DOCSLIB.ORG

Mapping of Monogenic and Quantitative Trait Loci Using a Whole Genome Scan Approach and Single Nucleotide Polymorphism Platforms

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mapping of Monogenic and Quantitative Trait Loci Using a Whole Genome Scan Approach and Single Nucleotide Polymorphism Platforms MAPPING OF MONOGENIC AND QUANTITATIVE TRAIT LOCI USING A WHOLE GENOME SCAN APPROACH AND SINGLE NUCLEOTIDE POLYMORPHISM PLATFORMS BY ALYSTA D. MARKEY DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Animal Sciences in the Graduate College of the University of Illinois at Urbana-Champaign, 2013 Urbana, Illinois Doctoral Committee: Professor Jonathan Beever, Chair, Director of Research Professor Sandra Rodriguez-Zas Clinical Associate Professor Clifford Shipley Assistant Professor Anna Dilger Abstract The release of the bovine genome sequence in 2004 opened the door for the development of high density single nucleotide polymorphism (SNP) panels that can be used for linkage disequilibrium mapping of traits in cattle populations. The BovineSNP50 Beadchip, containing 54,001 SNP markers, was released in 2008 and the recently released BovineHD Beadchip contains 777,000 SNP markers. These SNP platforms were utilized to map both monogenic and quantitative traits to finite genomic regions in beef cattle populations. The recessive defect, hypotrichosis is an autosomal recessive form of hairlessness that affects Hereford cattle. A whole-genome association analysis was conducted using BovineSNP50 BeadChip to map the hypotrichosis locus to a chromosomal region. Significant association was detected between the hypotrichosis phenotype and a locus on bovine chromosome 5 (BTA5) and homozygosity analysis localized the associated region to between 29 and 32 Mb. Sequencing of six candidate genes in the region revealed an eight base pair deletion in exon 1 of the bovine KRT71 gene that was consistent with putative genotypic status within archived samples. The deletion mutation is predicted to result in a frameshift and early truncation of the K71 protein. A DNA based diagnostic was developed that will permit animals to be screened for the mutation and thus allow animal breeders to make informed mating decisions and decrease the incidence of hypotrichosis in the Hereford breed. Genotype imputation from the BovineSNP50 to the high density BovineHD platform was conducted to provide a denser marker panel to carry out whole genome association mapping and allow for more refinement of genomic regions associated with traits. The imputed genotypes were used in a whole genome scan in order to discover quantitative trait loci that may be influencing growth, carcass and meat quality traits in an US Simmental- Angus population. Association was detected with the traits birth weight, back fat, yield ii grade, ribeye area and marbling. There were 81 SNP associations with birth weight that were sequestered into 10 genomic regions. The carcass trait, back fat exhibited association with 209 SNPs in 46 genomic regions and yield grade displayed association with 172 SNPs in 69 genomic areas while there were four SNP associations with ribeye area, representing one genomic region. There were 127 SNP associations with the meat quality trait, marbling, that represented 32 genomic regions. These regions are ideal targets for development of markers for use in marker assisted selection and are also excellent regions to investigate with further fine mapping and discovery of causal variants underlying the quantitative trait loci. The utilization of genotype imputation from the BovineSNP50 to the high density 770K platform allowed localization of QTL to refined regions of the genome, often eliminating the need for further fine mapping efforts prior to targeted re-sequencing. The whole genome scan using imputed genotypes revealed a locus on BTA 6 from 37 to 42 Mb that was associated with back fat, marbling and birth weight in an US Simmental- Angus population. The region on BTA6 was evaluated in an attempt to further refine the candidate locus interval by implementing haplotype analysis with the imputed SNP markers that were used the whole genome association analysis. Two regions within the 5 Mb interval were associated with the phenotypes; the first was near 38.83 Mb that was associated with both back fat and birth weight. The second region near 39.27 Mb was associated with back fat, marbling and birth weight. The first region, near 38.83 Mb, corresponds to the LCORL-NCAPG locus that has been implicated in body size in many species as well as contributing to growth and carcass phenotypes in cattle. Re-sequencing of the LCORL-NCAPG locus in animals of know haplotype status revealed several polymorphisms that were consistent with haplotype status. This research contributes to the mounting evidence implicating the LCORL-NCAPG region as influencing growth, carcass and meat quality traits in cattle. iii Acknowledgements I have been blessed to have a great group of people behind me during my entire academic career and I am very thankful for each and every one of you. First of all I would like to thank my parents for their love and support not only in my academic pursuits but throughout my life. You have always been there for me and pushed me to excel while never expecting too much or being unrealistic. You raised me to appreciate the little things, to always respect others, to work hard and always do my best and for that I will be forever grateful. And to Jason – thank you for your love and support throughout this entire endeavor. I could not have done this without your understanding and desire for me to finish although I know it took me longer than either of us would have preferred. And yes, thank you for asking about my day and listening patiently even though I could see your eyes glaze over as I talked. I really appreciate that you care enough to ask! I would like to thank my lab-mates and good friends Erin Wagner, Brandy Marron, Kristen Walker and Stacey Meyers for everything they have done for me. I am truly blessed to have had such a great group of colleagues who all become more than just co-workers. I appreciate all the assistance with projects, moral support when things went awry, shared “wohoos” when things went right, and always having your support no matter what was happening. I am very happy that I have been able to work with group of people who had the ability to pull together and work as a cohesive team. I am so thankful to have had such a great work environment and without you all I am pretty certain I would have lost my sanity! We have shared many good times over the last few years and I will miss my daily interactions with each of you! I would like to thank “boss” for everything; both things that fell under official duties as well as those things in the unofficial category. I am thankful for all the guidance in research and teaching I truly appreciate your patience, constant availability and the fact that you really do care about each and every one of us. Although we all seem to be iv exasperated when you “show us how it’s done” it is nice to have a boss who can truly guide us, teach us, trouble shoot with us and who not only has the ability to work side by side with us but is always willing to do so. I am also grateful for all things you did that were not required of an advisor - lab lunches and birthday cakes, Christmas parties and cookouts, days on the Beever ranch working cows and the times that we simply sat around and had enjoyable conversations. All of these things are going to be hard to find again in future supervisors and I am truly thankful that I have had this good of an experience at least once! And lastly I would like to thank my committee members Sandra Rodriguez-Zas, Clifford Shipley and Anna Dilger. I appreciate the guidance from each of you and the contributions that you made to my thesis research and academic career at the University of Illinois. v Table of Contents List of Figures.........................................................................................................vii List of Tables..........................................................................................................viii Chapter 1. Literature Review ....................................................................................1 Introduction ....................................................................................................1 Current status of Bovine Genome Technologies .....................................................2 Trait Mapping Approaches ..................................................................................4 Selected Review of Trait Mapping ........................................................................9 Genotype Imputation.........................................................................................15 Chapter 2. A deletion mutation in KRT71 is associated with congenital hypotrichosis in.....17 Hereford cattle. Abstract ..........................................................................................................17 Background......................................................................................................18 Results and discussion .......................................................................................20 Conclusion .......................................................................................................29 Methods ..........................................................................................................30 Figures ............................................................................................................35 Chapter 3. A genome wide association analysis for growth, carcass and meat quality .......41 traits in cattle Abstract ..........................................................................................................41
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Dog Coat Colour Genetics: a Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem
    www.als-journal.com/ ISSN 2310-5380/ August 2020 Review Article Advancements in Life Sciences – International Quarterly Journal of Biological Sciences ARTICLE INFO Open Access Date Received: 02/05/2020; Date Revised: 20/08/2020; Dog Coat Colour Genetics: A Review Date Published Online: 31/08/2020; 1,2 1 1 3 Rashid Saif *, Ali Iftekhar , Fatima Asif , Mohammad Suliman Alghanem Authors’ Affiliation: 1. Institute of Abstract Biotechnology, Gulab Devi Educational anis lupus familiaris is one of the most beloved pet species with hundreds of world-wide recognized Complex, Lahore - Pakistan breeds, which can be differentiated from each other by specific morphological, behavioral and adoptive 2. Decode Genomics, traits. Morphological characteristics of dog breeds get more attention which can be defined mostly by 323-D, Town II, coat color and its texture, and considered to be incredibly lucrative traits in this valued species. Although Punjab University C Employees Housing the genetic foundation of coat color has been well stated in the literature, but still very little is known about the Scheme, Lahore - growth pattern, hair length and curly coat trait genes. Skin pigmentation is determined by eumelanin and Pakistan 3. Department of pheomelanin switching phenomenon which is under the control of Melanocortin 1 Receptor and Agouti Signaling Biology, Tabuk Protein genes. Genetic variations in the genes involved in pigmentation pathway provide basic understanding of University - Kingdom melanocortin physiology and evolutionary adaptation of this trait. So in this review, we highlighted, gathered and of Saudi Arabia comprehend the genetic mutations, associated and likely to be associated variants in the genes involved in the coat color and texture trait along with their phenotypes.
    [Show full text]
  • Universidade Estadual De Campinas Instituto De Biologia
    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
    [Show full text]
  • A COLQ Missense Mutation in Sphynx and Devon Rex Cats With
    A COLQ Missense Mutation in Sphynx and Devon Rex Cats with Congenital Myasthenic Syndrome Marie Abitbol, Christophe Hitte, Philippe Bossé, Nicolas Blanchard-Gutton, Anne Thomas, Lionel Martignat, Stéphane Blot, Laurent Tiret To cite this version: Marie Abitbol, Christophe Hitte, Philippe Bossé, Nicolas Blanchard-Gutton, Anne Thomas, et al.. A COLQ Missense Mutation in Sphynx and Devon Rex Cats with Congenital Myasthenic Syndrome. PLoS ONE, Public Library of Science, 2015, 10 (9), pp.e0137019. 10.1371/journal.pone.0137019. hal-01196603 HAL Id: hal-01196603 https://hal-univ-rennes1.archives-ouvertes.fr/hal-01196603 Submitted on 27 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License RESEARCH ARTICLE A COLQ Missense Mutation in Sphynx and Devon Rex Cats with Congenital Myasthenic Syndrome Marie Abitbol1,2,3,4*, Christophe Hitte5, Philippe Bossé1,2,3,4, Nicolas Blanchard- Gutton1,2,3,4, Anne Thomas6, Lionel Martignat7, Stéphane Blot1,2,3,4, Laurent Tiret1,2,3,4 1 Inserm,
    [Show full text]
  • The Role of Genetic Variation in Predisposition to Alcohol-Related Chronic Pancreatitis
    The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Marianne Lucy Johnstone April 2015 The Role of Genetic Variation in Predisposition to Alcohol-related Chronic Pancreatitis 2015 Abstract Background Chronic pancreatitis (CP) is a disease of fibrosis of the pancreas for which alcohol is the main causative agent. However, only a small proportion of alcoholics develop chronic pancreatitis. Genetic polymorphism may affect pancreatitis risk. Aim To determine the factors required to classify a chronic pancreatic population and identify genetic variations that may explain why only some alcoholics develop chronic pancreatitis. Methods The most appropriate method of diagnosing CP was assessed using a systematic review. Genetics of different populations of alcohol-related chronic pancreatitics (ACP) were explored using four different techniques: genome-wide association study (GWAS); custom arrays; PCR of variable nucleotide tandem repeats (VNTR) and next generation sequencing (NGS) of selected genes. Results EUS and sMR were identified as giving the overall best sensitivity and specificity for diagnosing CP. GWAS revealed two associations with CP (identified and replicated) at PRSS1-PRSS2_rs10273639 (OR 0.73, 95% CI 0.68-0.79) and X-linked CLDN2_rs12688220 (OR 1.39, 1.28-1.49) and the association was more pronounced in the ACP group (OR 0.56, 0.48-0.64)and OR 2.11, 1.84-2.42). The previously identified VNTR in CEL was shown to have a lower frequency of the normal repeat in ACP than alcoholic liver disease (ALD; OR 0.61, 0.41-0.93).
    [Show full text]
  • Structural and Biochemical Changes Underlying a Keratoderma-Like Phenotype in Mice Lacking Suprabasal AP1 Transcription Factor Function
    Citation: Cell Death and Disease (2015) 6, e1647; doi:10.1038/cddis.2015.21 OPEN & 2015 Macmillan Publishers Limited All rights reserved 2041-4889/15 www.nature.com/cddis Structural and biochemical changes underlying a keratoderma-like phenotype in mice lacking suprabasal AP1 transcription factor function EA Rorke*,1, G Adhikary2, CA Young2, RH Rice3, PM Elias4, D Crumrine4, J Meyer4, M Blumenberg5 and RL Eckert2,6,7,8 Epidermal keratinocyte differentiation on the body surface is a carefully choreographed process that leads to assembly of a barrier that is essential for life. Perturbation of keratinocyte differentiation leads to disease. Activator protein 1 (AP1) transcription factors are key controllers of this process. We have shown that inhibiting AP1 transcription factor activity in the suprabasal murine epidermis, by expression of dominant-negative c-jun (TAM67), produces a phenotype type that resembles human keratoderma. However, little is understood regarding the structural and molecular changes that drive this phenotype. In the present study we show that TAM67-positive epidermis displays altered cornified envelope, filaggrin-type keratohyalin granule, keratin filament, desmosome formation and lamellar body secretion leading to reduced barrier integrity. To understand the molecular changes underlying this process, we performed proteomic and RNA array analysis. Proteomic study of the corneocyte cross-linked proteome reveals a reduction in incorporation of cutaneous keratins, filaggrin, filaggrin2, late cornified envelope precursor proteins, hair keratins and hair keratin-associated proteins. This is coupled with increased incorporation of desmosome linker, small proline-rich, S100, transglutaminase and inflammation-associated proteins. Incorporation of most cutaneous keratins (Krt1, Krt5 and Krt10) is reduced, but incorporation of hyperproliferation-associated epidermal keratins (Krt6a, Krt6b and Krt16) is increased.
    [Show full text]
  • Atypical Fibroepithelial Hyperplasia of the Teats in a Sphynx Cat: a Case Report
    Veterinarni Medicina, 59, 2014 (5): 265–269 Case Report Atypical fibroepithelial hyperplasia of the teats in a Sphynx cat: a case report E. Ozenc, M.F. Bozkurt Faculty of Veterinary Medicine, Afyon Kocatepe University, Afyonkarahisar, Turkey ABSTRACT: This study was conducted on a three-year-old Sphynx breed female cat which was brought to the clinic for masses on the teats. The medical history showed that these masses had developed slowly within the period of six months to one year. Following the clinical examination, these masses were removed via surgery. They were between 0.6 cm and 1.5 cm in diameter. Ulcer areas 2 mm to 5 mm in size were observed over the skin. Their sectional surface was uniformly grayish in colour. Histopathological examination of the masses revealed that the cells originated from the glandular duct and had given rise to hyperplasia; connective tissue was densely attached to the masses. Moreover, inflammatory changes and areas of ulceration were observed. Immunohistochemical analysis showed that the cells surrounding the epithelial hyperplasia were vimentin-positive and the proliferative activity of epithelial cells was measured to be 50% by analysis of proliferating cell nuclear antigen (PCNA). Based on clinical, histological and immunohistochemical findings, it was found the masses were diagnosed as atypical fibroepithelial hyperplasia. This case is the first to present a fibroepithelial hyperplasia in the teats of a cat. Keywords: Sphynx cat; fibroepithelial hyperplasia; teats List of abbreviations ABC = avidin-biotin complex, AEC = 3-amino-9-ethilcarbazole, FEH = fibroepithelial hyperplasia, HE = haema- toxylin & eosin, PCNA = proliferating cell nuclear antigen, SMA = smooth muscle actin Fibroepithelial hyperplasia (FEH) of the mam- Although the Sphynx is known as a hairless cat mary glands in cats (also known as fibroadenoma- breed, they may have hairs on the nose, tail and toes tous hyperplasia or feline mammary hyperplasia) (Robinson 1973; Gandolfi et al.
    [Show full text]
  • Keratin 71 Mutations: from Water Dogs to Woolly Hair
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector COMMENTARY See related article on pg 2342 C-terminal tail domain. Specifically, the N and C termini of the central a-helix contain helix initiation motif and Keratin 71 Mutations: From Water helix termination motif, respectively, which are essential for dimerization of Dogs to Woolly Hair type I and type II keratins (Coulombe 1 1,2 and Omary, 2002). About half of Sivan Harel and Angela M. Christiano the keratins are restricted to various compartments of the hair follicle. The study of rare genetic disorders of the hair follicle has resulted in the Hair keratins, in contrast to epithelial identification of many causative genes, leading to the potential for the develop- keratins, possess a highly sulfur-rich ment of novel therapeutic approaches for both inherited and acquired hair head and tail domain responsible for disorders. In this issue, Fujimoto et al. identify a missense mutation within the the tough, filamentous structure of the keratin 71 (KRT71) gene as the cause for autosomal dominant woolly hair/ hair and nails (Langbein et al., 1999; hypotrichosis in a Japanese family. This represents the first human mutation in Schweizer et al., 2006). KRT71 to be linked to a hair disorder, establishing this gene as an important determinant of mammalian hair texture. Moreover, this finding provides new insight into the relationship between similar phenotypes resulting from mutations Structural disorders of the hair follicle in distinct regulatory pathways and underscores the role of the inner root sheath Mutations in genes encoding keratins, in human hair growth.
    [Show full text]
  • Regulation of Signaling and Metabolism by Lipin-Mediated Phosphatidic Acid Phosphohydrolase Activity
    biomolecules Review Regulation of Signaling and Metabolism by Lipin-mediated Phosphatidic Acid Phosphohydrolase Activity Andrew J. Lutkewitte and Brian N. Finck * Center for Human Nutrition, Division of Geriatrics and Nutritional Sciences, Department of Medicine, Washington University School of Medicine, Euclid Avenue, Campus Box 8031, St. Louis, MO 63110, USA; [email protected] * Correspondence: bfi[email protected]; Tel: +1-3143628963 Received: 4 September 2020; Accepted: 24 September 2020; Published: 29 September 2020 Abstract: Phosphatidic acid (PA) is a glycerophospholipid intermediate in the triglyceride synthesis pathway that has incredibly important structural functions as a component of cell membranes and dynamic effects on intracellular and intercellular signaling pathways. Although there are many pathways to synthesize and degrade PA, a family of PA phosphohydrolases (lipin family proteins) that generate diacylglycerol constitute the primary pathway for PA incorporation into triglycerides. Previously, it was believed that the pool of PA used to synthesize triglyceride was distinct, compartmentalized, and did not widely intersect with signaling pathways. However, we now know that modulating the activity of lipin 1 has profound effects on signaling in a variety of cell types. Indeed, in most tissues except adipose tissue, lipin-mediated PA phosphohydrolase activity is far from limiting for normal rates of triglyceride synthesis, but rather impacts critical signaling cascades that control cellular homeostasis. In this review, we will discuss how lipin-mediated control of PA concentrations regulates metabolism and signaling in mammalian organisms. Keywords: phosphatidic acid; diacylglycerol; lipin; signaling 1. Introduction Foundational work many decades ago by the laboratory of Dr. Eugene Kennedy defined the four sequential enzymatic steps by which three fatty acyl groups were esterified onto the glycerol-3-phosphate backbone to synthesize triglyceride [1].
    [Show full text]
  • The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z
    REVIEW pubs.acs.org/CR The Metabolic Serine Hydrolases and Their Functions in Mammalian Physiology and Disease Jonathan Z. Long* and Benjamin F. Cravatt* The Skaggs Institute for Chemical Biology and Department of Chemical Physiology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, California 92037, United States CONTENTS 2.4. Other Phospholipases 6034 1. Introduction 6023 2.4.1. LIPG (Endothelial Lipase) 6034 2. Small-Molecule Hydrolases 6023 2.4.2. PLA1A (Phosphatidylserine-Specific 2.1. Intracellular Neutral Lipases 6023 PLA1) 6035 2.1.1. LIPE (Hormone-Sensitive Lipase) 6024 2.4.3. LIPH and LIPI (Phosphatidic Acid-Specific 2.1.2. PNPLA2 (Adipose Triglyceride Lipase) 6024 PLA1R and β) 6035 2.1.3. MGLL (Monoacylglycerol Lipase) 6025 2.4.4. PLB1 (Phospholipase B) 6035 2.1.4. DAGLA and DAGLB (Diacylglycerol Lipase 2.4.5. DDHD1 and DDHD2 (DDHD Domain R and β) 6026 Containing 1 and 2) 6035 2.1.5. CES3 (Carboxylesterase 3) 6026 2.4.6. ABHD4 (Alpha/Beta Hydrolase Domain 2.1.6. AADACL1 (Arylacetamide Deacetylase-like 1) 6026 Containing 4) 6036 2.1.7. ABHD6 (Alpha/Beta Hydrolase Domain 2.5. Small-Molecule Amidases 6036 Containing 6) 6027 2.5.1. FAAH and FAAH2 (Fatty Acid Amide 2.1.8. ABHD12 (Alpha/Beta Hydrolase Domain Hydrolase and FAAH2) 6036 Containing 12) 6027 2.5.2. AFMID (Arylformamidase) 6037 2.2. Extracellular Neutral Lipases 6027 2.6. Acyl-CoA Hydrolases 6037 2.2.1. PNLIP (Pancreatic Lipase) 6028 2.6.1. FASN (Fatty Acid Synthase) 6037 2.2.2. PNLIPRP1 and PNLIPR2 (Pancreatic 2.6.2.
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Overexpression of Hormone-Sensitive Lipase Prevents Triglyceride Accumulation in Adipocytes
    Overexpression of hormone-sensitive lipase prevents triglyceride accumulation in adipocytes. C Sztalryd, … , M C Komaromy, F B Kraemer J Clin Invest. 1995;95(6):2652-2661. https://doi.org/10.1172/JCI117967. Research Article Hormone-sensitive lipase (HSL) is a cytosolic neutral lipase that hydrolyzes intracellular stores of triglycerides within adipocytes and is thought to be the rate limiting enzyme in lipolysis; however, direct evidence to prove this concept has been lacking. The present study was designed to establish the function of HSL in adipocytes. A 2360-bp fragment containing the entire HSL coding region was cloned into the vector pCEP4 and was used to transfect the 3T3-F442A adipogenic cell line. Nondifferentiated, transfected cells were screened for HSL overexpression by indirect immunofluorescence microscopy and confirmed by immunoblotting cell extracts with anti-HSL/fusion protein antibodies and by Northern blots for HSL mRNA. Stable transfectants overexpressing HSL were obtained and cloned. Compared with undifferentiated 3T3-F442A cells transfected with pCEP4 not containing the insert (vector alone) where HSL expression was very low, undifferentiated HSL transfectants had up to a 100-fold increase in HSL activity. Likewise, immunoreactive HSL protein and HSL mRNA levels were increased up to 100-fold in HSL transfectants. When confluent cells were allowed to differentiate by exposure to insulin, HSL expression increased in vector alone transfected cells, but remained below that observed in HSL transfectants. A similar degree of differentiation was seen in both vector alone and HSL transfectants when based on the induction of lipoprotein lipase. Cellular triglyceride content increased dramatically in the vector alone transfected cells […] Find the latest version: https://jci.me/117967/pdf Overexpression of Hormone-sensitive Lipase Prevents Triglyceride Accumulation in Adipocytes Carole Sztalryd, Michael C.
    [Show full text]