DOCSLIB.ORG

Mouse Pdlim1 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Pdlim1 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Pdlim1 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Pdlim1 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Pdlim1 gene (NCBI Reference Sequence: NM_016861 ; Ensembl: ENSMUSG00000055044 ) is located on Mouse chromosome 19. 7 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 7 (Transcript: ENSMUST00000068439). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Pdlim1 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP24-352A5 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a gene trap allele exhibit enhanced platelet response to GPVI agonists and thrombosis. Exon 2 starts from about 9.89% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 19284 bp, and the size of intron 2 for 3'-loxP site insertion: 2206 bp. The size of effective cKO region: ~652 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 3 7 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Pdlim1 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7152bp) | A(27.39% 1959) | C(22.04% 1576) | T(28.22% 2018) | G(22.36% 1599) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 7 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr19 - 40252312 40255311 3000 browser details YourSeq 210 2642 2991 3000 89.5% chr12 - 70005272 70005621 350 browser details YourSeq 209 2640 2982 3000 88.2% chr11 - 54078387 54078749 363 browser details YourSeq 209 2641 2976 3000 90.8% chr1 + 91140449 91140803 355 browser details YourSeq 207 2640 2991 3000 91.9% chr1 + 118696724 118697085 362 browser details YourSeq 204 2642 2992 3000 89.4% chr8 - 85707118 85707484 367 browser details YourSeq 203 2642 3000 3000 85.9% chr1 - 183237369 183237696 328 browser details YourSeq 200 2642 3000 3000 89.5% chr4 + 46217186 46217550 365 browser details YourSeq 200 2646 2965 3000 85.3% chr17 + 43927872 43928180 309 browser details YourSeq 199 2642 2972 3000 85.8% chr13 + 91267135 91267406 272 browser details YourSeq 199 2642 2995 3000 85.8% chr11 + 104862662 104863011 350 browser details YourSeq 197 2652 3000 3000 87.4% chr16 + 37803679 37804024 346 browser details YourSeq 197 2220 2992 3000 82.0% chr1 + 63521947 63522675 729 browser details YourSeq 196 2641 3000 3000 86.9% chr9 - 77861022 77861365 344 browser details YourSeq 196 2642 2986 3000 87.2% chr5 - 99216770 99217173 404 browser details YourSeq 195 2683 2983 3000 86.7% chr7 + 79061802 79062070 269 browser details YourSeq 195 2684 3000 3000 87.1% chr10 + 83762906 83763184 279 browser details YourSeq 194 2644 3000 3000 86.5% chr2 + 22247330 22247689 360 browser details YourSeq 194 2650 2990 3000 90.2% chr18 + 74055498 74055916 419 browser details YourSeq 194 2642 2985 3000 83.3% chr11 + 50169468 50169768 301 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr19 - 40248660 40251659 3000 browser details YourSeq 199 898 1199 3000 88.4% chr7 + 43629613 43629928 316 browser details YourSeq 185 911 1210 3000 86.7% chr16 - 4734222 4734542 321 browser details YourSeq 162 916 1216 3000 86.3% chr5 - 132824722 132825039 318 browser details YourSeq 153 898 1211 3000 81.2% chr12 - 106562317 106562627 311 browser details YourSeq 149 811 1211 3000 78.1% chr3 + 65167146 65167488 343 browser details YourSeq 149 932 1191 3000 89.6% chr16 + 24082330 24082611 282 browser details YourSeq 147 937 1191 3000 89.8% chr8 - 86612121 86612394 274 browser details YourSeq 145 909 1210 3000 90.1% chr19 + 25042486 25042793 308 browser details YourSeq 144 908 1211 3000 88.4% chr7 - 143530206 143530514 309 browser details YourSeq 141 882 1184 3000 88.5% chr4 + 154874446 154874765 320 browser details YourSeq 140 910 1202 3000 85.2% chr2 + 10988803 10989118 316 browser details YourSeq 137 911 1186 3000 90.3% chr6 - 51776102 51776403 302 browser details YourSeq 135 933 1162 3000 87.4% chr11 - 58133509 58133747 239 browser details YourSeq 135 875 1201 3000 84.7% chr11 - 24916522 24916866 345 browser details YourSeq 135 908 1210 3000 88.8% chr10 - 3327772 3328094 323 browser details YourSeq 133 880 1201 3000 85.5% chr13 + 96759640 96759975 336 browser details YourSeq 132 811 1162 3000 77.3% chr4 - 109195536 109195801 266 browser details YourSeq 132 909 1164 3000 85.6% chr12 - 25089229 25089479 251 browser details YourSeq 132 937 1203 3000 88.6% chr5 + 67074594 67074871 278 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 7 https://www.alphaknockout.com Gene and protein information: Pdlim1 PDZ and LIM domain 1 (elfin) [ Mus musculus (house mouse) ] Gene ID: 54132, updated on 10-Oct-2019 Gene summary Official Symbol Pdlim1 provided by MGI Official Full Name PDZ and LIM domain 1 (elfin) provided by MGI Primary source MGI:MGI:1860611 See related Ensembl:ENSMUSG00000055044 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as CLP36; Clim1; mClim1 Expression Broad expression in large intestine adult (RPKM 123.7), placenta adult (RPKM 92.4) and 19 other tissues See more Orthologs human all Genomic context Location: 19; 19 C3 See Pdlim1 in Genome Data Viewer Exon count: 7 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 19 NC_000085.6 (40222239..40271616, complement) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 19 NC_000085.5 (40296729..40346106, complement) Chromosome 19 - NC_000085.6 Page 5 of 7 https://www.alphaknockout.com Transcript information: This gene has 5 transcripts Gene: Pdlim1 ENSMUSG00000055044 Description PDZ and LIM domain 1 (elfin) [Source:MGI Symbol;Acc:MGI:1860611] Gene Synonyms CLP36, mClim1 Location Chromosome 19: 40,221,173-40,271,842 reverse strand. GRCm38:CM001012.2 About this gene This gene has 5 transcripts (splice variants), 219 orthologues, 8 paralogues, is a member of 1 Ensembl protein family and is associated with 9 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Pdlim1-201 ENSMUST00000068439.12 2571 327aa ENSMUSP00000064545.5 Protein coding CCDS37977 O70400 TSL:1 GENCODE basic APPRIS P1 Pdlim1-202 ENSMUST00000182432.1 692 198aa ENSMUSP00000138383.1 Protein coding - S4R1V0 CDS 3' incomplete TSL:3 Pdlim1-204 ENSMUST00000182636.1 2835 No protein - Retained intron - - TSL:1 Pdlim1-203 ENSMUST00000182540.1 715 No protein - Retained intron - - TSL:2 Pdlim1-205 ENSMUST00000182813.1 666 No protein - Retained intron - - TSL:2 70.67 kb Forward strand Genes Gm16470-201 >processed pseudogene (Comprehensive set... Contigs AC170187.2 > Genes (Comprehensive set... < Pdlim1-201protein coding < Pdlim1-203retained intron < Pdlim1-204retained intron < Pdlim1-205retained intron < Pdlim1-202protein coding Regulatory Build Reverse strand 70.67 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding pseudogene processed transcript Page 6 of 7 https://www.alphaknockout.com Transcript: ENSMUST00000068439 < Pdlim1-201protein coding Reverse strand 50.44 kb ENSMUSP00000064... Superfamily PDZ superfamily SSF57716 SMART PDZ domain Zasp-like motif Zinc finger, LIM-type Pfam PDZ domain Domain of unknown function DUF4749 Zinc finger, LIM-type PROSITE profiles PDZ domain Zinc finger, LIM-type PROSITE patterns Zinc finger, LIM-type PANTHER PTHR24214 PDZ and LIM domain protein 1 Gene3D 2.30.42.10 2.10.110.10 CDD cd00992 cd09448 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 40 80 120 160 200 240 280 327 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 7 of 7.
Load more

Recommended publications
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Figure S1. Reverse Transcription‑Quantitative PCR Analysis of ETV5 Mrna Expression Levels in Parental and ETV5 Stable Transfectants
    Figure S1. Reverse transcription‑quantitative PCR analysis of ETV5 mRNA expression levels in parental and ETV5 stable transfectants. (A) Hec1a and Hec1a‑ETV5 EC cell lines; (B) Ishikawa and Ishikawa‑ETV5 EC cell lines. **P<0.005, unpaired Student's t‑test. EC, endometrial cancer; ETV5, ETS variant transcription factor 5. Figure S2. Survival analysis of sample clusters 1‑4. Kaplan Meier graphs for (A) recurrence‑free and (B) overall survival. Survival curves were constructed using the Kaplan‑Meier method, and differences between sample cluster curves were analyzed by log‑rank test. Figure S3. ROC analysis of hub genes. For each gene, ROC curve (left) and mRNA expression levels (right) in control (n=35) and tumor (n=545) samples from The Cancer Genome Atlas Uterine Corpus Endometrioid Cancer cohort are shown. mRNA levels are expressed as Log2(x+1), where ‘x’ is the RSEM normalized expression value. ROC, receiver operating characteristic. Table SI. Clinicopathological characteristics of the GSE17025 dataset. Characteristic n % Atrophic endometrium 12 (postmenopausal) (Control group) Tumor stage I 91 100 Histology Endometrioid adenocarcinoma 79 86.81 Papillary serous 12 13.19 Histological grade Grade 1 30 32.97 Grade 2 36 39.56 Grade 3 25 27.47 Myometrial invasiona Superficial (<50%) 67 74.44 Deep (>50%) 23 25.56 aMyometrial invasion information was available for 90 of 91 tumor samples. Table SII. Clinicopathological characteristics of The Cancer Genome Atlas Uterine Corpus Endometrioid Cancer dataset. Characteristic n % Solid tissue normal 16 Tumor samples Stagea I 226 68.278 II 19 5.740 III 70 21.148 IV 16 4.834 Histology Endometrioid 271 81.381 Mixed 10 3.003 Serous 52 15.616 Histological grade Grade 1 78 23.423 Grade 2 91 27.327 Grade 3 164 49.249 Molecular subtypeb POLE 17 7.328 MSI 65 28.017 CN Low 90 38.793 CN High 60 25.862 CN, copy number; MSI, microsatellite instability; POLE, DNA polymerase ε.
    [Show full text]
  • Downloaded Per Proteome Cohort Via the Web- Site Links of Table 1, Also Providing Information on the Deposited Spectral Datasets
    www.nature.com/scientificreports OPEN Assessment of a complete and classifed platelet proteome from genome‑wide transcripts of human platelets and megakaryocytes covering platelet functions Jingnan Huang1,2*, Frauke Swieringa1,2,9, Fiorella A. Solari2,9, Isabella Provenzale1, Luigi Grassi3, Ilaria De Simone1, Constance C. F. M. J. Baaten1,4, Rachel Cavill5, Albert Sickmann2,6,7,9, Mattia Frontini3,8,9 & Johan W. M. Heemskerk1,9* Novel platelet and megakaryocyte transcriptome analysis allows prediction of the full or theoretical proteome of a representative human platelet. Here, we integrated the established platelet proteomes from six cohorts of healthy subjects, encompassing 5.2 k proteins, with two novel genome‑wide transcriptomes (57.8 k mRNAs). For 14.8 k protein‑coding transcripts, we assigned the proteins to 21 UniProt‑based classes, based on their preferential intracellular localization and presumed function. This classifed transcriptome‑proteome profle of platelets revealed: (i) Absence of 37.2 k genome‑ wide transcripts. (ii) High quantitative similarity of platelet and megakaryocyte transcriptomes (R = 0.75) for 14.8 k protein‑coding genes, but not for 3.8 k RNA genes or 1.9 k pseudogenes (R = 0.43–0.54), suggesting redistribution of mRNAs upon platelet shedding from megakaryocytes. (iii) Copy numbers of 3.5 k proteins that were restricted in size by the corresponding transcript levels (iv) Near complete coverage of identifed proteins in the relevant transcriptome (log2fpkm > 0.20) except for plasma‑derived secretory proteins, pointing to adhesion and uptake of such proteins. (v) Underrepresentation in the identifed proteome of nuclear‑related, membrane and signaling proteins, as well proteins with low‑level transcripts.
    [Show full text]
  • Identifying and Characterizing a Novel Protein Kinase STK35L1 and Deciphering Its Orthologs and Close-Homologs in Vertebrates
    Identifying and Characterizing a Novel Protein Kinase STK35L1 and Deciphering Its Orthologs and Close-Homologs in Vertebrates Pankaj Goyal1*, Antje Behring1, Abhishek Kumar2, Wolfgang Siess1 1 Institute for Prevention of Cardiovascular Diseases, University of Munich, Munich, Germany, 2 University of Bielefeld, Bielefeld, Germany Abstract Background: The human kinome containing 478 eukaryotic protein kinases has over 100 uncharacterized kinases with unknown substrates and biological functions. The Ser/Thr kinase 35 (STK35, Clik1) is a member of the NKF 4 (New Kinase Family 4) in the kinome with unknown substrates and biological functions. Various high throughput studies indicate that STK35 could be involved in various human diseases such as colorectal cancer and malaria. Methodology/Principal Findings: In this study, we found that the previously published coding sequence of the STK35 gene is incomplete. The newly identified sequence of the STK35 gene codes for a protein of 534 amino acids with a N-terminal elongation of 133 amino acids. It has been designated as STK35L (STK35 long). Since it is the first of further homologous kinases we termed it as STK35L1. The STK35L1 protein (58 kDa on SDS-PAGE), but not STK35 (44 kDa), was found to be expressed in all human cells studied (endothelial cells, HeLa, and HEK cells) and was down-regulated after silencing with specific siRNA. EGFP-STK35L1 was localized in the nucleus and the nucleolus. By combining syntenic and gene structure pattern data and homology searches, two further STK35L1 homologs, STK35L2 (previously known as PDIK1L) and STK35L3, were found. All these protein kinase homologs were conserved throughout the vertebrates.
    [Show full text]
  • IL-1Β Regulates FHL2 and Other Cytoskeleton-Related Genes in Human Chondrocytes
    IL-1β Regulates FHL2 and Other Cytoskeleton-Related Genes in Human Chondrocytes Helga Joos,1 Wolfgang Albrecht,2 Stefan Laufer,3 Heiko Reichel,4 and Rolf E Brenner1 1Division for Biochemistry of Joint and Connective Tissue Diseases, Department of Orthopedics, University of Ulm, Ulm, Germany; 2ratiopharm group, Department of Drug Research, Ulm, Germany; 3Institute of Pharmacy, Department of Pharmaceutical and Medicinal Chemistry, Eberhard-Karls University Tübingen, Tübingen, Germany; 4Department of Orthopedics, University of Ulm, Ulm, Germany In osteoarthritis (OA), cartilage destruction is associated not only with an imbalance of anabolic and catabolic processes but also with alterations of the cytoskeletal organization in chondrocytes, although their pathogenetic origin is largely unknown so far. Therefore, we have studied possible effects of the proinflammatory cytokine IL-1β on components of the cytoskeleton in OA chondrocytes on gene expression level. Using a whole genome array, we found that IL-1β is involved in the regulation of many cytoskeleton-related genes. Apart from well-known cytoskeletal components, the expression and regulation of four genes cod- ing for LIM proteins were shown. These four genes were previously undescribed in the chondrocyte context. Quantitative PCR analysis confirmed significant downregulation of Fhl1, Fhl2, Lasp1, and Pdlim1 as well as Tubb and Vim by IL-1β. Inhibition of p38 mitogen-activated protein kinase (MAPK) by SB203580 counteracted the influence of IL-1β on Fhl2 and Tubb expression, indicat- ing partial involvement of this signaling pathway. Downregulation of the LIM-only protein FHL2 was confirmed additionally on the protein level. In agreement with these results, IL-1β induced changes in the morphology of chondrocytes, the organization of the cytoskeleton, and the cellular distribution of FHL2.
    [Show full text]
  • MPA-Induced Gene Expression and Stromal and Parenchymal Gene Expression Profiles in Luminal Murine Mammary Carcinomas with Different Hormonal Requirements
    Breast Cancer Res Treat DOI 10.1007/s10549-010-1185-4 PRECLINICAL STUDY MPA-induced gene expression and stromal and parenchymal gene expression profiles in luminal murine mammary carcinomas with different hormonal requirements Sebastia´n Giulianelli • Jason I. Herschkowitz • Vyomesh Patel • Caroline A. Lamb • J. Silvio Gutkind • Alfredo Molinolo • Charles M. Perou • Claudia Lanari Received: 27 August 2010 / Accepted: 17 September 2010 Ó Springer Science+Business Media, LLC. 2010 Abstract Over the past several years, we have been tumor stroma. Eighty-five percent of these genes were interested in understanding the mechanisms by which upregulated, whereas the remaining 15% were downregu- mammary carcinomas acquire hormone independence. We lated in C4-HI relative to their expression in the C4-HD demonstrated that carcinoma associated fibroblasts partic- tumor stroma. Several matrix metallopeptidases were ipate in the ligand-independent activation of progesterone overexpressed in the C4-HI tumor microenvironment. On receptors inducing tumor growth. In this study, we used the other hand, 1100 genes were specifically expressed in DNA microarrays to compare the gene expression profiles the tumor parenchyma. Among them, the 29% were of tumors from the MPA mouse breast cancer model, one upregulated, whereas the remaining 71% were downregu- hormone-dependent (C4-HD) and one hormone-indepen- lated in C4-HI relative to C4-HD tumor epithelium. Steap, dent (C4-HI), using whole tumor samples or laser-captured Pdgfc, Runx2, Cxcl9, and Sdf2 were among the genes with purified stromal and epithelial cells obtained from the high expression in the C4-HI tumor parenchyma. Interest- same tumors. The expression of selected genes was vali- ingly, Fgf2 was one of the few genes upregulated by MPA dated by immunohistochemistry and immunofluorescence in C4-HD tumors, confirming its pivotal role in regulating assays.
    [Show full text]
  • Chromosome 10, Frequently Lost in Human Melanoma, Encodes Multiple Tumor-Suppressive Functions
    Published OnlineFirst January 22, 2014; DOI: 10.1158/0008-5472.CAN-13-1446 Cancer Tumor and Stem Cell Biology Research Chromosome 10, Frequently Lost in Human Melanoma, Encodes Multiple Tumor-Suppressive Functions Lawrence N. Kwong and Lynda Chin Abstract Although many DNA aberrations in melanoma have been well characterized, including focal amplification and deletions of oncogenes and tumor suppressors, broad regions of chromosomal gain and loss are less well understood. One possibility is that these broad events are a consequence of collateral damage from targeting single loci. Another possibility is that the loss of large regions permits the simultaneous repression of multiple tumor suppressors by broadly decreasing the resident gene dosage and expression. Here, we test this hypothesis in a targeted fashion using RNA interference to suppress multiple candidate residents in broad regions of loss. We find that loss of chromosome regions 6q, 10, and 11q21-ter is correlated with broadly decreased expression of most resident genes and that multiple resident genes impacted by broad regional loss of chromosome 10 are tumor suppressors capable of affecting tumor growth and/or invasion. We also provide additional functional support for Ablim1 as a novel tumor suppressor. Our results support the hypothesis that multiple cancer genes are targeted by regional chromosome copy number aberrations. Cancer Res; 74(6); 1–8. Ó2014 AACR. Introduction mas (7). In contrast, the observed approximately 60% of CDKN2A/B Increasingly high-resolution genomic studies have estab- deletions on chromosome 9p are focal. These data PTEN lished that recurrent focal deletions and amplifications in suggest that although is a major driver of chromosome cancer can selectively target specific oncogenes and tumor 10 loss, other genes may also be targeted for inactivation.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • STK35 (NM 080836) Human Tagged ORF Clone – RG229271 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG229271 STK35 (NM_080836) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: STK35 (NM_080836) Human Tagged ORF Clone Tag: TurboGFP Symbol: STK35 Synonyms: CLIK1; STK35L1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 STK35 (NM_080836) Human Tagged ORF Clone – RG229271 ORF Nucleotide >RG229271 representing NM_080836 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCCACCAGGAGTCTCCGCTGGCCCGGGCGCCGGCGGGAGGTGCAGCTTATGTAAAGAGGTTATGTA AAGGGCTCAGCTGGCGCGAACACGTGGAAAGCCACGGGAGCCTAGGAGCCCAGGCTTCCCCAGCGAGCGC CGCGGCAGCAGAAGGATCCGCTACACGCCGGGCTCGGGCCGCCACCTCCCGCGCTGCTCGGTCCCGGAGG CAGCCCGGGCCCGGAGCGGACCATCCCCAGGCAGGGGCTCCAGGGGGGAAACGGGCCGCCCGGAAGTGGA GGTGCGCGGGCCAGGTCACAATCCAAGGTCCGGCTCCTCCGCGTCCCAGGGCCGGACGGAGGGATGAGGC AGGGGGGGCCCGGGCAGCGCCGTTGCTGCTCCCCCCGCCGCCCGCAGCCATGGAAACGGGGAAGGACGGC GCCCGCAGAGGTACACAAAGCCCGGAGCGGAAAAGGCGAAGCCCAGTGCCGCGGGCGCCCAGCACGAAGC TGAGGCCGGCGGCGGCGGCCCGGGCCATGGATCCGGTGGCGGCCGAGGCCCCGGGCGAGGCCTTCCTGGC GCGGCGACGGCCTGAGGGCGGTGGCGGGTCCGCGCGGCCGCGTTACAGCCTGTTGGCGGAGATCGGGCGC
    [Show full text]
  • Identifying Dynamic Protein and RNA Proximity Interaction Networks of Actinin Reveals RNA
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.18.994004; this version posted March 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available underConfidential aCC-BY-NC-ND Manuscript 4.0 International license. 1 Title: 2 Identifying dynamic protein and RNA proximity interaction networks of actinin reveals RNA- 3 binding and metabolic regulatory mechanisms 4 5 Feria A. Ladha M.S.1, Ketan Thakar Ph.D.2*, Anthony M. Pettinato B.S.1*, Nicholas Legere 2 2 1 1 2 6 B.S. , Rachel Cohn M.S. , Robert Romano B.S. , Emily Meredith B.S. , Yu-Sheng Chen Ph.D. , 7 and J. Travis Hinson M.D.1,2,3 8 Affiliations: 9 1University of Connecticut Health Center, Farmington, CT 06030, USA 10 2The Jackson Laboratory for Genomic Medicine, Farmington, CT 06032, USA 11 3Cardiology Center, UConn Health, Farmington, CT 06030, USA 12 *These authors contributed equally 13 14 Lead Contact: Correspondence: [email protected] 15 16 17 18 19 20 21 22 2 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.18.994004; this version posted March 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available underConfidential aCC-BY-NC-ND Manuscript 4.0 International license. 1 Abstract 2 Actinins are actin cross-linkers that are expressed in nearly all cells and harbor mutations in 3 heritable diseases.
    [Show full text]
  • Transcriptomic Profiling of Adipose Derived Stem Cells Undergoing
    www.nature.com/scientificreports OPEN Transcriptomic Profling of Adipose Derived Stem Cells Undergoing Osteogenesis by RNA-Seq Received: 11 January 2019 Shahensha Shaik1, Elizabeth C. Martin2, Daniel J. Hayes3, Jefrey M. Gimble4 & Accepted: 25 July 2019 Ram V. Devireddy1 Published: xx xx xxxx Adipose-derived stromal/stem cells (ASCs) are multipotent in nature that can be diferentiated into various cells lineages such as adipogenic, osteogenic, and chondrogenic. The commitment of a cell to diferentiate into a particular lineage is regulated by the interplay between various intracellular pathways and their resultant secretome. Similarly, the interactions of cells with the extracellular matrix (ECM) and the ECM bound growth factors instigate several signal transducing events that ultimately determine ASC diferentiation. In this study, RNA-sequencing (RNA-Seq) was performed to identify the transcriptome profle of osteogenic induced ASCs to understand the associated genotype changes. Gene ontology (GO) functional annotations analysis using Database for Annotation Visualization and Integrated Discovery (DAVID) bioinformatics resources on the diferentially expressed genes demonstrated the enrichment of pathways mainly associated with ECM organization and angiogenesis. We, therefore, studied the expression of genes coding for matrisome proteins (glycoproteins, collagens, proteoglycans, ECM-afliated, regulators, and secreted factors) and ECM remodeling enzymes (MMPs, integrins, ADAMTSs) and the expression of angiogenic markers during the osteogenesis of ASCs. The upregulation of several pro-angiogenic ELR+ chemokines and other angiogenic inducers during osteogenesis indicates the potential role of the secretome from diferentiating ASCs in the vascular development and its integration with the bone tissue. Furthermore, the increased expression of regulatory genes such as CTNNB1, TGBR2, JUN, FOS, GLI3, and MAPK3 involved in the WNT, TGF- β, JNK, HedgeHog and ERK1/2 pathways suggests the regulation of osteogenesis through interplay between these pathways.
    [Show full text]