a high protein expression of Sox10, we used the RCAS/tv-a model (replication-competent avian independent of the tumor type. The protein was expressed also leukemia virus splice acceptor/avian leukemia virus receptor) in in tumors without integrations in Sox10 (Fig. 2). In addition, which the expression of retrovirus-encoded genes can be real-time PCR analysis has previously shown that Sox10 is directed either to glial progenitor cells (Ntv-a mice; mice strongly up-regulated in both early and late MMLV/PDGFB– expressing the tv-a receptor behind the nestin promoter) or induced tumors (17). astrocytes (Gtv-a mice; mice expressing tv-a by the glial fibrillary acidic protein promoter). We have found that Sox10 Sox10 Enhances PDGF-Induced Gliomagenesis has a broad distribution in different types of gliomas in both To investigate the role of Sox10 in gliomagenesis, we used human and mouse tumors. Sox10 was not able to initiate the RCAS/tv-a mouse model. Cells infected with RCAS virus tumorigenesis by itself, but in combination with an RCAS virus containing SOX10 (RCAS-SOX10) were injected intracerebral- expressing PDGFB, the tumor incidence was increased. ly in newborn mice. Both Ntv-a transgenic mice, wild-type (wt), and Ntv-a p19Arf null mice were injected with RCAS- Results SOX10 alone or in combination with RCAS-PDGFB (Table 1). Sox10 Is Highly Expressed in PDGFB-Induced Mouse Infection with RCAS-SOX10 alone did not induce any gliomas, Gliomas neither in Ntv-a wt nor in Ntv-a ArfÀ/À mice. Injections with In our previous screen for candidate glioma genes in the RCAS-PDGFB together with an empty RCAS vector (RCAS-X) mouse, Sox10 wastaggedinfiveindependentMMLV/ gave rise to 3 tumors from 37 injected mice in the Ntv-a ArfÀ/À FIGURE 2. Sox10 expression in PDGFB-induced tumors. Immunohistochemical staining of Sox10 in mouse gliomas induced with MMLV/PDGFB. A. A representative PNET-like tumor. B. A glioblastoma-like tumor. C. A PNET-like tumor in which one of the Sox10 integrations was identified. Mol Cancer Res 2007;5(9). September 2007 Downloaded from mcr.aacrjournals.org on September 29, 2021. © 2007 American Association for Cancer Research. Sox10 in Gliomagenesis 893 Table 1. Tumor Incidence in Mice Injected with Different All the tumors grew invasively and had vessel formation. The RCAS Virus in Different Combinations tumor cells were relatively small and displayed perineuronal satellitosis (Fig. 3A). All tumors showed a strong and widely Genotype RCAS No. No. Incidence P a Mice Tumors (%) distributed expression of Sox10 and PDGFR- (Fig. 3B and C). Only scattered cells in the tumors were positive for the Ntv-a wt SOX10 28 0 0 astrocytic marker GFAP (Fig.
Recommended publications
  • Neurofibromatosis Type 2 (NF2)

    Neurofibromatosis Type 2 (NF2)

    International Journal of Molecular Sciences Review Neurofibromatosis Type 2 (NF2) and the Implications for Vestibular Schwannoma and Meningioma Pathogenesis Suha Bachir 1,† , Sanjit Shah 2,† , Scott Shapiro 3,†, Abigail Koehler 4, Abdelkader Mahammedi 5 , Ravi N. Samy 3, Mario Zuccarello 2, Elizabeth Schorry 1 and Soma Sengupta 4,* 1 Department of Genetics, Cincinnati Children’s Hospital, Cincinnati, OH 45229, USA; [email protected] (S.B.); [email protected] (E.S.) 2 Department of Neurosurgery, University of Cincinnati, Cincinnati, OH 45267, USA; [email protected] (S.S.); [email protected] (M.Z.) 3 Department of Otolaryngology, University of Cincinnati, Cincinnati, OH 45267, USA; [email protected] (S.S.); [email protected] (R.N.S.) 4 Department of Neurology, University of Cincinnati, Cincinnati, OH 45267, USA; [email protected] 5 Department of Radiology, University of Cincinnati, Cincinnati, OH 45267, USA; [email protected] * Correspondence: [email protected] † These authors contributed equally. Abstract: Patients diagnosed with neurofibromatosis type 2 (NF2) are extremely likely to develop meningiomas, in addition to vestibular schwannomas. Meningiomas are a common primary brain tumor; many NF2 patients suffer from multiple meningiomas. In NF2, patients have mutations in the NF2 gene, specifically with loss of function in a tumor-suppressor protein that has a number of synonymous names, including: Merlin, Neurofibromin 2, and schwannomin. Merlin is a 70 kDa protein that has 10 different isoforms. The Hippo Tumor Suppressor pathway is regulated upstream by Merlin. This pathway is critical in regulating cell proliferation and apoptosis, characteristics that are important for tumor progression.
  • Central Nervous System Cancers Panel Members Can Be Found on Page 1151

    Central Nervous System Cancers Panel Members Can Be Found on Page 1151

    1114 NCCN David Tran, MD, PhD; Nam Tran, MD, PhD; Frank D. Vrionis, MD, MPH, PhD; Patrick Y. Wen, MD; Central Nervous Nicole McMillian, MS; and Maria Ho, PhD System Cancers Overview In 2013, an estimated 23,130 people in the United Clinical Practice Guidelines in Oncology States will be diagnosed with primary malignant brain Louis Burt Nabors, MD; Mario Ammirati, MD, MBA; and other central nervous system (CNS) neoplasms.1 Philip J. Bierman, MD; Henry Brem, MD; Nicholas Butowski, MD; These tumors will be responsible for approximately Marc C. Chamberlain, MD; Lisa M. DeAngelis, MD; 14,080 deaths. The incidence of primary brain tumors Robert A. Fenstermaker, MD; Allan Friedman, MD; Mark R. Gilbert, MD; Deneen Hesser, MSHSA, RN, OCN; has been increasing over the past 30 years, especially in Matthias Holdhoff, MD, PhD; Larry Junck, MD; elderly persons.2 Metastatic disease to the CNS occurs Ronald Lawson, MD; Jay S. Loeffler, MD; Moshe H. Maor, MD; much more frequently, with an estimated incidence ap- Paul L. Moots, MD; Tara Morrison, MD; proximately 10 times that of primary brain tumors. An Maciej M. Mrugala, MD, PhD, MPH; Herbert B. Newton, MD; Jana Portnow, MD; Jeffrey J. Raizer, MD; Lawrence Recht, MD; estimated 20% to 40% of patients with systemic cancer Dennis C. Shrieve, MD, PhD; Allen K. Sills Jr, MD; will develop brain metastases.3 Abstract Please Note Primary and metastatic tumors of the central nervous system are The NCCN Clinical Practice Guidelines in Oncology a heterogeneous group of neoplasms with varied outcomes and (NCCN Guidelines®) are a statement of consensus of the management strategies.
  • Malignant Glioma Arising at the Site of an Excised Cerebellar Hemangioblastoma After Irradiation in a Von Hippel-Lindau Disease Patient

    Malignant Glioma Arising at the Site of an Excised Cerebellar Hemangioblastoma After Irradiation in a Von Hippel-Lindau Disease Patient

    DOI 10.3349/ymj.2009.50.4.576 Case Report pISSN: 0513-5796, eISSN: 1976-2437 Yonsei Med J 50(4): 576-581, 2009 Malignant Glioma Arising at the Site of an Excised Cerebellar Hemangioblastoma after Irradiation in a von Hippel-Lindau Disease Patient Na-Hye Myong1 and Bong-Jin Park2 1Department of Pathology, Dankook University College of Medicine, Cheonan; 2Department of Neurosurgery, Kyunghee University Hospital, Seoul, Korea. We describe herein a malignant glioma arising at the site of the resected hemangioblastoma after irradiation in a patient with von Hippel-Lindau disease (VHL). The patient was a 25 year-old male with multiple heman- gioblastomas at the cerebellum and spinal cord, multiple pancreatic cysts and a renal cell carcinoma; he was diagnosed as having VHL disease. The largest hemangioblastoma at the right cerebellar hemisphere was completely removed, and he received high-dose irradiation postoperatively. The tumor recurred at the same site 7 years later, which was a malignant glioma with no evidence of hemangioblastoma. The malignant glioma showed molecular genetic profiles of radiation-induced tumors because of its diffuse p53 immunostaining and the loss of p16 immunoreactivity. The genetic study to find the loss of heterozygosity (LOH) of VHL gene revealed that only the cerebellar hemangioblastoma showed allelic losses for the gene. To the best of our knowledge, this report is the first to show a malignant glioma that developed in a patient with VHL disease after radiation therapy at the site of an excised hemangioblastoma. This report also suggests that radiation therapy should be performed very carefully in VHL patients with hemangioblastomas.
  • Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma

    Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma

    Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients.
  • Charts Chart 1: Benign and Borderline Intracranial and CNS Tumors Chart

    Charts Chart 1: Benign and Borderline Intracranial and CNS Tumors Chart

    Charts Chart 1: Benign and Borderline Intracranial and CNS Tumors Chart Glial Tumor Neuronal and Neuronal‐ Ependymomas glial Neoplasms Subependymoma Subependymal Giant (9383/1) Cell Astrocytoma(9384/1) Myyppxopapillar y Desmoplastic Infantile Ependymoma Astrocytoma (9412/1) (9394/1) Chart 1: Benign and Borderline Intracranial and CNS Tumors Chart Glial Tumor Neuronal and Neuronal‐ Ependymomas glial Neoplasms Subependymoma Subependymal Giant (9383/1) Cell Astrocytoma(9384/1) Myyppxopapillar y Desmoplastic Infantile Ependymoma Astrocytoma (9412/1) (9394/1) Use this chart to code histology. The tree is arranged Chart Instructions: Neuroepithelial in descending order. Each branch is a histology group, starting at the top (9503) with the least specific terms and descending into more specific terms. Ependymal Embryonal Pineal Choro id plexus Neuronal and mixed Neuroblastic Glial Oligodendroglial tumors tumors tumors tumors neuronal-glial tumors tumors tumors tumors Pineoblastoma Ependymoma, Choroid plexus Olfactory neuroblastoma Oligodendroglioma NOS (9391) (9362) carcinoma Ganglioglioma, anaplastic (9522) NOS (9450) Oligodendroglioma (9390) (9505 Olfactory neurocytoma Ganglioglioma, malignant (()9521) anaplastic (()9451) Anasplastic ependymoma (9505) Olfactory neuroepithlioma Oligodendroblastoma (9392) (9523) (9460) Papillary ependymoma (9393) Glioma, NOS (9380) Supratentorial primitive Atypical EdEpendymo bltblastoma MdllMedulloep ithliithelioma Medulloblastoma neuroectodermal tumor tetratoid/rhabdoid (9392) (9501) (9470) (PNET) (9473) tumor
  • Central Nervous System Tumors General ~1% of Tumors in Adults, but ~25% of Malignancies in Children (Only 2Nd to Leukemia)

    Central Nervous System Tumors General ~1% of Tumors in Adults, but ~25% of Malignancies in Children (Only 2Nd to Leukemia)

    Last updated: 3/4/2021 Prepared by Kurt Schaberg Central Nervous System Tumors General ~1% of tumors in adults, but ~25% of malignancies in children (only 2nd to leukemia). Significant increase in incidence in primary brain tumors in elderly. Metastases to the brain far outnumber primary CNS tumors→ multiple cerebral tumors. One can develop a very good DDX by just location, age, and imaging. Differential Diagnosis by clinical information: Location Pediatric/Young Adult Older Adult Cerebral/ Ganglioglioma, DNET, PXA, Glioblastoma Multiforme (GBM) Supratentorial Ependymoma, AT/RT Infiltrating Astrocytoma (grades II-III), CNS Embryonal Neoplasms Oligodendroglioma, Metastases, Lymphoma, Infection Cerebellar/ PA, Medulloblastoma, Ependymoma, Metastases, Hemangioblastoma, Infratentorial/ Choroid plexus papilloma, AT/RT Choroid plexus papilloma, Subependymoma Fourth ventricle Brainstem PA, DMG Astrocytoma, Glioblastoma, DMG, Metastases Spinal cord Ependymoma, PA, DMG, MPE, Drop Ependymoma, Astrocytoma, DMG, MPE (filum), (intramedullary) metastases Paraganglioma (filum), Spinal cord Meningioma, Schwannoma, Schwannoma, Meningioma, (extramedullary) Metastases, Melanocytoma/melanoma Melanocytoma/melanoma, MPNST Spinal cord Bone tumor, Meningioma, Abscess, Herniated disk, Lymphoma, Abscess, (extradural) Vascular malformation, Metastases, Extra-axial/Dural/ Leukemia/lymphoma, Ewing Sarcoma, Meningioma, SFT, Metastases, Lymphoma, Leptomeningeal Rhabdomyosarcoma, Disseminated medulloblastoma, DLGNT, Sellar/infundibular Pituitary adenoma, Pituitary adenoma,
  • A Rare Disease in Pediatric Patients

    A Rare Disease in Pediatric Patients

    Cartas ao Editor Jornal de Pediatria - Vol. 85, Nº 3, 2009 277 Resposta do autor Gliomatose leptomeníngea primária difusa: uma doença rara em pacientes pediátricos Prezado Editor, Recebemos com prazer os comentários acima. Os autores esclarecem que, em momento algum, focaram suas preo- Prezado Editor, cupações em critérios para definir síndrome metabólica, até mesmo porque se ela existe1, não existem critérios de consenso O recente relato de caso de Val Filho & Avelar1 sobre um para o diagnóstico em adultos2,3 tampouco em adolescentes. raro tumor cerebral pediátrico é interessante e merece grande Preocupamo-nos sim, em mostrar a presença de fatores de consideração no contexto da literatura publicada sobre esse risco em uma amostra selecionada ao acaso, que eles existem assunto, já que representa um evento muito incomum. Em em proporções tais que podem até ser agrupados, e, por um nome da precisão científica, devemos, portanto, fazer uma dos muitos critérios sugeridos na literatura, com valores de importante correção no que se refere ao diagnóstico. referências pediátricos, dar origem ao que se denomina sín- Os autores fizeram uma revisão breve e adequada sobre a drome metabólica. Não nos propusemos, portanto, a estudar gliomatose cerebral; uma doença rara, classificada pela edição associações entre fatores de risco. de 2007 da Organização Mundial da Saúde (OMS)2 como uma Os autores acreditam que discutir critérios para o que não lesão de grau III com prognóstico reservado. A gliomatose 2,3 existe consenso é desfocar a atenção da gravidade
  • 6 Magnetic Resonance Imaging

    6 Magnetic Resonance Imaging

    Chapter 6 / MRI 105 6 Magnetic Resonance Imaging Paul M. Ruggieri Summary Magnetic resonance (MR) is clearly the accepted imaging standard for the preliminary evalua- tion, peri-operative management, and routine longitudinal follow-up of patients with high-grade glio- mas (HGG). The purpose of this chapter is to review the imaging characteristics of HGG using conventional MR imaging techniques. Whereas the newer techniques of MR diffusion, perfusion, diffusion tensor imaging, and MR spectroscopy will be included as part of this discussion of the high grade neoplasms, the detailed concepts of such studies will be discussed elsewhere in this text. Key Words: MR imaging; anaplastic astrocytoma; glioblastoma multiforme; gliosarcoma; gliomatosis cerebri; oligodendroglioma. INTRODUCTION Magnetic resonance (MR) is clearly the accepted imaging standard for the preliminary evaluation, peri-operative management, and routine longitudinal follow-up of patients with high-grade gliomas (HGG). The purpose of this chapter is to review the imaging characteristics of HGG using conventional MR imaging techniques. Whereas the newer techniques of MR diffusion, perfusion, diffusion tensor imaging, and MR spectroscopy will be included as part of this discussion of the high grade neoplasms, the detailed concepts of such studies will be discussed elsewhere in this text. In general terms, high-grade glial neoplasms are conventionally thought of as infiltrative parenchymal masses that are hyperintense on FLAIR fluid-attenuated inversion recovery (FLAIR) and T2-weighted images, hypointense on unenhanced T1-weighted images, may or may not extend into the corpus callosum, are surrounded by extensive vasogenic edema, and prominently enhance following gadolinium administration. It must be pointed out that this description is clearly just a generalization as many high-grade neoplasms clearly do not follow these “rules” and some of these characteristics may even be seen in low-grade neoplasms.
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic

    Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic

    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
  • A Case of Intramedullary Spinal Cord Astrocytoma Associated with Neurofibromatosis Type 1

    A Case of Intramedullary Spinal Cord Astrocytoma Associated with Neurofibromatosis Type 1

    KISEP J Korean Neurosurg Soc 36 : 69-71, 2004 Case Report A Case of Intramedullary Spinal Cord Astrocytoma Associated with Neurofibromatosis Type 1 Jae Taek Hong, M.D.,1 Sang Won Lee, M.D.,1 Byung Chul Son, M.D.,1 Moon Chan Kim, M.D.2 Department of Neurosurgery,1 St. Vincent Hospital, The Catholic University of Korea, Suwon, Korea Department of Neurosurgery,2 Kangnam St. Mary's Hospital, The Catholic University of Korea, Seoul, Korea The authors report a symptomatic intramedullary spinal cord astrocytoma in the thoracolumbar area associated with neurofibromatosis type 1 (NF-1). A 38-year-old woman presented with paraparesis. Magnetic resonance imaging revealed an intramedullary lesion within the lower thoracic spinal cord and conus medullaris, which was removed surgically. Pathological investigation showed anaplastic astrocytoma. This case confirms that the diagnosis criteria set by the National Institute of Health Consensus Development Conference can be useful to differentiate ependymoma from astrocytoma when making a preoperative diagnosis of intramedullary spinal cord tumor in patients of NF-1. KEY WORDS : Astrocytoma·Intramedullary cord tumor·Neurofibromatosis. Introduction eurofibromatosis type 1 (NF-1), also known as von N Recklinghausen's disease, is one of the most common autosomal dominant inherited disorders with an incidence of 1 in 3,000 individuals and is characterized by a predisposition to tumors of the nervous system5,6,12,16). Central nervous system lesions associated with NF-1 include optic nerve glioma and low-grade gliomas of the hypothalamus, cerebellum and brain stem6,10). Since the introduction of magnetic resonance(MR) imaging, Fig. 1. Photograph of the patient's back shows multiple subcutaneous incidental lesions with uncertain pathological characteristic nodules (black arrow) and a cafe-au-lait spot (white arrow), which have been a frequent finding in the brain and spinal cord of are typical of NF-1.
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes

    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
  • Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga

    Birth Defects Caused by Mutations in Human GLI3 and Mouse Gli3 Genescga

    doi:10.1111/j.1741-4520.2009.00266.x Congenital Anomalies 2010; 50, 1–7 1 REVIEW ARTICLE Birth defects caused by mutations in human GLI3 and mouse Gli3 genescga_ 266 1..71..7 Ichiro Naruse1, Etsuko Ueta1, Yoshiki Sumino1, Masaya Ogawa1, and Satoshi Ishikiriyama2 1School of Health Science, Faculty of Medicine, Tottori University, Yonago, and 2Division of Clinical Genetics and Cytogenetics, Shizuoka Children’s Hospital, Shizuoka, Japan ABSTRACT GLI3 is the gene responsible for Greig cepha- type-A (PAP-A) and preaxial polydactyly type-IV (PPD-IV). A lopolysyndactyly syndrome (GCPS), Pallister–Hall syndrome mimic phenomenon is observed in mice. Investigation of human (PHS) and Postaxial polydactyly type-A (PAP-A). Genetic poly- GLI3 and Gli3 genes has progressed using the knowledge of dactyly mice such as Pdn/Pdn (Polydactyly Nagoya), XtH/XtH Cubitus interruptus (Ci) in Drosophila, a homologous gene of GLI3 (Extra toes) and XtJ/XtJ (Extra toes Jackson) are the mouse and Gli3 genes. These genes have been highly conserved in the homolog of GCPS, and Gli3tmlUrtt/Gli3tmlUrt is produced as the animal kingdom throughout evolution. Now, a lot of mutant mice of mouse homolog of PHS. In the present review, relationships Gli3 gene have been known and knockout mice have been pro- between mutation points of GLI3 and Gli3, and resulting phe- duced. It is expected that the knowledge obtained from mutant and notypes in humans and mice are described. It has been con- knockout mice will be extrapolated to the manifestation mecha- firmed that mutation in the upstream or within the zinc finger nisms in human diseases to understand the diseases caused by the domain of the GLI3 gene induces GCPS; that in the post-zinc mutations in GLI3 gene.