Profiling the bacterial microbiome of that parasitise bandicoots in Australia

by

Siobhon Egan

Bachelor of Science

This thesis is presented for the degree of Bachelor of Science Honours in Molecular Biology

School of Veterinary and Life Sciences Murdoch University, Perth 2017

Author’s Declaration

I declare that this thesis is my own account of my research and contains as its main content work which has not previously been submitted for a degree at any tertiary education institution.

Siobhon Egan

ii Abstract

Molecular methods have recently revealed novel organisms inhabiting native Australian ticks, some of which are potentially pathogenic due to their similarity to causes of known -borne diseases (TBDs) worldwide. Australian bandicoots (Order: Peramelemorphia) are hosts of ticks that are known to bite humans. The persistence of bandicoots in urban and peri-urban areas results in increased exposure of humans to bandicoot ticks, and the bacterial diversity of ticks parasitising bandicoots is therefore of public health interest and requires further investigation.

This study analysed 290 ticks parasitising bandicoots from New South Wales (NSW; n = 125), Queensland (QLD; n = 26), Northern Territory (NT; n = 15), Tasmania (TAS; n = 80), and Western Australia (WA; n = 44). A total of seven tick species (Haemaphysalis bancrofti, H. humerosa, Ixodes australiensis, I. fecialis, I. holocyclus, I. myrmecobii and I. tasmani) were identified from four Australian bandicoot species; the eastern barred bandicoot (Perameles gunnii), the long-nosed bandicoot (P. nasuta), the northern brown bandicoot (Isoodon macrourus), and the southern brown bandicoot (I. obesulus).

Next Generation Sequencing (NGS) targeting the ubiquitous bacterial 16S rRNA gene was applied to a sub-sample of ticks (n = 66). Analysis of sequence data revealed the presence of , Borrelia, and ‘Ca. Neoehrlichia’. was detected in two ticks (H. bancrofti and H. humerosa) from the same bandicoot in NSW. A likely novel Ehrlichia sp. was identified from a single I. fecialis tick in WA. In addition to the confirmation of the recently described ‘Ca. Neoehrlichia arcana’ and ‘Ca. N. australis’ inhabiting I. holocyclus and I. tasmani from NSW and QLD, a novel ‘Ca. Neoehrlichia’ species was detected in ticks (I. australiensis and I. fecialis) from WA. Furthermore, sequences 98.8% similar to ‘Ca. Borrelia tachyglossi’ provide the first molecular description of Borrelia inhabiting ticks (H. humerosa and I. tasmani) parasitising Australian bandicoots.

This study has provided an interesting insight into the microbial communities present in ticks parasitising Australian bandicoots and raises questions about the potential for tick-associated illness in people parasitised by these ticks. An investigation

iii into the characterisation, prevalence, pathogenicity and transmission dynamics of these candidate tick-borne pathogens is required to establish the significance of this study.

iv Acknowledgements

My first acknowledgement must go to my supervisors, Dr. Charlotte Oskam (Primary) and Prof. Peter Irwin (Co-supervisor). Charlotte your generous support and advice has been the foundation of this project, thank you for being so approachable and providing the perfect balance of guidance and freedom. Peter, thank you for your inspiring ideas, big picture thinking and sharing your immense knowledge.

Thank you to the team at the Vector and Water Borne Pathogen Research Group for your ongoing encouragement and advice. It has been a privilege to be a part of such a diverse and motivated group. In particular, I’d thank to thank Kimberly (Siew-May) Loh, Alexander Gofton and Telleasha Greay. Kim, thank you for being so patient during my first steps in the lab and making me feel so welcome. Alex, your all-round expertise and advice has been invaluable, I apologise for the constant interrupts and questions. Telleasha, thank you for ever so patiently guiding me through my NGS run and your help throughout.

I would also like to thank Dr. Amanda Ash for your assistance in tick identification components. This research would not be possible without the many contributions by individuals and organisations. I would like to thank the following for donating specimens for this research; Prof. Peter Banks and Jenna Bytheway (University of Sydney), Dr. David Forshaw (Department of Agriculture and Food), Dr. Amy Northover (Murdoch University), Renata Phelps (WIRES), Dr. Bob Clippingdale (Forbes St Veterinary Clinic), Dr. Amber Gillet (Australia Zoo Wildlife Hospital), Trine Kruse (Territory Wildlife Park), Dr. Stephen Cutter (AMRIC) and Jacqui van Teulingen.

I would also like to thank Dr. Amy Northover and A/Prof. Peter Spencer for their guidance and advice during my undergraduate years. I would have never considered further research if not for the inspiration and support you both provided. This research was kindly supported through the Myrtle AB Lamb Honours Scholarship provided by Murdoch University.

Of course, a big thank you to my family for giving all this meaning. I would not be where I am today without your enduring support. To my partner Ray, thank you for continually reminding me that there is always time to laugh. Finally, to my big brother Rhys Egan, the source of my anguish but more overwhelming my inspiration. You made me want to make sure that I spent my 24th year on this earth achieving something worthwhile, and I hope I made you proud. You are so incredibly missed. I dedicate this to your memory. Until we meet again.

v Table of Contents

Author’s Declaration ...... ii Abstract ...... iii Acknowledgements ...... v List of Figures ...... viii List of Tables ...... x List of Abbreviations ...... xi Chapter 1 Introduction ...... 1 1.1 Ticks ...... 2 1.1.1 and evolution ...... 2 1.1.2 Identification of ticks ...... 3 1.1.3 Life cycle ...... 4 1.1.4 Host requirements and specificity ...... 5 1.2 The tick microbiome ...... 7 1.2.1 Bacterial composition in ticks ...... 7 1.2.2 Factors influencing the tick bacterial microbiome ...... 8 1.2.3 Methods to characterise these bacterial communities ...... 9 1.2.4 NGS – understanding caveats & limitations ...... 11 1.3 Tick borne diseases ...... 12 1.3.1 Australian tick-borne diseases ...... 13 1.3.2 Emerging infectious diseases and novel – a critical approach ...... 15 1.3.3 Identification of novel organisms inhabiting Australian ticks ...... 16 1.4. Australian bandicoots (Family Peramelidae) ...... 17 1.4.1 Taxonomy & geographic distribution ...... 17 1.4.2 Bandicoot-tick associations ...... 21 1.5 Conclusion & further research ...... 24 1.6 Thesis aims and hypothesis ...... 25 Chapter 2 Methods and materials ...... 26 2.1 Sample collection & identification ...... 26 2.2 DNA extraction ...... 27 2.2.1 Tick samples ...... 27 2.2.2 Bandicoot tissue samples ...... 28 2.3 Library preparation and NGS ...... 28 2.3.1 Determination of blocking primer assays for ...... 29 2.3.2 Amplicon PCR and gel electrophoresis ...... 30 2.3.3 Index PCR and gel electrophoresis ...... 31 2.3.4 Index PCR clean up and gel electrophoresis ...... 31 2.3.5 Library pooling and purification ...... 32 2.3.6 Library quantification and sample loading ...... 32 2.4 NGS data analysis ...... 32 2.4.1 Ecological modelling ...... 33 2.5 Species & genus specific PCR assays ...... 33

vi 2.5.1 ‘Candidatus Neoehrlichia’ qPCR ...... 34 2.5.2 Borellia nested PCR ...... 34 2.5.3 Ixodida PCR ...... 35 2.6 Gel electrophoresis ...... 36 2.7 DNA sequencing ...... 36 2.8 Phylogenetics ...... 36 2.8 One health comparison: ticks capable of biting humans ...... 36 Chapter 3 Results ...... 37 3.1 Ticks collected ...... 37 3.2 NGS overview and data exploration ...... 41 3.2.1 Sequencing depth ...... 41 3.2.2 Microbial composition ...... 43 3.2.3 Comparison of abundance and presence/absence models ...... 45 3.2.4 Exploration of factors affecting microbial beta-diversity ...... 48 3.3. Tick microbiome ...... 53 3.3.1 Factors influencing diversity & composition ...... 57 3.3.2 Presence of candidate bacterial pathogens ...... 60 3.3.3 Bandicoot tissue samples ...... 64 3.4 Target PCR assays ...... 65 3.4.1 ‘Ca. Neoehrlichia’ qPCR ...... 65 3.4.2 Borrelia nested PCR ...... 65 3.4.3 Ixodida PCR ...... 66 3.5 Human biting ticks ...... 66 Chapter 4 Discussion ...... 69 4.1 Tick-bandicoot associations ...... 69 4.1.1 Molecular identification of tick ...... 69 4.1.2 Demographics influencing tick-host associations ...... 70 4.1.3 Overlap associations with human-biting ticks ...... 71 4.2. Microbiome analysis ...... 72 4.2.1 Assessment of factors influencing the tick microbiome ...... 73 4.2.2 Bandicoot tissue samples ...... 73 4.3 Candidate TBPs ...... 74 4.3.1 Borrelia ...... 74 4.3.2 ‘Candidatus Neoehrlichia’ ...... 75 4.3.3 Other ...... 77 4.4 NGS - bioinformatic and diversity analysis limitations ...... 78 4.4.1 Estimates of abundance and multi-copy 16S ...... 78 4.4.2 Sequencing depth and taxonomy assignment ...... 79 4.5 A One Health approach ...... 80 4.6 Conclusion ...... 81 References ...... 82

Appendix ...... 98

vii List of Figures

Figure 1.1. Typical three host life cycle of a female Ixodid (hard) tick...... 5

Figure 1.2. Dominant bacterial taxa present within ticks...... 8

Figure 1.3. Distribution map of extant Australian bandicoot species ...... 20

Figure 2.1. NGS library preparation workflow...... 29

Figure 3.1. Ticks identified parasitising Australian bandicoots...... 38

Figure 3.2. Tick-bandicoot host associations...... 39

Figure 3.3. Geographic distribution of ticks collected during this study...... 40

Figure 3.4. Distribution of sequencing depth for tick samples ...... 42

Figure 3.5. Rarefaction curve to describe species diversity ...... 43

Figure 3.6. Overall representation of bacterial phyla ...... 44

Figure 3.7. PCoA analysis of beta-diversity between presence/absence data based on Jaccard index and abundance data based on Bray-Curtis dissimilarity ...... 46

Figure 3.8. Boxplot of beta-diversity between presence/absence using Jaccard index and abundance data using Bray-Curtis dissimilarity ...... 47

Figure 3.9. PCoA analysis of beta-diversity between OTU, family, order and phylum ...... 49

Figure 3.10. Boxplots of beta-diversity between OTU, family order and phylum ...... 50

Figure 3.11. PCoA analysis of beta-diversity in data that includes all family taxa and data where family taxa with <1000 total reads are grouped into one ‘low abundant’ family ...... 51

Figure 3.12. Boxplots of beta-diversity between data that includes all family taxa and data where family taxa with <1000 total reads grouped into one ‘low abundant’ family ...... 51

Figure 3.13. PCoA analysis of beta-diversity between all samples and samples that had >1000 reads only ...... 52

Figure 3.14. Boxplots of beta-diversity between all samples and samples that had >1000 reads only...... 52

Figure 3.15. Proportional abundance of phyla present in tick species...... 54

Figure 3.16. Proportional abundance of phyla present in ticks according to bandicoot host ...... 55

Figure 3.17. Proportional abundance of phyla present in ticks according to life stage ...... 55

viii Figure 3.18. Proportional abundance of phyla present in ticks according to geographic location ...... 56

Figure 3.19. Order representation of bacterial communities present in tick samples...... 56

Figure 3.20. Proportional abundance of Family taxa present in tick species ...... 57

Figure 3.21. NMDS plot of samples modelled by tick species at the Family level ...... 58

Figure 3.22. Comparison of the tick microbiome through Shannon diversity indices separated by host species, state, life stage and tick species ...... 59

Figure 3.23. Phylogenetic analysis of 276 bp 16S rRNA for Anaplasmataceae sequences . 63

Figure 3.24. Phylogenetic analysis of 300 bp 16S rRNA for Borrelia sequences ...... 64

Figure A1.1. Rarefaction curve to describe species diversity ...... 102

Figure A1.2. NMDS plot of samples modelled by life stage at the Family level ...... 105

Figure A1.3. NMDS plot of samples modelled by host species at the Family level ...... 105

Figure A1.4. NMDS plot of samples where more than one tick from same host was available at the Family level ...... 106

Figure A1.5. Phylogenetic analysis of 310 bp 16S rRNA for Anaplasmataceae sequence 107

Figure A1.6. An amplification plot obtained for the genus specific 'Ca. Neoehrlichia' qPCR assay for bandicoot tick samples ...... 108

Figure A1.7. Gel electrohporesis image of PCR products for Ixodida cox gene assay ...... 109

ix List of Tables Table 1.1. Tick taxonomy...... 3

Table 1.2. Bacterial TBPs present in Australia ...... 15

Table 1.3. Extant Australian bandicoot species ...... 19

Table 1.4. Summary of Australian tick-bandicoot associations ...... 22

Table 2.1. Primers used in NGS assays...... 31

Table 2.2. Primers used in species-specific PCR assays...... 35

Table 3.1. Geographic breakdown of tick-bandicoot associations ...... 38

Table 3.2. Prevalence of selected known tick endosymbionts and tick-specific bacterial species to assess contamination during NGS library preparation...... 44

Table 3.3. Summary of OTUs that closely match newly described organisms and are of interest in regards to similarity to TBD pathogens overseas ...... 62

Table 3.4 Samples that tested positive by genus specific qPCR assay ...... 65

Table 3.5. Records of ticks biting humans in Australia ...... 67

Table A1.1. Ticks identified from Australian bandicoots in this study ...... 67

Table A1.2. Number of reads present in tick samples of candidate bacterial pathogens through NGS ...... 67

Table A1.3. Mapping file for illumina MiSeq NGS sample loading ...... 110

Table A1.4. Taxonomy table of OTUs generated in NGS ...... 67

x List of Abbreviations

Symbol/Abbreviation Meaning ANIC Australian National Insect Collection BLAST Basic local alignment search tool bp Base pairs COX Cytochrome c oxidase I DNA Deoxyribonucleic acid dNTP Deoxynucleotide triphosphate et al. and others EXB Extraction blank control F Forward flaB Flagellin gene g Gram gDNA Genomic DNA Hr Hour Hz Hertz kb Kilobases Kg Kilograms mg Milligram MgCl2 Magnesium chloride min Minute mL Millilitre mM Millimolar MU Murdoch University µ Micro µg Microgram µL Microlitre n Number of samples NCBI National Centre for Biotechnology Information NGS Next generation sequencing NMDS Non-metric multidimensional scaling NTC No-template control OTU(s) Operational taxonomic unit(s) PCoA Principal coordinates analysis PCR Polymerase chain reaction pk Proteinase K qPCR Quantitative PCR R Reverse rpm Revolutions per minute rRNA Ribosomal ribonucleic acid s Second sp./spp. Species Taq Thermus aquaticus DNA polymerase TBD(s) Tick–borne disease(s) TBP(s) Tick–borne pathogen(s) VWBPRG Vector and water-borne research group w/v Weight of solute per volume of solvent 16S rRNA Bacterial gene 3’ Hydroxyl-terminus of DNA molecule 5’ Phosphate-terminus of DNA molecule °C Degrees Celsius

xi ~ Approximately > Greater than < Less than % Percentage + Positive - Negative

xii Chapter 1 Introduction

Ticks (: Ixodida) transmit more pathogens than any other group of blood- feeding , with approximately 10% of tick species transmitting pathogens affecting domestic and humans (Barker and Murrell, 2004; Jongejan and Uilenberg, 2004). The vast majority of tick-borne pathogens (TBPs) are considered zoonotic, meaning that pathogens within ticks can be transmitted to humans from animals and cause disease (Pfaffle et al., 2013). Although TBPs have been widely studied overseas, Australia is relatively free of infectious TBPs affecting humans; however increased reports of a ‘Lyme-like’ syndrome in the last three decades has led to a polarised debate in Australia (Chalada et al., 2016). Through recent molecular advances, a number of candidate bacterial TBPs have been identified in native Australian ticks (Gofton et al., 2015a; Goften et al., 2015b; Loh et al., 2016). The persistence of bandicoots (Peramelemorphia) in urban areas has meant they have received attention as the primary host of human-biting ticks, capable of transmitting disease (Hall- Mendelin et al., 2011; Barker and Walker, 2014). The objective of this project is to characterise the bacterial microbiome of ticks parasitising Australian bandicoots, and describe the presence of recently described or novel candidate TBPs.

The focus of this introduction chapter is to review the literature pertaining to Australian ticks and describe the ecological requirements of ticks. The tick microbiome is then described with a focus on advances in molecular techniques and caveats when analysing microbiome data. The presence of human TBDs in Australia is reviewed, with an emphasis on recently identified, novel bacterial organisms. Lastly, bandicoots will be briefly introduced with an updated summary of ticks identified parasitising Australian bandicoots. This chapter concludes with the thesis aims and hypotheses.

1 1.1 Ticks

All ticks are obligate haematophagous (blood feeding) arthropods, belonging to the suborder Ixodida (Subclass: Acari) (Oliver, 1989; Cupp, 1991). Ticks occur globally and comprise of nearly 900 species (Jongejan and Uilenberg, 2004). This section will discuss the taxonomy and evolution of ticks, how ticks can be identified using morphological features and molecular barcoding, their life cycle, hosts and environmental factors that contribute to their persistence.

1.1.1 Taxonomy and evolution

Despite the long evolutionary history of ticks, the taxonomy is still largely debated. The most accepted overview of tick taxonomy is presented in [Table 1.1]. The suborder Ixodida consists of three families; (Murray 1844), Argasidae (Canestrini, 1890) and Nuttalliellidae (Bedford, 1931)(Cupp, 1991; Barker and Murrell, 2008). The Ixodidae family, commonly referred to as hard ticks, is the largest and most diverse of the three families originating from the Ixodida suborder, representing 80% of described species including those of medical and veterinary significance. The second largest family, Argasidae, are known as the soft ticks, while a single species belongs to the third Nuttalliellidae family (Jongejan and Uilenberg, 2004).

The fossil record shows evidence that the origin of ticks dates back to 65 – 146 million years ago (mya), with majority of the evolutionary and dispersal processes occurring 5 – 65 mya (de la Fuente, 2003), consistent with the breakup of Australia from the Gondwana supercontinent. Phylogenetic evaluation supports the theory that the Ixodida taxa has strong evolutionary ties with Australia (Barker and Murrell, 2004), suggesting native ticks and Australian fauna have coevolved for over 100 million years (Klompen et al., 1996). Many of the known tick genera are found in Australia, including Bothriocroton, , Haemaphysalis and Australian lineage of Ixodes - except Ixodes uriae which is found worldwide on seabirds (Barker and Murrell, 2004). A review of Australian ticks by Barker et al. (2014) described 70 unique species (56 hard ticks and 14 soft ticks), including 65 native and 5 introduced. More recently Ash et al. (2017) described the first new Australian Ixodes tick in 50 years, Ixodes woyliei, which parasitises the endangered , the woylie (Bettongia penicillata), increasing the total number of described Australian tick species to 71.

2 Table 1.1. Taxonomic classification of ticks.

Phylum Arthropoda Class Arachnida Subclass Acari Order Parasitiformes Suborder Ixodida Super family Ixodoidea Families Ixodidae (hard ticks) Argasidae (soft ticks) Nuttalliellidae (monotypic)

1.1.2 Identification of ticks

Ticks are unique among other Acari in that they have a large body size (20-30 mm), specialised mouthparts (hypostome) and highly specialised aggregation of sensory structures (Klompen et al., 1996). Microscopy remains the gold standard method to identify tick species. Larvae can be differentiated from adults by the presence of six legs as opposed to eight, and the absence of a genital aperture. The Ixodidae family have a large anterodorsal sclerite, a dorsal plate or scutum; these species of ticks are also sexually dimorphic (Brites-Neto et al., 2015). Ixodidae males have a conscutum covering most of the dorsal surface, whereas females have a reduced scutum to allow for uptake of a large blood meal (Barker and Walker, 2014). Argasidae ticks are nonscutate and do not exhibited marked sexual dimorphism; these ticks have a more rounded oval outline than their hard tick counterparts (Cupp, 1991). The single species belonging to the Nuttalliellidae family, Nuttalliella namaqua, is only present in Africa and often described as the ‘missing link’ between hard and soft tick families (Mans et al., 2015).

To this day, Roberts (1970) ‘Australian Ticks’ remains the primary reference for identifying Australian ticks. Roberts describes the key morphological features that have been widely used by parasitologists, veterinarians, medical practitioners, ecologists and wildlife biologists for over five decades for tick identification. More recently, an updated text by Barker and Walker (2014) reviewed 16 adult tick species that commonly feed on domestic animals and humans in Australia, and provided hand-drawn and photographed images of ticks.

3 Advances in identification methods have enabled the differentiation of morphologically similar species which has also provided insight into the evolutionary history of ticks. For example, scanning electron microscopy has allowed finer morphological features to be recorded, improving the correct identification of ticks (Kwak, 2017; Kwak et al., 2017a). While morphological keys are standard, many larval and nymphal ticks cannot be identified due to the lack of recorded morphological features and are therefore identified only to family or genus level.

Molecular analyses on the other hand can provide a definitive answer for species identification, and can be used to identify ticks with damaged morphological features, cryptic species or early instars. Molecular analyses of some Australian ticks have been used to reveal a more detailed evolutionary history by examining the genetic relatedness between species (Ash et al., 2017; Kwak et al., 2017b) and have further confirmed the hypothesis that ticks have originated from Australia (Barker and Murrell, 2008). However, the use of molecular tools to identify Australian ticks has been limited due to the lack of standard protocols because of an uncertainty of which barcoding gene is most appropriate for ticks, and limited availability of reference sequences.

1.1.3 Life cycle

Ixodidae ticks undergo four life stages comprising: eggs, larvae, nymph and adult [Figure 1.1], and require long blood meals, often engorging for several hours to several days. The majority of Ixodid species have a three-host life cycle (Oliver, 1989). Each life stage feeds only once, with the exception of adult females, which are able to detach and reattach to a new host to continue feeding (Apanaskevich and Oliver, 2014). It is typically thought that larvae and nymphs of mammal-feeding Ixodid species engorge on small to medium-sized hosts, whilst adults feed on larger species (Oliver, 1989). However, there is no conclusive evidence this theory applies to native Australian ticks.

Detailed information on the life cycle of Australian ticks is limited, and mainly reserved for ticks commonly biting humans and domestic animals or those that cause economic loss in livestock industries. A recent study on the common marsupial tick Ixodes tasmani showed that it had shorter periods of engorgement and pre-moult stage in comparison to other Ixodes ticks (Murdoch and Spratt, 2005). It has been demonstrated that, like other Ixodes species in temperate climates (Oliver, 1989), I.

4 tasmani is able to complete more than one generation in a year, and all life stages co- exist throughout the year (Gemmell et al., 1991; Murdoch and Spratt, 2005). The life cycle of ticks species has shown to be related to their role in the transmission of tick- borne pathogens (TBPs), as three-host tick species transmit more infectious microbes than their one- and two-host counterparts (Jongejan and Uilenberg, 2004). The importance of understanding tick ecology is therefore also important in understanding the potential of TBPs in Australia.

Figure 1.1. Typical three host life cycle of a female Ixodid (hard) tick. Source: Apanaskevich and Oliver (2014).

1.1.4 Host requirements and specificity

Ticks are obligate blood feeders and their survival is dependent on the population density and susceptibility of the primary host (see Box 1 for host definitions) (Kirstein et al., 1997; Estrada-Pena, 2001). Worldwide, the majority of hard ticks (511 out of 650 species) rely on mammals as their main host meal; approximately 60 species feed on birds and approximately 60 species feed on reptiles, with limited information available on the remaining tick species (Kolonin, 2007). Host specificity is defined as an association between a tick species and vertebrate species (or related

5 species), which is critical for reproduction and survival of the tick (Hoogstraal and Aeschlimann, 1982). The specific host requirements of ticks vary, with some species being termed ‘generalist’ that can parasitise a range of host species, such as I. ricincus (Estrada-Pena, 2001), I. holocyclus (Jackson et al., 2007) and I. uriae (Munoz-Leal and Gonzalez-Acuna, 2015). Other tick species are more taxon ‘specialists’, favouring a particular host species, for example I. woyliei almost exclusively feeds on the woylie (B. penicillata) (Ash et al., 2017) and Bothriocroton hydrosauri on the bobtail (Tiliqua rugosa) (Bull, 1978).

It is accepted that 90% of tick species are host-specific and do not normally bite humans or livestock (Hoogstraal and Aeschlimann, 1982), who usually serve as paratenic hosts in the tick life cycle. The theory that ticks are host-specific, however, is not uniformly shared among experts. Klompen et al. (1996) suggest this assumption may simply be a result of incomplete sampling and reporting. Adult ticks adopt a species-specific preferred questing height, which is loosely related to the size of their principal host (Loye and Lane, 1998). The mechanisms by which Australian ticks locate their host remains largely unknown (Randolph, 2008). Although, Belan and Bull (1991) did identify that three species of reptile ticks (Amblyomma fimbriatum, A. limbatum, and B. hydrosauri) were only able to detect their hosts within a 200mm distance, unlike that described in the mammal tick, B. concolor, which was able to detect its host from a further distance. This finding also supports the evolutionary divergence and niche partitioning of Australian tick species.

Box 1 - Parasitology life cycle definitions. Adapted from Emergy (2015)

Intermediate host is where an obligatory development stage of the parasite occurs before infection of the final host can happen. Parasites do not reproduce (but may reproduce asexually) on this host. In the intermediate host the parasite always develops to a new stage, some parasites utilise several intermediate hosts. A primary or definitive host (also known as a final host) is described as the in which the adult stages of the parasite develop and sexually reproduce. This host can also be defined as the stage where sexual reproduction occurs, however issues can arise with this definition for a number of vector-borne protozoan parasites. A paratenic or transport host is an animal that can be infected by the parasite but is not necessary for the parasite to complete its life cycle. In this host disease can occur but more often parasites are suppressed by the hosts’ immune response. Vectors are a type of host, often divided into two categories (a) conventional vectors in which an obligatory stage of parasite development occurs; and (b) mechanical vectors which can transmit parasites from host to host while feeding.

6

A recent summary of 16 species of Australian ticks by Barker and Walker (2014) identified a number of inconsistencies with Roberts (1970) original records. For example, Ornithodoros gurneyi (Warburton, 1926), also known as the kangaroo soft tick, has not been collected from any mammalian host. This has resulted in questions over whether this lack of official documented association is due to the cryptic nature of O. gurneyi, which is so small it can often go unnoticed. It is clear that further knowledge and official records of tick-host relationships in Australia are needed. Research continues to report novel tick-host relationships (Buettner et al., 2013; Greay et al., 2016; Hillman et al., 2017; Kwak et al., 2017a), challenging previous understandings on ‘host- specificity’.

The complexity of ‘host-specify’ further arises where sympatric species co-exist, yet still exhibit distinct tick faunal assemblages. For example, in the south west corner of Western Australia (WA), Ixodes australiensis, I. tasmani and I. woyliei share similar habitat and host attributes (preferentially attaching to mammals), however remain genetically distinct (Ash et al., 2017; Kwak et al., 2017a). These fundamental questions on tick ecology remain to be answered for Australian species

1.2 The tick microbiome

The tick microbiome is a community of commensal, symbiotic and pathogenic microorganisms found on and within the tick (Hooper and Gordon, 2001; Narasimhan and Fikrig, 2015). Pioneering studies by Cowdry (1925) first described associations of ticks with non-. Using microscopy techniques, Cowdry identified that bacteria morphology was correlated among tick species giving rise to what was coined the ‘tick-specific microbiome’. It is thought that bacterial symbionts are present in the majority of Ixodid ticks (Noda et al., 1997).

1.2.1 Bacterial composition in ticks

A variety of endosymbiont bacteria closely related to known pathogens, are commonly found within ticks [Figure 1.2]. It is suggested that the ancestral origin of these endosymbionts might have been vertebrate pathogens, acquired while feeding on an infected host (Narasimhan and Fikrig, 2015). Some endosymbionts include: Coxiella

7 spp. (Klyachko et al., 2007; Andreotti et al., 2011; Lalzar et al., 2012; Machado-Ferreira et al., 2016), Francisella spp. (Sun et al., 2000; Scoles, 2005; Szigeti et al., 2014), Wolbachia spp. (Benson et al., 2004), and spp. (Benson et al., 2004; Kurtti et al., 2005; Mattila et al., 2007; Lalzar et al., 2012). Recently a study by Gofton et al. (2015a) revealed I. holocyclus ticks are dominated by the endosymbiont ‘Candidatus Midichloria mitochondrii’ (CMM). While five native Australian hard tick microbiomes have been characterised (Gofton et al., 2015a; Gofton et al., 2015b); a further 60 species remain to be investigated.

Figure 1.2. Dominant bacterial taxa present within ticks. SG = salivary glands, MG = midgut, Ov = ovary, and Malphigian tubules (Mp). The tissue distribution of Arsenophonus spp. has yet to be determined. Source Narasimhan and Fikrig (2015).

1.2.2 Factors influencing the tick bacterial microbiome

The microbiome of the tick is strongly influenced by the environment. Ticks reared in a laboratory setting have significantly lower levels of diversity than ticks occurring naturally in the environment (Zolnik et al., 2016). The interactions between the microbes inside the tick affect the pathogenicity and transmission dynamics of tick- borne illnesses (de la Fuente et al., 2003; Clay et al., 2008; Narasimhan et al., 2014); however, very little work has been done to confirm this this in Australian ticks.

Bacterial composition of ticks has also been shown to be influenced by instar with fed females exhibiting a more diverse bacterial microbiome than male

8 counterparts (Andreotti et al., 2011). In a similar manner, the prevalence of bacterial endosymbionts has been demonstrated to reduce by as much as half between life stages, as is the case for larval and nymphal life stages of I. scapularis (Parola and Raoult, 2001). Further complexities arise with the uptake of a blood meal, which has been shown to alter the composition of the microbiome, however does not does affect the bacterial diversity (Zhang et al., 2014). In addition, the blood meal induces bacterial multiplication in the tick gut during the feeding process (Azad and Beard, 1998). Importantly with respect to ecology of TBPs, the host blood meal has also been shown to affect the presence of pathogenic bacteria present in ticks (Pichon et al., 2005; Wodecka et al., 2015). There are currently no studies to determine what effect the host blood meal has on the microbial communities of Australian ticks.

1.2.3 Methods to characterise these bacterial communities

While early tick microbiome studies utilised microscopy and cell culture techniques, providing the foundation of what is known about the tick-microbiome in general (Cowdry, 1925), studies were restricted by; (i) lack of distinguishing features between bacterial species and often pleomorphic taxa; and (ii) the presence of unculturable bacteria. However, with the advent of the polymerase chain reaction (PCR) (Mullis and Faloona, 1987) and DNA sequencing technologies (Sanger et al., 1977), a definitive identification of microbes that were morphologically similar or unable to be cultured by traditional methods was deemed possible. Further advancements, such as quantitative PCR (qPCR), have also proven successful in optimising extraction methodologies, detection of PCR inhibition and quantification of DNA (Bunce et al., 2012).

The advancement of molecular tools has highlighted the diversity of organisms present inside ticks. Broadly, DNA extracted from whole tick specimens can be broken down into one of three categories; (i) tick DNA; (ii) host (vertebrate) DNA (particularly in fed specimens); and (iii) microbial DNA (e.g. bacterial, protozoan, and viral). Attempts to survey bacterial communities requires a targeted approach and is possible with the use of primers targeting conserved regions of the ubiquitous 16S ribosomal RNA gene (Chakravorty et al., 2007; MacDonald and Sarre, 2016). However, traditional 16S rRNA sequencing approach is often not sufficient to fully characterise the complete

9 suite of bacterial species present in diverse environmental samples (Degnan and Ochman, 2012). It is noted that Sanger methods remain superior when attempting to sequence longer fragments, for example in the aims of providing a detailed phylogenetic analysis (Poretsky et al., 2014).

For a decade, advanced molecular techniques, such as next generation (massively parallel) sequencing (NGS) has revolutionised how we sequence multiple complex communities. NGS offers a high throughput, low cost, alternative to traditional sequencing methods such as Sanger sequencing (Reis-Filho, 2000; Hert et al., 2008) allowing millions to trillions of observations to made in parallel during a single instrument run (Levy and Myers, 2016). Microbial diversity studies have adapted NGS techniques by; (i) amplicon based – through targeting one of the nine hypervariable regions in the 16S rRNA gene; and (ii) shotgun sequencing - through direct sequencing of genomic DNA or RNA extracted from environmental samples (Pinto and Raskin, 2012). Despite the presumption that shotgun sequencing remains superior to amplicon- based methods, studies have shown amplicon-based approaches can yield up to 50% more phyla than shotgun based methods (Tessler et al., 2017). Amplicon based microbial studies have largely been confined to Roche’s 454, Ion torrent PGM and Illumina’s GAIIx, HiSeq and MiSeq platforms (Degnan and Ochman, 2012; Liu et al., 2012; Shokralla et al., 2012). NGS platforms have made it possible to amplify DNA directly from environmental samples, bypassing the need for laboratory isolation of individual specimens (Degnan and Ochman, 2012; Shokralla et al., 2012); as such they present an ideal platform in the characterisation of the bacterial microbiome of ticks.

The first application of NGS methods to study the tick microbiome was in the Rhipicephalus (Boophilus) microplus which demonstrated the viability of high- throughput sequencing in characterising bacterial diversity (Andreotti et al., 2011). Since then, NGS methods have shed light on the diversity of the tick microbiome. 16S amplicon based methods commonly target the V1-2 or V3-5 regions of the 16S rRNA gene (Barb et al., 2016; Yang et al., 2016; Sperling et al., 2017). Despite limitations of NGS, it remains superior to traditional cloning and Sanger sequencing methods in characterising a diverse community of organisms (Poretsky et al., 2014). Studies of TBPs are often restricted in scope due to their narrow focus on known tick-borne

10 pathogens, by the use of species- or genus-specific primers, and as a result are at risk of overlooking potentially pathogenic agents or novel organisms.

1.2.4 NGS – understanding caveats & limitations

Whilst the use of NGS has been increasingly adapted by researchers worldwide, much less attention is given to its caveats and limitations. Methodological challenges of NGS include; (i) sequencing depth and short amplicon sequencing (Gihring et al., 2012; Hou et al., 2013; Sims et al., 2014); (ii) sequencing artefacts (errors and chimeric sequences) (Kunin et al., 2010; Haas et al., 2011); and (iii) PCR amplification bias through the effect of 16S copy number (Ahn et al., 2012) and annealing temperature (Suzuki and Giovannoni, 1996).

To overcome some of the limitations associated with NGS pre-processing steps are required for both amplicon and shotgun sequencing data. The steps can include primer trimming, removal of low quality reads, chimera detection (and removal), removal of low abundance reads and denoising (Edgar, 2010; Kunin et al., 2010; Haas et al., 2011; Edgar, 2016). For 16S sequence analysis widely used pipelines include mothur (Schloss et al., 2009), Quantitative Insights into Microbial Ecology (QIIME) (Caporaso et al., 2010) and USEARCH (Edgar, 2010). Generally, comparisons between these, and other pipelines, conclude that they remain more-or-less comparable – with the emphasis on customising the parameters to best suit each unique dataset (Nilakanta et al., 2014; Plummer et al, 2015; Forster et al., 2016). Large curated reference 16S datasets include GreenGenes (DeSantis et al., 2006), the Ribosomal Database project (Cole et al., 2009), SILVA (Pruesse et al., 2007) and the EZ-Taxon (Chun et al., 2007), these datasets provide an additional point of stability between studies and generate more comparable results.

Bioinformatic pipelines and reference databases present an additional source of variation in analysis of NGS data, whereby a ‘one-size-fits-all’ approach is not appropriate. The development of freely available applications and pipelines has provided a fundamental basis for 16S bioinformatic analyses (Schloss et al., 2009; Caporaso et al., 2010; Edgar, 2010); however care must still be taken, particularly when forming comparisons between data sets analysed in different pipelines.

11 Estimates of abundance in microbiology are widely used to describe microbial community composition and diversity. The genomic copy number of the 16S gene varies considerably, from 1- 15 copies in some bacteria (Norman, 1997; Hugenholtz et al., 1998). Therefore, the variation in abundance of 16S genes is due to both actual relative abundance differences in samples and variation in genomic 16S copy number among bacteria present. In part this can be overcome through ecological models, such as an assessment of beta-diversity, which can be divided into two components; (i) turnover: difference between communities based on species presence/absence; and (ii) nestedness: differences in the abundance of species composition between communities (Baselga, 2010; Baselga et al., 2017).

1.3 Tick borne diseases

Ticks are able to cause disease in their host by direct means, e.g. tick paralysis (Diaz, 2010), mammalian meat allergy (van Nunen, 2015), and by acting as a vector for pathogenic micro-organisms, e.g. Lyme borreliosis Borrelia burgdorferi (Burgdorfer et al., 1982), Flinders Island () (Graves et al., 1991; Stewart, 1991). As obligate hematophagous ectoparasites (Brites-Neto et al., 2015), ticks are responsible for the transmission of more microorganisms than any other vector- group and include pathogenic bacterial, protozoal and viral organisms. To successfully persist, a tick-borne disease requires three components; vector-competent ticks, the aetiological agent, and reservoir host overlap (Pfaffle et al., 2013).

There are a number of well-described tick-borne infectious diseases throughout the world. The first demonstration that ticks were capable causing infectious disease dates back to the end of the 19th century where Boophilus annulatus was shown to transmitted Babesia bigemia, the agent of Texas cattle fever (Smith and Killbourne, 1893). However it was in 1982, the discovery of Lyme disease, caused by spirochetes of the B. burgdorferi sensu lato complex (Burgdorfer et al., 1982), that put TBDs on the map in the western world (Parola and Raoult, 2001). Lyme borreliosis (LB) is recognised as the most commonly-reported arthropod-borne disease in the Northern America and Europe (Dennis and Hayes, 2002) and is vectored predominately by I.

12 scapularis in central and eastern USA, Ixodes pacificus in the Western USA and Ixodes ricinus throughout Europe (Piesman and Gern, 2004).

Ticks are also known to vector viral and protozoal agents of disease. Viral tick- borne diseases include; tick-borne encephalitis virus, Crimean-Congo haemorrhagic fever virus and Colorado tick fever virus (Brites-Neto et al., 2015). Piroplasmida species, Babesia and Theileria, are vectored by hard ticks globally (Irwin, 2009; Bonnet et al., 2014; Krol et al., 2016). Additional protozoa detected from ticks include Trypanosoma spp. (Austen et al., 2011; Barbosa et al., 2017b) and Hepatozoon spp. (Herbert et al., 2010), however the disease significance of these micro-organisms remains largely unknown.

1.3.1 Australian tick-borne diseases

Australia is free from many tick-borne diseases known overseas. Whilst 71 tick species are described in Australia, only a very small portion of these have been known to bite humans (Barker and Walker, 2014; Ash et al., 2017). Mammalian meat allergy and tick paralysis are non-infectious tick-borne illnesses that have been documented in Australia, the onset of illness varies greatly among individuals (Diaz, 2010; van Nunen, 2015) and are largely attributed to I. holocyclus. In Australia, there are currently three known infectious tick-borne agents that are capable of causing disease in humans [Table 1.2]. Two endemic Rickettsia species have been identified as responsible for causing disease in humans. Queensland Tick and Australia/Flinders Island Spotted Fever (SF) are caused by and R. honei respectively. Ticks also play a role in maintaining the life cycle of , the causative agent of Q- Fever (Maurin and Raoult, 1999), although the major route of infection is by aerosol the agent has been detected in ticks, including human biting species I. holocyclus and A. triguttatum (Vilcins et al., 2009; Cooper et al., 2012; Cooper et al., 2013; Oskam et al., 2017).

The tectonic break-up of the Gondwanan super-continent has meant Australia’s unique tick and vertebrate fauna have co-evolved in relative isolation for ~100 million years (Upchurch, 2008). One consequence is that Australia remains free of the I. ricinus species complex (Barker et al., 2014; Greay et al., 2016), and importantly free of the

13 northern hemisphere TBPs that are associated with these ticks. Recent research by Gofton et al. (2015a,b) has revealed that Australian ticks appear to possess a relatively unique suite of bacteria that, while similar to pathogenic agents of disease overseas, are phylogenetically distinct; providing further support for the strong, unique evolutionary relatedness between Australian native vertebrate fauna, ticks and tick-inhabiting microorganisms.

In Australia growing concern around an unknown human tick-borne illness resulted in a Federal government Senate Inquiry in 2016 (Radcliffe et al., 2016). Increasing public and media pressure has highlighted the number of Australians that assert they have a locally acquired ‘Lyme-like’ illness. Although the peak medical body in Australia, Australian Medical Association (AMA), accept that patients may present with Lyme disease in Australia, they only accept this in the context that the individual has travelled to a Lyme-endemic country and contracted the illness outside of Australia. A handful of medical practitioners do accept, and go on to treat, locally-acquired cases of ‘Lyme-like’ illness in patients. This controversy has led to a fierce division within the scientific discipline, medical industry, the community and the political sphere. Despite the ongoing suggestion that I. holocyclus is a likely candidate for the transmission of Lyme disease in Australia (Wills and Barry, 1991; Hudson et al., 1994), clear evidence has proven that I. holocyclus is an incomponent vector of B. burgdorferi (Piesman and Stone, 1991). Researchers identify that further investigation should follow focusing on potential native Australian Borrelia spp.; however a rigorous scientific study should also include microbes such as , piroplasmids and viruses.

14 Table 1.2. Australian bacterial tick-borne diseases, associated aetiological agents and vectors.

Aetiological agent Tick species (common name) References Rickettsia australis Ixodes holocyclus (paralysis tick) (Andrew et al., 1946; Ixodes tasmani (marsupial tick) Brody, 1946; Pope, Ixodes cornuatus (southern 1955) paralysis tick) Australian tick typhus (including Flinders Island tick typhus) Rickettsia honei Bothriocroton hydrosauri (Graves et al., 1991; (southern reptile tick) Stewart, 1991; Stenos et al., 2003) Rickettsia honei Haemaphysalis novaeguinae (Lane et al., 2005; subsp. marmionii Unsworth et al., 2007) Q-Fever Coxiella burnetii Ixodes holocyclus (paralysis tick), (McDiarmid et al., Amblyomma triguttatum (ornate 2000; Vilcins et al., kangaroo tick) 2009; Cooper et al., 2012; Oskam et al., 2017)

1.3.2 Emerging infectious diseases and novel bacteria – a critical approach

The term ‘emerging infectious disease’ (EID) was originally coined to focus attention on rare or new infectious entities that were increasing in prevalence. In more recent years, however, the term has been used to described any poorly characterised or recently recognised infection (Telford and Goethert, 2004), perhaps due to the social, political and funding attached with the provoking term. The development of molecular tools, such as PCR and DNA sequencing, has undoubtedly resulted in an increased number of novel micro-organisms described inhabiting tick species across the globe (Izzard et al., 2009; Paparini et al., 2014; Gofton et al., 2015a; Loh et al., 2016; Hornok et al., 2017; Mwamuye et al., 2017).

Whilst the use of molecular tools has increased in recent years, limitations to this technology also exist. Telford and Goethert (2004) challenge this modern approach to characterising infectious agents by questioning the assumptions; (i) that data accumulated by older (‘classical’) methods are not as precise and thus not trusted; and (ii) that if a DNA or RNA sequence is obtained and does not match one that is already present in GenBank (or similar database) then it represents something novel. Although

15 Telford and Goehert (2004) present an extreme argument, and molecular methods are critical in identifying previously undescribed organisms, it is still important to be aware of such perceptions when describing novel species through molecular methods. Does the identification of a novel organism really translate into a ‘new’ finding?

1.3.3 Identification of novel organisms inhabiting Australian ticks

Four species of borreliae have been identified to date in Australia. Borrelia theileri and B. anserina were both introduced into Australia with the importation of livestock. B. theileri is transmitted by the cattle tick, (Rhipicephalus (Boophilus) australis), and causes bovine spirochaetosis (Mulhearn, 1946; Callow and Hoyte, 1961). B. anserina is mainly associated with avian spirochaetosis in poultry and is transmitted by the soft tick, Argas persicus. The third borreliae, B. queenslandica was identified from a long-haired rat, Rattus villosissimus, in north-western Queensland. The suggested vector is the soft kangaroo tick (O. gurneyi) however, this was never confirmed and its clinical significance remains unknown (Carley and Pope, 1962); additionally it has not been isolated since. The fourth and most recently identified species is ‘Candidatus Borrelia tachyglossi’ which has been observed within ticks parasitising echidnas (B. concolor, and a single I. holocyclus). This is the first novel Borrelia sp. to be molecularly characterised in Australia (Loh et al., 2017).

The family Anaplasmataceae is a group of Gram-negative obligate intracellular Alphaproteobacteria. Current classification includes four genera; Anaplasma, Ehrlichia, and Wolbachia, in addition a recent ‘Ca. Neoehrlichia’ genus has been molecularly described (Kawahara et al., 2004). Anaplasma, Ehrlichia and ‘Ca. Neoehrlichia’ are all tick-borne bacteria, that have been demonstrated to cause disease.

Compared to other known tick-borne pathogens, ‘Ca. Neoehrlichia mikurensis’ is an emerging infectious disease (EID) that causes septicaemia in humans, with symptoms such as relapsing fever, malaise and weight loss. It was first described by Kawahara et al. (2004) in Japan, isolated from rats (Rattus norvegicus) and determined to be transmitted by a tick vector (Ixodes ovatus) through molecular analysis. Since then it has been recorded around the world, including the United States (Yabsley et al., 2008), Germany (Diniz et al., 2011), Czech Republic (Maurer et al., 2013), China (Li et al., 2012), Sweden (Andersson et al., 2013) and France (Vayssier-Taussat et al., 2012)

16 predominately from ticks. Gofton et al. (2015a) first identified the novel bacteria present in I. holocyclus along the east coast of Australia.

Three species of Anaplasma have been introduced to Australia; A. platys, A. marginale and A. centrale. These exotic Anaplasma species have all been introduced through exotic tick species Haemaphysalis longicornis, Rhipicephalus sanguineus and R. australis, and occur in tropical regions of Australia (Callow, 1984; Angus, 1996). Similarly, introduced species of Ehrlichia have been described Australian domestic animals, such as E. platys (Brown et al., 2001) and E. canis (Mason et al., 2001); however their prevalence remains unknown. It was unknown if Australia had any native Anaplasma and Ehrlichia species, until recent molecular evidence has shown the presence of ‘Ca. E. occidentalis’ and a novel Anaplasma bovis genotype Y11 (Gofton et al., 2017).

Research groups across Australia have also identified a number of tick-borne organisms in wildlife (Paparini et al., 2012; Wayne et al., 2012; Dawood et al., 2013; Vanstreels et al., 2015) however in many cases their clinical effects and zoonotic potential is unknown (Averis et al., 2009; Barbosa et al., 2017a). Further research on the epidemiology, transmission dynamics and pathogenicity are urgently needed for recently described species of Borrelia, Ehrlichia and ‘Ca. Neoehrlichia’ inhabiting Australian ticks. Wildlife surveillance is a key method for the prevention of emerging infectious diseases in both humans and domestic animals (Galan et al., 2016) and highlights the importance of a One Health approach.

1.4. Australian bandicoots (Family Peramelidae)

Bandicoots are small to medium-sized weighing 1 -2 kg when mature and are endemic to Australia, Papua New Guinea and nearby islands (Gordon and Hulbert, 1989). Despite their wide range of habitats, bandicoots form a fairly uniform group (Lyne, 1990).

1.4.1. Taxonomy & geographic distribution

All extant Australian bandicoots are part of the Peramelidae family, however there is much debate about their taxonomic relatedness and distinction of species (Westerman and Krajewski, 2000). A recent review recognises eight extant species in

17 Australia within two genera – Isoodon and Perameles (Warburton and Travouillon, 2016) [Table 1.3]. Changes in taxonomy have presented some challenges when reviewing historical tick-host associations of bandicoots.

Bandicoots have experienced a severe contraction in their geographic range and it has only recently been recognised that there is a number of bandicoot species that have already become extinct (Warburton and Travouillon, 2016). Current distribution maps in Figure 1.3 shows that extant bandicoot species have partitioned to colonise separate parts of the country. In Queensland (QLD), the northern brown bandicoot (Perameles pallescens) and long-nosed bandicoot (Perameles nasuta) are most abundant, whilst as the name suggested, the Cape York bandicoot (Isoodon peninsulae) is mainly restricted to the Cape York Peninsula (Gordon et al., 1990). The long-nosed bandicoot is by far the most commonly encountered species in New South Wales (NSW), often taking up residence in urban areas (Ashby et al., 1990). Records in Victoria (VIC) show that the long-nosed bandicoot and the southern brown bandicoot (Isoodon obesulus) dominate much of the state with small populations of the eastern barred bandicoot (Perameles gunnii) still existing in more rural landscapes (Menkhorst and Seebeck, 1990). Unlike the situation faced throughout much of the mainland, Tasmania (TAS) is home to comparatively healthy populations of the southern brown bandicoot and the eastern barred bandicoot (Hocking, 1990). Although South Australia (SA) was once home to a rich diversity of bandicoot species, the southern brown bandicoot is the only extant member of the Peramelidae family (Li et al., 2016). Three current strongholds in South Australia include the Mount Loft Ranges, Kangaroo Island and the south-east region (Paull, 1995; Li et al., 2014). In Western Australia (WA), populations of the southern brown bandicoot or quenda (I. obesulus fusciventer) are widespread among the southern half of the state, and encroach urban areas (Howard et al., 2014; Hillman and Thompson, 2016). Populations of the northern brown bandicoot persist in the far north of the state. The status of the western barred bandicoot (Perameles bougainville) and golden bandicoot (Isoodon auratus) on the mainland remain highly vulnerable, with island populations the main stronghold for these species (Friend, 1990; Richards and Short, 2003). In the Northern Territory (NT), the northern brown bandicoot remains the main species encountered in the northern wet-dry tropics of the state (Johnson and Southgate, 1990).

18 Table 1.3. Recent extant bandicoot taxa present in Australia (Family: Peramelidae). Described by Warburton and Travouillon (2016) with IUCN and EPBC status at June 2017. # No published status for this species. LC = least concern, VU = vulnerable, EN = endangered, EX = extinct in the wild.

Common name Scientific name IUCN EPBC Sub-species (distribution) Status Status Golden bandicoot Isoodon auratus VU VU - I. a. auratus, mainland; - I. a. borrowensis, Barrow Island - I. a. arnhemensis, NT Cape York brown Isoodon peninsulae # # bandicoot Northern brown Isoodon macrourus LC bandicoot - I. m. macrourus, WA/NT - I. m. torous, Qld Southern brown Isoodon obesulus LC bandicoot/quenda (WA) - I. o. fusciventer, WA - I. o. nauticus, SA VU - I. o. obesulus, NSW/Vic/SA EN - I. o. affnis, TAS Western barred bandicoot Perameles bougainville VU - P. b. bougainville, WA EN - P. b. fasciata, SA, Vic, NSW EX Eastern barred bandicoot Perameles gunnii VU EN Long-nosed bandicoot Perameles nasuta LC Northern long-nosed Perameles pallescens LC bandicoot

19

Figure 1.3. Distribution map of extant Australian bandicoot species (genus Isoodon and Perameles) from Warburton and Travouillon (2016). Dark grey shade, present distribution; light grey shade, past distribution; black dots, fossil locality where it is present; grey dots, translocation sites.

20 1.4.2 Bandicoot-tick associations

A review of tick species parasitising Australian bandicoots has not been published since the work of Roberts (1970). An updated review is provided in Table 1.4, with 15 new host-tick associations, which were mainly attributed to Western Australia. In total 14 tick species biting Australian bandicoots have been recorded, representing ~20% of the known tick fauna present. The southern brown bandicoot shows the highest diversity of tick species (n = 11), followed by the long-nosed bandicoot (n = 4).

Bandicoots are regarded as a reservoir for many Australian tick species. Their status as ‘primary host’ for tick species such as I. holocyclus, combined with their persistence in urban areas, has meant bandicoots have received criticism for their suggested role in the transmission of ticks and their associated pathogens. In particular, media reports blaming bandicoots for the transmission of tick-borne illnesses to humans (Chen, 2013a; Ambrose, 2014; Kruszelnicki, 2014) has led to public backlash. Lydecker et al. (2015) found that despite the common assumption that bandicoots serve as the primary host for I. holocyclus, citations can be traced back to a single study by Doube (1975). This study was found to be limited in scope, with results largely distorted due to trapping bias. Fauna trapping techniques (e.g. Elliot and cage traps) in Australia often favour small-medium sized mammals, and as a result bandicoots may be overrepresented in records due to their trapability. Care needs to be taken when extrapolating host records of ticks and fauna to account for this bias.

The European hedgehog (Erinaceus europaeus) has been identified as a reservoir of TBPs and is host to many tick species that are known to parasitise humans (Jahfari et al., 2017). Its persistence in urban areas has meant it has been coined the ‘melting pot of zoonotic TBDs’. Similarly, bandicoots have been the targeted as the host reservoir of potential TBPs in Australia. Their continued activity in urban areas (FitzGibbon and Jones, 2006) and host to tick species such as I. holocyclus has meant they remain a possible candidate with respect to the source of enzootic disease.

21 Table 1.4. Summary of Australian tick-bandicoot associations. ^ denotes specimens unable to be identified to species level. Ticks in bold represent new records since Roberts (1970). # represents tick-host record unable to compare to Roberts 1970 due to issues around taxonomy, not identified as own species.

Common name Scientific name Ticks recorded Reference Southern brown bandicoot Isoodon obesulus Ixodes woyliei (Ash et al., 2017) Ixodes australiensis Ixodes myrmecobii Ixodes fecialis (Hillman, 2016) Ixodes australiensis Haemaphysalis humerosa Amblyomma sp.^ Ixodes holocyclus (Dowle, 2012) Ixodes tasmani Ixodes trichosuri Haemaphysalis bancrofti Ixodes tasmani (Weaver and Aberton, 2004) Haemaphysalis sp.^ Ixodes australiensis (Owen, 2007) Northern brown bandicoot Isoodon macrourus Haemaphysalis humerosa (Cooper et al., 2013) Ixodes holocyclus Haemaphysalis humerosa (Gemmell et al., 1991) Ixodes tasmani Ixodes holocyclus Ixodes holocyclus (Doube, 1975) Western barred bandicoot Perameles bougainville Haemaphysalis humerosa (Bennett, 2008; Bennett et al., 2011) Haemaphysalis ratti Haemaphysalis lagostrophi Golden bandicoot Isoodon auratus Haemaphysalis humerosa# (Dunlop, 2015) Haemaphysalis ratti# (Owen, 2007) Amblyomma limbatum#

22 Long-nosed bandicoot Perameles nasuta Ixodes holocyclus (Dowle, 2012) Ixodes tasmani Ixodes trichosuri Haemaphysalis bancrofti Ixodes holocyclus (Doube, 1975) Ixodes tasmani (Burnard et al., 2017) Ixodes holocyclus Haemaphysalis humerosa Eastern barred bandicoot Perameles gunnii Ixodes tasmani (Lenghaus et al., 1990) Ixodes fecialis

23

1.5 Conclusion & further research

Advances in molecular tools have been fundamental in describing bacterial species that cannot be readily cultivated by traditional culture methods or microscopy (Sparagano et al., 1999). Development of NGS methods has identified a number of novel candidate tick pathogens present in Australian native ticks (Gofton et al., 2015a). As the concern surrounding a putative tick-borne illness in Australia grows (Chalada et al., 2016), there is a need to further clarify the prevalence of these organisms.

Bandicoots remain one of the few marsupials that continue to persist in urban areas around Australia, particularly along the east coast (long-nosed bandicoot) and west coast (southern brown bandicoot). Bandicoots, in particular, have received attention regarding their role as the ‘primary host’ of tick species that are capable of transmitting pathogens to humans. A review of ticks that parasitise bandicoots demonstrates the overlap between tick species capable of biting humans (Doube, 1979; Murdoch and Spratt, 2005; Jackson et al., 2007; Barker and Walker, 2014; Kwak et al., 2017a).

The presence of these organisms in ticks parasitising bandicoots if of public health concern and warrants further investigation. Outcomes will shed light on the status of tick-borne diseases in Australia and assist in management decisions regarding Australian bandicoots.

24 1.6 Thesis aims and hypothesis

This honours research project has three board aims;

i. Morphologically identify ticks collected parasitising Australian bandicoots. ii. Characterise the diversity of bacterial microbes within bandicoot ticks. iii. Conduct phylogenetic analyses of identified microorganisms associated with TBD overseas

Through the review of the literature and preliminary investigation by Gofton et al. (2015a), Gofton et al. (2015b), Loh et al. (2016) and Loh et al. (2017), the following hypothesis for this project are:

1. Analysis of tick-bandicoot association will be consistent with current literature; 2. Tick-bandicoot associations will be influenced by geographic distribution; 3. Bacterial microbiome analysis will reveal that ticks parasitising Australian bandicoots have a diverse composition of bacterial microbes; 4. The diversity of microbes will be influenced by host species, tick species and geographic distribution; and lastly 5. NGS will reveal the presence of newly described organisms, closely related to those that are known to cause disease outside of Australia.

25 Chapter 2 Methods and materials

2.1 Sample collection & identification

Ticks were submitted by various research groups (see acknowledgements) around Australia to the Vector and Water-Borne Pathogen Research Group (VWBPRG) at Murdoch University. The majority of bandicoot ticks were submitted by either (i) veterinary hospitals/wildlife centres in which case bandicoots were admitted by members of the public following varying degrees of illness or stress; and (ii) research groups carrying out small mammal trapping in urban and rural areas. In all cases, ticks were collected directly from the bandicoot host. Relevant host data was recorded and ticks were stored in 70% ethanol at 4°C where practical and shipped to Murdoch University, Western Australia.

Ticks were removed from 70% ethanol and examined in petri dishes. Forceps, handling equipment and surfaces were cleaned with DNA AWAY ™ (Molecular Bio- products Inc., San Diego, USA) between samples. Samples were visualised using an Olympus SZ61 stereomicroscope (Olympus, Centre Valley, PA, United States) with an external Schott KL 1500 LED (Schott AG Mainz, Germany) light source. Photographs of tick specimens were taken using an Olympus SC30 digital camera (Olympus, Centre Valley, PA, United States) and analysis getIT software (Olympus, Centre Valley, PA, United States).

Instar, sex and species was identified using morphological keys set out in Barker and Walker (2014) and in Roberts (1970). Morphology keys for Australian larval ticks are severely lacking, and in most cases larvae could not be accurately identified to species level. In these cases samples were assigned to genus level. Following identification, ticks were grouped by species, instar, sex, and host, and stored in sterile collection tubes containing 70% ethanol at 4 °C until molecular analysis.

26 2.2 DNA extraction

2.2.1 Tick samples

Prior to DNA extraction, individual ticks were surface-sterilised with 10% sodium hypochlorite, washed with sterile DNA-free Phosphate-Buffered saline (PBS) and 70% ethanol, and air-dried. DNA-free equipment and tubes were used for each step and equipment was decontaminated between samples with DNA AWAY ™ (Molecular Bio-products Inc., San Diego, USA).

Genomic DNA (gDNA) was extracted using the DNeasy Blood and Tissue Kit (Qiagen, Germany) following the manufacturers’ recommendations (Qiagen Supplementary Protocol: Purification of total DNA from insects), with some modifications. Following the surface decontamination procedure described above, ticks were air-dried to remove excess ethanol, and placed in a 2 mL safe lock tube (Eppendorf ™) with a 5 mm steel bead. Samples were then immersed in liquid nitrogen for approximately 5 min and homogenised using a Tissue Lyser LT (Qiagen, Germany) for 1 min at 40Hz. Adult ticks were sliced into quarters with a sterile blade prior to aid homogenisation. Buffer ATL and Proteinase K (pk) enzyme were then added in the following amounts; engorged adults 350 µL buffer ATL and 50 µL of pk enzyme; nymphs, larvae and unengorged adults 225 µL of buffer ATL and 25 µL pk enzyme. Samples were then incubated overnight (approximately 16 hr) on a heat block at 56°C, 700 rpm on. Following incubation 200 µL of supernatant was transferred into a sterile 1.5 mL safe lock tube (Eppendorf ™) with 200 µL of 96% ethanol and 200 µL of buffer AL and then vortexed thoroughly. Following 500 µL buffer AW1 and buffer AW2 washes buffer AE was added directly to the membrane in the following amounts: engorged adults 200 µL, unengorged adults 100 µL and larvae and nymphs 40µL. Samples were incubated at room temperature for 4 min and then centrifuged at 8,000 rpm for 1 min. Extracted gDNA was stored at -20°C until molecular analysis. In each case gDNA extraction was carried out on each tick except larvae, which were pooled into groups of 4 to increase DNA yield. Extraction reagent blanks were carried out in parallel within each batch.

27 2.2.2 Bandicoot tissue samples

In addition to ticks, bandicoot tissue samples were sent to Murdoch University following opportunistic collection. Tissue samples were obtained from one deceased bandicoot where attached ticks were also recovered (Sample no. PI-771). Following necropsy by a local NSW registered veterinarian, spleen, kidney and liver samples were excised and stored in specimen jars at -20°C. DNA extraction was carried out on kidney, spleen and liver samples using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Germany) following the manufactures recommendations (Qiagen supplementary protocol: animal tissue). Duplicate DNA samples were extracted on each organ with the following weights: spleen 10 mg, liver 25 mg and kidney 25 mg.

2.3 Library preparation and NGS

NGS was carried out on a sub-sample of bandicoot ticks (n = 66) and bandicoot tissue samples (n = 3). Ticks were chosen to ensure one of each life stage was sampled from every individual in the collection. Where more than two specimens of the same life stage were present from the same bandicoot, an additional sample was also taken. NGS was carried out on the Illumina MiSeq platform targeting a 250-320bp product of the V1-2 hyper-variable region of the bacterial 16S rRNA gene (Turner et al., 1999; Gofton et al., 2015a) [Figure 2.1, Table 2.1]. Extraction reagent blanks (EXB) (n = 4) and no- template controls (NTC) (n = 4) were included in all stages to quantify environmental microbial communities. All pre-PCR and post-PCR procedures were performed in physically-separate dedicated laboratories, and strict hygiene protocols were maintained through library preparation in order to minimise amplicon contamination.

28 1st Stage 16S 2nd Stage Index Index PCR ampure Amplicon PCR PCR cleanup

Sample pooling Library Library Denaturing and QIAGEN Quantification and and MiSeq Sample purification Normalisation Loading

Figure 2.1. NGS library preparation workflow. Tick and tissue samples sequenced on the illumina MiSeq platform.

2.3.1 Determination of blocking primer assays for Ixodes holocyclus

Previous research has shown NGS of I. holocyclus has been limited due to a large proportion (>95%) of 16S sequences generated belonging to the endosymbiont ‘Candidatus Midichloria mitochondrii’. As a result a blocking primer developed by Gofton et al. (2015a) was utilised in this study. To optimise the concentration of blocking primer in each sample, preliminary PCR assays were carried out on I. holocyclus ticks. In addition, due to its close phylogenetic and morphological relationship with I. holocyclus, I. myrmecobii was run in parallel with and without blocking primer to assess the presence of ‘Ca. Midichloria mitochondrii’.

Reactions were carried out in 25 µL volumes containing 1 x KAPA Taq buffer + dye (KAPABiosystems, Massachusetts, USA), 0.4 µM of 27F-Y and 338R primer [Table 2.1], targeting the V1-V2 16S rRNA hypervariable region, each with an Illumina MiSeq sequencing adapter (Integrated DNA Technologies, California, USA), 0.5 U of KAPA Taq polymerase (KAPABiosystems, Massachusetts, USA), 0.25 mM dNTPs (Fisher Biotech, Australia), 0.01 mg BSA (Fisher Biotech, Australia) and 2 µL of neat extracted gDNA. Varying concentration between 1 µM and 10 µM of blocking primer (Midblocker) were

29 added. PCR amplification was carried out by conventional PCR on a BioRAD T100 following the thermal cycling conditions: initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s with a final extension at 72°C for 5 min. PCR products were separated on a 2% (w/v) agarose gel with a 100 bp molecular weight ladder (Promega, Madison USA) as described in section 2.6. As a result of these assays, optimal concentration of MidBlocker primer was determined for each life stage.

2.3.2 Amplicon PCR and gel electrophoresis

Amplicon PCR reactions [1st stage PCR, Figure 2.1] were carried out in 25 µL assays. For all samples without MidBlocking primer (i.e. all ticks except I. holocyclus and parallel sample of I. myrmecobii), each reaction contained 1 X KAPA Taq Buffer & dye (KAPA Biosystems, Massachussetts, USA), 0.4 µM of each forward and reverse primer with MiSeq adapters [Table 2.1], 0.4 mg/mL BSA (FisherBiotech, Australia), 2.5 mM dNTPs (FisherBiotech, Australia), 0.5 U KAPA Taq (KAPA Biosystems, Massachusetts, USA), 2.0 µL of neat DNA. NTC and EXB controls were included in every PCR and in the final sequencing libraries to establish background bacterial populations. In addition to the reagents and concentrations listed above, samples of I. holocyclus and I. myrmecobii contained the following concentration of MidBlocker; 10 mM for engorged females, 2 mM for males, and 1 mM for nymphs. PCR amplification was carried out by conventional PCR on a BioRAD T100™. Samples without MidBlocker underwent the following thermal cycling conditions; initial denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 45 s with a final extension at 72°C for 5 min. Samples with MidBlocker present underwent the following thermal cycling conditions; initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 62°C for 30 s, and extension at 72°C for 30 s with a final extension at 72°C for 5 min. All pre-PCR and post-PCR procedures were performed in physically-separated laboratories to minimise amplicon contamination. Following amplicon PCR, 5 µL of products were separated on a 2% (w/v) agarose gel with a 100 bp molecular weight ladder (Promega, Madison USA) as described in section 2.6.

30

Table 2.1. Primers used in NGS assays.

Primer Sequence (5’ – 3’) Reference 27F-Y AGAGTTTGATCCTGGCTYAG (Gofton et al., 2015a) 338R TGCTGCCTCCCGTAGGAGT (Turner et al., 1999) MiSeq forward TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (Illumina Inc, adapter 2015) MiSeq reverse GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG adapter MidBlocker Primer GGCTYAGAGTGAACGCTGGCGG/C3/ (Gofton et al., 2015a)

2.3.3 Index PCR and gel electrophoresis

Amplicon samples were indexed [2nd stage PCR, Figure 2.1], in 25 µL volumes containing 12.5 µL KAPA HiFi HotStart 2 X mix, 2.5 µL each of Nextera XT Index 1 primer (N7XX) and Index 2 primer (S5XX) and 1 µL of amplicon PCR product. Thermal cycling conditions were performed in 95°C for 3 min with 15 cycles of 95°C for 30s, 55°C for 30s on a BioRAD T100™.

Following the index PCR 5 µL of product and 2 µL of 6 X loading dye (ThermoFisher Scientific, California USA) were mixed and separated on a 2% (w/v) agarose gel with a 100 bp molecular weight ladder (Promega, Madison USA) as described in section 2.6. Visualisation of index PCR products was done to confirm unique indexes were successfully attached to samples, seen by an increase in 30-50 bp.

2.3.4 Index PCR clean up and gel electrophoresis

Index PCR clean-up was carried out following the Illumina 16S metagenomics protocol with some exceptions using Agencourt® AMPure® XP PCR Purification beads (Massachusetts, USA). 9 µL of index PCR product was mixed with 9 µL of Agencourt® AMPure® (Massachusetts, USA) beads to remove DNA products below 250 bp. After 5 min incubation at room temperature, samples were placed on a magnetic plate and supernatant was removed. Two washes of 80% ethanol were performed before eluting in 20 µL of EB buffer. 15 µL of supernatant was then stored at -20 °C until further

31 analysis. The remaining 5µL of sample was mixed with 2µL 6 X loading dye (ThermoFisher Scientific, California USA) and separated on a 2% (w/v) agarose gel with a 100 bp molecular weight ladder (Promega, Madison USA) as described in section 2.6. Images from this gel electrophoresis were used to quantify samples in preparation for library pooling.

2.3.5 Library pooling and purification

Following gel electrophoresis of purified index products, band intensity was calculated using GelAnalyzer (Lazar and Lazar, 2010) to ensure equimolar concentration of pooled samples. Intensity measurements were then standardised to ensure equal molar concentrations of DNA amplicons were added to final pooled library. Three aliquots of 20 µL pooled library sample were then mixed with 5 µL of 6 X loading dye (ThermoFisher Scientific, California USA) and separated on a 2% (w/v) agarose gel with a 100 bp molecular weight ladder (Promega, Madison USA) as described in section 2.6. Following this, 50 µL of the original pooled library underwent PCR purification using the QIAquick PCR purification kit (Qiagen, Germany), following manufacturers recommendations, except for a final elution in 20 µL of Buffer EB to increase DNA yield.

2.3.6 Library quantification and sample loading

The final purified pooled library was then quantified using the Qubit® 2.0 Fluorometer (Thermo Fisher, Australia) following manufacturers’ protocol. A final pooled library of 4.85 pM was then denatured and combine with an equimolar concentration of 15% PhiX library, used as an internal control to increase sequence diversity on the MiSeq platform as recommended by manufacturer. Final quantified library was then loaded onto the Illumina MiSeq platform [see Table A1.3 for mapping file].

2.4 NGS data analysis

Raw fasta files were downloaded from the Illumina BaseSpace Sequence Hub for analysis in a USEARCH (Edgar, 2010) pipeline. Raw illumina paired reads were first merged and trimmed, with a minimum merge overlap of 50 bp in USEARCH v9.2 (Edgar, 2010). Reads were then quality filtered (error rate threshold of 1%) and short dimer

32 sequences were removed. Sequences below 150 bp were then removed and adaptor and primer sequences were trimmed in USEARCH v8 (Edgar, 2010). Sequences were dereplicated and singletons were removed in USEARCH v9.2 (Edgar, 2010). Operational taxonomy units (OTUs) were created by clustering sequences with a 97% similarity with the UNOISE3 algorithm (Edgar, 2016) in USEARCH v10.0 (Edgar, 2010). Taxonomy was assigned to OTUs in QIIME (Caporaso et al., 2010) with reference to the GreenGenes 16S curated database (August 2013) (DeSantis et al., 2006). The profile from EXBs and NTCs were first analysed to ensure quality of samples, and minimal contamination. The profiles of EXB and NTC were then bioinformatically removed from samples to eliminate potentially contaminating and background bacteria.

2.4.1 Ecological modelling

Ecological modelling was carried in RStudio v1.0.136 (RStudio, 2016) using the following packages; Vegan v2.4.4 (Oksanen et al., 2017), Microbiome (Lahti et al., 2012- 207), betapart (Baselga et al., 2017) and phyloseq (McMurdie and Holmes, 2013). Data wrangling and visualisation packages included; ggplot2 (Wickham, 2009) and tidyverse (Wickham, 2017). Alpha diversity analysis included rarefaction curves and Shannon diversity plots based on Hurlbert (1971) formulation generated in Vegan v2.4.4. Principal coordinate analysis plots of beta diversity were made using Jaccard index (presence/absence) (Baselga et al., 2017) and Bray-Curtis dissimilarity index (abundance) (Baselga, 2013). Non-metric multidimensional scaling (NMDS) was performed in Vegan v2.4.4 based on relationship between the dissimilarities in the samples matrix (Torondel et al., 2016). Except where specifically outlined data excluded EXB and NTC profile and included all samples and taxa individually.

2.5 Species & genus specific PCR assays

To gain more information regarding recently-described candidate pathogenic bacteria, samples underwent species- and genus-specific PCR assays. Due to time and budget constraints, only a sub-selection of tick samples were selected for NGS. All extracted tick samples underwent targeted bacterial screening. Target PCR assays were also carried out where tick species could not be identified morphologically and in cases where host-bandicoot records were missing species information. In all cases, samples were prepared in a two-stage process to avoid the risk of contamination, where

33 separate DNA hoods were used to prepare master mix solution and add gDNA samples (DNA/RNA UV-cleaner box UVC/T-AR, Biosan, Riga, Latvia).

2.5.1 ‘Candidatus Neoehrlichia’ qPCR

To assess the presence of ‘Ca. Neoehrlichia’, a genus-specific qPCR assay (Maurer et al., 2013) was performed on extracted gDNA from tick samples (n = 130) and tissue samples (n = 6). Reactions were carried out in 25 µL volumes each containing 1 X KAPA

Taq Buffer A with 1.5 mM MgCl2, additional 0.5 mM of MgCl2, 0.1 µM of genus-specific probe, 0.4 µM each of Ana_fwd and Neo_rev primers [Table 2.2], 2.5 mM dNTPs, 0.5 U KAPA Taq and 2 µL of undiluted DNA. A positive control and NTC were included in all assays. The qPCR assay was carried out using the StepOne™ Real-Time PCR Machine (version 2.1, Applied Biosystems, Foster City, CA) under the following conditions; initial hold (50°C, 2 min), one cycle of denaturation (95°C, 10 min), followed by 50 cycles of denaturation (95°C, 15 s) and annealing/extension (60°C, 1 min).

2.5.2 Borellia nested PCR

To detect the presence of Borrelia gDNA, tick samples underwent a nested-PCR assay targeting the flaB gene, as described in Loh et al. (2016). The nested flaB assay targeting an approximately 407 bp final product was selected as an initial screening assay due to the increased sensitivity to detect the novel Australian ‘Ca. B. tachyglossi’ over other targeted genes such as 16S rRNA or GroEL as described by Loh et al. (2016). Reactions were carried out in 25 µL volumes each containing 1 X KAPA Taq Buffer + dye, 1.5 mM MgCl2, 0.4 µM of each forward and reverse primers [Table 2.2], 2.5 mM dNTPs, and 0.5 U KAPA Taq. Primary reactions included 2 µL of undiluted gDNA and secondary reactions included 2µL of the primary product. PCR amplification was carried out by nested PCR on a BioRAD T100™ under the following thermal cycling conditions; initial denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 52°C (primary) or 55°C (nested) for 30 s, and extension at 72°C for 30 s with a final extension at 72°C for 5 min. Positive and NTC samples were included in all assays.

34 2.5.3 Ixodida PCR

Morphology of Australian tick species is extremely elusive, with only a handful of publications available. The most extensive reference for Australian tick larvae remains Roberts (1969), however it only describes 29 species and the description of some species is lacking. In order to clarify the identification of larvae, a PCR assay targeting a 750 bp product of the cytochrome c oxidase gene was carried out. Reactions were carried out in 25µL volumes each containing 1 X KAPA Taq Buffer + dye, 3.5 mM MgCl2, 0.4 µM each of COX1 fwd and COX1 rev primers [Table 2.2], 2.5 mM dNTPs, 1 U KAPA Taq and 1 µL of undiluted gDNA. PCR amplification was carried out by conventional PCR on a BioRAD T100™ under the following thermal cycling conditions; initial denaturation at 95°C for 5 min followed by 40 cycles of denaturation at 95°C for 45 s, annealing at 50°C for 60 s, and extension at 72°C for 60 s with a final extension at 72°C for 5 min. Controls of morphologically identified tick species and NTC samples were included in all assays.

Table 2.2. Primers used in species-specific PCR assays.

Primer Sequence (5’ – 3’) Amplicon Reference (bp) Borrelia flaB Primary GCAGTTCARTCAGGTAACGG 645 (Barbour et al., FlaB280F 1996; Clark et al., Primary GCAATCATAGCCATTGCAGATTGT 2013) FlaRL Secondary GCATCAACTGTRGTTGTAACATTAACAGG 407 FlaB_737F (Loh et al., 2016) Secondary ACATATTCAGATGCAGACAGAGGT FlaLL Neoehrlichia qPCR Ana fwd ATC CTG GCT CAG AAC GAA CG 280

Neo fwd ATC CTG GCT CAG AAC GAA CG (Maurer et al., 2013) Probe 6FAM-ACC CAT AGT AAA CTA CAG CTA CA-MGB Ixodida COX1 fwd GGA ACA ATA TAT TTA ATT TTT GG (Chitimia et al., 750 2010) COX2 red ATC TAT CCC TAC TGT AAA TAT ATG

35 2.6 Gel electrophoresis

Nested and conventional PCR products were ran on a 1-2% (w/v) agarose gel with a 100 bp or 1 kb molecular weight ladder (Promega, Madison USA). DNA bands were visualized using a UV transillumination and an AlphaDigiDoc transillumination system (BioRad, Hercules, USA), with images retrieved and saved using a Cannon camera and AlphaDigiDoc software.

2.7 DNA Sequencing

Following visualisation via gel electrophoresis positive amplicons of expected size were then purified using the QIAquick® Gel Extraction Kit (QIAGEN, Germany) according to the manufacturers protocols. Purified PCR products were sequenced with both forward and reverse primers on an ABI 373096 Capillary Sequencer (Life Technologies, USA) following an ethanol precipitation as described by the manufacturer.

2.8 Phylogenetics

Sequences were imported into Geneious (Kearse et al., 2012) and primers were trimmed. Sequences were aligned with reference sequences retrieved from GenBank using MAFFT v7.017(Katoh et al., 2002), and realigned using MUSCLE (Edgar, 2004). An outgroup was used to root trees and provide a more meaningful comparison due to the short fragment length of sequences analysed. Trees were drawn using MrBayes (Ronquist and Huelsenbeck, 2003) using a gamma distribution.

2.8 One health comparison: ticks capable of biting humans

Records of ticks biting humans in Australia were sourced from the ANIC (Australian National Insect Collection) curated by Dr Bruce Halliday (August 2013) and VWBPRG databases. Human host records of ticks were extracted for comparison with ticks known to bite bandicoots.

36 Chapter 3 Results

3.1 Ticks collected

In total, 290 ticks parasitising bandicoots were collected and identified from around Australia. Ticks were identified from four bandicoot species: eastern barred bandicoot (Perameles gunnii), long-nosed bandicoot (Perameles nasuta), northern brown bandicoot (Isoodon macrourus) and southern brown bandicoot (Isoodon obesulus). Seven species of ticks from two genera, Ixodes and Haemaphysalis, were identified morphologically [Figure 3.1, Table A1.1]. A summary of host-tick relationships is shown in Figure 3.2. A small number of larvae (n = 9) could only be identified to genus level using morphological features.

Tick samples were submitted from WA, NT, QLD, NSW and TAS [Figure 3.3]. No samples were submitted from SA, VIC or ACT. Table 3.1 displays the geographic association of ticks identified. I. australiensis, I. fecialis and I. myrmecobii were identified exclusively from WA. I. tasmani was the only tick identified from TAS, similarly H. humerosa the only species from NT. H. bancrofti, H. humerosa, I. holocyclus and I. tasmani were identified from NSW, while H. humerosa, I. holocyclus and I. tasmani were identified from QLD.

Tick infestation was highly variable among individual bandicoots, ranging from 1 - 68, with a mean infestation of 5.9± 1.67 ticks per host. The southern brown bandicoot and long-nosed bandicoot displayed the highest tick diversity with four species identified parasitising these hosts. Nymphs were the most abundant instar collected (n = 215), followed by females (n = 80), males (n = 36) and larvae (n = 9).

37 A-i B-ii

B-i B-ii

C-i C-ii

Figure 3.1. Ticks identified parasitising Australian bandicoots. A Male Ixodes holocyclus, dorsal (i) and ventral (ii) view. B Female Ixodes holocyclus engorged, dorsal (i) and ventral (ii) view. C Nymph Ixodes tasmani, dorsal (i) and ventral (ii) view.

38

Figure 3.2. Tick-bandicoot host associations. Bandicoot spp. represent individuals that were missing species data. Seven species of tick spanning two genera identified from four bandicoot species (n = 290). A small number of larvae could not be identified to species level (n = 9).

Table 3.1. Geographic breakdown of tick specimens morphologically identified from Australian bandicoots.

State/Territory Larvae Nymph Male Female Haemaphysalis bancrofti NSW 0 3 0 1

Haemaphysalis humerosa NSW 0 1 0 0 NT 0 3 3 9 QLD 0 0 1 2

Ixodes australiensis WA 13 13 0 3

Ixodes fecialis WA 0 0 0 2 Ixodes holocyclus NSW 0 46 32 37 QLD 0 6 0 5

Ixodes myrmecobii WA 0 4 0 0

Ixodes tasmani NSW 0 5 0 0 QLD 0 11 0 1 TAS 0 60 0 20

Ixodes spp. (unknown) WA 9 0 0 0

Sum 22 152 36 80

39

Figure 3.3. Geographic distribution of ticks collected during this study. Ticks collected from WA (n = 44), NT (n = 15), QLD (n = 26), NSW (n = 125) and TAS (n = 80).

40

3.2 NGS overview and data exploration

NGS was carried out on a selection of 67 tick, three tissue biopsies and eight EXB/NTC samples, which included parallel sample of I. myrmecobii as described in 2.4.1. Where possible, ticks were selected to represent each individual host, species, and life stage present in the collection. In some instances, the scutum had been pierced during handling and as such compromised the exoskeleton of these ticks, therefore were not suitable for microbial analysis because contamination could not be ruled out. A total of 13,579,900 sequences were generated on the Illumina MiSeq platform with approx. 11,678,700 sequences passing quality filter. The number of reads that passed filter set at Q30, indicating a 0.1% chance of an incorrect base being called during sequencing.

3.2.1 Sequencing depth

Distribution of sample sequencing depth in Figure 3.4 shows the variation in the number of sequences generated for each sample. In particular, 12 specimens had extremely low sequencing depth (< 1000 sequences), of which eight (8/12, 67%) were I. holocyclus, a single I. myrmecobii (with blocking primer, an additional sample was run in parallel without blocking primer), two I. tasmani and a single H. humerosa.

41

No. samples

Sampling depth (No. of reads)

Figure 3.4. Distribution of sequencing depth for tick samples. Samples with < 1000 sequences were considered low and inadequate coverage to accurately determine microbiome composition.

The relationship between sequencing depth and species diversity showed a general trend that increasing sequencing depth resulted in an increased observed species diversity. Rarefaction curves were used to determine how adequate sequencing depth was in detecting the complete theoretical suite of bacterial organisms present; of note, rarefaction plots excluded OTUs considered environmental contaminants (described in section 3.2.2 Microbial composition). Figure 3.5 shows that sampling depth was highly variable, however most samples did display the characteristic plateau, which is indicative of adequate sampling of all species present. The species diversity rarefaction plot highlights the variation in sequencing depth among samples. In general, there was a trend that samples with greater sampling (sequencing) depth display a plateau in species diversity, indicating that sampling was adequate. One sample exhibited an unusually high species diversity (1135IHN_B14) with 125 OTUs exhibiting > 1 read, however when this threshold was increased to > 30 reads, only 77 OTUs were identified in the same sample. Some samples generated a low read depth (< 1000 reads = 13/67) and generally displayed low species diversity. The effect of low abundance reads was considered through a rarefaction curve, where OTUs with < 50 reads were

42 removed from samples [Figure A1.1]. Species diversity did plateau earlier when low abundance taxa were removed from samples. In all cases, except where specifically outlined all reads were included to ensure adequate representation of all taxa.

Figure 3.5. Rarefaction curve to describe species diversity (number of OTUs) between samples size (number of reads). Species diversity modelling using the Shannon index based on Hurlbert (1971).

3.2.2 Microbial composition

No-template and EXB controls were included to determine the level of cross- contamination and contamination from the laboratory environment that occurred during DNA extraction and NGS library preparation. The bacterial communities in control samples were dominated by Cyanobacteria (44.43%), in contrast to the tick samples that were dominated by (66.00%), and contained very little Cyanobacteria (0.91%) [Figure 3.6]. However, a very small amount of cross- contamination was detected, indicated by the presence of tick-endosymbiont in control samples. Rickettsiella (OTU 1 and 2) and ‘Ca. Midichloria’ (OTU 3 and 5) endosymbionts (Kurtti et al., 2005; Sassera et al., 2006; Gofton et al., 2015a) were almost exclusive to

43 tick samples, only 10 reads of ‘Ca. Midichloria’ in a no-template control sample [Table 3.2]. To account for this low level of contamination, the microbial profile reflective of NTC and EXB samples (523, 501 sequences) was removed from samples. This study recorded a total of 1206 OTU’s inclusive of NTC/EXB, 1057 OTUs were detected in tick samples once NTC and EXB reads were bioinformatically removed.

Figure 3.6. Overall representation of bacterial phyla present in tick samples (left) and extraction blank/no-template control samples (EXB/NTC) (right). Microbiome composition of ticks was dominated by Proteobacteria while EXB and NTC samples were made up predominately by Cyanobacteria and Firmicutes phyla.

Table 3.2. Prevalence of selected known tick endosymbionts and tick-specific bacterial species to assess contamination during NGS library preparation.

OTU(s) Closest NCBI GenBank No. of reads in No. of reads in match Accession No. tick samples EXB/NTC samples 1,2 Rickettsiella U97547 1,477,312 0 3,5 ‘Ca. Midichloria’ FM992372/ 791,169 10 JQ031634 18 ‘Ca. Neoehrlichia KT203914 51,565 0 arcana’ 20 Ca. Neoehrlichia KT203915 43,933 0 australis’ 24 ‘Ca. Neoehrlichia’ JQ359050 39,794 0 nov. sp. 27 Ehrlichia AY309970 36,215 0 231 ‘Ca. Borrelia KT203916 1,371 0 tachyglossi’ 268 Anaplasma bovis KY425426 1,120 0

44 3.2.3 Comparison of abundance and presence/absence models

The effect of abundance and presence/absence data was analysed through species diversity models and plotted through principle coordinate analysis (PCoA). Figure 3.7 shows that I. tasmani and I. holocyclus have distinct, different microbial communities. In the case of presence/absence data, except for I. myrmecobii, all other tick species grouped more closely with I. tasmani. Conversely when analysing the community abundances, I. tasmani was isolated, while all other tick species grouped more closely with I. holocyclus. In both abundance and presence/absence data there appears to be two distinct groupings of the tick microbiome. Both models show that. I. fecialis, I. australiensis, H. humerosa, H. bancrofti and Ixodes spp. samples share a similar suite of microbes. I. holocyclus and I. myrmecobii display a similar pattern. In both models a significant difference in diversity was observed between tick species with P < 0.001 [Figure 3.8]. Abundance data exhibited greater variation within groups (tick species), with I. tasmani showing the greatest diversity. Presence/absence data displayed much more constrained ranges with I. holocyclus showing the greatest diversity.

45

bd bd 0.4 0.2

IT 0.2 IM IA IT IH

0.0 IU HB IF PCoA 2 PCoA PCoA 2 PCoA HH 0.0 IH HB IF HH

IM

-0.2 IU -0.2

IA -0.4 -0.4 -0.4 -0.2 0.0 0.2 -0.2 0.0 0.2 0.4 0.6

PCoA 1 PCoA 1 method = "" method = ""

Figure 3.7. PCoA analysis showing the differences in beta-diversity between tick species at OTU taxa between presence/absence data based on Jaccard index (left) and abundance data based on Bray-Curtis dissimilarity (right). Distance to centroid value is used to evaluate distance of beta diversity values among tick species. All tick samples and OTU's were included for analysis. HB = H. bancrofti (n = 4), HH = H. humerosa (n = 6), IA = I. australiensis (n = 4), IF = I. fecialis (n = 2), IH = I. holocyclus (n = 32), IT = I. tasmani (n = 15), IU = Ixodes spp. (n = 2), IM = I. myrmecobii (n = 2).

46

1.0 0.8 0.6 0.4 Distance to centroid Distance 0.2 0.0

H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp.

1.0 0.8 0.6 0.4 Distance to centroid Distance 0.2 0.0

H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp.

Figure 3.8. Boxplot showing the differences in beta-diversity between tick species at OTU taxa between presence/absence using Jaccard index (top) and abundance data using Bray-Curtis dissimilarity (bottom). Distance to centroid value is used to evaluate differences of beta diversity among tick species. ANOVA analysis; presence/absence (Jaccard index), F7,59 = 18.688 P < 0.001; Abundance (Bray-Curtis dissimilarity), F7,59 = 5.461 P < 0.001. H. ban = H. bancrofti (n = 4), H. hum = H. humerosa (n = 6), I. aus = I. australiensis (n = 4), I. fec = I. fecialis (n = 2), I. hol = I. holocyclus (n = 32), I. tas = I. tasmani (n = 15), Ixodes spp. (unknown) (n = 2), I. myr = I. myrmecobii (n = 2).

47

3.2.4 Exploration of factors affecting microbial beta-diversity

Taxonomic assignment

PCoA via presence/absence Jaccard index using taxa assignment at phyla, order, family and species OTU levels were carried out to determine the effects of taxonomic assignment of diversity indices. Figure 3.9 shows a consistent pattern at all four taxon levels with I. holocyclus and I. myrmecobii grouping together, compared to the other tick species. As taxonomic hierarchy becomes broader, the microbial composition between tick species becomes less distinct, with almost complete overlap displayed at phylum level. Differences in beta diversity between tick species was most prominent at OTU, family and order level (P <0.001), than at the phylum level (P = 0.034) [Figure 3.10].

Grouping low abundant taxa

In addition to exploring the effect of taxonomic assignment, the effect of grouping low abundant taxa was also analysed. Family taxa with <1000 reads were grouped into a single ‘low abundant’ group. Figure 3.11 shows that grouping low abundant taxa, does not shift the pattern in microbial relatedness between tick species. Further analysis also showed that beta diversity remains significant between tick species (P <0.001) in both cases [Figure 3.12].

Removing samples with low number of reads

The effect of samples that were poorly sequenced was explored by removing samples with < 1000 reads. Figure 3.13 shows that where all samples were analysed tick species formed more distinct groups, compared to analysis where samples with a low number of reads were excluded. Figure 3.14 shows that beta-diversity variation however, was only marginally affected, and in both cases a significant difference (P <0.001) was observed.

48 bd bd 0.2

0.2 IH IM IT IM IA 0.0 IU HB HH IA IF

0.0 IU HB IF PCoA 2 PCoA

HH 2 PCoA IH IT -0.2 -0.2 -0.4

-0.4 -0.4 -0.2 0.0 0.2 0.4 0.6 0.8 -0.4 -0.2 0.0 0.2

PCoA 1 PCoA 1 method = "" method = "" (a) (b)

bd 0.4 0.2

IM IU HH PCoA 2 PCoA HB

0.0 IF IT IH

IA -0.2

-0.2 0.0 0.2 0.4 0.6

PCoA 1 method = ""

(c) (d)

Figure 3.9. PCoA analysis showing the differences in beta-diversity between tick species (Jaccard index) at (a) OTU, (b) family (c) order and (d) phylum. Distance to centroid value is used to evaluate distance of beta diversity values among tick species. All tick samples and OTU's were included for analysis. HB = H. bancrofti (n = 4), HH = H. humerosa (n = 6), IA = I. australiensis (n = 4), IF = I. fecialis (n = 2), IH = I. holocyclus (n = 32), IT = I. tasmani (n = 15), IU = Ixodes spp. (n = 2), IM = I. myrmecobii (n = 2).

49 1.0 0.8

0.6

0.4

Distance to centroid Distance 0.2

0.0 (a) H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp.

1.0

0.8

0.6 0.4

Distance to centroid Distance

0.2 0.0

(b) H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp.

1.0

0.8

0.6

0.4 Distance to centroid Distance

0.2

0.0 (c) H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp.

1.0

0.8

0.6

0.4 Distance to centroid Distance

0.2

0.0

(d) H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp.

Figure 3.10. Boxplots showing the differences in beta-diversity between tick species at (a) OTU, (b) family (c) order and (d) phylum based on Figure 3.9. Distance to centroid value is used to evaluate differences of beta diversity among tick species. ANOVA analysis; OTU F7,59 = 18.688 P <0.001; Family F7,59 = 8.756 P < 0.001; Order F7,59 = 4.219 P <0.001; Phyla F7,59 = 2.3551 P =0.034. H. ban, H. bancrofti (n = 4), H. hum, H. humerosa (n = 6), I. aus, I. australiensis (n = 4), I. fec, I. fecialis (n = 2), I. hol, I. holocyclus (n = 32), I. myr, I. myrmecobii (n = 2). I. tas, I. tasmani (n = 15), Ixodes spp. (unknown) (n = 2).

50

bd bd 0.2 0.4 IH IM 0.0

0.2 IT IU HB HH IA IF IF HH IA PCoA 2 PCoA

PCoA 2 PCoA HB IT IU 0.0 -0.2

IH IM -0.2 -0.4

-0.4 -0.2 0.0 0.2 0.4 0.6 0.8 -0.4 -0.2 0.0 0.2 0.4 0.6

PCoA 1 PCoA 1 method = "" method = "" (a) (b)

Figure 3.11. PCoA analysis showing the differences in beta-diversity between tick species using Family taxa (a) includes all family taxa (b) family taxa with <1000 total reads grouped into one ‘low abundant’ family. Distance to centroid value is used to evaluate distance of beta diversity values among tick. HB = H. bancrofti (n = 4), HH = H. humerosa (n = 6), IA = I. australiensis (n = 4), IF = I. fecialis (n = 2), IH = I. holocyclus (n = 32), IT = I. tasmani (n = 15), IU = Ixodes spp. (n = 2), IM = I. myrmecobii (n = 2).

1.0 1.0 0.8 0.8 0.6 0.6 0.4 0.4 Distance to centroid Distance Distance to centroid Distance 0.2 0.2 0.0 0.0

H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp. H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp.

(a) (b)

Figure 3.12. Boxplots showing the differences in beta-diversity between tick species at family taxa between (a) includes all family taxa (b) family taxa with <1000 total reads grouped into one ‘low abundant’ family based on Figure 3.11. Distance to centroid value is used to evaluate differences of beta diversity among tick species. ANOVA analysis; All Family taxa F7,59 = 8.756 P <0.001; Grouped lower abundant family taxa F7,59 = 6.046 P <0.001. H. ban, H. bancrofti (n = 4), H. hum, H. humerosa (n = 6), I. aus, I. australiensis (n = 4), I. fec, I. fecialis (n = 2), I. hol, I. holocyclus (n = 32), I. myr, I. myrmecobii (n = 2). I. tas, I. tasmani (n = 15), Ixodes spp. (unknown) (n = 2).

51 bd bd 0.4 0.4

0.2 IT 0.2 IF HH IA IH

PCoA 2 PCoA IU HB PCoA 2 PCoA 0.0 HB 0.0 IA IH IM HHIU IT

-0.2 IF -0.2

-0.4 -0.2 0.0 0.2 0.4 0.6 -0.6 -0.4 -0.2 0.0 0.2 0.4 PCoA 1 method = "" PCoA 1 method = "" (a) (b)

Figure 3.13. PCoA analysis showing the differences in beta-diversity between tick species using Family taxa (a) all samples (b) samples >1000 reads only. Distance to centroid value is used to evaluate distance of beta diversity values among tick. HB = H. bancrofti (n = 4/4), HH = H. humerosa (n = 6/5), IA = I. australiensis (n = 4/4), IF = I. fecialis (n = 2/2), IH = I. holocyclus (n = 32/24), IT = I. tasmani (n = 15/13), IU = Ixodes spp. (n = 2/2), IM = I. myrmecobii (n = 2/0). First number indicates number of samples in (a) and second number indicates samples in (b), I. myrmecobii had to be excluded from plot (b) due to sample size of n = 1.

1.0 1.0 0.8 0.8 0.6 0.6 0.4 0.4 Distance to centroid Distance Distance to centroid Distance 0.2 0.2 0.0 0.0 H. ban H. hum I. aus I. fec I. hol I. myr I. tas Ixodes spp. H. ban H. hum I. aus I. fec I. hol I. tas Ixodes spp.

(a) (b)

Figure 3.14. Boxplots showing the differences in beta-diversity between tick species using Family taxa (a) all samples (b) samples <1000 reads excluded based on Figure 3.13. Distance to centroid value is used to evaluate differences of beta diversity among tick species. ANOVA analysis; All samples taxa F7,59 = 8.756 P <0.001; samples >1000 reads only F6,47 = 6.658 P <0.001. H. ban, H. bancrofti (n = 4/4), H. hum, H. humerosa (n = 6/5), I. aus, I. australiensis (n = 4/4), I. fec, I. fecialis (n = 2/2), I. hol, I. holocyclus (n = 32/24), I. myr, I. myrmecobii (n = 2/0). I. tas, I. tasmani (n = 15/13), Ixodes spp. (unknown) (n = 2/2). First number indicates number of samples in (a) and second number indicates samples in (b), I. myrmecobii had to be excluded from plot (b) due to sample size of n = 1.

52 3.3 Tick microbiome

At the phylum level, the tick microbiome was dominated by the Proteobacteria, with the remainder largely consisting of Firmicutes and Actinobacteria. This general pattern was seen when comparing samples by tick species, vertebrate host, life stage and state [Figure 3.15-18]. Comparison of phylum-level diversity between tick species show that H. humerosa, I. australiensis, I. fecialis, I. tasmani and Ixodes spp. had >50% composition of Proteobacteria, H. bancrofti consisted of approximately 50% Firmicutes, I. myrmecobii was dominated by approximately 60% Actinobacteria, while I. holocyclus had a more even composition all three phyla. Male ticks sampled had a higher proportion of Firmicutes compared with other life stages, while larvae largely consisted of Proteobacteria. Comparison of the microbial composition at phylum level between life stage, host and geographic location, displayed similar patterns in microbial distribution as seen when compared by tick species. For example, the microbiome of the long-nosed bandicoot, was similar to that observed by I. holocyclus ticks. This is likely due to the findings that long-nosed bandicoots (host grouping) were most commonly parasitised by I. holocyclus (tick grouping), and demonstrates the confounding relationship between factor analysis. A confounding relationship can also be seen where ticks identified from Tasmania (geographic grouping) and the eastern barred bandicoot (host grouping) were highly dominated by Proteobacteria, indicative of their exclusive relationship to I. tasmani.

Taxonomic assignment at the Order level were dominated by and as seen in Figure 3.19. Analysis at the Family level further divided tick species by their unique microbiomes [Figure 3.20]. At the Family level, the Coxiellaceae were highly abundant in I. australiensis, and to a lesser extent in I. tasmani and Ixodes spp. Staphylococcaceae, Francisellaceae, Anaplasmataceae, ‘Ca. Midichloriaceae’ and Propionibacteriaceae were the dominant Family taxa present in H. bancrofti, H. humerosa, I. fecialis, I. holocyclus and I. myrmecobii species respectively.

Analysis at the OTU level displayed varying degrees of prevalence. Francisella sp. accounted for 43.1% of reads for H. humerosa. 97.3% of reads for I. australiensis were attributed to a Rickettsella sp, in a smaller manner the two unknown larvae were dominated by 50.0% of reads to the same Rickettsiella sp. Two candidate pathogenic

53 species OTU 18 and 20 were responsible for 40.0% of microbial composition for I. fecialis, 39.7% of reads for I. holocyclus were attributed to Midichloria spp. Staphylococcus and Propionibacterium accounted for 41.7% of I. myrmecobii. Rickettsella dominated I. tasmani accounting for 62.4% of microbiome [see Table A1.4 for OTU taxonomy table].

100

Phyla Acidobacteria OP11 75 Actinobacteria Planctomycetes Armatimonadetes Proteobacteria Bacteroidetes Spirochaetes Chlorobi Tenericutes

50 Cyanobacteria Thermi Elusimicrobia TM6 Firmicutes TM7

Taxa proportion (%) Taxa proportion Gemmatimonadetes Unassigned GN02 Verrucomicrobia 25 NC10 WS3 OD1

0

H. ban H. hum I. aus I. fec I. hol I. myr I. spp I. tas Tick species

Figure 3.15. Proportional abundance of phyla present in tick species. Dominant phyla include Proteobacteria (blue), Firmicutes (green) and Actinobacteria (orange). Tick species; H. ban, H. bancrofti (n = 4), H. hum, H. humerosa, (n = 6), I. aus, I. australiensis (n = 4), I. fec, I. fecialis (n = 2), I. hol, I. holocyclus (n = 32), I. myr, I. myrmecobii (n = 2), Ixodes spp. (unknown) (n = 2), I. tas, I. tasmani (n =15).

54 100

Phyla Acidobacteria OP11 75 Actinobacteria Planctomycetes Armatimonadetes Proteobacteria Bacteroidetes Spirochaetes Chlorobi Tenericutes

50 Cyanobacteria Thermi Elusimicrobia TM6 Firmicutes TM7

Taxa proportion (%) Taxa proportion Gemmatimonadetes Unassigned GN02 Verrucomicrobia 25 NC10 WS3 OD1

0

Band. spp E. barred L. nosed N. brown S. brown Host

Figure 3.16. Proportional abundance of phyla present in ticks according to bandicoot host. Dominant phyla include Proteobacteria (blue), Firmicutes (green) and Actinobacteria (orange). Bandicoot species; bandicoot spp. (unknown) (n = 2), eastern barred (n = 5), long- nosed band (n = 42), northern brown (n = 7) and southern brown (n = 10).

100

Phyla Acidobacteria OP11 75 Actinobacteria Planctomycetes Armatimonadetes Proteobacteria Bacteroidetes Spirochaetes Chlorobi Tenericutes

50 Cyanobacteria Thermi Elusimicrobia TM6 Firmicutes TM7

Taxa proportion (%) Taxa proportion Gemmatimonadetes Unassigned GN02 Verrucomicrobia 25 NC10 WS3 OD1

0

Female Larvae Male Nymph Instar

Figure 3.17. Proportional abundance of phyla present in ticks according to life stage. Dominant phyla include Proteobacteria (blue), Firmicutes (green) and Actinobacteria (orange). Life stages; female (n = 20), larvae (n = 3), male (n = 6), nymph (n = 38).

55 100

Phyla Acidobacteria OP11 Actinobacteria Planctomycetes 75 Armatimonadetes Proteobacteria Bacteroidetes Spirochaetes Chlorobi Tenericutes

50 Cyanobacteria Thermi Elusimicrobia TM6 Firmicutes TM7

Taxa proportion (%) Taxa proportion Gemmatimonadetes Unassigned 25 GN02 Verrucomicrobia NC10 WS3 OD1

0

NSW NT QLD TAS WA State

Figure 3.18. Proportional abundance of phyla present in ticks according to geographic location (state). Dominant phyla include Proteobacteria (blue), Firmicutes (green) and Actinobacteria (orange). Geographic regions: NSW, New South Wales (n = 35), NT, Northern Territory (n = 4), QLD, Queensland (n = 12), TAs, Tasmania (n = 6), WA, Western Australia (n = 10).

Figure 3.19. Order level representation of bacterial communities present in tick samples. Order’s with reads less than 1000 sequences were considered low abundance and were merged to ‘Other<1000’ category. Unassigned represents OTUs unassigned at order level.

56

Figure 3.20. Proportional abundance of Family taxa present in tick species. Dominant families present annotated. Tick species; H. ban, H. bancrofti (n = 4), H. hum, H. humerosa, (n = 6), I. aus, I. australiensis (n = 4), I. fec, I. fecialis (n = 2), I. hol, I. holocyclus (n = 32), I. myr I. myrmecobii (n = 2), Ixodes spp. (unknown) (n = 2), I. tas, I. tasmani (n = 15).

3.3.1 Factors influencing diversity & composition

When separating confounding variables of tick-microbial dynamics, analysis showed that grouping by tick species was the strongest predictor of microbial diversity. NMDS revealed that separation by tick species produced the most distinct grouping [Figure A1.2], compared with life stages [Figure A1.3], bandicoot host [Figure A1.4] and geographic location. In some cases, differences in diversity were likely to be overestimated due to the small sample size in some parameters (e.g. TAS n = 4, NSW n = 32) and may not be reflective of the true representation. Comparison of tick samples from the same individual revealed that samples clustered more closely based on tick species than on host dynamics [Figure A1.4]. Shannon indices, seen in Figure 3.22, further support that tick species is the most significant factor to predict microbial composition and diversity.

57 0.6

● ● ● ● Tick.species 0.3 ● HB ● ● HH ● ● ● ● IA IT ● IF IA ● IH

● ● ● HB IM ● IT y 0.0 HH ● ● ● IU ● ● IH IM IUIF Instar ● ● F

● ● L ● M −0.3 N

●

−0.6 −0.4 0.0 0.4 x

Figure 3.21. NMDS plot of samples modelled by tick species at the Family level. HB = H. bancrofti, HH = H. humerosa, IA = I. australiensis, IF = I. fecialis, IH = I. holocyclus, IT = I. tasmani, IU = Ixodes spp., IM = I. myrmecobii. F = female, L = larvae, M = male, N = nymph.

58

Figure 3.22. Comparison of the tick microbiome through Shannon diversity indices separated by host species, state, life stage and tick species (clock-wise from top left). Significant difference in diversity only observed in separation by tick species.

59

3.3.2 Presence of candidate bacterial pathogens

NGS identified a number of OTUs assigned to bacteria that have the potential to be both of veterinary and medical significance. Based on these newly described similar bacterial species (Gofton et al., 2015b; Gofton et al., 2016; Loh et al., 2016; Gofton et al., 2017), OTUs of interest were extracted and compared against the NCBI GenBank Nucleotide database using BLAST (Alstchul et al., 1990) [Table 3.3]. Samples were considered positive where >30 reads for an OTU were present. Cross-contamination during library preparation was extremely low (see section 3.2.2) however this threshold was applied to ensure prevalence of candidate bacterial pathogens was not over-estimated; raw output of OTUs can be found in Table A1.2.

Several distinct ‘Candidatus Neoehrlichia’ sequences were recovered from 21 samples from NSW, QLD and WA. OTU 15, was identified in eight I. holocyclus ticks parasitising long-nosed bandicoots (7 nymphs, 1 male) from QLD and NSW and was highly similar (99.32%) to ‘Ca. N. arcana’ reference sequences (KT203914) from I. holocyclus. Likewise, OTU 18 was identified in 13 (11 nymphs, 2 male) I. holocyclus and I. tasmani ticks parasitising long-nosed bandicoots from QLD and NSW, and was highly similar (98.99%) to ‘Ca. N. australis’ reference sequences (KT203915), also from I. holocyclus. Six tick samples were positive for both ‘Ca. N. australis’ and ‘Ca. N. arcana’; two I. holocyclus males, one I. holocyclus nymph, and three I. tasmani nymphs. OTU 20 was also identified as belonging to the genera ‘Ca. Neoehrlichia’, however was exclusive to ticks parasitising southern brown bandicoots in WA, and was identified in five (1 nymph, 4 females) I. australiensis and I. fecialis ticks, and was most similar (98.7%) to ‘Ca. N. mikurensis’. This is the first identification of ‘Ca. Neoehrlichia’ bacteria in Western Australia. Although similar to ‘Ca. N. mikurensis’, OTU 24 is clearly distinct based on two single nucleotide polymorphisms (SNPs), one 3-base and one 4-base differences in the sequences identified. Due to geographical factors, it is hypothesised that this represents a novel ‘Ca. Neoehrlichia’, which may be unique to Western Australia.

Two additional genera belonging to the Anaplasmataceae family were identified. OTU 27 was highly abundant in one I. fecialis sample from a quenda in WA, and belonged to the genus Ehrlichia; however, no clear species-level relationships could be

60 elucidated due to the short sequences generated. OTU 27 had a closest match of 93.38% to (NC_007799), and was only 92.59% similar to recently described ‘Ca. Ehrlichia occidentalis’ (KY425450) which was identified from A. triguttatum in WA (Gofton et al., 2017). OTU 268 was identified in two nymphs, H. bancrofti and H. humerosa both parasitising the same long-nosed bandicoot in NSW, sharing 97.74% similarity with A. bovis genotype Y11 (KY425447) identified from A. triguttatum in WA (Gofton et al., 2017). Phylogenetic analysis of Anaplasmataceae species was made using the 276 bp product of the 16S gene, shown in Figure 3.23. Trimming of the sequences to 276 bp was done to allow the comparison with a greater number of reference sequences. A phylogenetic analysis of a 310 bp alignment [Figure A1.5] is consistent with Figure 3.23 and has the same tree topography.

Borrelia sequences generated from NGS were aligned with available Borrelia sequences available to assist with taxonomic identity [Figure 3.24]. Borrelia sequences obtained (OTU 231) most closely aligned with ‘Ca. B. tachyglossi’ (KT203916) sequenced from echidna-biting ticks (B. concolor) (Gofton et al., 2015a). The phylogenetic tree that was generated exhibited similar topology to that recently described by Loh et al. (2016), however, due to the short nature of the 16S NGS fragment, these sequences aligned more closely with the Borrelia species in the relapsing fever group which was noted in Gofton et al. (2015a).

61 Table 3.3. Summary of OTUs that closely match newly described organisms and are of interest in regards to similarity to TBD pathogens overseas. Sample considered positive if >30 reads. * indicates OTU that likely represents a novel bacterial species.

OTU Closest NCBI match Prevalence Positive tick State samples 18 ‘Ca. Neoehrlichia acarna’ (8/66) I. holocyclus NSW (KT203914) 99.32% I. tasmani QLD H. humerosa H. bancrofti 20 ‘Ca. Neoehrlichia australis’ (13/66) I. holocyclus NSW (KT203915) 98.99% I. tasmani QLD 24* ‘Ca. Neoehrlichia mikurensis (5/66) I. fecialis WA (KU865475) 98.7% I. australiensis 27* Ehrlichia chaffeensis (NC_007799) (1/66) I. fecialis WA 93.38% 268 Anaplasma bovis (KY425426) (2/66) H. humerosa NSW 98.91% H. bancrofti 231 Borrelia tachyglossi (KT203916) (2/66) I. tasmani QLD 98.21% H. humerosa

62 Ehrlichia ruminantium (NC_006831) ‘Ca. Ehrlichia occidentalis’ (KY425450)

Ehrlichia chaffeensis (NC_007799)

Ehrlichia canis (NR_118741) Ehrlichia muris (AB013008) OTU 27

Anaplasma marginale (NC_004842) Anaplasma centrale (NC_043532)

Anaplasma bovis (KY425447) OTU 268

Anaplasma phagocytophilum (NC_007797)

‘Ca. Neoehrlichia mikurensis’ (AB084582) OTU 24 ‘Ca. Neoehrlichia australis’ (KT203915) OTU 20 ‘Ca. Neoehrlichia arcana’ (KT203916)

OTU 18 (RIRRGDP)

Figure 3.23. Phylogenetic analysis of 276 bp 16S rRNA for Anaplasmataceae sequences generated from NGS. OTUs in bold represent sequences generated from this study.

63 Borrelia recurrentis (CP000993)

Borrelia duttonii (NR_074865)

Borrelia crocidurae (CP003426)

OTU 231

‘Ca. Borrelia tachyglossi’ (KT203916)

Borrelia sp. Tortoise (AB473533)

Borrelia anserina (NZ_CP013704)

Borrelia valaisiana (CP009117)

Borrelia afzelii (CP000395)

Borrelia bavariensis (NC_006156)

Borrelia bissettii (NC_015921)

Borrelia burgdorferi (CP002228)

Spirochaeta americana (NR_028820)

Figure 3.24. Phylogenetic analysis of 300 bp 16S rRNA for Borrelia sequences generated from NGS. OTU 231 in bold represent the sequence generated from this study.

3.3.3 Bandicoot tissue samples

Three bandicoot tissue samples produced 279, 855 reads and did not reveal the presence of candidate tick-borne pathogens. Three ticks parasitising the bandicoot were also sequenced with one I. holocyclus nymph positive for ‘Ca. N. australis’ and confirmed by a positive qPCR result (section 3.4.1). Of interest is that ‘Ca. N. australis’ was not detected in spleen samples by NGS or genus-specific qPCR.

64 3.4 Target PCR assays

3.4.1 ‘Ca. Neoehrlichia’ qPCR

A genus specific qPCR assay of tick samples (n = 130) revealed that 19 (14.6%) ticks were positive for the presence of ‘Ca. Neoehrlichia’ DNA. Four male, seven female and ten nymph ticks from NSW, QLD and WA were positive [Table 3.4]. All assays were confirmed by the amplification of two positive controls, while EXB and NTC samples showed no amplification [Figure A1.6].

Table 3.4. Samples that tested positive by genus specific qPCR assay. Overall prevalence of ‘Ca. Neoehrlichia’ by qPCR is 14.6% (19/130).

Sample ID Tick species Life stage Bandicoot host State 1594IHM_B5 I. holocyclus Male Long-nosed bandicoot NSW 1135IHN_B14 I. holocyclus Nymph Long-nosed bandicoot NSW 1622IFF_B17 I. fecialis Female Southern brown bandicoot WA 1623IAF_B18 I. australiensis Female Southern brown bandicoot WA 1189IHF_B23 I. holocyclus Female Long-nosed bandicoot NSW 1189IHM_B34 I. holocyclus Male Long-nosed bandicoot NSW 1189IHM_B37 I. holocyclus Male Long-nosed bandicoot NSW 1189IHM_B41 I. holocyclus Male Long-nosed bandicoot NSW 906IHF_B49 I. holocyclus Female Northern brown bandicoot QLD 906IHF_B50 I. holocyclus Female Northern brown bandicoot QLD 906IHF_B51 I. holocyclus Female Northern brown bandicoot NSW 1255ITN_B66 I. tasmani Nymph Long-nosed bandicoot QLD 1255IHN_B71 I. holocyclus Nymph Long-nosed bandicoot QLD 1255IHN_B72 I. holocyclus Nymph Long-nosed bandicoot QLD 1255IHN_B74 I. holocyclus Nymph Long-nosed bandicoot QLD 1255IHF_B75 I. holocyclus Female Long-nosed bandicoot QLD 1570IHN_B79 I. holocyclus Nymph Long-nosed bandicoot NSW 1570IHN_B81 I. holocyclus Nymph Long-nosed bandicoot NSW 1565IHN_B128 I. holocyclus Nymph Long-nosed bandicoot NSW

3.4.2 Borrelia nested PCR

Nested PCR on extracted tick gDNA (n = 130) targeting the flaB gene yielded negative results for all samples. Despite repeated attempts using spike tests and dilutions to limit any signs of inhibition ticks that were positive through NGS for Borrelia sp. did not amplify when targeted by flaB primers.

65 3.4.3 Ixodida PCR

Unidentified larvae (n = 2) and identified Ixodes australiensis larvae (n =1) underwent targeted amplification to identify and confirm species. These samples were run in parallel with known tick species identified morphologically [Figure A1.7]. Unfortunately, despite good quality sequences generated through 16S NGS these samples did not yield positive results for targeted Sanger sequencing at the COX gene. Larvae that could not be identified by morphological or molecular techniques are referred to as Ixodes spp.

3.5 Human biting ticks

Records of human-biting in Australia can be found in Table 3.5 sourced from Dr Bruce Halliday curator of the Australian National Insect Collection (ANIC) database (August 2013) and VWBPRG database. Comparison of ticks parasitising bandicoots [Table 1.4] shows that six species of ticks are capable of biting humans and bandicoots: I. holocyclus, I. myrmecobii, I. australiensis, I. tasmani and I. trichosuri.

66

Table 3.5. Records of ticks biting humans in Australia. Sourced from Dr Bruce Halliday curator of the ANIC database (August 2013) and VWBPRG database. International refers to ticks collected in Australia but acquired overseas. Ticks species in bold represent identification of tick- bandicoot association in Table 1.4.

Australia Tick species ACT NSW NT QLD SA TAS VIC WA (state unknown) International Amblyomma spp. - - + - + + - - - - ------+ Amblyomma breviscutatum ------+ Amblyomma loculosum - - - + - - - - - + Amblyomma maculatum ------+ Amblyomma marmoreum ------+ Amblyomma triguttatum - + + + + - - + - - Bothriocroton undatum ------+ - + ------Haemaphysalis spp. - - - - + - + - - - Haemaphysalis bancrofti + + - + ------Haemaphysalis longicornis + + - - - - + - - - Haemaphysalis novaeguineae - - - + ------Ixodes spp. + - - + - - + - - - Ixodes australiensis ------+ - - Ixodes confusus - - - + ------Ixodes cornuatus - - - - - + + - - - Ixodes hirsti ------+ - - - Ixodes holocyclus + + - + - - + - + - Ixodes myrmecobii ------+ - - Ixodes ricinus ------+ Ixodes tasmani - - - + - + + - - - Ixodes trichosuri + - - - - - + - - - Ornithodoros gurneyi - - - + ------Ornithodoros papuensis ------+ Otobius spp. - - - + ------

67 Rhipicephalus appendiculatus ------+ - - Rhipicephalus microplus - - - + ------Rhipicephalus sanguineus - - + - - - + - - - 6 4 3 11 3 3 9 4 2 7

68 Chapter 4 Discussion

4.1 Tick-bandicoot associations

Since Roberts’ 1970 seminal publication, there have been no published scientific reviews of the tick species parasitising bandicoots. In this study, the literature is reviewed and the tick-host associations for Australian bandicoots are described, however no new tick-bandicoot associations for the four bandicoot species were identified. Comparisons of tick-bandicoot associations can be problematic due to the numerous taxonomic changes that have occurred for the Peramelemorphia order (Warburton and Travouillon, 2016), and incomplete records of species assignments for both hosts and ticks. A review of tick-bandicoot associations (section 1.4.2) presented difficulties as these associations were largely documented in relatively hidden and/or low profile articles (e.g. government reports, academic theses). These records were often not well publicised in scientific, peer-reviewed journals, and are at risk of remaining hidden, inhibiting advancements of our understanding of the ecology of Australian ticks. Unlike their overseas counterparts, the life cycles and detailed host requirements of many Australian ticks remain largely unknown. This may be, in part, due to the relatively low number of tick-related illnesses documented in Australia, and therefore low public health concern

4.1.1 Molecular identification of tick species

Identification of the larvae of Australian tick species using morphological features is poorly described in the literature. The most extensive keys for identification of larvae remain those by Roberts (1969) who described 29 species nearly 50 years ago. The lack of larvae descriptions means that, in many cases, they are either excluded from studies on ticks in Australia or at best identified to genus level only (Greay et al., 2016; Kwak, 2017; Kwak et al., 2017a). Exceptions usually include tick species that are not native to Australia (e.g. the brown dog tick R. sanguineus, the bush tick H. longicornis and cattle tick R. (B.) microplus) and have more detailed morphological descriptions available from overseas studies. Based on morphological characteristics, host attributes and geographic location, the unidentified larvae from this study are hypothesised to be I. australiensis, however this could not be confirmed. Repeated attempts to amplify the COX1 gene of larval samples did not yield in any positive results in this study. Larval

69 specimens were pooled to increase the genomic DNA yield during extraction. However, molecular data for distinguishing Australian tick species is limited to genetic data of only 11 out of the 66 native species on GenBank. Failure to achieve amplification of the COX1 and other barcoding regions (e.g. ITS) in tick samples was also recorded by Kwak et al. (2017b), who was only able to amplify 27/64 samples the using COX1 and ITS targeted gene sequencing. Assays were therefore modified to explore inhibition by using dilute gDNA (1/10, 1/100, 1/1000), as well as changes to other confounding factors (e.g. annealing temperature, MgCl2 concentration), however amplification was not achieved. Future research regarding the barcoding and molecular taxonomy of Australian ticks is urgently needed in order to fill this fundamental gap in tick identification and further understand phylogenetic relatedness of species. A robust barcoding system for tick identification will facilitate the use of larvae in studies, as it will then be possible for results to be interpreted in a meaningful way.

4.1.2 Demographics influencing tick-host associations

Tick-bandicoot associations reported in this study support previous research findings that Australian bandicoots host a range of tick species. The lack of tick diversity for the eastern barred and northern brown bandicoots in this study is likely a result of small sample sizes. Opportunistic sampling in this study did not record ticks from the following extant Australian bandicoots: the western barred bandicoot (P. bougainville), the golden bandicoot (I. auratus), the Cape York bandicoot (I. peninsular) and the northern-long-nosed bandicoot (P. pallescens), and is likely attributed to the restricted geographic range of these species. No samples were recorded from South Australia, which is likely reflective of the sparse and remote distribution of bandicoots in the state (Paull, 1995).

This study identified that nymphs are the most common life stage recovered from bandicoots (52.4%, 152/290), followed by females (27.6%, 80/290), males (12.4%, 36/290) and larvae (5.7%, 17/290). Due to opportunistic nature of sampling a meaningful analysis of these infestations could not be made. Despite this, these results do concur with reports from overseas that nymphs attach preferentially to small vertebrate hosts (Randolph, 2004), suggesting hard ticks in Australia may also follow this hypothesis. The scarcity of tick-host records in Australia, and the lack of detail in

70 those records make it difficult to conclude conclusively if this is true for the 66 species of native Australian ticks. It is important that future studies and records are as detailed as possible, and include information regarding life stage and feeding status.

Consolidation of tick-host information is necessary to further understand host specificity, and better understand tick ecology in Australia. State museums, universities and/or government bodies provide a unique opportunity to collect and refine these records. The largest collection of ticks in Australia is at the ANIC, however even some of these records lack fundamental details of host records and in some cases tick species have been shown to be incorrectly identified (Krige, 2017). Collaboration with government bodies and land managers, particularly those on the front line of wildlife management would greatly benefit our knowledge of Australian ticks and, importantly, aid biosecurity measures. In many cases gathering this additional information would cost little with respect to time and budget. Barker and Walker (2014) outline materials and methods for the collection field samples. Data regarding host and environmental factors should be sent along with the tick specimen, which should be routinely recorded. This additional step would of a small investment to front line personnel, however, would greatly assist in providing insight into ecology of Australian ticks.

4.1.3 Overlap associations with human-biting ticks

A search of the databases of the VWBPRG and ANIC (August 2012) revealed six tick species recorded from both bandicoot and human hosts in Australia. This overlap indicates that there are potential common vectors that may present a risk of zoonotic transfer of disease between bandicoots and humans. Importantly, I. holocyclus is most notably known as the common tick identified parasitising people (Barker and Walker, 2014), and as such has been a strong focus as a candidate vector of humans TBDs in Australia (Piesman and Stone, 1991; Hall-Mendelin et al., 2011). A One Health approach to tick-borne diseases is essential to assess risk and determine demographics of disease. This comparison is often missed when references are made to potential human tick- borne pathogens. Research on emerging tick-borne zoonoses needs to include both horizontal (tick-host-tick) and vertical (tick-offspring) transmission of pathogenic agents occupying the same environmental niche.

71 4.2 Microbiome analysis

NGS revealed 23 phyla present in tick samples, however only four were present at abundances greater than 1%; Actinobacteria (12.86%), Bacteroidetes (2.00%), Firmicutes (16.48%) and Proteobacteria (66.00%). Proteobacteria was also found to be highly abundant in Ixodida ticks around the world, including: I. persulcatus (Zhang et al., 2014), Haemaphysalis species (Khoo et al., 2016), I. ricinus (Vayssier-Taussat et al., 2013), I. scapularis and Ixodes angustus (Sperling et al., 2017). Ticks analysed in this study harboured one or two, highly abundant family taxa, supportive of similar evidence overseas that the tick microbiome is dominated by one or two highly abundant endosymbionts (Narasimhan and Fikrig, 2015; Bonnet et al., 2017; Sperling et al., 2017).

Comparisons of OTU diversity can be complicated between metagenomics studies, as data is often not directly comparable (see section 4.4 on caveats of bioinformatic analysis). This study recorded a total of 1206 OTU’s inclusive of NTC/EXB samples, 1057 OTUs were detected in tick samples once NTC and EXB reads were removed. When considering OTUs which generated a total of >50 reads this dropped to just 618, and further fell to just 195 OTUs for greater than 1000 reads. Although not directly comparable 787 OTUs, consisting of 392 identified genera were detected in Haemaphysalis ticks parasitising domestic animals in Malaysia (Khoo et al., 2016). Zhang et al. (2014) reported 373 and 278 genera in unfed and fed ticks respectively. A comparable study by Gofton et al. (2015a) identified 119 genera from I. holocyclus. The results from this study show a high number of OTUs were recorded, however this may be explained by the diversity of tick species analysed (i.e. seven species, spanning two genera), compared with more focused approaches commonly taken in other studies.

NGS was conducted on whole tick samples, and in the case of larvae, groups of five were pooled. This approach of analysing whole ticks can have decreased sensitivity to detect low-copy bacteria (Narasimhan and Fikrig, 2015). It also does not allow for identification of anatomically-specific bacteria residing in the tick, which is important for understanding transmission dynamics and epidemiology of TBPs. Future studies could employ techniques such as conducting the same Illumina sequencing protocol described here on dissected organ biopsies (Andreotti et al., 2011; Narasimhan et al., 2014) and fluorescence in situ hybridization (FISH) (Hammer et al., 2001).

72 4.2.1 Assessment of factors influencing the tick microbiome

This study demonstrated that tick species was the most significant factor in predicting microbial composition. This finding is supported by studies which also concluded that tick species determined the bacterial community composition(Rudolf et al., 2009; Hawlena et al., 2013; de la Fuente et al., 2017). Dynamics of tick-host associations are dependent on the geographical distribution overlap between species. In geographical areas where bandicoots reside there is little, if any, overlap between bandicoot species (Lyne, 1990; Warburton and Travouillon, 2016). It appears in many cases across Australia it is rare for two bandicoot species to be sympatric, perhaps due to niche partitioning. As a result, it is unclear if tick-bandicoot host associations are driven by geographic or host characteristics. Due to the relative uniformity of bandicoot spp., it is hypothesised that geographic restriction of tick species remains the main factors influencing tick-bandicoot associations. Nymphs had the highest bacterial diversity, as demonstrated in previous findings (Khoo et al., 2016; Zolnik et al., 2016). Whilst not detectable at the community level, the effect of the host blood meal has been shown to affect the presence of pathogenic bacteria (Hartemink and Takken, 2016; Swei and Kwan, 2017). Although this finding was not supported in this study with respect to candidate TBPs (see section 4.3), it is suggested that the close relatedness of hosts (i.e. all bandicoot spp.) may be a confounding factor, and further studies incorporating a broader host analysis are required.

In vitro studies have demonstrated that the bacterial microbiome of ticks can be manipulated in disease vectors such as I. scapularis (Narasimhan et al., 2014) and A. americanum (Zhong et al., 2007). The use of these tools in the management of ticks and prevalence of potential TBPs in Australia remains to be investigated.

4.2.2 Bandicoot tissue samples

NGS analysis of a small number of bandicoot tissue samples collected opportunistically failed to detect the presence of tick endosymbionts or candidate pathogens. An I. holocyclus parasitising the bandicoot was positive by NGS and qPCR for ‘Ca. Neoehrlichia’, however all tissue samples tested negative. The presence of ‘Ca. Neoehrlichia’ is confirmed by PCR assay of blood and has also been found in the cytoplasm of endothelial cells lining the splenic venous sinuses (Kawahara et al., 2004),

73 as such the failure of detection in spleen tissue in this study is of particular interest, and highlights the need for further investigation into the transmission dynamics of this novel organism.

4.3 Candidate TBPs

Results of the NGS combined with recent research discoveries by Gofton et al (2015a; 2015b) further provide a focus on analysis of novel tick-borne organisms in Australia. NGS is not yet widely used as a diagnostic tool in this endeavour, and many gold standard tests for tick-associated microorganisms still rely on microscopy, immunological assays, and genus- and species-specific PCR (Graves and Stenos, 2017; Silaghi et al., 2017). When considering NGS as a diagnostic tool, bioinformatics become even more important. In the case of this study, a stringent 0.1% error was the upper limit of accepted sequences. When considering positive samples bacteria of interest, a sample was considered positive if it had >30 reads. The use of percentage estimate reads as cut offs is problematic when using 16S rRNA data due to issues of copy number (as described in section 4.4.1). However, a thorough assessment concluded contamination during library preparation to be exceptionally minimal where highly abundant tick endosymbionts were present at level <0.002% in NTC/EXB samples.

4.3.1 Borrelia

Borrelia sequences were detected in this study by NGS, and were most closely related to 'Ca. B. tachyglossi' (KT203916) (Gofton et al., 2015a). It is deemed highly plausible that the Borrelia detected in this study is either very similar to, or an exact match to, ‘Ca. B. tachyglossi’. It is noted that this conclusion is limited to molecular characterisation. ‘Ca. B. tachyglossi’ was observed at a much lower prevalence of 2% (2/66 individuals) compared to that detected by Loh et al. (2016) (40%). In addition to NGS, a total of 130 samples were also screened for the presence of Borrelia targeting the flaB gene. Samples that were positive in NGS failed to amplify at the flaB gene. Out of the 130 samples none produced a positive result. While the genus-specific assay result was not consistent with NGS results, this observation may be due to the shorter target fragment length in NGS ~300 bp, compared with Loh et al. (2016) ~1.2 kb fragment for the 16S rRNA gene. Larger fragment lengths are associated with a decreased sensitivity, particularly when attempting to extract sequences from diverse microbe communities,

74 as is the case in the tick microbiome. While the short fragment generated by NGS in this study, meant a thorough phylogenetic reconstruction was not possible, an assessment of ~300 bp product was possible to conclude a likely species (98% similarity). Future investigation to optimise the amplification of this novel Borrelia from bandicoot ticks is needed.

In addition, this study provided further information regarding ‘Ca. B. tachyglossi’ inhabiting I. holocyclus ticks, which are commonly associated with human bites on the east coast of Australia. Although Gofton et al. (2015a) did identify the novel Borrelia in a single I. holocyclus tick parasitising an echidna, it was not present in any of the I. holocyclus sampled in this study (0/68), providing further evidence that 'Ca. B. tachyglossi' is likely specific to echidna hosts and their associated ticks. I. holocyclus ticks are not commonly recorded parasitising echidnas, as most ticks biting echidnas appear to be host specific (Krige, 2017).

The results from this study support the conclusion that it is likely echidna-biting ticks remain the primary reservoir for ‘Ca. B. tachyglossi’. Further studies which include the analysis of tissue and blood from a range of wildlife would be needed to confirm the epidemiology ‘Ca. B. tachyglossi’. Due to the host specificity that echidna ticks exhibit, the risk of horizontal transmission of bacteria is likely minimal. Isolation of ‘Ca. B. tachyglossi’ in culture would also prove prudent in an attempt to determine if Borrelia queenslandica and ‘Ca. B. tachyglossi’ are the same species. The lack of follow up identification of B. queenslandica since its discovery in R. villosissimus blood by Carley and Pope (1962), may suggest that, like bandicoots, R. villosissimus, is an accidental host of this novel Borrelia and echidnas remain the primary host. This study highlights the need for further research into the transmission dynamics, pathogenicity, and zoonotic potentials of ‘Ca. B. tachyglossi’.

4.3.2 ‘Candidatus Neoehrlichia’

Two species; ‘Ca. N. arcana and ‘Ca. N. australis’, were previously characterised within I. holocyclus along the east coast of Australia (Gofton et al., 2016). The disease potential and transmission dynamics of these candidate pathogens remains unknown. This study provides the first confirmation of ‘Ca. Neoehrlichia’ present in ticks parasitising Australian bandicoots. Both ‘Ca. N. arcana’ (8/66) and ‘Ca. N. australis’

75 (13/66) were detected along the eastern seaboard in I. holocyclus, I. tasmani, H. humerosa, and H. bancrofti ticks. Gofton et al. (2016) reported an overall prevalence of 11.25% (44/391) in I. holocyclus ticks (31 females, 7 males and 6 nymphs). This study recorded a higher prevalence of the ‘Ca. N. arcana’ and ‘Ca. N. australis’ despite the smaller sample size. In particular considering I. holocyclus from NSW and QLD (as per study parameters from Gofton et al. (2016)), prevalence rises to 23.5% (16/68), this may be suggestive that bandicoot ticks act as a primary reservoir of the bacterium. Through NGS, this study also revealed the presence of a potentially novel species of ‘Ca. Neoehrlichia’ unique to Western Australia. This novel species was identified from I. australiensis and I. fecialis ticks parasitising quenda in the south-west of WA. The geographic distance between the east and west coast of Australia makes it plausible that WA is home to a species of ‘Ca. Neoehrlichia’ that whilst similar to that described on the east coast, is phylogenetically distinct. The closest BLAST match to this novel ‘Ca. Neoehrlichia’ was ‘Ca. N. mikurensis’ (JQ359050) (Li et al., 2012), however it is unlikely that this exotic northern hemisphere pathogen is present in WA. All tick samples from TAS and NT were negative for the presence of ‘Ca. Neoehrlichia’, suggestive of a geographic restriction to presence of this candidate pathogen. Further molecular analysis and amplification of a longer fragment is needed to confirm the phylogenetic relatedness of this novel ‘Ca. Neoehrlichia’ species.

The characterisation of this candidate pathogen in four species of Ixodida may indicate a broad range of competent tick vectors. The pathogenicity of ‘Ca Neoehrlichia’ species has been described in a number of countries infecting both humans and domestic animals (von Loewenich et al., 2010; Diniz et al., 2011; Wenneras, 2015). Its impact on wildlife however remains unclear. Like many other TBDs it is suggested that ‘Ca. Neoehrlichia’ does not cause disease in native wildlife, as they act as asymptomatic reservoirs or amplification hosts. Future research to assess the prevalence and pathogenicity of the Australian ‘Ca. Neoehrlichia’ species is needed and would benefit from a one health approach to understand its prevalence in Australian wildlife and associated ticks and, also the transmission dynamics of the bacterium.

76 4.3.3 Other Anaplasmataceae

Anaplasma bovis (previously Ehrlichia bovis) is a known pathogenic TBD affecting cattle in Africa, Asia and more recently identified in Europe (Rar and Golovljova, 2011; Sumrandee et al., 2016; Battilani et al., 2017). Cattle and buffalo are considered the main host of A. bovis, although it has been described in a number of additional mammal species (Battilani et al., 2017). Whilst infection in cattle is usually minor it can develop into a severe disease and occasionally death (Santos and Carvalho, 2006). Unlike it’s close relative Anaplasma phagocytophilum, A. bovis is not considered a zoonotic pathogen (Atif, 2016). NGS yielded sequences that closely aligned with recently described Anaplasmataceae bacteria inhabiting ticks. A. bovis was identified in two ticks (2/66), H. humerosa and H. bancrofti parasitising long-nosed bandicoots in NSW. Gofton et al. (2017) recently described A. bovis from A. triguttatum on the west coast of Australia (Yanchep and Barrow Island). Molecular analysis showed that this genotype appeared to be unique and distinct from A. bovis genotypes described overseas and was designated A. bovis genotype Y11. The distinct phylogeny of A. bovis Y11, suggested that this strain may be endemic to Australia and has coevolved with Australian ticks and wildlife. This study identified OTU 278 is closely related (98.91%) to the A. bovis Y11 genotype (KY425426], however due to the short fragment length the exact phylogenetic relationship could not be determined.

An Ehrlichia sp. most similar (93.38%) to E. chaffeensis (NC_007799) (Dunning Hotopp et al., 2006) was detected in a single I. fecialis parasitising a quenda in WA. Although the first native Australian Ehrlichia sp. (‘Ca. E. occidentalis’) has been recently described from questing A. triguttatum (Gofton et al., 2017) the distinct phylogenetic relationship suggest the sequences generated in this study represents an additional novel species.

The epidemiology and clinical significance of the recently described A. bovis genotype Y11 and ‘Ca. E. occidentalis’ in Australia remains unclear. Wildlife reservoir hosts have been described around the world including; deer from Japan and South Korea (Kawahara et al., 2006), cotton tail rabbits from North America (Goethert and Telford, 2003), raccoons from Japan (Sashika et al., 2011) and ticks parasitising birds in Spain (Palomar et al., 2015). The wide host and geographic range can present

77 difficulties when attempting to characterise epidemiology and determine host status (i.e. primary vs accidental hosts). This study described the presence of A. bovis along the east coast of Australia, inhabiting Haemaphysalis ticks parasitising long-nosed bandicoots. The role of bandicoots in the life cycle of A. bovis is unclear, and further research is needed to understand the pathogenicity and epidemiology, particularly with respect to its known pathogenicity in cattle and its listing as a notifiable cattle disease in Australian (Department of Agriculture and Water Resources, 2017).

4.4 NGS - bioinformatic and diversity analysis limitations

This is study utilised a two-stage PCR library preparation as per Illumina protocol (Illumina Inc, 2015) and while analysis showed minimal contamination during library preparation it is noted that this is limited to preparation post-index (stage 2) PCR. Only once a unique index tag (coupled with MiSeq flowcell adaptors) is added to identify samples can assessment of library contamination be made. This study aimed to characterise the microbiome of ticks and identify candidate pathogens, and as such the interpretation of results are subject to less stringent requirements as would be considered in the case of diagnostics. However, the amplification of bacterial organisms through targeted PCR assays would be useful to quantify effect of contamination during library preparation (i.e. type I error) .

4.4.1 Estimates of abundance and multi-copy 16S

NGS targeting the 16S gene, as done in this study, presents an additional bias as copy number varies between bacterial species (Case et al., 2007). Methods to limit this bias include; using PCR-independent approaches to determine microbial diversity (Rosselli et al., 2016) and data analysis protocols to ensure genomic copy number of 16S genes is taken into account when assessing microbial abundance (Kembel et al., 2012). The integration of these methods in microbial studies is still limited, and perhaps unsuitable in some instances. Due to distinct aims and time constraints of this project, these novel methods were not explored however provide direction for future research on the microbiome of Australian ticks. This study did assess the effect of abundant data through diversity analysis. Assessment of presence/absence and abundance indexes demonstrated that while differences in composition were detected, both indexes detected significant differences in beta-diversity. The lack of uniformity in assessment

78 of the tick microbiome, however makes it difficult to draw comparisons between studies.

4.4.2 Sequencing depth and taxonomy assignment

There is currently no consensus on the number of reads required to ensure the tick microbiome is adequately sampled. Issues surrounding sequencing depth were further explored in this study through various ecological modelling tools. The large number of ecological variables and variance in sequencing techniques make it difficult to conclude a single best practice number of reads needed, and it would be recommend that each study explores this in preliminary data analysis. Zhang et al. (2014) generated rarefaction curves derived from the Shannon index to determine adequate sequencing depth was achieved at around 20,000 reads. Further they reported that fed ticks showed a lower number of reads compared to unfed ticks, however concluded this would have little effect on diversity estimates. Other research has indicated 40,000 reads per sample is an adequate sequencing depth (Khoo et al., 2016). Rarefaction curves generated in this study supports suggest 20,000 reads provides an adequate sampling depth, however some samples required ~40,000 reads before species diversity plateaued. A number of samples (13/67) produced <1000 reads once the bacterial profile EXB and NTC samples was bioinformatically subtracted. Eight of these samples (69.2%) contained varying concentration of Midblocker, despite preliminary assays to optimise concentration to block the abundant endosymbiont CMM. The development of a robust assay to quantify CMM and calculate the required concentration of Midblocker would be useful for future studies on I. holocyclus. The variation in bacterial abundance in ticks, PCR biases, and error in library pooling may be factors contributing to the remainder five tick samples which failed to generate >1000 sequences.

The generation of short fragment lengths (~250-350 bp) in this study limited taxonomic assignment to species level (Case et al., 2007; Chakravorty et al., 2007). In part this was overcome by targeting the V1-2 hypervariable regions of the 16S rRNA gene (Pinto and Raskin, 2012), however abundant species such as Rickettsia are often indistinguishable . Efforts to reduce sequence artefacts of the 16S gene (chimeric sequences) formed during the PCR amplification step (Haas et al., 2011) was done

79 through stringent bioinformatic parameters. Taxonomic identification was further hindered by the lack of reference sequences.

4.5 A One Health approach

The ‘One Health’ concept aims to provides a seamless interaction between environmental, animal and human health, with clinicians, researchers, agencies and government, working together for a common benefit towards the health of humans, domestic animals, wildlife and the global environment (Day, 2011; Thompson, 2013). Currently over 70% of emerging human infectious diseases are considered zoonotic and attributed to arthropod vectors (King, 2014). Vector-borne diseases are prone to environmental pressures that contribute to changes in ecology and emergence of infectious pathogens (Fritz, 2009).

In the majority of cases, TBDs occur in localised geographic regions, where conditions are optimal for the tick and animals involved in the sylvatic lifecycle of the bacterial pathogen. With the rise in a global economy, trade and travel have driven the spread of pathogens and their vectors resulting in the rise of TBD cases (Zinsstag et al., 2011; Dantas-Torres et al., 2012). The effects of climate change (Dobson and Randolph, 2011; Dantas-Torres, 2015; Ogden and Lindsay, 2016; Anderson and Davis, 2017) and urbanisation (Reis et al., 2011; Webster et al., 2014; Rothenburger et al., 2017) also contribute to changes in disease distribution, and require further studies to document their effect on TBPs in Australia.

Further influencing host ecology of Australian ticks is the effect of urbanisation, which has been shown to alter bandicoots-tick associations. Bandicoots in urban areas have been shown to have an increased tick burden compared with their rural counterparts (Dowle, 2012; Hillman et al., 2017). In addition, urbanisation influences the composition of tick fauna parasitising bandicoots. Hillman et al. (2017) demonstrated quenda in urban areas have an increased prevalence of I. australiensis, while quenda inhabiting rural areas are more likely to be parasitised by H. humerosa. These complex dynamics further complicate studies of TBPS in Australia.

The detection of candidate TBPs in this study provides further support for on- going investigations. The focus of this study was on ticks parasitising bandicoots, and as

80 such the transmission dynamics of these bacterial organisms remain unknown. This study also advocates for the accurate and appropriate dissemination of information to medical and veterinary practitioners, health care workers and the public. Previously, abrupt responses to misinformation regarding Australian TBDs have resulted in community groups campaigning for the cessation of conservation efforts for bandicoots populations due to their association with human-biting ticks (Chen, 2013a; Chen, 2013b). This has lead to severe contractions of bandicoot populations across Australia. and requires that a coordinated response to community concerns surrounding a potential TBDs in Australia is essential to ensure that conservation efforts are not compromised.

4.6 Conclusion

This study provides the first updated review in almost half a century on ticks that parasitise bandicoots and has further confirmed tick-bandicoot associations in Australia. This study is also the first NGS survey to provide insight into the diverse range of bacterial communities present in bandicoot ticks. The observed bacterial diversity was significantly different among tick species, which was the strongest predictor of microbial composition. Beta-diversity analysis also revealed the bias encountered when grouping ticks at various taxon levels, demonstrating comparisons at the phylum level are inadequate at detecting differences in microbial composition between tick species. In addition, differences in abundance and presence/absence models highlight the need for the adoption of uniform analysis to be able to compare microbial diversity between tick species effectively. NGS revealed the presence of candidate bacterial pathogens, ‘Ca. B. tachyglossi’, ‘Ca. N. arcana’ ‘Ca. N. australis’, ‘Ca. E. occidentalis’, and A. bovis genotype Y11 in bandicoot ticks. Furthermore, this study presents evidence for novel species of ‘Ca. Neoehrlichia’ and Ehrlichia present in bandicoot ticks from WA, with genus-specific assays of ‘Ca. Neoehrlichia’ detecting a prevalence of 14.6%. Bandicoot taxa represent one of the last remaining species of small marsupials that continue to persist, and in some cases, thrive in urban and peri-urban areas across the country. The results generated in this study further highlight the presence of potential zoonotic TBPs present in Australia and advocate the need for a one health approach in understanding potential disease dynamics.

81 References

Ahn, J.H., Kim, B.Y., Song, J., Weon, H.Y., 2012. Effects of PCR cycle number and DNA polymerase type on the 16S rRNA gene pyrosequencing analysis of bacterial communities. J. Microbiol. 50(6), 1071-1074. Alstchul, S.F., Gish, W., Miller, W., Myers, E.W., J., L.D., 1990. Basic local alignment seach tool. J. Mol. Biol. 215, 403-410. Ambrose, M., 2014. Lyme disease - a ticking timebomb that health authorities say does not exist, WA News. Perth Now, The Sunday Times. [https://www.perthnow.com.au/news/wa/lyme-disease-a-ticking-timebomb-that- health-authorities-say-does-not-exist-ng-f3b5ed3f7106ca370ac9cfc467028a31] Anderson, L.K., Davis, D.P., 2017. Climate change and the epidemiology of selected tick- borne and mosquito-borne diseases: update from the International Society of Dermatology Climate Change Task Force. Int. J. Dermatol. 56, 252-259. Andersson, M., Bartkova, S., Lindestad, O., Raberg, L., 2013. Co-infection with 'Candidatus Neoehrlichia Mikurensis' and Borrelia afzelii in Ixodes ricinus ticks in southern Sweden. Vector Borne Zoonotic Dis. 13, 438-442. Andreotti, R., Perez deLeon, A.A., Dowd, S.E., Guerrero, F.D., Bendele, K.G., Scoles, G.A., 2011. Assessment of bacterial diversity in the cattle tick Rhipicephalus (Boophilus) microplus through tag-encoded pyrosequencing. BMC Microbiol. 11(1), 6. Andrew, R., Bonnin, J.M., Williams, S., 1946. Tick typhus in north Queensland. Med. J. Aus. II(8), 253-258 Angus, B.M., 1996. The history of the cattle tick Boophilus microplus in Australia and achievement in its control. Int. J. Parasitol. 26(12), 1341-1355. Apanaskevich, D.A., Oliver, J.H., 2014. Life cycles and natural history of ticks, in: Sonenshine, D.E., Roe, R.M. (Eds.), Biology of ticks, 2nd ed. Oxford University Press, New York, USA. Ash, A.L., Elliot, A.D., Godfrey, S., Burmej, H., Abdad, M.Y., Northover, A., Wayne, A., Morris, K., Clode, P., Lymbery, A.J., Thompson, R.C.A., 2017. Morphological and molecular description of Ixodes woyliei n. sp. (Ixodidae) with consideration for co- extinction with its critically endangered marsupial host. Parasit. Vectors 10(1), 70. Ashby, E., Lunney, D., Robertshaw, J., Harden, R., 1990. Distribution and status of bandicoots in New South Whales, in: Seebeck, J.H., Brown, P.R., Wallis, R.L., Kemper, C.M. (Eds.), Bandicoots and Bilbies. Surrey Beatty & Sons, Sydney, Australia, pp. 43- 50. Atif, F.A., 2016. Alpha proteobacteria of genus Anaplasma (Rickettsiales: Anaplasmataceae): Epidemiology and characteristics of Anaplasma species related to veterinary and public health importance. Parasitology 143(6), 659-685. Austen, J.M., Ryan, U.M., Friend, J.A., Ditchman, W.G.F., Reid, S.A., 2011. Vector of Trypanosoma copemani identified as Ixodes sp. Parasitology 138(7), 866 - 872. Averis, S., Thompson, R.C., Lymbery, A.J., Wayne, A.F., Morris, K.D., Smith, A., 2009. The diversity, distribution and host-parasite associations of trypanosomes in Western Australian wildlife. Parasitology 136(11), 1269-1279. Azad, A.F., Beard, C.B., 1998. Rickettsial pathogens and their arthropod vectors. Emerg. Infect. Dis. 4(2), 179-186. Barb, J.J., Oler, A.J., Kim, H.S., Chalmers, N., Wallen, G.R., Cashion, A., Munson, P.J., Ames, N.J., 2016. Development of an analysis pipeline characterizing multiple hypervariable regions of 16S rRNA using mock samples. PLoS One 11(2), e0148047.

82 Barbosa, A., Reiss, A., Jackson, B., Warren, K., Paparini, A., Gillespie, G., Stokeld, D., Irwin, P., Ryan, U., 2017a. Prevalence, genetic diversity and potential clinical impact of blood-borne and enteric protozoan parasites in native mammals from northern Australia. Vet. Parasitol. 238, 94-105. Barbosa, A.D., Gofton, A.W., Paparini, A., Codello, A., Greay, T., Gillett, A., Warren, K., Irwin, P., Ryan, U., 2017b. Increased genetic diversity and prevalence of co-infection with Trypanosoma spp. in koalas (Phascolarctos cinereus) and their ticks identified using next-generation sequencing (NGS). PLoS One 12(7), e0181279. Barbour, A.G., Maupin, G.O., Glenna, J.T., Carter, C.J., Piesman, J., 1996. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J. Infect. Dis. 173(2), 403-409. Barker, S.C., Murrell, A., 2004. Systematics and evolution of ticks with a list of valid genus and species names. Parasitology 129(Suppl), S15-S36. Barker, S.C., Murrell, A., 2008. Systematics and evolution of ticks with a list of valid genus and species names, in: Bowman, A.S., Nuttall, P.A. (Eds.), Ticks: biology, disease and control. Cambridge University Press, New York, USA, pp. 1-39. Barker, S.C., Walker, A.R., 2014. Ticks of Australia. The species that infest domestic animals and humans. Zootaxa 18(3816), 1-144. Barker, S.C., Walker, A.R., Campelo, D., 2014. A list of the 70 species of Australian ticks; diagnostic guides to and species accounts of Ixodes holocyclus (paralysis tick), Ixodes cornuatus (southern paralysis tick) and Rhipicephalus australis (Australian cattle tick); and consideration of the place of Australia in the evolution of ticks with comments on four controversial ideas. Int. J. Parasitol. 44(12), 941-953. Baselga, A., 2010. Partitioning the turnover and nestedness components of beta diversity. Global Ecol. Biogeogr. 19(1), 134-143. Baselga, A., 2013. Separating the two components of abundance-based dissimilarity: balanced changes in abundance vs. abundance gradients. Methods Ecol. Evol. 4(6), 552-557. Baselga, A., Orme, D., Villeger, S., De Bortoli, J., Leprieur, F., 2017. betapart: partioning beta diversity into turnover and nestedness components, R package version 1.4-1. Battilani, M., De Arcangeli, S., Balboni, A., Dondi, F., 2017. Genetic diversity and molecular epidemiology of Anaplasma. Infect. Genet. Evol. 49, 195-211. Belan, I., Bull, C.M., 1991. Host detection by four Australian tick species. J. Parasitol. 77(3), 337-340. Bennett, M.D., 2008. Western barred bandicoots in health and disease. Murdoch University, Perth, Western Australia. Bennett, M.D., Woolford, L., Banazis, M.J., O'Hara, A.J., Warren, K.S., Nicholls, P.K., Sims, C., Fenwick, S.G., 2011. Coxiella burnetii in Western Barred Bandicoots (Perameles bougainville) from Bernier and Dorre Islands in Western Australia. Ecohealth 8(4), 519-524. Benson, M.J., Gawronski, J.D., Eveleigh, D.E., Benson, D.R., 2004. Intracellular Symbionts and Other Bacteria Associated with Deer Ticks (Ixodes scapularis) from Nantucket and Wellfleet, Cape Cod, Massachusetts. Appl. Environ. Microbiol. 70(1), 616-620. Bonnet, S., Michelet, L., Moutailler, S., Cheval, J., Hebert, C., Vayssier-Taussat, M., Eloit, M., 2014. Identification of parasitic communities within European ticks using next- generation sequencing. PLoS Negl. Trop. Dis. 8(3), e2753. Bonnet, S.I., Binetruy, F., Hernández-Jarguín, A.M., Duron, O., 2017. The tick microbiome: why non-pathogenic microorganisms matter in tick biology and pathogen transmission. Front. Cell. Infect. Microbiol. 7, 283.

83 Brites-Neto, J., Duarte, K.M.R., Martins, T.F., 2015. Tick-borne infections in human and animal populations worldwide. Vet. World 8(3), 301-315. Brody, J., 1946. A case of tick typhus in north Queensland. Med. J. Aust. I, 511-512. Brown, G.K., Roberts, M.T.K., Aitken, R.J., 2001. Detection of Ehrlichia platys in dogs in Australia. Aust. Vet. J. 79(8), 554-558. Buettner, P.G., Westcott, D.A., Maclean, J., Brown, L., McKeown, A., Johnson, A., Wilson, K., Blair, D., Luly, J., Skerratt, L., Muller, R., Speare, R., 2013. Tick paralysis in spectacled flying-foxes (Pteropus conspicillatus) in north Queensland, Australia: Impact of a ground-dwelling ectoparasite finding an arboreal host. PLoS 8(9), e73078. Bull, C.M., 1978. Dispersal of the Australian reptile tick Aponomma hydrosauri by host movement. Aust. J. Zool. 26(4), 689-697. Bunce, M., Oskam, C.L., Allentoft, M.E., 2012. Quantitative real-time PCR in aDNA research, in: Shapiro, B., Hofreiter, M. (Eds.), Ancient DNA: methods and protocols. Springer, New York, USA, pp. 121-132. Burgdorfer, W., Barbour, A.G., Hayes, S.F., Benach, J.L., Grunwaldt, E., Davis, J.P., 1982. Lyme Disease - A tick-borne spirochetosis? Science 216(4552), 1317-1319. Burnard, D., Weaver, H., Gillett, A., Loader, J., Flanagan, C., Polkinghorne, A., 2017. Novel Chlamydiales genotypes identified in ticks from Australian wildlife. Parasit. Vectors 10(1), 46. Callow, L.L., 1984. Protozoal and Rickettsial Diseases. Australian Government Publishing Services, Canberra, ACT. Callow, L.L., Hoyte, H.M.D., 1961. Transmission experiemnts using Babesia bigemina, Theileria mutans, Borrelia sp. and the cattle tick Boophilus microplus. Aust. Vet. J. 37(10), 381-390. Caporaso, J.G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F.D., Costello, E.K., 2010. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7(5), 335-336. Carley, J.C., Pope, J.H., 1962. A New Species of Borrella (B. Queenslandica) from Rattus villosissimus in Queensland. Aust. J. Exp. Biol. Med. Sci. 40, 255-262. Case, R.J., Boucher, Y., Dahllof, I., Holmstrom, C., Doolittle, W.F., Kjelleberg, S., 2007. Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. Appl. Environ. Microbiol. 73(1), 278-288. Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D., 2007. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J. Microbiol. Methods 69(2), 330-339. Chalada, M.J., Stenos, J., Bradbury, R.S., 2016. Is there a Lyme-like disease in Australia? Summary of findings to date. One Health 2, 42-54. Chen, R., 2013a. Fox baiting program in Ku-ring-gai causes rise of bandicoots and ticks. The Daily Telegraph. [https://www.dailytelegraph.com.au/newslocal/north-shore/fox-baiting-program- causes-rise-of-bandicoots-and-ticks/news story/2c7572fb9f3408524abc3995856a8 7d6] Chen, T., 2013b. Bandicoot rise not due to fox baiting council denies ticks are result of cull, North Shore Times, Parramatta, NSW. Chitimia, L., Lin, R.Q., Cosoroaba, I., Wu, X.Y., Song, H.Q., Yuan, Z.G., Zhu, X.Q., 2010. Genetic characterization of ticks from southwestern Romania by sequences of mitochondrial cox1 and nad5 genes. Exp. Appl. Acarol. 52(2), 305-311.

84 Chun, J., Lee, J.H., Jung, Y., Kim, M., Kim, S., Kim, B.K., Lim, Y.W., 2007. EzTaxon: a web- based tool for the identification of prokaryotes based on 16S ribosomal RNA gene sequences. Int. J. Syst. Evol. Microbiol. 57(Pt 10), 2259-2261. Clark, K.L., Leydet, B., Hartman, S., 2013. Lyme borreliosis in human patients in Florida and Georgia, USA. Int. J. Med. Sci. 10(7), 915-931. Clay, K., Klyachko, O., Grindle, N., Civitello, D., Oleske, D., Fuqua, C., 2008. Microbial communities and interactions in the lone star tick, Amblyomma americanum. Mol. Ecol. 17(19), 4371-4381. Cole, J.R., Wang, Q., Cardenas, E., Fish, J., Chai, B., Farris, R.J., Kulam-Syed-Mohideen, A.S., McGarrell, D.M., Marsh, T., Garrity, G.M., Tiedje, J.M., 2009. The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res. 37, D141-D145. Cooper, A., Goullet, M., Mitchell, J., Ketheesan, N., Govan, B., 2012. Serological evidence of Coxiella burnetti exposure in native marsupials and introduced animals in Queensland, Australia. Epidemiol. Infect. 140(7), 1304-1308. Cooper, A., Stephens, J., Ketheesan, N., Govan, B., 2013. Detection of Coxiella burnetii DNA in wildlife and ticks in northern Queensland, Australia. Vector Borne Zoonotic Dis. 13(1), 12-16. Cowdry, E.V., 1925. A group of microorganisms transmitted hereditarily in ticks and apparently unassociated with disease. J. Exo. Med. 41(6), 817-830. Cupp, E.W., 1991. Biology of Ticks. Vet. Clin. N. Am-Small 21(1), 1-26 Dantas-Torres, F., 2015. Climate change, biodiversity, ticks and tick-borne diseases: The butterfly effect. Int. J. Parasitol. Parasites Wildl. 4(3), 452-461. Dantas-Torres, F., Chomel, B., Otranto, D., 2012. Ticks and tick-borne diseases: a one health perspective. Trends Parsitol. 28(1), 437-446. Dawood, K.E., Morgan, J.A., Busfield, F., Srivastava, M., Fletcher, T.I., Sambono, J., Jackson, L.A., Venus, B., Philbey, A.W., Lew-Tabor, A.E., 2013. Observation of a novel Babesia spp. in Eastern Grey Kangaroos (Macropus giganteus) in Australia. Int. J. Parasitol. Parasites Wildl. 2, 54-61. Day, M.J., 2011. One health: the importance of companion animal vector-borne diseases. Parasit. Vectors 4(49). de la Fuente, J., 2003. The fossil record and the origin of ticks (Acari: Parasitiformes: Ixodida). Exp. Appl. Acarol 29(304), 331-344. de la Fuente, J., Antunes, S., Bonnet, S., Cabezas-Cruz, A., Domingos, A.G., Estrada-Pena, A., Johnson, N., Kocan, K.M., Mansfield, K.L., Nijhof, A.M., Papa, A., Rudenko, N., Villar, M., Alberdi, P., Torina, A., Ayllon, N., Vancova, M., Golovchenko, M., Grubhoffer, L., Caracappa, S., Fooks, A.R., Gortazar, C., Rego, R.O.M., 2017. Tick-pathogen interactions and vector competence: identification of molecular drivers for tick-borne diseases. Front. Cell. Infect. Microbiol 7, 114. de la Fuente, J., Blouin, E.F., Kocan, K.M., 2003. Infection exclusion of the Rickettsial pathogen Anaplasma marginale in the tick vector Dermacentor variabilis. Clin. Diagn. Lab. Immunol. 10(1), 182-184. Degnan, P.H., Ochman, H., 2012. Illumina-based analysis of microbial community diversity. ISME J. 6(1), 183-194. Department of Agriculture and Water Resources, 2017. National lost of notifiable animal diseases. Australian Government. Last updated 22 Aug 2017. URL [http://www.agriculture.gov.au/pests-diseases-weeds/animal/notifiable#national- list-of-notifiable-diseases-of-terrestrial-animals-at-november-2015] Date accessed 10/10/2017.

85 Dennis, D.T., Hayes, E.B., 2002. Epidemiology of Lyme borreliosis, in: Gray, J.S., Kahl, O., Lane, R.S., Stanek, G. (Eds.), Lyme Borreliosis. Biology, Epidemiology and Control. CABI Publishing, Wallingford, UK, pp. 251-280. DeSantis, T.Z., Hugenholtz, P., Larsen, N., Rojas, M., Brodie, E.L., Keller, K., Huber, T., Dalevi, D., Hu, P., Andersen, G.L., 2006. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72(7), 5069-5072. Diaz, J.H., 2010. Ticks, including tick paralysis, in: Mandell, G.L., Bennett, J.E., Dolin, R. (Eds.), Mandell, Douglas and Bennett's Principles and Practice of Infectious Diseases, 7th ed. Churchill Livingstone Elsevier, Philadelphia, USA. Diniz, P.P.V.P., Schulz, B.S., Hartmann, K., Breitschwerdt, E.B., 2011. 'Candidatus Neoehrlichia mikurensis' Infection in a Dog from Germany. J. Clin. Microbiol. 49, 2059-2062. Dobson, A.D.M., Randolph, S.E., 2011. Modelling the effects of recent changes in climate, host density and acaricide treatmentson population dynamics of Ixodes ricinus in the UK. J. Appl. Ecol. 48(4), 1029-1037. Doube, B.K., 1975. Cattle and the paralysis tick Ixodes holocyclus. Aust. Vet. J. 51(11), 511-515. Doube, B.M., 1979. Seasonal patterns of abundance and host relationships of the Australia paralysis tick, Ixodes holocyclus Neumann (Acarina: Ixodidae), in southeastern Queensland. Aust. J. Ecol 4, 345-360. Dowle, M., 2012. A comparison of two species of bandicoots (Perameles nasuta and Isoodon obesulus) influenced by urbanisation: Population characteristics, genetic diversity, public perceptions, stress and parasites. Macquarie University, Sydney, New South Wales. Dunlop, J., 2015. The ecology and host-parasite dynamics of a fauna translocation in Australia. Murdoch University, Perth, Western Australia. Dunning Hotopp, J.C., Lin, M., Madupu, R., Crabtree, J., Angiuoli, S.V., Eisen, J.A., Seshadri, R., Ren, Q., Wu, M., Utterback, T.R., Smith, S., Lewis, M., Khouri, H., Zhang, C., Niu, H., Lin, Q., Ohashi, N., Zhi, N., Nelson, W., Brinkac, L.M., Dodson, R.J., Rosovitz, M.J., Sundaram, J., Daugherty, S.C., Davidsen, T., Durkin, A.S., Gwinn, M., Haft, D.H., Selengut, J.D., Sullivan, S.A., Zafar, N., Zhou, L., Benahmed, F., Forberger, H., Halpin, R., Mulligan, S., Robinson, J., White, O., Rikihisa, Y., Tettelin, H., 2006. Comparative genomics of emerging human agents. PLoS Genet. 2(2), e21. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32(5), 1792-1797. Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26(19), 2640-2461. Edgar, R.C., 2016. UNOISE2: improved error-correction for Illumina 16S and ITS amplico sequencing. biorxviv. Edgar, R.C., 2017. Search_16S: a new algorithm for identifying 16S ribosomal RNA gene contigs and chromosomes. biorxviv. Emergy, D., 2015. Introduction, in: Beveridge, I., Emery, D. (Eds.), Australasian animal parasites: Inside & out. The Australian Society for Parasitology Inc, Australia, pp. 5- 24. Estrada-Pena, A., 2001. Distribution, abundance and habitat preferences of Ixodes ricinus (Acari: Ixodidae) in northern Spain. J. Med. Entomol. 38(3), 361-370.

86 FitzGibbon, S.I., Jones, D.N., 2006. A community-based wildlife survey: the knowledge and attitudes of residents of suburban Brisbane, with a focus on bandicoots. Wildlife Res. 33(3), 233-241. Forster, D., Dunthorn, M., Stoeck, T., Mahe, F., 2016. Comparison of three clustering appraoch for detecting novel environmental microbial diversity. PeerJ. 4, e1692. Friend, J.A., 1990. Status of bandicoots in Western Australia, in: Seebeck, J.H., Brown, P.R., Wallis, R.L., Kemper, C.M. (Eds.), Bandicoots and Bilbies. Surrey Beatty & Sons, Sydney, Australia, pp. 73-84. Fritz, C.L., 2009. Emerging tick-borne diseases. Vet. Clin. North Am. Small Anim. Pract. 39(2), 265-278. Galan, M., Razzauti, M., Bard, E., Bernard, M., Brouat, C., Charbonnel, N., Dehne-Garcia, A., Loiseau, A., Tatard, C., Tamisier, L., Vayssier-Taussat, M., Vignes, H., Cosson, J.F., 2016. 16S rRNA amplicon sequencing for epidemiological surveys of bacteria in wildlife. mSystems 1(4), e00032-16. Gemmell, R.T., Cepon, G., Green, P.E., Stewart, N.P., 1991. Some effects of tick infestations on juvenile northern brown bandicoot (Isoodon macrourus). J. Wildl. Dis. 27(2), 269- 275. Gihring, T.M., Green, S.J., Schadt, C.W., 2012. Massively parallel rRNA gene sequencing exacerbates the potential for biased community diversity comparisons due to variable library sizes. Environ.l Microbiol. 14(2), 285-290. Goethert, H.K., Telford, S.R., 2003. Enzootic transmission of Anaplasma bovis in Nantucket cottontail rabbits. J. Clin. Microbiol. 41(8), 3744-3747. Gofton, A.W., Oskam, C.L., Lo, N., Beninati, T., Wei, H., McCarl, V., Murray, D.C., Paparini, A., Greay, T.L., Holmes, A.J., Bunce, M., Ryan, U.M., Irwin, P.J., 2015a. Inhibition of the endosymbiont 'Candidatus Midichloria mitochondrii' during 16S rRNA gene profiling reveals potential pathogens in Ixodes ticks from Australia. Parasit. Vectors 8, 345. Gofton, A.W., Doggett, S.L., Ratchford, A., Oskam, C.L., Paparini, A., Ryan, U.M., Irwin, P.J., 2015b. Bacterial profiling reveals novel 'Ca. Neoehrlichia', Ehrlichia, and Anaplasma species in Australian human-biting ticks. PLoS One 10(12), e0145449. Gofton, A.W., Soggett, S., Ratchford, A., Ryan, U.M., Irwin, P.J., 2016. Phylogenetic characterisation of two novel Anaplasmataceae from Australia Ixodes holocyclus ticks: 'Candidatus Neoehrlichia australis' and 'Candidatus Neoehrlichia arcana'. Int. J. Syst. Evol. Microbiol. 66(10), 4256-4261. Gofton, A.W., Waudby, H.P., Petit, S., Greay, T.L., Ryan, U.M., Irwin, P.J., 2017. Detection and phylogenetic characterisation of novel Anaplasma and Ehrlichia species in Amblyomma triguttatum subsp. from four allopatric populations in Australia. Ticks Tick Borne Dis. 8(5), 749-756. Gordon, G., Hall, L.S., Atherton, R.G., 1990. Status of bandicoots in Queensland, in: Seebeck, J.H., Brown, P.R., Wallis, R.L., Kemper, C.M. (Eds.), Bandicoots and Bilbies. Surrey Beatty & Sons, Sydney, Australia, pp. 37-42. Gordon, G., Hulbert, A.J., 1989. Peramelidae, in: Walton, D.W., Ricgardson, B.J. (Eds.), Fauna of Australia Mammalia. Australian Government Publishing Service, Canberra, ACT, pp. 603-624. Graves, S.R., Dwyer, B.W., McColl, D., McDade, J.E., 1991. Flinders Island spotted fever: a newly recognised endemic focus of tick typhus in Bass Strait. Part 2. Serological investigations. Med. J. Aust. 154(2), 99-104. Graves, S.R., Stenos, J., 2017. Tick-borne infectious diseases in Australia. Med. J. Aust. 206(7), 320-324.

87 Greay, T.L., Oskam, C.L., Gofton, A.W., Rees, R.L., Ryan, U.M., Irwin, P.J., 2016. A survey of ticks (Acari: Ixodidae) of companion animals in Australia. Parasit. Vectors 9, 207. Haas, B.J., Gevers, D., Earl, A.M., Feldgarden, M., Ward, D.V., Giannoukos, G., Ciulla, D., Tabbaa, D., Highlander, S.K., Sodergren, E., Methe, B., DeSantis, T.Z., Human Microbiome, C., Petrosino, J.F., Knight, R., Birren, B.W., 2011. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons. Genome Res. 21, 494-504. Hall-Mendelin, S., Craig, S.B., Hall, R.A., O'Donoghue, P., Atwell, R.B., Tulsiani, S.M., Graham, G.C., 2011. Tick paralysis in Australia caused by Ixodes holocyclus Neumann. Ann. Trop. Med. Parasitol. 105(2), 95-106. Hammer, B., Moter, A., Kahl, O., Alberti, G., Gobel, U.B., 2001. Visualization of Borrelia burgdorferi sensu latoby fluorescence in situ hybridization (FISH) on whole-body sections of Ixodes ricinus ticks and gerbil skin biopsies. Microbiology 147(Pt 6), 1425- 1436. Hartemink, N., Takken, W., 2016. Trends in tick population dynamics and pathogen transmission in emerging tick-borne pathogens in Europe: An introduction. Exp. Appl. Acarol. 68(3), 269-278. Hawlena, H., Rynkiewicz, E., Toh, E., Alfred, A., Durden, L.A., Hastriter, M.W., Nelson, D.E., Rong, R., Munro, D., Dong, Q., Fuqua, C., Clay, K., 2013. The arthropod, but not the vertebrate host or its environment, dictates bacterial community composition of and ticks. ISME J. 7(1), 221-223. Herbert, J.D., Godfrey, S.S., Bull, C.M., Menz, R.I., 2010. Developmental stages and molecular phylogeny of Hepatozoon tuatarae, a parasite infecting the New Zealand tuatara, Sphenodon punctatus and the tick, Amblyomma sphenodonti. Int. J. Parasitol. 40(11), 1311-1315. Hert, D.G., Fredlake, C.P., Barron, A.E., 2008. Advantages and limitations of next- generation sequencing technologies: a comparison of electrophoresis and non- electrophoresis methods. Electrophoresis 29(23), 4618-4626. Hillman, A., Thompson, R.C.A., 2016. Interactions between humans and urban-adapted marsupials on private properties in the greater Perth region. Australian Mammalogy 38(2), 253. Hillman, A.E., 2016. Urbanisation and small marsupials in the greater Perth region, Western Australia. Murdoch University, Perth, Western Australia. Hillman, A.E., Lymbery, A.J., Elliot, A.D., Andrew Thompson, R.C., 2017. Urban environments alter parasite fauna, weight and reproductive activity in the quenda (Isoodon obesulus). Sci. Total Environ. 607-608, 1466-1478. Hocking, G.J., 1990. Status of bandicoots in Tasmania, in: Seebeck, J.H., Brown, P.R., Wallis, R.L., Kemper, C.M. (Eds.), B Bandicoots and Bilbies. Surrey Beatty & Sons, Sydney, Australia, pp. 61-66. Hoogstraal, H., Aeschlimann, A., 1982. Tick-host specificity. Bulletin de la société entomologique Suisse 55, 5-32. Hooper, L.V., Gordon, J.I., 2001. Commensal host-bacterial relationships in the gut. Science 292(5519), 1115-1118. Hornok, S., Trauttwein, K., Takacs, N., Hodzic, A., Duscher, G.G., Kontschan, J., 2017. Molecular analysis of Ixodes rugicollis, 'Candidatus Neoehrlichia sp.' (FU98) and a novel Babesia genotype from a European badger (Meles meles). Ticks Tick Borne Dis. 8(1), 41-44. Hou, R., Yang, Z., Li, M., Xiao, H., 2013. Impact of the next-generation sequencing data depth on various biological result inferences. Sci. China Life Sci. 56(2), 104-109.

88 Howard, K.H., Barrett, G., Ramalho, C.E., Friend, J.A., Boyland, R.J.I., Hudson, J., Wilson, B., 2014. Community quenda survey 2012. WWF-Australia and Department of Parks and Wildlife, WWF-Australia, Perth, Western Australia. Hudson, B.J., Barry, R.D., Shafren, D.R., Wills, M.C., Caves, S., Lennox, V.A., 1994. Does Lyme borreliosis exist in Australia? J. Spiroch. Tick Borne Dis. 1, 46-51. Hugenholtz, P., Goebel, B.M., Pace, N.R., 1998. Impact of culture-independent studies on the emerging phylogenetic view of bacterial diversity. J. Bacteriol. 180(18), 4765- 4767. Hurlbert, S.H., 1971. The nonconcept of species divserity: a critique and alternative parameters. Ecology 52(4), 577-586. Illumina Inc, 2015. MiSeq System Guide, version 10, USA. Irwin, P.J., 2009. Canine babesiosis: from molecular taxonomy to control. Parasit. Vectors 2(S1), S4. Izzard, L., Graves, S., Cox, E., Fenwick, S.G., Unsworth, N., Stenos, J., 2009. Novel Rickettsia in ticks, Tasmania, Australia. Emerg. Infect. Dis. 15(10), 1654-1656. Jackson, J., Beveridge, I., Chilton, N.B., Andrews, R.H., 2007. Distributions of the paralysis ticks Ixodes cornuatus and Ixodes holocyclus in south-eastern Australia. Aust. Vet. J. 85(10), 420-424. Jahfari, S., Ruyts, S.C., Frazer-Mendelewska, E., Jaarsma, R., Verheyen, K., Sprong, H., 2017. Melting pot of tick-borne zoonoses: the European hedgehog contributes to the maintenance of various tick-borne diseases in natural cycles urban and suburban areas. Parasit. Vectors 10(1), 134. Johnson, J.A., Southgate, R.I., 1990. Present and former status of bandicoots in the Northern Territory, in: Seebeck, J.H., Brown, P.R., Wallis, R.L., Kemper, C.M. (Eds.), Bandicoots and Bilbies. Surrey Beatty & Sons, Sydney, Australia, pp. 85-92. Jongejan, F., Uilenberg, G., 2004. The global importance of ticks. Parasitology 129(Suppl.), S3-S14. Katoh, K., Misawa, K., Kuma, K., Miyata, T., 2002. MAFFT: a novel method for rapid mulitple sequence alignment based on fast fourier transform. Nucleic Acids Res. 30(14), 3059-3066. Kawahara, M., Rikihisa, Y., Isogai, E., Takahashi, M., Misumi, H., Suto, C., Shibata, S., Zhang, C., Tsuji, M., 2004. Ultrastructure and phylogenetic analysis of 'Candidatus Neoehrlichia mikurensis' in the family Anaplasmataceae, isolated from wild rats and found in Ixodes ovatus ticks. Int. J. Syst. Evol. Microbiol. Microbiology 54(Pt 5), 1837- 1843. Kawahara, M., Rikihisa, Y., Lin, Q., Isogai, E., Tahara, K., Itagaki, A., Hiramitsu, Y., Tajima, T., 2006. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl. Environ. Microbiol. 72(2), 1102-1109. Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Drummond, A., 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12), 1647-1649. Kembel, S.W., Wu, M., Eisen, J.A., Green, J.L., 2012. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Comput. Biol. 8(10), e1002743. Khoo, J.J., Chen, F., Kho, K.L., Ahmad Shanizza, A.I., Lim, F.S., Tan, K.K., Chang, L.Y., AbuBakar, S., 2016. Bacterial community in Haemaphysalis ticks of domesticated

89 animals from the Orang Asli communities in Malaysia. Ticks Tick Borne Dis. 7(5), 929-937. King, L.J., 2014. Combating the triple threat: the need for a one health approach, in: Atlas, R.M., Maloy, S. (Eds.), One Health: People, Animals and the Environment. American Society for Microbiology, Washington, USA, pp. 3-16. Kirstein, F., Rijpkema, S., Molkenboer, M., Gray, J.S., 1997. Local variations in the distribution and prevalence of Borrelia burgdorgeri sensu lato genomospecies in Ixodes ricinus ticks. Appl. Environ. Microbiol. 63(3), 1102-1106. Klompen, J.S.H., Black, W.C., Keirans, J.E., Oliver, J.H., 1996. Evolution of ticks. Annu. Rev. Entomol. 41, 141-161. Klyachko, O., Stein, B.D., Grindle, N., Clay, K., Fuqua, C., 2007. Localization and visualization of a coxiella-type symbiont within the lone star tick, Amblyomma americanum. Appl. Environ. Microbiol. 73(20), 6584-6594. Kolonin, G.V., 2007. Mammals as hosts for Ixodid ticks (Acarina, Ixodidae). Entomol. Rev. 87(4), 401-412. Krige, A., 2017. Unlocking archived ticks to investigate a novel putative pathogen. Murdoch University, Perth, Western Australia. Krol, N., Obiegala, A., Pfeffer, M., Lonc, E., Kiewra, D., 2016. Detection of selected pathogens in ticks collected from cats and dogs in the Wroclaw Agglomeration, South-West Poland. Parasit. Vectors 9, 351. Kruszelnicki, K.S., 2014. Tick bites causes meat allergy. ABC News, Australia. [ http://www.abc.net.au/science/articles/2014/02/25/3951271.htm] Kunin, V., Engelbrektson, A., Ochman, H., Hugenholtz, P., 2010. Wrinkles in the rare biosphere: pyrosequencing errors can lead to artificial inflation of diversity estimates. Environ. Microbiol. 12(1), 118-123. Kurtti, T.J., Simser, J.A., Baldridge, G.D., Palmer, A.T., Munderloh, U.G., 2005. Factors influencing in vitro infectivity and growth of (Rickettsiales: ), an endosymbiont of the Rocky Mountain wood tick, (Acari, Ixodidae). J. Invertebr. Pathol. 90(3), 177-186. Kwak, M.L., 2017. Keys for the morphological identification of the Australian paralysis ticks (Acari: Ixodidae), with scanning electron micrographs. Exp. Appl. Acarol. 72(1), 93-101. Kwak, M.L., Ash, A., Elliot, A., 2017a. Redescription of the numbat tick Ixodes (Sternalixodes) myrmecobii Roberts, 1962 (Acari: Ixodidae) with descriptions of the male and nymph, and new host records. Zootaxa 4272(1), 40-56. Kwak, M.L., Beveridge, I., Koehler, A.V., Malipatil, M., Gasser, R.B., Jabbar, A., 2017b. Phylogenetic analysis of the Australian paralysis ticks and their relatives (Ixodidae: Ixodes: Sternalixodes). Parasit. Vectors 10(1), 122. Lahti, L., Shetty, S., Blake, T., Salojarvi, J., 2012-207. Microbiome R package, version 0.99.63. Lalzar, I., Harrus, S., Mumcuoglu, K.Y., Gottlieb, Y., 2012. Composition and seasonal variation of Rhipicephalus turanicus and Rhipicephalus sanguineus bacterial communities. Appl. Environ. Microbiol. 78(12), 4110-4116. Lane, A.M., Shaw, M.D., McGraw, E.A., O'Neill, S.L., 2005. Evidence of a spotted fever-like Rickketsia and a potential new vector from northeastern Australia. J. Med. Entomol. 42(5), 918-921. Lazar, I., Lazar, I., 2010. Gel Analyzer. Lenghaus, C., Obendorf, D.L., Wright, F.H., 1990. Veterinary aspects of Perameles gunnii biology with special reference to species conservation, in: Clark, T.W., Seebeck, J.H.

90 (Eds.), Management and conservation of small populations. Chicago Zoological Society, Illinois, USA, pp. 89 - 108. Levy, S.E., Myers, R.M., 2016. Advancements in Next-Generation Sequencing. Annu. Rev. Geonomics Hum. Genet. 17, 95-115. Li, H., Jiang, J., Liu, W., Zheng, Y., Huo, Q., Tang, K., Zuo, S., Liu, K., Jiang, B., Yang, H., Cao, W., 2012. Human infection with 'Candidatus Neoehrlichia mikurensis', China. Emerg. Infect. Dis. 18(10), 1636-1639. Li, Y., Cooper, S.J.B., Lancaster, M.L., Packer, J.G., Carthew, S.M., 2016. Comparative population genetic structure of the endangered southern brown bandicoot, Isoodon obesulus, in fragmented landscapes of southern Australia. PLoS One 11(4) e0152850. Li, Y., Lancaster, M.L., Carthew, S.M., Packer, J.G., Cooper, S.J.B., 2014. Delineation of conservation units in an endangered marsupial, the southern brown bandicoot (Isoodon obesulus obesulus), in South Australia/western Victoria, Australia. Aust. J. Zool. 62, 345-359. Liu, L., Li, Y., Li, S., Hu, N., He, Y., Pong, R., Lin, D., Lu, L., Law, M., 2012. Comparison of next-generation sequencing systems. J. Biomed. Biotechnol. 2012, 251364. Loh, S., Gofton, A.W., Lo, N., Gillett, A., Ryan, U.M., Irwin, P.J., Oskam, C.L., 2016. Novel Borrelia species detected in echidna ticks, Bothriocroton concolor, in Australia. Parasit. Vectors 9(1), 339 Loh, S.M., Gillett, A., Ryan, U., Irwin, P., Oskam, C., 2017. Molecular characterization of 'Candidatus Borrelia tachyglossi' (family Spirochaetaceae) in echidna ticks, Bothriocroton concolor. Int. J. Syst. Evol. Microbiol. 67(4), 1075-1080. Loye, J.E., Lane, R.S., 1998. Questing behaviour of Ixodes pacificus (Acari: Ixodidae) in relation to meterological and seasonal factors. J. Med. Entomol. 25(5), 391-398. Lydecker, H.W., Stanfield, E., Lo, N., Hochuli, D.F., Banks, P.B., 2015. Are urban bandicoots solely to blame for tick concerns? Aust. Zool. 37(3), 288-293. Lyne, A.G., 1990. A brief review of bandicoot studies, in: Seebeck, J.H., Brown, P.R., Wallis, R.L., Kemper, C.M. (Eds.), Bandicoots and Bilbies. Surrey Beatty & Sons, Sydney, Australia, pp. xxii-xxix. MacDonald, A.J., Sarre, S.D., 2016. A framework for developing and validating taxon- specific primers for specimen identification from environmental DNA. Mol. Ecol. Resour. 17(4), 708-720. Machado-Ferreira, E., Vizzoni, V.F., Balsemao-Pires, E., Moerbeck, L., Gazeta, G.S., Piesman, J., Voloch, C.M., Soares, C.A., 2016. Coxiella symbionts are widespread into hard ticks. Parasitol. Res. 115(12), 4691-4699. Mans, B.J., de Klerk, D., Pienaar, R., de Castro, M.H., Latif, A.A., 2015. Next-generation sequenecing as means to retrieve tick systematic markers, with the focus on Nuttalliella namaqua (Ixodoidea: Nuttalliellidae). Tick Tick Borne Dis. 6(4), 450-462. Mason, R.J., Lee, J.M., Curran, J.M., Moss, A., Van der Heide, B., Daniels, P.W., 2001. Seriological survey of Ehrlichia canis in urban dogs from the major population centres of northern Australia. Aust. Vet. J. 79(8), 559 - 562. Mattila, J.T., Munderloh, U.G., Kurtti, T.J., 2007. Rickettsia peacockii, an endosymbiont of Dermacentor andersoni, does not elicit or inhibit humoral immune responses from immunocompetent D. andersoni or Ixodes scapularis cell lines. Dev. Comp. Immunol. 31(11), 1095-1106. Maurer, F.P., Keller, P.M., Beuret, C., Joha, C., Achermann, Y., Gubler, J., Bircher, D., Karrer, U., Fehr, J., Zimmerli, L., Bloemberg, G.V., 2013. Close geographic association of human neoehrlichiosis and tick populations carrying 'Candidatus Neoehrlichia mikurensis' in eastern Switzerland. J. Clin. Microbiol. 51(1), 169-176.

91 Maurin, M., Raoult, D., 1999. . Clin. Microbiol. Rev. 12(4), 518-553. McDiarmid, L., Petney, T., Dixon, B., Andrews, R.H., 2000. Range expansion of the tick Amblyomma triguttatum trigattatum, Australia vector of Q fever. Int. J. Parasitol. 30(7), 791-793. McMurdie, P.J., Holmes, S., 2013. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One 8(4), e61217. Menkhorst, P.W., Seebeck, J.H., 1990. Distribution and conservation status of bandicoots in Victoria, in: Seebeck, J.H., Brown, P.R., Wallis, R.L., Kemper, C.M. (Eds.), Bandicoots and Bilbies. Surrey Beatty & Sons, Sydney, Australia, pp. 51-60. Mulhearn, C.R., 1946. A note on two blood parasites of cattle (Spirochaeta theileri and bovis) recorded for the first time in Australia. Aust. Vet. J. 22(4), 118. Mullis, K.B., Faloona, F.A., 1987. Specific synthesis of DNA in vitro via a polymerase- catalyzed chain reaction. Methods Enzymol. 155, 335-350. Munoz-Leal, S., Gonzalez-Acuna, D., 2015. The tick Ixodes uriae (Acari: Ixodidae): hosts, geographical distribution, and vector roles. Ticks Tick Borne Dis. 6(6), 843-868. Murdoch, F.A., Spratt, D.M., 2005. Ecology of the common marsupial tick (Ixodes tasmani Neumann) (Acarina: Ixodidae), in eastern Australia. Aust. J. Zool. 53, 383-388. Mwamuye, M.M., Kariuki, E., Omondi, D., Kabii, J., Odongo, D., Masiga, D., Villinger, J., 2017. Novel Rickettsia and emergent tick-borne pathogens: a molecular survey of ticks and tick-borne pathogens in Shimba Hills National Reserve, Kenya. Ticks Tick Borne Dis. 8(2), 208 -218. Narasimhan, S., Fikrig, E., 2015. Tick microbiome: the force within. Trends Parsitol. 31(7), 315-323. Narasimhan, S., Rajeevan, N., Liu, L., Zhao, Y.O., Heisig, J., Pan, J., Eppler-Epstein, R., Deponte, K., Fish, D., Fikrig, E., 2014. Gut microbiota of the tick vector Ixodes scapularis modulate colonization of the lyme disease spirochete. Cell Host. Microbe 15(1), 58-71. Nilakanta, H., Drews, K., Firrell, S., Foulkes, M., Jablonski, K., 2014. A review of software for analyzing molecular sequences. BMC Res. Notes 7, 830. Noda, H., Munderloh, U.G., Kurtti, T.J., 1997. Endosymbionts of ticks and their relationship to Wolbachia spp. and tick-borne pathogens of humans and animals. Appl. Environ. Microbio. 63(10), 3926-3932. Norman, R.P., 1997. A molecular view of microbial diversity and the biosphere. Science 276(5313), 734-740. Ogden, N.H., Lindsay, L.R., 2016. Effects of climate and climate change on vectors and vector-borne dieases: ticks are different. Trends in Parsitol. 32(8), 646-656. Oksanen, J., Blanchet, F.G., Friendly, M., Kindt, R., Legendre, P., McGlinn, D., Minchin, R., O'Hara, R.B., Simpson, G.L., Solymos, P., Stevens, M.H.H., Szoecs, E., Wagner, H., 2017. Vegan: community ecology package, version 2.4-4. R package Oliver, J.H., 1989. Biology and systematics of ticks (Acari:Ixodida). Annu. Rev. Ecol. Syst. 20, 397-430. Oskam, C.L., Gofton, A.W., Greay, T.L., Yang, R., Doggett, S., Ryan, U.M., Irwin, P.J., 2017. Molecular investigation into the presence of a Coxiella sp. in Rhipicephalus sanguineus ticks in Australia. Veterinary Microbiol. 201, 141-145. Owen, H.C., 2007. Detection and characterisation of Rickettsiae in Western Australia. Murdoch University, Perth Western Australia. Palomar, A.M., Portillo, A., Santibanez, P., Mazuelas, D., Roncero, L., Garcia-Alvarez, L., Santibanez, S., Gutierrez, O., Oteo, J.A., 2015. Detection of tick-borne Anaplasma bovis,

92 Anaplasma phagocytophilum and Anaplasma centrale in Spain. Med. Vet. Entomol. 29(3), 349-353. Paparini, A., Macgregor, J., Irwin, P.J., Warren, K., Ryan, U.M., 2014. Novel genotypes of Trypanosoma binneyi from wild platypuses (Ornithorhynchus anatinus) and identification of a leech as a potential vector. Exp. Parasitol. 145, 42-50. Paparini, A., Ryan, U.M., Warren, K., McInnes, L.M., de Tores, P., Irwin, P.J., 2012. Identification of novel Babesia and Theileria genotypes in the endangered marsupials, the woylie (Bettongia penicillata ogilbyi) and boodie (Bettongia lesueur). Exp. Parasitol. 131(1), 25-30. Parola, P., Raoult, D., 2001. Ticks and tickborne bacterial diseases in humans: An emerging infectious threat. Clin. Infect. Dis. 32(6), 897-928. Paull, D.J., 1995. The distribution of the southern brown bandicoot (Isoodon obesulus obesulus) in South Australia. Wildl. Res. 22(5), 585-600. Pfaffle, M., Littwin, N., Muders, S.V., Petney, T.N., 2013. The ecology of tick-borne diseases. Int. J. Parasitol. 43(12-13), 1059-1077. Pichon, B., Rogers, M., Egan, D., Gray, J., 2005. Blood-meal analysis for the identification of reservoir hosts of tick-borne pathogens in Ireland. Vector Borne Zoonotic Dis. 5(2), 172-180. Piesman, J., Gern, L., 2004. Lyme borreliosis in Europe and North America. Parasitology 129(Suppl), S191-S220. Piesman, J., Stone, B.J., 1991. Vector competence of the Australia paralysis tick, Ixodes holocyclus, for the lyme disease spirochete Borrelia burgdoferi. Int. J. Parasitol. 21(1), 109-111. Pinto, A.J., Raskin, L., 2012. PCR biases distort bacterial and archaeal community structure in pyrosequencing datasets. PLoS One 7(8), e43093. Plummer, E., Twin, J., Bulach, D., Garland, S., Tabrizi, S., 2015. A comparison of three bioinformatics pipelines for the analysis of preterm gut microbiota using 16S rRNA gene sequencing data. J. Proteomics Bioinform. 8(12), 283-291. Pope, J.H., 1955. The isolation of rickettsia resembling Rickettsia australis in south east Queensland. Med. J. Aust. 42(1-21), 761-763. Poretsky, R., Rodriguez-R, L.M., Luo, C., Tsementzi, D., Konstantinidis, K.T., 2014. Strengths and limitations of 16S rRNA gene amplicon sequencing in revealing temporal microbial community dynamics. PLoS One 9(4) e93827. Pruesse, E., Quast, C., Knittel, K., Fuchs, B.M., Ludwig, W., Peplies, J., Glockner, F.O., 2007. SILVA: a comprehensive online resource for quality checked and aligned ribosomal RNA sequence data compatible with ARB. Nucleic Acids Res. 35(21), 7188-7196. Radcliffe, J., Rusjakovski, N., Forkert, J., Jones, M., Stewart, C., 2016. Growing evidence of an emerging tick-borne disease that causes a Lyme-like illness for many Australian patients. Community Affairs References Committee, Canberra, Australian Capital Territory. Randolph, S.E., 2004. Tick ecology: Processes and patterns behind the epidemiological risk posed by ixodid ticks as vectors. Parasitology 129(Suppl.), S37-S65. Randolph, S.E., 2008. The impact of tick ecology on pathogen transmission dynamics, in: Bowman, A.S., Nuttall, P.A. (Eds.), Ticks: biology, disease and control. Cambridge University Press, New York, USA, pp. 40-72. Rar, V., Golovljova, I., 2011. Anaplasma, Ehrlichia, and ‘Candidatus Neoehrlichia’ bacteria: Pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infect. Genet. Evol. 11(8), 1842-1861.

93 Reis, C., Cote, M., Paul, R.E., Bonnet, S., 2011. Questing ticks in suburban forest are infected by at least six tick-borne pathogens. Vector Borne Zoonotic Dis. 11(7), 907- 916. Reis-Filho, J., 2000. Next-generation sequencing. Breast Cancer Res. 11(S3), 1-7. Richards, J.D., Short, J., 2003. Reintroduction and establishment of the western barred bandicoot Perameles bougainville (Marsupialia: Peramelidae) at Shark Bay, Western Australia. Biol. Conserv. 109(2), 181-195. Roberts, F.S.H., 1969. The larvae of Australian Ixodidae (Acarina: Ixodidea). Aust. J. Entomol. 8(1), 37-78. Roberts, F.S.H., 1970. Australian Ticks. CSIRO, Melbourne, Victoria. Ronquist, F., Huelsenbeck, J.P., 2003. MRBAYERS: Bayesian inference of phylogeny. Bioinformatics 17(8), 1572-1574. Rosselli, R., Romoli, O., Vitulo, N., Vezzi, A., Campanaro, S., de Pascale, F., Schiavon, R., Tiarca, M., Poletto, F., Concheri, G., Valle, G., Squartini, A., 2016. Direct 16S rRNA-seq from bacterial communities: a PCR-independent approach to simultaneously assess microbial diversity and functional activity potential of each taxon. Sci. Rep. 6, 32165. Rothenburger, J.L., Himsworth, C.H., Nemeth, N.M., Pearl, D.L., Jardine, C.M., 2017. Environmental factors and zoonotic pathogen ecology in urban exploiter species. Ecohealth 14(3), 603-641. RStudio, T., 2016. RStudio: Integrated Development for R. RStudio Inc, Boston, USA. Rudolf, I., Mendel, J., Sikutova, C., Svec, P., Masarikova, J., Novakova, D., Bunkova, L., Sedlacek, I., Hubalek, Z., 2009. 16S rRNA gene-based idenfitication of cultured bacterial flora from host-seeking Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna ticks, vectos of vertebrate pathogens. Folia Microbiol (Praha) 54(5), 419-428. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain-termination inhibitors. Proc. Natl. Acad. Sci. U.S.A 74(12), 5463-5467. Santos, C.F., Carvalho, C.B., 2006. First report of Anaplasma bovis (Donatien and Lestoquard, 1936) Dumler et al. (2001) at micro region of Campos dos Goytacazes, State of Rio de Janeiro Brazil. Rev. Bras. Parasitol. Vet. 15(3), 126-127. Sashika, M., Abe, G., Matsumoto, K., Inokuma, H., 2011. Molecular survey of Anaplasma and Ehrlichia infections of feral raccoons (Procyon lotor) in Hokkaido, Japan. Vector Borne Zoonotic Dis. 11(4), 349-354. Sassera, D., Beninati, T., Bandi, C., Bouman, E.A., Sacchi, L., Fabbi, M., Lo, N., 2006. 'Candidatus Midichloria mitochondrii', an endosymbiont of the tick Ixodes ricinus with a unique intramitochondrial lifestyle. Int. J. Syst. Evol. Microbiol. 56(Pt 11), 2535-2540. Schloss, P., Westcott, S., Ryabin, T., Hall, J., Hartmann, M., Hollister, E., Lesneuwski, R., Oakley, B., Parks, D., Robinson, C., Sahl, J., Stres, B., Thallinger, G., Van Horn, D., Weber, C., 2009. Introducig mothur: open-source, platform-independent, community- supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75(23), 7537-7541. Scoles, G.A., 2005. Phylogenetic analysis of the Francisella-like endosymbionts of Dermacentor ticks. J. Med. Entomol. 41(3), 277-286. Shokralla, S., Spall, J.L., Gibson, J.F., Hajibabaei, M., 2012. Next-generation sequencing technologies for environmental DNA research. Mol. Ecol. 21(8), 1794-1805. Silaghi, C., Santos, A.S., Gomes, J., Christova, I., Matei, I.A., Walder, G., Domingos, A., Bell- Sakyi, L., Sprong, H., von Loewenich, F.D., Oteo, J.A., de la Fuente, J., Dumler, J.S., 2017.

94 Guidelines for the direct detection of Anaplasma spp. in diagnosis and epidemiological studies. Vector Borne Zoonotic Dis. 17(1), 12-22. Sims, D., Sudbery, I., Ilot, N.E., Heger, A., Ponting, C.P., 2014. Sequencing depth and coverage: key considerations in genomic analyses. Nature Rev. Genet. 15(2), 121- 132. Smith, T., Killbourne, F.L., 1893. Investigators into the nature, causation and prevention of Texas or southern cattle fever, in: Agric, U.D. (Ed.), Bull bur Anim Ind. Sparagano, O.A.E., Allsopp, M.T.E.P., Mank, R.A., Rijpkema, S.G.T., Figueroa, J.V., Jongejan, F., 1999. Molecular detection of pathogen DNA in ticks (Acari: Ixodidae): A review. Exp. Appl. Acarol. 23(12), 929-960. Sperling, J.L., Silva-Brandao, K.L., Brandao, M.M., Lloyd, V.K., Dang, S., Davis, C.S., Sperling, F.A.H., Magor, K.E., 2017. Comparison of bacterial 16S rRNA variable regions for microbiome surveys of ticks. Tick Tick Brne Dis. 8(4), 453-461. Stenos, J., Graves, S., Popov, V.L., Walker, D.H., 2003. Aponomma hydrosauri, the reptile- associted tick reservoir of Rickettsia honei on Flinders Island, Australia. Am. J. Trop. Med. Hyg. 69(3), 314-317. Stewart, R.S., 1991. Flinders Island spotted fever: a newly recognised endemic focus of tick typhus in Bass Strait. Part 1. Clinical and epidemiological features. Med. J. Aust. 154(2), 94-104. Sumrandee, C., Baimai, V., Trinachartvanit, W., Ahantarig, A., 2016. Molecular detection of Rickettsia, Anaplasma, Coxiella and Francisella bacteria in ticks collected from Artiodactyla in Thailand. Ticks Tick Borne Dise. 7(5), 678-689. Sun, L.V., Scoles, G.A., Fish, D., O'Neill, S.L., 2000. Francisella-like endosymbionts of ticks. J. Invertebr. Pathol. 76(4), 301-303. Suzuki, M.T., Giovannoni, S.J., 1996. Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR. Appl. Environ. Microbiol. 62(2), 625-630. Swei, A., Kwan, J.Y., 2017. Tick microbiome and pathogen acquisition altered by host blood meal. ISME J. 11(3), 813-816. Szigeti, A., Kreizinger, Z., Hornok, S., Abichu, G., Gyuranecz, M., 2014. Detection of Francisella-like endosymbiont in Hyalomma rufipes from Ethiopia. Tick Tick Borne Dis. 5(6), 818-820. Telford, S.R., Goethert, H.K., 2004. Emerging tick-borne infections: rediscovered and better characterized, or truly ‘new’? Parasitology 129(Suppl.), S301-S327. Tessler, M., Neumann, J.S., Afshinnekoo, E., Pineda, M., Hersch, R., Velho, L.F.M., Segovia, B.T., Lansac-Toha, F.A., Lemke, M., DeSalle, R., Mason, C.E., Brugler, M.R., 2017. Large- scale differences in microbial biodiversity discovery between 16S amplicon and shotgun sequencing. Sci. Rep. 7(1), 6589. Thompson, R.C.A., 2013. Parasite zoonoses and wildlife: One health, spillover and human activity. Int. J. Parasitol. 43(12-13), 1079-1088. Torondel, B., Ensink, J.H., Gundogdu, O., Ijaz, U.Z., Parkhill, J., Abdelahi, F., Nguyen, V.A., Sudgen, S., Gibson, W., Walker, A.W., Quince, C., 2016. Assessment of the influence of intrinsic environmental and geographical factors on the bacterial ecology of pit latrines. Microb. Biotechnol. 9(2), 209-223. Turner, S., Pryer, K.M., Miao, V.P., Palmer, J.D., 1999. Investigating deep phylogenetic relationships among cyanbacteria and plastids by small subunit rRNA sequence analysis. J. Eukaryot. Microbiol. 46(4), 327-338. Unsworth, N., Stenos, J., Graves, S.R., Faa, A.G., Cox, E., Dyer, J.R., Boutlis, C.S., Lane, A.M., Shaw, M.S., Robson, J., Nissen, M.D., 2007. Flinders Island Spotted Fever Rickettsioses

95 caused by 'marmionii' strain of Rickettsia honei, Eastern Australia. Emerg. Infect. Dis. 13(4), 566-573. Upchurch, P., 2008. Gondwanan break-up: legacies of a lost world? Trends Ecol. Evol. 23(4), 229-236. van Nunen, S., 2015. Tick-induced allergies: mammalian meat allergy, tick anaphylaxis and their significance. Asia Pac. Allergy 5(1), 3-16. Vanstreels, R.E., Woehler, E.J., Ruoppolo, V., Vertigan, P., Carlile, N., Priddel, D., Finger, A., Dann, P., Herrin, K.V., Thompson, P., Ferreira Junior, F.C., Braga, E.M., Hurtado, R., Epiphanio, S., Catao-Dias, J.L., 2015. Epidemiology and molecular phylogeny of Babesia sp. in Little Penguins Eudyptula minor in Australia. Int. J. Parasitol. Parasites Wildl 4(2), 198-205. Vayssier-Taussat, M., Le Rhun, D., Buffet, J.P., Maaoui, N., Galan, M., Guivier, E., Charbonnel, N., Cosson, J.F., 2012. 'Candidatus Neoehrlichia mikurensis' in bank voles, France. Emerg. Infect. Dis. 18(12), 2063-2065. Vayssier-Taussat, M., Moutailler, S., Michelet, L., Devillers, E., Bonnet, S., Cheval, J., Hebert, C., Eloit, M., 2013. Next generation sequencing uncovers unexpected bacterial pathogens in ticks in western Europe. PLoS One 8(11), e81439. Vilcins, I.E., Old, J.M., Deane, E., 2009. Molecular detection of Rickettsia, Coxiella and Rickettsiella DNA in three native Australian tick species. Exp. Appl. Acarol. 49(3), 229-242. von Loewenich, F.D., Geissdorfer, W., Disque, C., Matten, J., Schett, G., Sakka, S.G., Bogdan, C., 2010. Detection of "Candidatus Neoehrlichia mikurensis" in two patients with severe febrile illnesses: evidence for a European sequence variant. J. Clin. Microbiol. 48(7), 2630-2635. Warburton, N.W., Travouillon, K.J., 2016. The biology and palaeontology of the Peramelemorphia: a review of current knowledge and future research directions. Aust. J. Zool. 64(3), 151-181. Wayne, A.F., Maxwell, M.A., Ward, C.G., Vellios, C.V., Wilson, I.J., Dawson, K.E., 2012. Woylie Conservation and Research Project: Progress Report 2010 - 2013. Department of Parks and Wildlife, Perth, Western Australia. Weaver, H.J., Aberton, J.G., 2004. A survey of ectoparasite species on small mammals during autumn and winter at Anglesea, Victoria. P. Linn. Soc. N.S.W 125, 205-210. Webster, K.N., Hill, N.J., Burnett, L., Deane, E.M., 2014. Ectoparasite Infestation Patterns, Haematology and Serum Biochemistry of Urban-Dwelling Common Brushtail Possums. Wildlife Biol. 20, 206-216. Wenneras, C., 2015. Infections with the tick-borne bacterium Candidatus Neoehrlichia mikurensis. Clin. Microbiol. Infect. 21(7), 621-630. Westerman, M., Krajewski, C., 2000. Molecular relationships of the Australian bandicoot genera Isoodon and Perameles (Marsupialia: Peramelina). Aust. Mammal. 22, 1-8. Wickham, H., 2009. ggplot2: elegent graphics for data analysis. Spinger-Verlag, New York, USA. Wickham, H., 2017. tidyverse: easily install and load 'tidyverse' packages.R package. Wills, M., Barry, R., 1991. Detecting the cause of lyme disease in Australia. Med. J. Aust. 155(4), 257. Wodecka, B., Rymaszewska, A., Skotarczak, B., 2015. Host and pathogen DNA identification in blood meals of nymphal Ixodes ricinus ticks from forest parks and rural forests of Poland. Exp. Appl. Acarol. 62(4), 543-555.

96 Yabsley, M.J., Murphy, S.M., Luttrell, M.P., Wilcox, B.R., Howerth, E.W., Munderloh, U.G., 2008. Characterization of 'Candidatus Neoehrlichia lotoris' (family Anaplasmataceae) from raccoons (Procyon lotor). Int. J. Syst. Evol. Microbiol. 58(Pt 12), 2794-2798. Yang, B., Wang, Y., Qian, P.Y., 2016. Sensitivity and correlation of hypervariable regions in 16S rRNA genes in phylogenetic analysis. BMC Bioinformatics 17, 135. Zhang, X., Yang, Z., Lu, B., Ma, X., Zhang, C., Xu, H., 2014. The composition and transmission of microbiome in hard tick, Ixodes persulcatus, during blood meal. Tick Tick Borne Dis. 5(6), 864-870. Zhong, J., Jasinskas, A., Barbour, A.G., 2007. Antibiotic treatment of the tick vector Amblyomma americanum reduced reproductive fitness. PLoS One 2(5), e405. Zinsstag, J., Schelling, E., Waltner-Toews, D., Tanner, M., 2011. From "one medicine" to "one health" and systemic approaches to health and well-being. Prev. Vet. Med. 101(3-4), 148-156. Zolnik, C.P., Prill, R.J., Falco, R.C., Daniels, T.J., Kolokotronis, S.O., 2016. Microbiome changes through ontogeny of a tick pathogen vector. Mol. Ecol. 25(19), 4963-4977.

97 Appendix

Table A1.1. Ticks identified from Australian bandicoots in this study. Life stage; F = female, M= male, N = nymph and L = larvae; Comments; D = damaged, E = engorged/fed, P = pale, U = unfed.

PI Region State Host Sample ID Genus species Life stage No. Comments 319 Post Sorell TAS Bandicoot 319ITF Ixodes tasmani F 1 E 387 Boxhill NSW Bandicoot, long-nosed 387IHF Ixodes holocyclus F 1 P 1622 Albany WA Bandicoot, southern brown 1622IFF Ixodes fecialis F 1 E 1623 Albany WA Bandicoot, southern brown 1623IAF Ixodes australiensis F 1 E 1189 Boorie Creek NSW Bandicoot, long-nosed 1189IHF1 Ixodes holocyclus F 7 E 1189 Boorie Creek NSW Bandicoot, long-nosed 1189IHF2 Ixodes holocyclus F 3 E 1189 Boorie Creek NSW Bandicoot, long-nosed 1189IHF3 Ixodes holocyclus F 7 E, 2D 1189 Boorie Creek NSW Bandicoot, long-nosed 1189IHF4 Ixodes holocyclus F 1 E 1189 Boorie Creek NSW Bandicoot, long-nosed 1189IHM Ixodes holocyclus M 27 P 928 Beerwah QLD Bandicoot 928ITF Ixodes tasmani F 1 E 895 Beerwah QLD Bandicoot, northern brown 895HHF Haemaphysalis humerosa F 1 E 797 Palmerston NT Bandicoot, northern brown 797HHF Haemaphysalis humerosa F 2 E 797 Palmerston NT Bandicoot, northern brown 797HHM Haemaphysalis humerosa M 3 E 797 Palmerston NT Bandicoot, northern brown 797HHN Haemaphysalis humerosa N 1 E 906 Beerwah QLD Bandicoot, northern brown 906IHF Ixodes holocyclus F 2 E 906 Beerwah QLD Bandicoot, northern brown 906IHF Ixodes holocyclus F 1 E 936 Beerwah QLD Bandicoot, northern brown 936IHF Ixodes holocyclus F 1 E 936 Beerwah QLD Bandicoot, northern brown 936HHF Haemaphysalis humerosa F 1 P, D 1690 Bees creek NT Bandicoot, northern brown 1690HHF Haemaphysalis humerosa F 7 3P, 4U 1107 Sydney NSW Bandicoot, long-nosed 1107IHN Ixodes holocyclus N 1 E 1108 Sydney NSW Bandicoot, long-nosed 1108IHN Ixodes holocyclus N 2 E, 1D

98 1110 Sydney NSW Bandicoot, long-nosed 1110IHN Ixodes holocyclus N 1 E 1128 Sydney NSW Bandicoot, long-nosed 1128IHN Ixodes holocyclus N 1 E 1129 Sydney NSW Bandicoot, long-nosed 1129IHN Ixodes holocyclus N 1 E 1130 Sydney NSW Bandicoot, long-nosed 1130IHN Ixodes holocyclus N 2 E, 1D 1592 Castlecrag NSW Bandicoot, long-nosed 1592IHF Ixodes holocyclus F 2 P 1592 Castlecrag NSW Bandicoot, long-nosed 1592IHM Ixodes holocyclus M 1 P 1593 Castlecrag NSW Bandicoot, long-nosed 1593IHF Ixodes holocyclus F 1 D 1594 Castlecrag NSW Bandicoot, long-nosed 1594IHF Ixodes holocyclus F 1 E, D 1594 Castlecrag NSW Bandicoot, long-nosed 1594IHM Ixodes holocyclus M 1 1596 Castlecrag NSW Bandicoot, long-nosed 1596IHF Ixodes holocyclus F 3 E, D 1596 Castlecrag NSW Bandicoot, long-nosed 1596IHN Ixodes holocyclus N 1 1596 Castlecrag NSW Bandicoot, long-nosed 1596HBN Haemaphysalis bancrofti N 1 1131 Sydney NSW Bandicoot, long-nosed 1131IHN Ixodes holocyclus N 1 E 1132 Sydney NSW Bandicoot, long-nosed 1132ITN Ixodes tasmani N 1 1134 Sydney NSW Bandicoot, long-nosed 1134IHN Ixodes holocyclus N 2 E 1134 Sydney NSW Bandicoot, long-nosed 1134ITN Ixodes tasmani N 3 2P, 1E 1135 Sydney NSW Bandicoot, long-nosed 1135IHN Ixodes holocyclus N 1 E 1135 Sydney NSW Bandicoot, long-nosed 113ITN Ixodes tasmani N 1 Pale 1260 Beerwah QLD Bandicoot, long-nosed 1260IHN Ixodes holocyclus N 1 E 1260 Beerwah QLD Bandicoot, long-nosed 1260ITN Ixodes tasmani N 6 3E, 3Pale 1255 Beerwah QLD Bandicoot, long-nosed 1255ITN Ixodes tasmani N 5 2E, 3Pale 1255 Beerwah QLD Bandicoot, long-nosed 1255IHN Ixodes holocyclus N 4 3E, 1Pale 1255 Beerwah QLD Bandicoot, long-nosed 1255IHF Ixodes holocyclus F 1 E 1388 Stony Chute NSW Bandicoot, long-nosed 1388IHF Ixodes holocyclus F 11 E 1388 Stony Chute NSW Bandicoot, long-nosed 1388IHM Ixodes holocyclus M 3 1388 Stony Chute NSW Bandicoot, long-nosed 1388IHN Ixodes holocyclus N 1 E 1388 Stony Chute NSW Bandicoot, long-nosed 1388HHN Haemaphysalis humerosa N 1 E

99 1388 Stony Chute NSW Bandicoot, long-nosed 1388HBF Haemaphysalis bancrofti F 1 1388 Stony Chute NSW Bandicoot, long-nosed 1388HBN Haemaphysalis bancrofti N 1 1565 Manly NSW Bandicoot, long-nosed 1565IHN Ixodes holocyclus N 2 P, 1D 1566 Manly NSW Bandicoot, long-nosed 1566IHN Ixodes holocyclus N 1 E 1567 Manly NSW Bandicoot, long-nosed 1567IHN Ixodes holocyclus N 2 1E, 1D 1568 Manly NSW Bandicoot, long-nosed 1568IHN Ixodes holocyclus N 4 P, D 1569 Manly NSW Bandicoot, long-nosed 1569IHN Ixodes holocyclus N 7 4E, 3P & D 1570 Manly NSW Bandicoot, long-nosed 1570IHN Ixodes holocyclus N 5 4E, 1P 1571 Manly NSW Bandicoot, long-nosed 1571IHN Ixodes holocyclus N 2 D 1573 Manly NSW Bandicoot, long-nosed 1573IHN Ixodes holocyclus N 3 1E, 1D, 1 1P 1574 Manly NSW Bandicoot, long-nosed 1574IHN Ixodes holocyclus N 3 E, D 1578 Pearl Beach NSW Bandicoot, long-nosed 1578IHN Ixodes holocyclus N 1 E, D 886 Ridgeway TAS Bandicoot, eastern barred 886ITN Ixodes tasmani N 2 E 501 Beerwah QLD Bandicoot, northern brown 501IHN Ixodes holocyclus N 1 E, D 216 Seven Mile TAS Bandicoot, eastern barred 216ITN Ixodes tasmani N 9 E Beach 321 Devonport TAS Bandicoot, eastern barred 321ITF Ixodes tasmani F 19 321 Devonport TAS Bandicoot, eastern barred 321ITN Ixodes tasmani N 49 1225 Albany WA Bandicoot, southern brown 1225IFF Ixodes fecialis F 1 E 1690 Bees creek NT Bandicoot, northern brown 1690HHN Haemaphysalis humerosa N 2 E 493 Beerwah QLD Bandicoot 493HHM Haemaphysalis humerosa M 1 D 771 Murrah NSW Bandicoot, long-nosed 771IHN Ixodes holocyclus N 2 P 771 Murrah NSW Bandicoot, long-nosed 771HBN Haemaphysalis bancrofti N 1 E Q5109 Walcot WA Bandicoot, southern brown Q5109IAF Ixodes australiensis F 2 E Q5109 Walcot WA Bandicoot, southern brown Q5109IMN Ixodes myrmecobii N 4 E Q4932 Warrup WA Bandicoot, southern brown Q4932IUL Ixodes Unknown L 5 P Q5028 Warrup WA Bandicoot, southern brown Q5028IUL Ixodes Unknown L 4 P

100 Q6611 Perup WA Bandicoot, southern brown Q6611IUL Ixodes australiensis L 13 E Q6611 Perup WA Bandicoot, southern brown Q6611IAN Ixodes australiensis N 13 E

101

Figure A1.1. Rarefaction curve to describe species diversity (number of OTUs) relative to samples size (number of reads). Samples with <50 reads per OTU were removed. Species diversity modelled using the Shannon index based on Hurlbert (1971).

102

Table A1.2. Number of reads present in tick samples of candidate bacterial pathogens through 16S amplicon NGS. A sample was considered positive where number of reads exceeded 30.

Sample ID OTU 18 OTU 20 OTU 24 OTU 27 OTU 231 OTU 268 IH_F_LN_NSW_387_B1 0 0 0 0 0 0 IH_F_LN_NSW_1592_B2 0 0 0 0 0 0 IH_M_LN_NSW_1592_B4 0 0 0 0 0 0 IH_M_LN_NSW_1594_B5 0 0 0 0 0 0 IH_N_LN_NSW_1596_B6 0 107 0 0 0 0 IH_N_LN_NSW_1131_B7 0 1000 0 0 0 0 IT_N_LN_NSW_1132_B8 0 0 0 0 0 0 IH_N_LN_NSW_1134_B9 0 0 0 0 0 0 IT_N_LN_NSW_1134_B11 0 0 0 0 0 0 IT_N_LN_NSW_1134_B12 0 0 0 0 0 0 IH_N_LN_NSW_1135_B14 12476 14053 0 0 0 0 IT_N_LN_NSW_1135_B15 0 0 0 0 0 0 IT_F_B_TAS_319_B16 0 0 0 0 0 0 IF_F_SB_WA_1622_B17 0 0 30201 36135 0 0 IA_F_SB_WA_1623_B18 0 0 6613 9 0 0 IH_F_LN_NSW_1189_B19 0 0 0 0 0 0 IH_F_LN_NSW_1189_B20 0 0 0 0 0 0 IH_M_LN_NSW_1189_B30 0 0 0 0 0 0 IT_F_B_QLD_928_B43 0 0 9 0 42 0 HH_F_NB_QLD_895_B44 0 0 15 7 1329 0 HH_F_NB_NT_797_B45 0 0 6 0 0 0 HH_M_NB_NT_797_B47 0 0 0 0 0 0 IH_F_NB_QLD_906_B49 0 0 0 0 0 0 IH_F_NB_QLD_936_B51 0 0 0 0 0 0 HH_F_NB_NT_1690_B52 0 0 0 0 0 0 IH_N_LN_NSW_1107_B54 0 0 0 0 0 0 IH_N_LN_NSW_1110_B55 6 0 0 0 0 0 IH_N_LN_NSW_1128_B56 0 0 0 0 0 0 IH_N_LN_NSW_1129_B57 0 27 0 0 0 0 HB_N_LN_NSW_1596_B58 0 0 11 8 0 0 IH_N_LN_QLD_1260_B59 0 0 0 0 0 0 IT_N_LN_QLD_1260_B60 475 156 0 0 0 0 IT_N_LN_QLD_1260_B61 556 51 0 0 0 0 IT_N_LN_QLD_1255_B66 33969 1208 0 0 0 0 IT_N_LN_QLD_1255_B67 141 0 0 0 0 0 IH_N_LN_QLD_1255_B71 0 2025 0 0 0 0

103 IH_N_LN_QLD_1255_B72 0 14466 0 0 0 0 IH_F_LN_QLD_1255_B75 7 0 0 0 0 0 HH_N_LN_NSW_1388_B76 826 0 0 0 0 760 HB_F_LN_NSW_1388_B77 0 0 9 9 0 0 HB_N_LN_NSW_1388_B78 331 0 0 6 0 360 IH_N_LN_NSW_1570_B79 0 7000 0 0 0 0 IH_N_LN_NSW_1570_B80 0 0 0 0 0 0 IT_N_EB_TAS_886_B84 8 0 0 0 0 0 IT_F_EB_TAS_321_B86 5 0 0 0 0 0 IT_F_EB_TAS_321_B87 6 0 0 0 0 0 IT_N_EB_TAS_321_B95 0 0 0 0 0 0 IT_N_EB_TAS_321_B96 5 0 0 0 0 0 IF_F_SB_WA_1225_B105 0 0 2103 11 0 0 HH_N_NB_NT_1690_B106 0 0 0 0 0 0 IH_N_LN_NSW_771_B108 0 636 0 0 0 0 IH_N_LN_NSW_771_B109 0 0 0 0 0 0 HB_N_LN_NSW_771_B110 0 0 6 11 0 0 IA_F_SB_WA_5109_B111 0 0 73 5 0 0 IU_L_SB_WA_4932_B113 6 0 0 0 0 0 IU_L_SB_WA_5028_B114 11 0 0 0 0 0 IA_L_SB_WA_6611_B115 13 0 0 0 0 0 IA_N_SB_WA_6611_B116 0 0 748 14 0 0 IH_N_LN_NSW_1108_B117 0 9 0 0 0 0 IH_F_LN_NSW_1388_B119 0 0 0 0 0 0 IH_M_LN_NSW_1388_B124 2701 3109 0 0 0 0 IH_M_LN_NSW_1388_B125 23 47 0 0 0 0 IH_N_LN_NSW_1388_B127 0 0 0 0 0 0 IH_N_LN_NSW_1565_B128 0 0 0 0 0 0 IH_N_LN_NSW_1566_B129 0 39 0 0 0 0 IM_N_SB_WA_5109_B112a 0 0 0 0 0 0 IM_N_SB_WA_5109_B112b 0 0 0 0 0 0

104

0.4 Tick.species ● HB

● HH IA IF ● IH

F● IM 0.0 IT y L N M IU

● Instar ● F

● L

● M −0.4 ● N

−0.8

−0.4 0.0 0.4 x Figure A1.2. NMDS plot of samples modelled by life stage at the Family level. F = female, L = larvae, M = male, N = nymph. HB = H. bancrofti, HH = H. humerosa, IA = I. australiensis, IF = I. fecialis, IH = I. holocyclus, IT = I. tasmani, IU = Ixodes spp., IM = I. myrmecobii.

0.6

Host 0.3 ● B EB LN NB IF SB IU IM IH Tick.species 0.0 HH y ● HB ● HB ● HH

IA ● IA IT ● IF ● ● IH

● IM

−0.3 ● IT

● IU

−0.6 −0.6 −0.3 0.0 0.3 0.6 x Figure A1.3. NMDS plot of samples modelled by host species at the Family level. B = bandicoot, EB = eastern barred bandicoot, LN = long-nosed bandicoot, NB = northern brown bandicoot, SB = southern brown bandicoot. HB = H. bancrofti, HH = H. humerosa, IA = I. australiensis, IF = I. fecialis, IH = I. holocyclus, IT = I. tasmani, IU = Ixodes spp., IM = I. myrmecobii.

105 1.0 Individual ● 1134 1135 1189 1225 1255

0.5 1260 ● 1388

● 1570

● 1592 ● ● 1596

● 1690 ● ● 321 y 0.0 ● 5109 ● 6611

● 771

● 797

Tick.species

● ● HB −0.5 ● HH

● IA

● IF

● IH

● IM

● IT −1.0 −0.5 0.0 0.5 x

Figure A1.4. NMDS plot of samples where more than one tick from same host was available at the Family level. Numbers represent unique individuals. HB = H. bancrofti, HH = H. humerosa, IA = I. australiensis, IF = I. fecialis, IH = I. holocyclus, IT = I. tasmani, IU = Ixodes spp., IM = I. myrmecobii.

106 Anaplasma bovis (KY425447) OTU 268

‘Ca. Ehrlichia occidentalis’ (KY425450) Ehrlichia canis (NR_118741)

Ehrlichia muris (NR_121714)

OTU 27

‘Ca. Neoehrlichia mikurensis’ (AB084582)

OTU 24

‘Ca. Neoehrlichia australis’ (KT203915)

OTU 20

‘Ca. Neoehrlichia arcana’ (KT203916)

OTU 18

Rickettsia rickettsii (RIRRGDP)

Figure A1.5. Phylogenetic analysis of 310 bp 16S rRNA for Anaplasmataceae sequences generated from NGS. Sequences in bold represent the OTU’s from this study

107

Figure A1.6. An amplification plot obtained for the genus specific ‘Ca. Neoehrlichia’ assay for bandicoot tick samples. Amplification curves for the positive samples, extraction blank and negative (no-template) controls are labelled.

108

Figure A1.7. Gel electrophoresis (2% w/v) image of cox PCR products from neat tick samples. Top image: 3.5mM MgCl2, bottom image 3.0mM MgCl2. Lane 1 100 bp ladder; lanes 2-3 unknown larval samples; lane 4 known larval sample (I. australiensis), lanes 5-12 known Ixodida adult female ticks.

109 Table A1.3. Mapping file for illumina MiSeq sample loading of NGS. Index PCR coordinates included to assist in assessing contamination during library preparation. Midblocker concentration for (I. holocyclus and I. myrmecobii) included in mM.

Code Index1 Index2 Tick_ID DNA_ID Primers Index_PCR MIDBLOCK Coord CONC(mM) IH_F_B_NSW_387_B1 N701 S511 387IHF B1 Bact16S27F338R A01 10 IF_F_SB_WA_1225_B105 N711 S507 1225IFF B105 Bact16S27F338R D09 0 HH_N_NB_NT_1690_B106 N703 S506 1690HHN B106 Bact16S27F338R E03 0 IH_N_LN_NSW_771_B108 N705 S508 771IHN B108 Bact16S27F338R C05 1 IH_N_LN_NSW_771_B109 N706 S508 771IHN B109 Bact16S27F338R C06 1 IT_N_LN_NSW_1134_B11 N706 S506 1134ITN B11 Bact16S27F338R E06 0 HB_N_LN_NSW_771_B110 N707 S507 771HBN B110 Bact16S27F338R D07 0 IA_F_SB_WA_5109_B111 N702 S507 Q5109IAF B111 Bact16S27F338R D02 0 IM_N_SB_WA_5109_B112a N704 S506 Q5109IMN B112 Bact16S27F338R E04 0 IM_N_SB_WA_5109_B112b N714 S508 Q5109IMN B112 Bact16S27F338R C11 1 IU_L_SB_WA_4932_B113 N710 S505 Q4932IUL B113 Bact16S27F338R F08 0 IU_L_SB_WA_5028_B114 N711 S505 Q5028IUL B114 Bact16S27F338R F09 0 IA_L_SB_WA_6611_B115 N712 S505 Q6611IUL B115 Bact16S27F338R F10 0 IA_N_SB_WA_6611_B116 N703 S507 Q6611IAN B116 Bact16S27F338R D03 0 IH_N_LN_NSW_1108_B117 N707 S508 1108IHN B117 Bact16S27F338R C07 1 IH_F_LN_NSW_1388_B119 N710 S511 1388IHF B119 Bact16S27F338R A08 10 IT_N_LN_NSW_1134_B12 N707 S506 1134ITN B12 Bact16S27F338R E07 0 IH_M_LN_NSW_1388_B124 N702 S510 1388IHM B124 Bact16S27F338R B02 2 IH_M_LN_NSW_1388_B125 N703 S510 1388IHM B125 Bact16S27F338R B03 2 IH_N_LN_NSW_1388_B127 N710 S508 1388IHN B127 Bact16S27F338R C08 1 IH_N_LN_NSW_1565_B128 N711 S508 1565IHN B128 Bact16S27F338R C09 1 IH_N_LN_NSW_1566_B129 N712 S508 1566IHN B129 Bact16S27F338R C10 1 IH_N_LN_NSW_1135_B14 N707 S510 1135IHN B14 Bact16S27F338R B07 1 IT_N_LN_NSW_1135_B15 N710 S506 1135ITN B15 Bact16S27F338R E08 0 IT_F_B_TAS_319_B16 N711 S506 319ITF B16 Bact16S27F338R E09 0 IF_F_B_WA_1622_B17 N710 S507 1622IFF B17 Bact16S27F338R D08 0 IA_F_B_WA_1623_B18 N701 S507 1623IAF B18 Bact16S27F338R D01 0 IH_F_B_NSW_1189_B19 N703 S511 1189IHF B19 Bact16S27F338R A03 10 IH_F_LN_NSW_1592_B2 N702 S511 1592IHF B2 Bact16S27F338R A02 10

110 IH_F_B_NSW_1189_B20 N704 S511 1189IHF B20 Bact16S27F338R A04 10 IH_M_B_NSW_1189_B30 N701 S510 1189IHM B30 Bact16S27F338R B01 2 IH_M_LN_NSW_1592_B4 N712 S511 1592IHM B4 Bact16S27F338R A10 2 IT_F_B_QLD_928_B43 N712 S506 928ITF B43 Bact16S27F338R E10 0 HH_F_NB_QLD_895_B44 N712 S507 895HHF B44 Bact16S27F338R D10 0 HH_F_NB_NT_797_B45 N714 S507 797HHF B45 Bact16S27F338R D11 0 HH_M_NB_NT_797_B47 N715 S507 797HHM B47 Bact16S27F338R D12 0 IH_F_NB_QLD_906_B49 N705 S511 906IHF B49 Bact16S27F338R A05 10 IH_M_LN_NSW_1594_B5 N714 S511 1594IHM B5 Bact16S27F338R A11 2 IH_F_NB_QLD_936_B51 N706 S511 936IHF B51 Bact16S27F338R A06 10 HH_F_NB_NT_1690_B52 N701 S506 1690HHF B52 Bact16S27F338R E01 0 IH_N_LN_NSW_1107_B54 N710 S510 1107IHN B54 Bact16S27F338R B08 1 IH_N_LN_NSW_1110_B55 N711 S510 1110IHN B55 Bact16S27F338R B09 1 IH_N_LN_NSW_1128_B56 N712 S510 1128IHN B56 Bact16S27F338R B10 1 IH_N_LN_NSW_1129_B57 N714 S510 1129IHN B57 Bact16S27F338R B11 1 HB_N_LN_NSW_1596_B58 N704 S507 1596HBN B58 Bact16S27F338R D04 0 IH_N_LN_QLD_1260_B59 N715 S510 1260IHN B59 Bact16S27F338R B12 1 IH_N_LN_NSW_1596_B6 N704 S510 1596IHN B6 Bact16S27F338R B04 1 IT_N_LN_QLD_1260_B60 N714 S506 1260ITN B60 Bact16S27F338R E11 0 IT_N_LN_QLD_1260_B61 N715 S506 1260ITN B61 Bact16S27F338R E12 0 IT_N_LN_QLD_1255_B66 N701 S505 1255ITN B66 Bact16S27F338R F01 0 IT_N_LN_QLD_1255_B67 N702 S505 1255ITN B67 Bact16S27F338R F02 0 IH_N_LN_NSW_1131_B7 N705 S510 1131IHN B7 Bact16S27F338R B05 1 IH_N_LN_QLD_1255_B71 N701 S508 1255IHN B71 Bact16S27F338R C01 1 IH_N_LN_QLD_1255_B72 N702 S508 1255IHN B72 Bact16S27F338R C02 1 IH_F_LN_QLD_1255_B75 N707 S511 1255IHF B75 Bact16S27F338R A07 10 HH_N_LN_NSW_1388_B76 N702 S506 1388HHN B76 Bact16S27F338R E02 0 HB_F_LN_NSW_1388_B77 N705 S507 1388HBF B77 Bact16S27F338R D05 0 HB_N_LN_NSW_1388_B78 N706 S507 1388HBN B78 Bact16S27F338R D06 0 IH_N_LN_NSW_1570_B79 N703 S508 1570IHN B79 Bact16S27F338R C03 1 IT_N_LN_NSW_1132_B8 N705 S506 1132ITN B8 Bact16S27F338R E05 0 IH_N_LN_NSW_1570_B80 N704 S508 1570IHN B80 Bact16S27F338R C04 1 IT_N_EB_TAS_886_B84 N703 S505 886ITN B84 Bact16S27F338R F03 0

111 IT_F_EB_TAS_321_B86 N704 S505 321ITF B86 Bact16S27F338R F04 0 IT_F_EB_TAS_321_B87 N705 S505 321ITF B87 Bact16S27F338R F05 0 IH_N_LN_NSW_1134_B9 N706 S510 1134IHN B9 Bact16S27F338R B06 1 IT_N_EB_TAS_321_B95 N706 S505 321ITN B95 Bact16S27F338R F06 0 IT_N_EB_TAS_321_B96 N707 S505 321ITN B96 Bact16S27F338R F07 0 771BK1-BK1_S70_MG_QF N704 S502 771BK1 BK1 Bact16S27F338R H04 0 771BL1-BL1_S71_MG_QF N702 S502 771BL1 BL1 Bact16S27F338R H02 0 771BS1-BS1_S72_MG_QF N703 S502 771BS1 BS1 Bact16S27F338R H03 0

112 Table A1.4. Taxonomy table of OTUs generated in NGS.

OTU Taxonomy 1 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__Rickettsiella s__ 2 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__Rickettsiella s__ 3 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Midichloriaceae g__Ca. Midiclorhia s__ 4 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Rickettsiaceae g__Rickettsia s__ 5 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Midichloriaceae g__Ca. Midiclorhia s__ 6 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 7 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Francisellaceae g__Francisella s__ 8 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 9 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales 10 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Propionibacteriaceae g__Propionibacterium s__acnes 11 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__ s__ 12 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__ 13 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus 14 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Enterococcaceae g__Enterococcus s__ 15 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 16 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Francisellaceae g__Francisella s__ 17 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__celatum 18 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Anaplasmataceae g__Ca. Neoehrlichia s__australis 19 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__perfringens 20 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Anaplasmataceae g__Ca. Neoehrlichia 21 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__Rickettsiella s__ 22 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Lactococcus s__garvieae 23 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Lysinibacillus s__boronitolerans

113 24 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Anaplasmataceae g__Ca. Neoehrlichia 25 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Francisellaceae g__Francisella s__ 26 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Rickettsiaceae g__Wolbachia s__ 27 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Anaplasmataceae g__Ehrlichia s__ 28 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__sciuri 29 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__ s__ 30 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__Cloacibacterium s__ 31 k__Bacteria p__Proteobacteria c__Gammaproteobacteria 32 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Candidatus Aquiluna s__rubra 33 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas 34 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae 35 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Rickettsiaceae g__Rickettsia s__ 36 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__ 37 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 38 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 39 Unassigned 40 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Delftia s__ 41 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Lactococcus s__ 42 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 43 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae 44 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae g__Ralstonia s__ 45 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Bradyrhizobiaceae 46 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Alcaligenaceae 47 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 48 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Leucobacter s__ 49 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae g__Agrobacterium s__

114 50 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales 51 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Sphingobacterium s__faecium 52 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 53 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Actinomycetaceae g__N09 s__ 54 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__ s__ 55 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__Ethanoligenens s__ 56 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 57 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas s__yabuuchiae 58 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 59 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 60 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 61 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 62 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__ g__ s__ 63 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__C111 g__ s__ 64 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__ 65 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__ s__ 66 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__SMB53 s__ 67 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 68 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Leucobacter s__ 69 k__Bacteria p__TM7 c__TM7-3 o__ f__ g__ s__ 70 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Xanthomonadaceae g__Stenotrophomonas s__geniculata 71 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 72 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 73 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 74 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Planomicrobium s__ 75 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Rickettsiaceae g__Rickettsia s__

115 76 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Micrococcus s__luteus 77 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__ s__ 78 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 79 Unassigned 80 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Novosphingobium s__ 81 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__Segetibacter s__ 82 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 83 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Spirosoma s__ 84 Unassigned 85 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__ 86 k__Bacteria p__Firmicutes c__Bacilli o__Turicibacterales f__Turicibacteraceae g__Turicibacter s__ 87 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Sphingobacterium s__ 88 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 89 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Coprococcus s__ 90 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__ 91 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Enterococcaceae g__Enterococcus 92 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Propionibacteriaceae g__Propionibacterium s__granulosum 93 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Frankiaceae g__ s__ 94 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 95 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 96 Unassigned 97 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 98 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Kocuria s__palustris 99 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 100 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Olivibacter s__ 101 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae g__Janthinobacterium s__

116 102 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Rothia 103 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylocystaceae g__ s__ 104 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae 105 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Pedobacter s__cryoconitis 106 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 107 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae g__Agrobacterium s__ 108 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 109 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 110 Unassigned 111 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__Wautersiella s__ 112 k__Bacteria p__Cyanobacteria c__Synechococcophycideae o__Pseudanabaenales f__Pseudanabaenaceae g__Pseudanabaena s__ 113 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__ s__ 114 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Coprococcus s__ 115 k__Bacteria p__Cyanobacteria c__4C0d-2 o__MLE1-12 f__ g__ s__ 116 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__[Tissierellaceae] g__Anaerococcus s__ 117 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 118 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__ s__ 119 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 120 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 121 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae g__Agrobacterium s__ 122 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Leucobacter s__ 123 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 124 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 125 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas s__ 126 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 127 Unassigned

117 128 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Rhodospirillaceae g__ s__ 129 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Candidatus Aquiluna s__rubra 130 Unassigned 131 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__Microthrixaceae g__Candidatus Microthrix s__parvicella 132 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 133 Unassigned 134 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 135 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Paracoccus s__ 136 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae 137 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Microbacterium s__ 138 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__aureus 139 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Sporocytophaga s__ 140 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Geobacillus s__ 141 Unassigned 142 Unassigned 143 Unassigned 144 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Dermabacteraceae g__Dermabacter s__ 145 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Aerococcaceae g__Alloiococcus s__otitis 146 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 147 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae g__ s__ 148 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Saprospiraceae g__ s__ 149 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Lysinibacillus s__boronitolerans 150 k__Bacteria p__[Thermi] c__Deinococci o__Deinococcales f__Deinococcaceae g__Deinococcus s__ 151 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae g__Methylobacterium s__ 152 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 153 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__ s__

118 154 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Novosphingobium s__ 155 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Caulobacterales f__Caulobacteraceae g__ s__ 156 k__Bacteria p__Proteobacteria c__Alphaproteobacteria 157 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__ g__ s__ 158 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Intrasporangiaceae g__ s__ 159 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__ s__ 160 k__Bacteria p__Firmicutes c__Bacilli o__Turicibacterales f__Turicibacteraceae g__Turicibacter s__ 161 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Agrococcus s__jenensis 162 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 163 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 164 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 165 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae g__ s__ 166 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Arthrobacter s__ 167 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 168 k__Bacteria p__OP11 c__OP11-4 o__ f__ g__ s__ 169 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae g__Methylobacterium s__ 170 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 171 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__EB1017 g__ s__ 172 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Leuconostocaceae g__Weissella s__ghanensis 173 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae 174 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 175 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Leuconostocaceae g__Leuconostoc 176 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__Chryseobacterium s__ 177 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 178 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Pedobacter s__ 179 Unassigned

119 180 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__ s__ 181 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Aerococcaceae g__Aerococcus s__ 182 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Cryomorphaceae g__Fluviicola s__ 183 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Sporolactobacillaceae g__Tuberibacillus s__calidus 184 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 185 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 186 k__Bacteria p__Cyanobacteria c__ML635J-21 o__ f__ g__ s__ 187 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 188 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 189 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae 190 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Geodermatophilaceae g__Geodermatophilus s__ 191 k__Bacteria p__Planctomycetes c__vadinHA49 o__DH61 f__ g__ s__ 192 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Rhodospirillaceae g__Azospirillum s__ 193 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Rathayibacter s__caricis 194 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__Flavisolibacter s__ 195 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Pseudomonadaceae g__Pseudomonas s__ 196 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 197 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae 198 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 199 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 200 Unassigned 201 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 202 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Kineosporiaceae g__Kineococcus s__ 203 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Burkholderiaceae g__ s__ 204 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 205 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__

120 206 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 207 k__Bacteria p__Firmicutes c__Bacilli o__Turicibacterales f__Turicibacteraceae g__Turicibacter s__ 208 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__ s__ 209 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales 210 Unassigned 211 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micromonosporaceae 212 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus 213 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__ g__ s__ 214 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 215 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__ g__ s__ 216 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae 217 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 218 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Burkholderiaceae g__Burkholderia s__ 219 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Moraxellaceae g__Acinetobacter 220 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__ s__ 221 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__ s__ 222 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micromonosporaceae 223 k__Bacteria p__Firmicutes c__Bacilli o__Turicibacterales f__Turicibacteraceae g__Turicibacter s__ 224 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Pseudonocardiaceae g__Saccharopolyspora s__ 225 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Capnocytophaga s__ 226 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Thermoactinomycetaceae g__Planifilum s__ 227 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 228 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 229 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Agrococcus s__jenensis 230 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales 231 k__Bacteria p__Spirochaetes c__Spirochaetes o__[Borreliales] f__[Borreliaceae] g__Borrelia s__Ca. tachyglossi

121 232 Unassigned 233 Unassigned 234 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 235 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Rhodospirillaceae g__ s__ 236 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 237 k__Bacteria p__Gemmatimonadetes c__Gemm-3 o__ f__ g__ s__ 238 Unassigned 239 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Rickettsiaceae g__Rickettsia s__ 240 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Cellulomonadaceae g__Oerskovia 241 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Ellin329 f__ g__ s__ 242 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 243 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Cryomorphaceae g__Fluviicola s__ 244 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Sporichthyaceae g__Sporichthya s__ 245 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Propionibacteriaceae g__ s__ 246 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 247 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 248 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 249 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae g__ s__ 250 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 251 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 252 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Alcaligenaceae g__ s__ 253 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__ s__ 254 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__ g__ s__ 255 Unassigned 256 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__Wautersiella s__ 257 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Microbacterium s__chocolatum

122 258 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Leadbetterella s__ 259 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Pseudonocardiaceae g__Actinomycetospora s__ 260 k__Bacteria p__Bacteroidetes c__[Rhodothermi] o__[Rhodothermales] f__Rhodothermaceae g__Rubricoccus s__ 261 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__[Tissierellaceae] g__Peptoniphilus s__ 262 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 263 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Intrasporangiaceae g__Phycicoccus s__ 264 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Pseudomonadaceae g__Pseudomonas s__ 265 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Hymenobacter s__ 266 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 267 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 268 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Anaplasmataceae g__Anaplasma s__bovis 269 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 270 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Promicromonosporaceae g__Xylanimicrobium 271 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Spirosoma s__ 272 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Enterococcaceae g__Enterococcus s__ 273 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__ s__ 274 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Actinomycetaceae g__Actinomyces s__ 275 k__Bacteria p__Firmicutes c__Bacilli o__Gemellales f__Gemellaceae g__ s__ 276 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__ g__ s__ 277 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 278 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Geodermatophilaceae g__ s__ 279 Unassigned 280 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae 281 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 282 k__Bacteria p__Cyanobacteria c__Chloroplast o__Chlorophyta f__Trebouxiophyceae g__ s__ 283 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Hymenobacter s__

123 284 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__humi 285 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Friedmanniella s__ 286 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] 287 k__Bacteria p__Cyanobacteria c__4C0d-2 o__YS2 f__ g__ s__ 288 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 289 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 290 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Porphyromonadaceae g__ s__ 291 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__ 292 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__ s__ 293 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Erythrobacteraceae g__ s__ 294 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae 295 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 296 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Curtobacterium s__ 297 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Aerococcaceae g__ s__ 298 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 299 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Rhodospirillaceae g__Skermanella s__ 300 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__uniformis 301 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae g__Agrobacterium s__ 302 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae 303 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae 304 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Hymenobacter s__ 305 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales 306 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 307 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Xanthomonadaceae g__ s__ 308 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Novosphingobium 309 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Bartonellaceae g__ s__

124 310 k__Bacteria p__Cyanobacteria c__Chloroplast o__Chlorophyta f__ g__ s__ 311 k__Bacteria p__Chloroflexi c__Thermomicrobia o__JG30-KF-CM45 f__ g__ s__ 312 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 313 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Pontibacter s__ 314 Unassigned 315 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 316 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__ s__ 317 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 318 k__Bacteria p__TM7 c__TM7-3 o__EW055 f__ g__ s__ 319 k__Bacteria p__Gemmatimonadetes c__Gemmatimonadetes 320 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__ g__ s__ 321 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__ g__ s__ 322 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Dermabacteraceae g__Brachybacterium s__conglomeratum 323 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Anoxybacillus s__kestanbolensis 324 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Pseudonocardiaceae g__Pseudonocardia s__ 325 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Ellin329 f__ g__ s__ 326 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 327 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Pedobacter s__ 328 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Acetobacteraceae 329 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Pedobacter s__cryoconitis 330 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 331 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Rhodobacter s__ 332 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 333 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Microbacterium s__ 334 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__ s__ 335 Unassigned

125 336 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Microbacterium s__ 337 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 338 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Sphingobacterium s__faecium 339 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Burkholderiaceae g__Burkholderia s__ 340 Unassigned 341 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas s__ 342 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Emticicia s__ 343 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Brevibacteriaceae g__Brevibacterium s__ 344 k__Bacteria p__Chloroflexi c__Ellin6529 o__ f__ g__ s__ 345 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 346 Unassigned 347 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Rhodobacter s__ 348 k__Bacteria p__TM7 c__TM7-3 o__ f__ g__ s__ 349 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae g__ s__ 350 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Polaromonas s__ 351 Unassigned 352 k__Bacteria p__Acidobacteria c__Holophagae o__Holophagales f__Holophagaceae g__Geothrix s__ 353 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Dermacoccaceae g__Dermacoccus s__ 354 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Brevibacillus 355 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae g__ s__ 356 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 357 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 358 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae 359 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Oribacterium s__ 360 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Burkholderiaceae g__Burkholderia s__ 361 k__Bacteria p__Verrucomicrobia c__[Spartobacteria] o__[Chthoniobacterales] f__[Chthoniobacteraceae] g__DA101 s__

126 362 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__ s__ 363 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Alicyclobacillaceae g__ s__ 364 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 365 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Actinomycetaceae g__Actinomyces s__ 366 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Acidovorax 367 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Gaiellales f__Gaiellaceae g__ s__ 368 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 369 k__Bacteria p__Actinobacteria c__Coriobacteriia o__Coriobacteriales f__Coriobacteriaceae g__ s__ 370 Unassigned 371 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Friedmanniella s__ 372 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Moraxellaceae g__Acinetobacter s__ 373 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Coprococcus s__ 374 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__ g__ s__ 375 k__Bacteria p__Acidobacteria c__Solibacteres o__Solibacterales f__Solibacteraceae g__Candidatus Solibacter s__ 376 Unassigned 377 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae g__ s__ 378 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 379 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Cohnella s__ 380 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus 381 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Pseudomonadaceae g__Pseudomonas s__ 382 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae g__Rhizobium s__leguminosarum 383 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 384 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Bradyrhizobiaceae 385 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 386 k__Bacteria p__Bacteroidetes c__[Rhodothermi] o__[Rhodothermales] f__Rhodothermaceae g__Rubricoccus s__ 387 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Nocardioides s__

127 388 Unassigned 389 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 390 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Saprospiraceae g__ s__ 391 k__Bacteria p__Acidobacteria c__Acidobacteria-6 o__CCU21 f__ g__ s__ 392 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__macerans 393 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 394 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Rhodoplanes s__ 395 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 396 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Blautia s__ 397 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Moraxellaceae g__Acinetobacter s__lwoffii 398 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas 399 Unassigned 400 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Cohnella s__ 401 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 402 Unassigned 403 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae 404 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__0319-6G20 g__ s__ 405 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__ s__ 406 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 407 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 408 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Propionibacteriaceae g__Propionibacterium s__acnes 409 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Brevibacteriaceae g__Brevibacterium s__aureum 410 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Hymenobacter s__ 411 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 412 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae 413 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__ s__

128 414 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__Segetibacter s__ 415 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Peptococcaceae g__Pelotomaculum s__ 416 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingobium s__ 417 Unassigned 418 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 419 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Cohnella s__ 420 k__Bacteria p__[Thermi] c__Deinococci o__Deinococcales f__Deinococcaceae g__Deinococcus s__ 421 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Thermoactinomycetaceae g__ s__ 422 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 423 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Methylibium s__ 424 k__Bacteria p__Firmicutes c__Erysipelotrichi o__Erysipelotrichales f__Erysipelotrichaceae g__Coprobacillus s__ 425 k__Bacteria p__Chlorobi c__SJA-28 o__ f__ g__ s__ 426 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 427 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__ s__ 428 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Eubacteriaceae g__Anaerofustis s__ 429 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 430 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Rhodococcus s__ 431 Unassigned 432 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__ 433 Unassigned 434 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 435 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__flexus 436 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Blautia s__ 437 Unassigned 438 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Aeromicrobium s__ 439 k__Bacteria p__OP11 c__OP11-4 o__ f__ g__ s__

129 440 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__ s__ 441 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 442 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 443 Unassigned 444 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 445 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Geobacillus s__ 446 k__Bacteria p__Armatimonadetes c__Armatimonadia o__Armatimonadales f__Armatimonadaceae g__Armatimonas s__ 447 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__ 448 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__BD7-3 f__ g__ s__ 449 k__Bacteria p__TM7 c__TM7-3 o__ f__ g__ s__ 450 k__Bacteria p__Gemmatimonadetes c__Gemmatimonadetes o__Gemmatimonadales f__Gemmatimonadaceae g__Gemmatimonas s__ 451 Unassigned 452 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Sphingobacterium s__ 453 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylocystaceae g__ s__ 454 Unassigned 455 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 456 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 457 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 458 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Thermoactinomycetaceae g__ s__ 459 k__Bacteria p__Actinobacteria 460 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas s__ 461 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Acetobacteraceae g__ s__ 462 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylocystaceae g__Methylopila s__ 463 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Novosphingobium s__ 464 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__ 465 k__Bacteria p__TM7 c__SC3 o__ f__ g__ s__

130 466 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__BD7-3 f__ g__ s__ 467 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Rhodoplanes s__elegans 468 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Aerococcaceae g__ s__ 469 k__Bacteria p__Cyanobacteria c__Synechococcophycideae o__Pseudanabaenales f__Pseudanabaenaceae 470 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 471 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Anoxybacillus s__kestanbolensis 472 k__Bacteria p__Actinobacteria c__Coriobacteriia o__Coriobacteriales f__Coriobacteriaceae g__ s__ 473 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas s__wittichii 474 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Propionibacteriaceae 475 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Acetobacteraceae g__ s__ 476 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Rhodococcus 477 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 478 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 479 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae g__ s__ 480 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Lactococcus s__ 481 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__[Thermicanaceae] g__Thermicanus s__ 482 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptosporangiaceae g__ s__ 483 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__ s__ 484 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Methylophilales f__Methylophilaceae g__ s__ 485 k__Bacteria p__Chloroflexi c__Thermomicrobia o__JG30-KF-CM45 f__ g__ s__ 486 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhodobiaceae g__Afifella s__ 487 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 488 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Thermoactinomycetaceae g__ s__ 489 k__Bacteria p__Elusimicrobia c__Elusimicrobia o__FAC88 f__ g__ s__ 490 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae 491 k__Bacteria p__Chloroflexi c__Ellin6529 o__ f__ g__ s__

131 492 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 493 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 494 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Rhodobacter s__ 495 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Rhodoplanes s__ 496 Unassigned 497 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Propionicimonas s__ 498 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Saprospiraceae g__ s__ 499 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 500 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Christensenellaceae g__ s__ 501 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Cellulomonadaceae g__Actinotalea s__ 502 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__ f__ g__ s__ 503 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__ s__ 504 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Sinobacteraceae g__ s__ 505 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 506 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__ g__ s__ 507 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 508 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Pseudonocardiaceae g__Pseudonocardia s__ 509 k__Bacteria p__TM7 c__TM7-3 o__ f__ g__ s__ 510 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Symbiobacteriaceae g__Symbiobacterium s__ 511 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 512 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__EB1017 g__ s__ 513 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__Chryseobacterium s__ 514 Unassigned 515 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__0319-6G20 g__ s__ 516 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae g__ s__ 517 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Cellulomonadaceae g__Cellulomonas s__

132 518 Unassigned 519 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 520 Unassigned 521 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Blautia s__ 522 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 523 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Rhodococcus s__fascians 524 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae g__Hydrogenophilus s__ 525 k__Bacteria p__TM7 c__SC3 o__ f__ g__ s__ 526 k__Bacteria p__Actinobacteria c__Coriobacteriia o__Coriobacteriales f__Coriobacteriaceae g__Slackia s__ 527 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 528 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Conexibacteraceae g__ s__ 529 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 530 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 531 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Enterococcaceae 532 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__ s__ 533 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 534 Unassigned 535 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 536 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Moraxellaceae g__Enhydrobacter s__ 537 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Micrococcus 538 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Gaiellales f__ g__ s__ 539 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__ s__ 540 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 541 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 542 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Sphingobacterium s__multivorum 543 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales

133 544 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 545 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 546 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Caulobacterales f__Caulobacteraceae 547 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 548 Unassigned 549 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Caulobacterales f__Caulobacteraceae g__Brevundimonas s__diminuta 550 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Anoxybacillus 551 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Rhodoplanes s__ 552 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Sinobacteraceae g__ s__ 553 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Bradyrhizobiaceae 554 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus 555 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 556 Unassigned 557 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 558 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Moraxellaceae g__Acinetobacter s__ 559 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 560 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 561 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__ s__ 562 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 563 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Bdellovibrionales f__Bdellovibrionaceae g__Bdellovibrio s__ 564 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__[Paraprevotellaceae] g__[Prevotella] s__ 565 k__Bacteria p__Firmicutes c__Clostridia o__OPB54 f__ g__ s__ 566 k__Bacteria p__Gemmatimonadetes c__Gemmatimonadetes o__Gemmatimonadales f__A1-B1 g__ s__ 567 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Gaiellales f__Gaiellaceae g__ s__ 568 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 569 Unassigned

134 570 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Beijerinckiaceae 571 k__Bacteria p__Chloroflexi c__Ellin6529 o__ f__ g__ s__ 572 Unassigned 573 Unassigned 574 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 575 k__Bacteria p__Acidobacteria c__Sva0725 o__Sva0725 f__ g__ s__ 576 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Xanthomonadaceae g__Luteimonas s__ 577 Unassigned 578 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 579 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 580 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__ g__ s__ 581 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 582 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 583 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 584 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__ s__ 585 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae 586 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 587 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__ 588 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Thermoactinomycetaceae g__Planifilum s__ 589 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Sporosarcina s__ 590 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 591 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Gaiellales f__ g__ s__ 592 Unassigned 593 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__ s__ 594 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__ s__ 595 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__chondroitinus

135 596 Unassigned 597 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__ s__ 598 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Paracoccus 599 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Solirubrobacteraceae g__ s__ 600 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Bdellovibrionales f__Bacteriovoracaceae g__ s__ 601 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__thermoamylovorans 602 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Sporosarcina s__ 603 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Aeromonadales f__Aeromonadaceae 604 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__Rickettsiella s__ 605 Unassigned 606 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Proteiniclasticum s__ 607 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 608 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 609 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__ s__ 610 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 611 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__ f__ g__ s__ 612 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__ s__ 613 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 614 Unassigned 615 Unassigned 616 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Intrasporangiaceae g__ s__ 617 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__ f__ g__ s__ 618 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 619 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Legionellaceae g__Legionella s__ 620 Unassigned 621 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium

136 622 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Solirubrobacteraceae g__ s__ 623 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 624 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium 625 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae 626 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Solirubrobacteraceae g__ s__ 627 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Veillonellaceae 628 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 629 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ACK-M1 g__ s__ 630 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__ s__ 631 Unassigned 632 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 633 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Paracoccus s__ 634 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__kroppenstedtii 635 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Rhodococcus s__fascians 636 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 637 Unassigned 638 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Comamonas s__ 639 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Proteiniclasticum s__ 640 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Rhodococcus s__ 641 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Cellulomonadaceae g__Oerskovia 642 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 643 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 644 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Bdellovibrionales f__Bdellovibrionaceae g__Bdellovibrio s__ 645 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 646 Unassigned 647 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__

137 648 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 649 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 650 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 651 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Veillonellaceae g__Pelosinus s__ 652 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Prevotellaceae g__Prevotella s__ 653 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Porphyromonadaceae g__Porphyromonas s__ 654 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 655 k__Bacteria p__Gemmatimonadetes c__Gemm-5 o__ f__ g__ s__ 656 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 657 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Rhodocytophaga s__ 658 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 659 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae g__Agrobacterium s__ 660 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 661 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__mitochondria 662 k__Bacteria p__Gemmatimonadetes c__Gemmatimonadetes o__Ellin5290 f__ g__ s__ 663 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Hymenobacter s__ 664 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__ s__ 665 Unassigned 666 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales 667 Unassigned 668 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 669 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Acetobacteraceae g__ s__ 670 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales 671 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Veillonellaceae g__ s__ 672 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Rhodobacter s__ 673 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Xanthomonadaceae

138 674 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 675 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 676 k__Bacteria p__TM6 c__SBRH58 o__ f__ g__ s__ 677 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 678 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae 679 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Methylophilales f__Methylophilaceae g__ s__ 680 k__Bacteria p__Gemmatimonadetes c__Gemmatimonadetes o__Ellin5290 f__ g__ s__ 681 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__ s__ 682 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae 683 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__ s__ 684 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__celatum 685 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylocystaceae g__Methylopila s__ 686 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylocystaceae g__ s__ 687 k__Bacteria p__Acidobacteria c__[Chloracidobacteria] o__RB41 f__Ellin6075 g__ s__ 688 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 689 k__Bacteria p__Cyanobacteria c__Chloroplast o__Chlorophyta f__ g__ s__ 690 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 691 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 692 Unassigned 693 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__ s__ 694 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 695 Unassigned 696 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 697 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Pedomicrobium 698 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Paracoccus 699 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ACK-M1 g__ s__

139 700 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 701 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae g__Shinella s__ 702 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Moraxellaceae g__Acinetobacter s__ 703 k__Bacteria p__Acidobacteria c__Acidobacteriia o__Acidobacteriales f__Acidobacteriaceae g__ s__ 704 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Xanthomonadaceae g__ s__ 705 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 706 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__Chryseobacterium s__ 707 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Caulobacterales f__Caulobacteraceae g__ s__ 708 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__ s__ 709 k__Bacteria p__Elusimicrobia c__Elusimicrobia o__Elusimicrobiales f__ g__ s__ 710 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Rhodoplanes s__ 711 Unassigned 712 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Pseudomonadaceae g__Pseudomonas s__ 713 Unassigned 714 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Chromatiales f__Ectothiorhodospiraceae g__ s__ 715 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 716 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__ g__ s__ 717 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 718 Unassigned 719 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae g__ s__ 720 k__Bacteria p__Acidobacteria c__Solibacteres o__Solibacterales f__[Bryobacteraceae] g__ s__ 721 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas 722 Unassigned 723 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 724 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Microbacterium 725 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Conexibacteraceae g__ s__

140 726 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Procabacteriales f__Procabacteriaceae g__ s__ 727 Unassigned 728 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Friedmanniella s__ 729 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 730 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Leucobacter s__ 731 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 732 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 733 k__Bacteria p__Proteobacteria c__Alphaproteobacteria 734 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 735 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Sporolactobacillaceae g__Pullulanibacillus s__ 736 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 737 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 738 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 739 Unassigned 740 Unassigned 741 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 742 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 743 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Xanthomonadaceae 744 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Friedmanniella s__ 745 Unassigned 746 k__Bacteria p__Cyanobacteria c__Synechococcophycideae o__Synechococcales f__Synechococcaceae g__Synechococcus s__ 747 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Thermomonosporaceae 748 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Frankiaceae g__ s__ 749 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__Ruminococcus s__ 750 k__Bacteria p__Chloroflexi c__Gitt-GS-136 o__ f__ g__ s__ 751 k__Bacteria p__Proteobacteria c__Epsilonproteobacteria o__Campylobacterales f__Helicobacteraceae g__Sulfuricurvum s__kujiense

141 752 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__mitochondria 753 Unassigned 754 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Alicyclobacillaceae g__Alicyclobacillus s__ 755 Unassigned 756 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__ 757 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Oceanospirillales f__Halomonadaceae 758 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 759 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micromonosporaceae g__ s__ 760 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__ g__ s__ 761 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Frankiaceae g__ s__ 762 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Procabacteriales f__Procabacteriaceae g__ s__ 763 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae 764 k__Bacteria p__Chloroflexi c__Ktedonobacteria o__Thermogemmatisporales f__Thermogemmatisporaceae g__ s__ 765 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 766 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__Ethanoligenens s__ 767 Unassigned 768 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae 769 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__EB1017 g__ s__ 770 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 771 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Cytophaga s__ 772 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Thermoactinomycetaceae g__ s__ 773 k__Bacteria p__Acidobacteria c__Acidobacteria-6 o__iii1-15 f__ g__ s__ 774 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Gordoniaceae g__Gordonia s__ 775 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Intrasporangiaceae g__ s__ 776 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__ 777 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Kocuria s__

142 778 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Variovorax s__paradoxus 779 Unassigned 780 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__chondroitinus 781 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 782 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales 783 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Syntrophobacterales f__Syntrophobacteraceae g__ s__ 784 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__Microthrixaceae g__ s__ 785 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Propionicimonas s__ 786 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 787 Unassigned 788 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Hymenobacter s__ 789 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae g__ s__ 790 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 791 Unassigned 792 k__Bacteria p__Proteobacteria c__Gammaproteobacteria 793 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__EB1017 g__ s__ 794 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Patulibacteraceae g__Patulibacter s__ 795 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 796 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__Flavisolibacter s__ 797 Unassigned 798 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 799 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__SC-I-84 f__ g__ s__ 800 k__Bacteria p__Firmicutes c__Clostridia o__Halanaerobiales f__Halanaerobiaceae g__Halanaerobium s__ 801 k__Bacteria p__Acidobacteria c__Solibacteres o__Solibacterales f__ g__ s__ 802 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 803 k__Bacteria p__Cyanobacteria c__Oscillatoriophycideae o__Oscillatoriales f__Phormidiaceae g__Phormidium s__

143 804 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Aerococcaceae g__Alloiococcus s__ 805 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Promicromonosporaceae g__Promicromonospora s__ 806 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Brucellaceae g__Ochrobactrum 807 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium 808 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 809 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__ 810 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__ s__ 811 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__ g__ s__ 812 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Hyphomicrobium s__zavarzinii 813 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Friedmanniella s__ 814 k__Bacteria p__Acidobacteria c__Solibacteres o__Solibacterales f__ g__ s__ 815 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Thermoactinomycetaceae g__Planifilum s__ 816 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Comamonas s__ 817 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micromonosporaceae 818 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 819 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Thermomonosporaceae g__Actinomadura 820 k__Bacteria p__Actinobacteria c__Coriobacteriia o__Coriobacteriales f__Coriobacteriaceae g__ s__ 821 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 822 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 823 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Prevotellaceae g__Prevotella s__melaninogenica 824 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Coprococcus s__ 825 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 826 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 827 Unassigned 828 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Pseudonocardiaceae g__ s__ 829 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__

144 830 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Dyadobacter s__ 831 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas s__ 832 k__Bacteria p__Firmicutes c__Erysipelotrichi o__Erysipelotrichales f__Erysipelotrichaceae g__Allobaculum s__ 833 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Rikenellaceae g__ s__ 834 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 835 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__horti 836 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__vaccae 837 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Staphylococcus s__epidermidis 838 k__Bacteria p__GN02 c__GKS2-174 o__ f__ g__ s__ 839 Unassigned 840 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__ 841 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Rhizobiaceae 842 Unassigned 843 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Porphyromonadaceae g__Parabacteroides s__ 844 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 845 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 846 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 847 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Spirosoma s__ 848 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__ASSO-13 f__ g__ s__ 849 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Flectobacillus s__ 850 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__Sediminibacterium s__ 851 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Kocuria s__ 852 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 853 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Acetobacteraceae g__ s__ 854 k__Bacteria p__Acidobacteria c__Acidobacteria-6 o__iii1-15 f__ g__ s__ 855 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Brevibacillus s__reuszeri

145 856 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 857 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 858 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__S24-7 g__ s__ 859 Unassigned 860 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__ g__ s__ 861 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__ g__ s__ 862 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 863 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Jeotgalicoccus s__ 864 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__celatum 865 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Bradyrhizobiaceae 866 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Rhodobacter s__ 867 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Actinospicaceae g__ s__ 868 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 869 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Lysinibacillus s__boronitolerans 870 Unassigned 871 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Ureibacillus s__ 872 k__Bacteria p__Proteobacteria c__Alphaproteobacteria 873 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Nocardioides s__ 874 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 875 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae 876 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 877 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 878 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptosporangiaceae 879 k__Bacteria p__Actinobacteria c__MB-A2-108 o__0319-7L14 f__ g__ s__ 880 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 881 Unassigned

146 882 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micromonosporaceae g__ s__ 883 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 884 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Prevotellaceae g__Prevotella s__ 885 k__Bacteria p__Acidobacteria c__[Chloracidobacteria] o__RB41 f__Ellin6075 g__ s__ 886 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Intrasporangiaceae g__Janibacter s__ 887 k__Bacteria p__Chloroflexi c__Anaerolineae o__Caldilineales f__Caldilineaceae g__ s__ 888 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Actinomycetaceae g__Actinomyces s__ 889 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 890 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Ramlibacter s__ 891 Unassigned 892 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__ g__ s__ 893 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Yaniellaceae g__Yaniella s__ 894 Unassigned 895 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Spirobacillales f__ g__ s__ 896 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Rhodospirillaceae g__ s__ 897 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Arthrobacter s__ 898 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__EB1017 g__ s__ 899 k__Bacteria p__Tenericutes c__Mollicutes o__RF39 f__ g__ s__ 900 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 901 k__Bacteria p__Acidobacteria c__[Chloracidobacteria] o__11-24 f__ g__ s__ 902 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 903 k__Bacteria p__Cyanobacteria c__Chloroplast o__Streptophyta f__ g__ s__ 904 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 905 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae g__ s__ 906 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Kocuria s__ 907 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__Tepidimonas s__

147 908 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 909 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Rikenellaceae g__ s__ 910 Unassigned 911 k__Bacteria p__Acidobacteria c__[Chloracidobacteria] o__RB41 f__ g__ s__ 912 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingobium s__ 913 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 914 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae g__Herbaspirillum s__ 915 k__Bacteria p__Chloroflexi c__Ellin6529 o__ f__ g__ s__ 916 k__Bacteria p__Acidobacteria c__Acidobacteria-5 o__ f__ g__ s__ 917 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__ f__ g__ s__ 918 k__Bacteria p__Tenericutes c__Mollicutes o__ f__ g__ s__ 919 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Coprococcus s__ 920 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 921 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__ s__ 922 k__Bacteria p__OD1 c__ABY1 o__ f__ g__ s__ 923 k__Bacteria p__Firmicutes c__Erysipelotrichi o__Erysipelotrichales f__Erysipelotrichaceae g__Catenibacterium s__ 924 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__ g__ s__ 925 Unassigned 926 Unassigned 927 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 928 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__ g__ s__ 929 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Alicyclobacillaceae g__ s__ 930 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus 931 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 932 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Pseudonocardiaceae g__Pseudonocardia s__ 933 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Alteromonadales f__OM60 g__ s__

148 934 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__Rickettsiella s__ 935 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__Rickettsiella s__ 936 Unassigned 937 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium 938 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__Microbacterium s__ 939 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 940 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Pedobacter s__ 941 Unassigned 942 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__EB1017 g__ s__ 943 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 944 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 945 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__Segetibacter s__ 946 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Burkholderiaceae g__Burkholderia 947 k__Bacteria p__NC10 c__12-24 o__JH-WHS47 f__ g__ s__ 948 Unassigned 949 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 950 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Cohnella s__ 951 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 952 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__ 953 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__ 954 Unassigned 955 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 956 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micromonosporaceae g__ s__ 957 k__Bacteria p__Chloroflexi c__Gitt-GS-136 o__ f__ g__ s__ 958 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 959 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__

149 960 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Anoxybacillus s__kestanbolensis 961 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nakamurellaceae g__ s__ 962 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 963 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Lactobacillaceae g__Lactobacillus 964 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 965 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Xanthomonadales f__Xanthomonadaceae g__Luteibacter s__rhizovicinus 966 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nakamurellaceae g__ s__ 967 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Nitrosomonadales f__Nitrosomonadaceae g__ s__ 968 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 969 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 970 Unassigned 971 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Cohnella s__ 972 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__MIZ46 f__ g__ s__ 973 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Alicyclobacillaceae g__Alicyclobacillus s__acidocaldarius 974 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Leadbetterella s__ 975 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__ 976 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Pseudonocardiaceae g__Amycolatopsis s__ 977 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 978 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 979 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 980 k__Bacteria p__Acidobacteria c__Acidobacteriia o__Acidobacteriales f__Koribacteraceae g__ s__ 981 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Veillonellaceae g__Veillonella s__dispar 982 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Coprococcus s__ 983 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 984 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 985 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__

150 986 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Microbacteriaceae g__ s__ 987 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Leadbetterella s__ 988 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__ s__ 989 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae 990 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas 991 Unassigned 992 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 993 Unassigned 994 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Staphylococcaceae g__Jeotgalicoccus s__psychrophilus 995 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae g__Hydrogenophilus s__ 996 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Clostridiaceae g__Clostridium s__bowmanii 997 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__ s__ 998 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__ s__ 999 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__ g__ s__ 1000 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 1001 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__ g__ s__ 1002 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Oceanospirillales 1003 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 1004 Unassigned 1005 k__Bacteria p__Actinobacteria c__Coriobacteriia o__Coriobacteriales f__Coriobacteriaceae g__Collinsella s__stercoris 1006 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 1007 Unassigned 1008 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae g__Buchnera s__ 1009 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__ 1010 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Arthrobacter s__ 1011 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Phyllobacteriaceae

151 1012 k__Bacteria p__Actinobacteria c__Coriobacteriia o__Coriobacteriales f__Coriobacteriaceae g__ s__ 1013 Unassigned 1014 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Pedomicrobium s__ 1015 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 1016 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Hyphomicrobium s__ 1017 k__Bacteria p__Cyanobacteria c__Oscillatoriophycideae o__Chroococcales f__Xenococcaceae g__ s__ 1018 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__ s__ 1019 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 1020 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 1021 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__ s__ 1022 k__Bacteria p__Actinobacteria c__Rubrobacteria o__Rubrobacterales f__Rubrobacteraceae g__Rubrobacter s__ 1023 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pasteurellales f__Pasteurellaceae g__Pasteurella s__multocida 1024 k__Bacteria p__Cyanobacteria c__Synechococcophycideae o__Pseudanabaenales f__Pseudanabaenaceae g__Pseudanabaena s__ 1025 k__Bacteria p__Planctomycetes c__Planctomycetia o__Gemmatales f__Gemmataceae g__ s__ 1026 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 1027 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__ s__ 1028 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__S24-7 g__ s__ 1029 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 1030 Unassigned 1031 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__ g__ s__ 1032 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Flammeovirgaceae g__Reichenbachiella s__ 1033 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Gaiellales f__Gaiellaceae g__ s__ 1034 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Dorea 1035 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__horti 1036 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae 1037 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae g__Zoogloea s__

152 1038 Unassigned 1039 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Methylophilales f__Methylophilaceae g__ s__ 1040 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__ g__ s__ 1041 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae 1042 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 1043 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 1044 Unassigned 1045 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 1046 Unassigned 1047 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] g__ s__ 1048 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylobacteriaceae 1049 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Oceanospirillales f__Halomonadaceae g__Candidatus Portiera s__ 1050 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Geodermatophilaceae 1051 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__ s__ 1052 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 1053 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Thermomonosporaceae g__Actinomadura s__vinacea 1054 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__ g__ s__ 1055 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae 1056 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__ g__ s__ 1057 k__Bacteria p__Planctomycetes c__OM190 o__agg27 f__ g__ s__ 1058 Unassigned 1059 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 1060 Unassigned 1061 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Frankiaceae g__ s__ 1062 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Comamonadaceae g__ s__ 1063 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Streptococcaceae g__Streptococcus s__

153 1064 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__Hymenobacter s__ 1065 k__Bacteria p__Proteobacteria c__Alphaproteobacteria 1066 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__[Tissierellaceae] g__Helcococcus s__ 1067 Unassigned 1068 k__Bacteria p__Chloroflexi c__Thermomicrobia o__JG30-KF-CM45 f__ g__ s__ 1069 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__C111 g__ s__ 1070 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__ g__ s__ 1071 k__Bacteria p__WS3 c__PRR-12 o__Sediment-1 f__ g__ s__ 1072 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Dermabacteraceae g__Brachybacterium s__ 1073 k__Bacteria p__TM6 c__SJA-4 o__S1198 f__ g__ s__ 1074 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Thiotrichales f__Piscirickettsiaceae g__ s__ 1075 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 1076 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 1077 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Xanthobacteraceae 1078 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__ s__ 1079 Unassigned 1080 k__Bacteria p__TM6 c__SJA-4 o__ f__ g__ s__ 1081 Unassigned 1082 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__ s__ 1083 k__Bacteria p__Cyanobacteria c__Chloroplast o__Chlorophyta f__Chlamydomonadaceae 1084 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__ s__ 1085 Unassigned 1086 k__Bacteria p__Chloroflexi c__Ktedonobacteria o__TK10 f__ g__ s__ 1087 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 1088 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 1089 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__

154 1090 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 1091 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 1092 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Bradyrhizobiaceae g__ s__ 1093 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Methylophilales f__ g__ s__ 1094 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Rhodospirillaceae g__ s__ 1095 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Methylophilales f__Methylophilaceae g__ s__ 1096 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Methylocystaceae g__ s__ 1097 k__Bacteria p__Cyanobacteria c__Oscillatoriophycideae o__Chroococcales f__Xenococcaceae g__ s__ 1098 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 1099 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodospirillales f__Rhodospirillaceae g__ s__ 1100 k__Bacteria p__OD1 c__ZB2 o__ f__ g__ s__ 1101 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Carnobacteriaceae g__Granulicatella s__ 1102 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 1103 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Rhodocyclales f__Rhodocyclaceae g__ s__ 1104 Unassigned 1105 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__Rickettsiella s__ 1106 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 1107 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__ f__ g__ s__ 1108 k__Bacteria p__Planctomycetes c__Planctomycetia o__Gemmatales f__Isosphaeraceae g__ s__ 1109 k__Bacteria p__TM6 c__SJA-4 o__S1198 f__ g__ s__ 1110 k__Bacteria p__Acidobacteria c__Acidobacteria-5 o__ f__ g__ s__ 1111 Unassigned 1112 k__Bacteria p__Verrucomicrobia c__Verrucomicrobiae o__Verrucomicrobiales f__Verrucomicrobiaceae g__Luteolibacter s__ 1113 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__Sporosarcina s__ 1114 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 1115 k__Bacteria p__Cyanobacteria c__Chloroplast o__ f__ g__ s__

155 1116 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae g__ s__ 1117 k__Bacteria p__Bacteroidetes c__[Saprospirae] o__[Saprospirales] f__Chitinophagaceae g__ s__ 1118 k__Bacteria p__TM7 c__TM7-1 o__ f__ g__ s__ 1119 k__Bacteria p__Proteobacteria c__Deltaproteobacteria 1120 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__Pedobacter s__ 1121 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 1122 k__Bacteria p__Acidobacteria c__[Chloracidobacteria] o__RB41 f__Ellin6075 g__ s__ 1123 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__ s__ 1124 k__Bacteria p__OP11 c__OP11-3 o__ f__ g__ s__ 1125 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__ g__ s__ 1126 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Propionibacteriaceae g__Microlunatus s__ 1127 Unassigned 1128 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Pseudomonadales f__Moraxellaceae g__Acinetobacter s__guillouiae 1129 Unassigned 1130 Unassigned 1131 Unassigned 1132 k__Bacteria p__Firmicutes c__Bacilli o__Lactobacillales f__Lactobacillaceae g__Lactobacillus s__ 1133 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Nesterenkonia s__ 1134 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Ruminococcaceae g__Oscillospira s__ 1135 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales 1136 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Propionicimonas s__ 1137 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae g__Streptomyces s__ 1138 k__Bacteria p__TM6 c__SJA-4 o__ f__ g__ s__ 1139 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__MIZ46 f__ g__ s__ 1140 k__Bacteria p__Actinobacteria c__Acidimicrobiia o__Acidimicrobiales f__C111 g__ s__ 1141 k__Bacteria p__OP11 c__OP11-4 o__ f__ g__ s__

156 1142 Unassigned 1143 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae g__Bacillus s__ 1144 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Veillonellaceae 1145 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Alicyclobacillaceae g__Alicyclobacillus s__ 1146 k__Bacteria p__GN02 c__GKS2-174 o__ f__ g__ s__ 1147 k__Bacteria p__Firmicutes c__Clostridia o__Clostridiales f__Lachnospiraceae g__Blautia s__ 1148 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__ g__ s__ 1149 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Paenibacillaceae g__Paenibacillus s__ 1150 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Patulibacteraceae g__ s__ 1151 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 1152 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhizobiales f__Hyphomicrobiaceae g__Devosia s__ 1153 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__MIZ46 f__ g__ s__ 1154 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Micrococcaceae g__Micrococcus s__luteus 1155 k__Bacteria p__Firmicutes c__Erysipelotrichi o__Erysipelotrichales f__Erysipelotrichaceae g__ s__ 1156 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Nocardia s__ 1157 k__Bacteria p__Chloroflexi c__Ellin6529 o__ f__ g__ s__ 1158 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Bacillaceae 1159 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__[Weeksellaceae] 1160 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae 1161 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__0319-6G20 g__ s__ 1162 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__OM27 g__ s__ 1163 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardiaceae g__Rhodococcus s__fascians 1164 Unassigned 1165 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rickettsiales f__Rickettsiaceae g__ s__ 1166 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Streptomycetaceae 1167 Unassigned

157 1168 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__ g__ s__ 1169 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__Myxococcales f__Myxococcaceae g__ s__ 1170 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__MIZ46 f__ g__ s__ 1171 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__ f__ g__ s__ 1172 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Alcaligenaceae g__ s__ 1173 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Sphingomonadales f__Sphingomonadaceae g__Sphingomonas s__wittichii 1174 k__Bacteria p__OD1 c__ o__ f__ g__ s__ 1175 k__Bacteria p__[Thermi] c__Deinococci o__Deinococcales f__Deinococcaceae g__Deinococcus s__ 1176 k__Bacteria p__Spirochaetes c__Spirochaetes o__Spirochaetales f__Spirochaetaceae g__Spirochaeta s__aurantia 1177 k__Bacteria p__Bacteroidetes c__Sphingobacteriia o__Sphingobacteriales f__Sphingobacteriaceae g__ s__ 1178 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Nocardioidaceae g__Propionicimonas s__ 1179 k__Bacteria p__Bacteroidetes c__Cytophagia o__Cytophagales f__Cytophagaceae g__ s__ 1180 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Enterobacteriales f__Enterobacteriaceae g__ s__ 1181 k__Bacteria p__Proteobacteria c__Deltaproteobacteria o__FAC87 f__ g__ s__ 1182 k__Bacteria p__Gemmatimonadetes c__Gemmatimonadetes o__Ellin5290 f__ g__ s__ 1183 k__Bacteria p__Acidobacteria c__DA052 o__Ellin6513 f__ g__ s__ 1184 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Burkholderiales f__Oxalobacteraceae 1185 k__Bacteria p__OD1 c__SM2F11 o__ f__ g__ s__ 1186 k__Bacteria p__Actinobacteria c__Thermoleophilia o__Solirubrobacterales f__Conexibacteraceae g__Conexibacter s__ 1187 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium s__ 1188 k__Bacteria p__Cyanobacteria c__Chloroplast o__CAB-I f__ g__ s__ 1189 k__Bacteria p__TM6 c__SJA-4 o__S1198 f__ g__ s__ 1190 Unassigned 1191 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Corynebacteriaceae g__Corynebacterium 1192 k__Bacteria p__Proteobacteria c__Gammaproteobacteria o__Legionellales f__Coxiellaceae g__ s__ 1193 k__Bacteria p__Cyanobacteria c__Chloroplast o__Chlorophyta f__Chlamydomonadaceae

158 1194 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__celatum 1195 Unassigned 1196 k__Bacteria p__Proteobacteria c__Alphaproteobacteria o__Rhodobacterales f__Rhodobacteraceae g__Rhodobacter s__ 1197 k__Bacteria p__Chloroflexi c__Anaerolineae o__Caldilineales f__Caldilineaceae g__Caldilinea s__ 1198 k__Bacteria p__Firmicutes c__Bacilli o__Bacillales f__Planococcaceae g__ s__ 1199 k__Bacteria p__Bacteroidetes c__Bacteroidia o__Bacteroidales f__Bacteroidaceae g__Bacteroides s__ 1200 k__Bacteria p__Cyanobacteria c__Chloroplast o__Chlorophyta f__Chlamydomonadaceae g__ s__ 1201 Unassigned 1202 k__Bacteria p__Proteobacteria c__Betaproteobacteria o__Neisseriales f__Neisseriaceae g__ s__ 1203 k__Bacteria p__Bacteroidetes c__Flavobacteriia o__Flavobacteriales f__Flavobacteriaceae g__Flavobacterium s__ 1204 k__Bacteria p__Cyanobacteria c__Chloroplast o__Stramenopiles f__ g__ s__ 1205 k__Bacteria p__Actinobacteria c__Actinobacteria o__Actinomycetales f__Mycobacteriaceae g__Mycobacterium s__ 1206 Unassigned

159