J. Mol. Microbiol. Biotechnol. (2002) 4(5): 495–501. JMMB Research article

The General Stress Protein Ctc of Bacillus subtilis is a Ribosomal Protein

Matthias Schmalisch, Ines Langbein, and Jo¨ rg promoter analyses. Altogether, these studies revealed Stu¨ lke* that more than 150 genes are under the control of sB in B. subtilis (Bernhardt et al., 1997, Petersohn et al., Lehrstuhl fu¨ rMikrobiologie, Institut fu¨ rMikrobiologie, 1999, Price et al., 2001, Petersohn et al., 2001, Hecker Biochemie und Genetik der Friedrich-Alexander- and Vo¨ lker, 2001). Whereas intensive work has been Universita¨tErlangen-Nu¨ rnberg, Staudtstr. 5, D-91058 devoted to the elucidation of the regulatory network Erlangen, Germany that govern the activity of sB and thus the synthesis of the general stress proteins, much less is known about the function of the proteins of the sB regulon. B Abstract B. subtilis sigB mutants devoid of s are viable as the wild type but are impaired in resistance to severe oxi- Cells respond to stress conditions by synthesizing dative, alkaline or heat stress (Antelmann et al., 1996; general or specific stress proteins. The Ctc protein Gaidenko and Price, 1998, Vo¨ lker et al., 1999). Among of Bacillus subtilis belongs to the general stress the general stress proteins with known functions are proteins. The synthesis of Ctc is controlled by an the solute transporter OpuE, the catalase KatE, the B ClpC and ClpP protease subunits and several regula- alternative s factor of RNA polymerase, s .Se- B quence analyses revealed that Ctc is composed of tors of s activity (Kempf and Bremer, 1998, En- two domains, an N-terminal domain similar to the gelmann et al., 1995, Kru¨ger et al., 1994, Gerth et al., 1998, Benson and Haldenwang, 1992). About 100 ribosomal protein L25 of Escherichia coli,anda B C-terminal domain. The similarity of the N-terminal proteins of the s regulon are of unknown function. domain of Ctc to L25 suggested that Ctc might be a Database analyses allowed to predict a function for ribosomal protein in B. subtilis. The function of the about 50 of these proteins, however, these predictions C-terminal domain is unknown. We purified Ctc to need to be tested experimentally (Price et al., 2001). homogeneity and used the pure protein to raise The first gene known to be transcribed by RNA antibodies. Western blot analyses demonstrate that polymerase carrying an alternative sigma factor was ctc (Ollington et al., 1981). Expression of ctc is driven Ctc is induced under stress conditions and can be B found in ribosomes of B. subtilis.Asobserved for by a s -dependent promoter upstream of ctc (Hilden its E. coli counterpart L25, Ctc is capable of binding et al., 1995). Upon stress, expression of ctc is about 5S ribosomal RNA in a specific manner. The stress- 10-fold induced. Thus, ctc is among the genes that are specific localization of Ctc in B. subtilis ribosomes most strongly induced by stress (Vo¨ lker et al., 1994). and the sporulation defect of ctc mutants at high The highexpressionofctc suggests an important temperatures suggest that Ctc might be required for function for the Ctc protein, which is, however, accurate translation under stress conditions. unknown so far. B. subtilis strains lacking a functional ctc gene are viable under normal growth conditions but they are impaired in sporulation at high temperature. In Introduction addition, a ctc spoVG double mutant exhibits a growth defect at 37Cwhichisnot observed in ctc or spoVG In soil, the natural habitat of Bacillus subtilis,thecells single mutant strains. However, the reason for the are more often found in a non-growing than in a growing effects of ctc mutations has so far remained obscure state. Growing cells are often faced with nutrient lim- (Truitt et al., 1988). itations or different other stresses that result in the Based on its sequence, Ctc is composed of two cessation of growth. Exposure to any stress results in domains. The N-terminal domain of the protein shows a the expression of specific proteins, the stress proteins. significant similarity to the ribosomal protein L25 from These stress proteins may help the cells to adapt to the Escherichia coli (Stoldt et al., 1998). However, in many actual stress but also to be prepared for future stresses. bacteria there exist homologues of Ctc that contain While some stress proteins are synthesized only in both the N-terminal (L25-like) and the C-terminal response to a specific stress such as heat shock or domain. These proteins are exemplified by the riboso- heavy metal ions, others are expressed generally under mal protein TL5 from Thermus thermophilus (Gryazno- all stress conditions. The expression of these general va et al., 1996). Proteins, which show similarity to the stress proteins depends in B. subtilis on the alternative B C-terminal domain as well as proteins which consist sigma factor, s (Hecker et al., 1996). only of the C-terminal domain, like Ctc of Aquifex General stress proteins and the genes encoding aeolicus (Deckert et al., 1998) are known. them were identified by proteome, transcriptome and Although the function of Ctc is still unknown, *For correspondence. Email [email protected]; the function of several Ctc-homologues has been Tel. +49-9131-8528818; Fax. +49-9131-8528082. determined. Being ribosomal proteins, both L25 from

# 2002 Horizon Scientific Press Further Reading

Caister Academic Press is a leading academic publisher of advanced texts in microbiology, molecular biology and medical research. Full details of all our publications at caister.com

• MALDI-TOF Mass Spectrometry in Microbiology Edited by: M Kostrzewa, S Schubert (2016) www.caister.com/malditof • Aspergillus and Penicillium in the Post-genomic Era Edited by: RP Vries, IB Gelber, MR Andersen (2016) www.caister.com/aspergillus2

• The Bacteriocins: Current Knowledge and Future Prospects Edited by: RL Dorit, SM Roy, MA Riley (2016) www.caister.com/bacteriocins • Omics in Plant Disease Resistance Edited by: V Bhadauria (2016) www.caister.com/opdr

• Acidophiles: Life in Extremely Acidic Environments Edited by: R Quatrini, DB Johnson (2016) www.caister.com/acidophiles

• Climate Change and Microbial Ecology: Current Research and Future Trends Edited by: J Marxsen (2016) www.caister.com/climate

• Biofilms in Bioremediation: Current Research and Emerging Technologies • Flow Cytometry in Microbiology: Technology and Applications Edited by: G Lear (2016) www.caister.com/biorem Edited by: MG Wilkinson (2015) www.caister.com/flow • Microalgae: Current Research and Applications • Probiotics and Prebiotics: Current Research and Future Trends Edited by: MN Tsaloglou (2016) www.caister.com/microalgae Edited by: K Venema, AP Carmo (2015) www.caister.com/probiotics • Gas Plasma Sterilization in Microbiology: Theory, Applications, Pitfalls and New Perspectives • Epigenetics: Current Research and Emerging Trends

Edited by: H Shintani, A Sakudo (2016) Edited by: BP Chadwick (2015) www.caister.com/gasplasma www.caister.com/epigenetics2015

• Virus Evolution: Current Research and Future Directions • Corynebacterium glutamicum: From Systems Biology to Biotechnological Applications Edited by: SC Weaver, M Denison, M Roossinck, et al. (2016) www.caister.com/virusevol Edited by: A Burkovski (2015) www.caister.com/cory2 • Arboviruses: Molecular Biology, Evolution and Control Edited by: N Vasilakis, DJ Gubler (2016) • Advanced Vaccine Research Methods for the Decade of www.caister.com/arbo Vaccines Edited by: F Bagnoli, R Rappuoli (2015) • Shigella: Molecular and Cellular Biology www.caister.com/vaccines Edited by: WD Picking, WL Picking (2016) www.caister.com/shigella • Antifungals: From Genomics to Resistance and the Development of Novel Agents

• Aquatic Biofilms: Ecology, Water Quality and Wastewater Edited by: AT Coste, P Vandeputte (2015) Treatment www.caister.com/antifungals Edited by: AM Romaní, H Guasch, MD Balaguer (2016) www.caister.com/aquaticbiofilms • Bacteria-Plant Interactions: Advanced Research and Future Trends Edited by: J Murillo, BA Vinatzer, RW Jackson, et al. (2015) • Alphaviruses: Current Biology www.caister.com/bacteria-plant Edited by: S Mahalingam, L Herrero, B Herring (2016) www.caister.com/alpha • Aeromonas Edited by: J Graf (2015) • Thermophilic Microorganisms www.caister.com/aeromonas Edited by: F Li (2015) www.caister.com/thermophile • Antibiotics: Current Innovations and Future Trends Edited by: S Sánchez, AL Demain (2015) www.caister.com/antibiotics

• Leishmania: Current Biology and Control Edited by: S Adak, R Datta (2015) www.caister.com/leish2

• Acanthamoeba: Biology and Pathogenesis (2nd edition) Author: NA Khan (2015) www.caister.com/acanthamoeba2

• Microarrays: Current Technology, Innovations and Applications Edited by: Z He (2014) www.caister.com/microarrays2

• Metagenomics of the Microbial Nitrogen Cycle: Theory, Methods and Applications Edited by: D Marco (2014) www.caister.com/n2

Order from caister.com/order 496 Schmalisch et al.

E. coli and TL5 from T. thermophilus form a complex was constructed as described in the Experimental with 5S rRNA. The structure of the two proteins has been Procedures. This plasmid allows overexpression of solved and represents a distinct RNA-binding motif thecloned gene after induction with IPTG in E. coli 2+ (Gongadze et al., 1996, Stoldt et al., 1998, Fedorov et BL21/pLysS. Ctc-His6 was purified on a Ni chelating al., 2001). Thus, RNA-binding properties of the proteins column. Pure Ctc-His6 eluted at an imdazol concentra- are very well characterized. Both proteins bind strongly tion of 500 mM (see Figure 1). About 3 mg of Ctc-His6 and specifically to a region of the 5S rRNA called loop E were used to immunize rabbits to obtain a polyclonal (Stoldt et al., 1999, Fedorov et al., 2001). The amino antiserum raised against Ctc. acid residues in TL5 and L25 that interact with the 5S rRNA are well conserved in Ctc and in Ctc homologues Localization of Ctc in Ribosomes from different bacteria (Stoldt et al., 1999, Fedorov et al., To test the possibility that Ctc may be a ribosomal 2001). Thus, Ctc of B. subtilis might be a ribosomal protein, we performed experiments to detect Ctc in protein. purified B. subtilis ribosomes. For the preparation of The gene encoding L25 of E. coli, rplY,isstrongly intact ribosomes, cells of B. subtilis 168 and the constitutively expressed as are the known genes isogenic Dctc mutant GP500 were grown in LB medium coding for ribosomal proteins in B. subtilis (Karlin and the ribosomes were purified from heat-stressed and et al., 2001). In contrast, ctc is expressed weakly during control cultures (Figure 2A). Inspection of the purified logarithmic growth but strongly induced after stress. ribosomes failed to indicate the presence of Ctc in any This expression pattern suggests that Ctc may not be of the preparations. It was therefore possible that the necessary as a ribosomal component under normal amount of Ctc was below the limit of detection by conditions but that it becomes part of the ribosome Coomassie Blue stain. Similarly, Ctc was not detectable under stress conditions. The implication of a ribosomal in ribosomal preparation after silver staining (data not protein in the activation of the stress response of shown). To circumvent this problem, a Western blot B. subtilis was already demonstrated for the L11 protein analysis was perfomed. Using antibodies raised against which is required for the activation of sB in response to His-tagged Ctc signals were detected in protein extracts environmental stress (Zhang et al., 2001). from cultures exposed to a heat shock. In contrast, no In this work, we demonstrate that Ctc is indeed a Ctc was detectable in unstressed cells. As expected, ribosomal protein that binds 5S rRNA. While Ctc was Ctc was absent from protein extracts of the Dctc mutant undetectable in ribosomal protein extracts from expo- strain GP500. As shown in Figure 2B, Ctc was present nentially growing cultures, it was present in extracts in purified ribosomes of B. subtilis 168 obtained after a prepared from stressed cultures of B. subtilis.This heat shock. However, this result did not rule out the finding suggests that Ctc might play a role in transla- possibility that Ctc was just loosely associated to the tion in stressed cells. ribosomes. Therefore, we assayed the presence of a non-ribosomal protein, the HPr protein of the phospho- Results transferase system, in the ribosome preparations by Western blot analysis with antibodies raised against Purification of Ctc-His6 His-tagged HPr. While HPr was present in the cell In order to have Ctc available for both assays of extracts of both the mutant and the wild type strains interaction with its potential target RNA and for the under both conditions tested, it was not detectable in generation of antibodies, we decided to purify the Ctc any of the ribosome preparations (Figure 2C). Similarly, protein. To facilitate the purification, a plasmid encoding therepressor CggR and the glyceraldehyde 3-phos- Ctc with a C-terminal hexahistidine sequence (pGP807) phate dehydrogenase GapA were absent from our

2+ Figure 1. Purification of Ctc-His6.Ctc-His6 was overexpressed in E. coli BL21/pLysS and purified using a Ni -NTA column. The fractions were analyzed on a 12.5% SDS polyacrylamide gel. Lane 1: molecular weight marker; lanes 2–4: flow through; lanes 5–10: fractions from the washing step; lanes 11–12: pure Ctc-His6 from the elution step. Function of the General Stress Protein Ctc 497

Figure 2. SDS-PAGE and Western blot analysis to localize Ctc in B. subtilis ribosomes. Both crude and ribosomal protein extracts were analyzed by SDS-PAGE (A) and immunodetection with antibodies against Ctc (B) and HPr (C). Sizes of molecular weight marker (lane 1) are indicated on the left.

100 ng of purified HPr (lane 2) and Ctc-His6 (lane 3) were loaded on the gel. Crude protein extracts and ribosome from control (lanes 4, 6, 8, 10) and heat-shocked cultures (lanes 5, 7, 9, 11) were isolated as described in Experimental procedures. 10 mgofcrudeprotein extracts of the wild type strain 168 (lanes 4, 5) and the Dctc mutant GP500 (lanes 6, 7) were loaded on the gel. Ribosome preparations of both the wild type strain (lanes 8, 9) and the Dctc mutant (lanes 10, 11) were analyzed. 10 mgproteinextracts of a DptsGHI mutant were used to identify the HPr band (lane 12).

purified ribosomes (data not shown). Taken together, The obvious binding of Ctc-His6 to the 5S rRNA these data demonstrate that Ctc is present in ribosomes might be due to an ability of Ctc to unspecifically bind after a heat stress. RNA. To verify that the observed interaction is specific, we repeated the interaction assays in the presence of Specific Interaction of Ctc with 5S rRNA a non-specific RNA. Non-specific competitor RNA The presence of Ctc in ribosomes and the high similarity was used inatwofoldexcess.Asshown in Figure 4, with proteins binding 5S rRNA suggested that this RNA 5S rRNA was efficiently bound by Ctc even in the might be the target of Ctc. This hypothesis was tested presence of non-specific RNA (compare lanes 2 and 3). by gel retardation experiments. B. subtilis 5S rRNA was prepared by in vitro transcription as described in Discussion Experimental Procedures. Increasing amounts of Ctc- His6 were incubated with 6 mg5SrRNA.Asshownin Ctc isamongtheB. subtilis general stress proteins that Figure 3, the 5S rRNA was retarded if the molar excess have been investigated for a long time. However, the of Ctc-His6 was threefold or more. A complete retarda- function of Ctc has so far not been elucidated. Based on tion of 5S rRNA was observed at a fivefold excess of Ctc results that demonstrate that homologues of Ctc from (see Figure 3, lane 8). other organisms are ribosomal proteins (Gryaznova 498 Schmalisch et al.

Figure 3. Interaction of Ctc-His6 with 5S rRNA. The different samples were analyzed on a 4% native agarose gel as described in Experimental procedures. 6 mgof5SrRNAwereloadedonthegel(lane 1). Interaction between Ctc-His6 and 5S rRNA was tested by adding increasing amounts of Ctc-His6 to the 5S rRNA. Molar ratios of 1:1 (lane 2), 1:1,5 (lane 3), 1:2 (lane 4), 1:2,5 (lane 5), 1:3 (lane 6), 1:3,5 (lane 7) and 1:5 (lane 8) were used. et al., 1996; Harms et al., 2001), we tested whether Ctc amounts (Hilden et al., 1995). Our Western blots failed in B. subtilis might also be a component of the to reproducibly detect Ctc both in cell extracts from ribosome. unstressed cells and in the ribosomes isolated from So far, 53 ribosomal proteins have been described these extracts. Taking into account the large number of in B. subtilis.Homologues of L25 from E. coli or TL5 ribosomes in exponentially growing cells and the usual from T. thermophilus have not yet been identified in high expression of genes encoding ribosomal proteins B. subtilis ribosomes (Henkin, 2002). The data pre- (Karlin et al., 2001), it is very unlikely that Ctc plays a sented in this work unequivocally demonstrate that Ctc significant role in ribosomes of unstressed growing is indeed a ribosomal protein. One aspect, however, cells. distinguishes the ribosomes of B. subtilis from all other The obvious exclusive association of Ctc with the ribosomes that contain L25 and/or TL5 homologues: ribosome under stress conditions raises the question of In the latter, L25 or TL5 are constitutive components of its function in the ribosome. As observed for L25 and the ribosomes whereas B. subtilis Ctc is detectable in TL5, Ctc specifically binds the 5S rRNA. This interaction ribosomes only after the cells were exposed to stress involves the N-terminal domain of TL5, and therefore conditions. It is known that Ctc is present in the cells probably also of Ctc (Gongadze et al., 1999). The stru- even during lorarithmic growth, however, in very small cture of the large ribosomal subunit of Deinococcus

Figure 4. Gel mobility shift assays on a 4% agarose gel in the presence of unspecific RNA. 5S rRNA (lane 1) aund unspecific RNA (lane 5) were mixed in a ratio of 1:2 (lane 4). 5S rRNA was incubated with Ctc-His6 in amolar ratio of 1:5 in the absence (lane 2) or presence of unspecific RNA (lane3). Function of the General Stress Protein Ctc 499 radiodurans revealed that Ctc is localized in this DNA Manipulation organism at the interface between the large and the Transformation of E. coli and plasmid DNA extraction was performed using standard procedures (Sambrook et al., 1989). Restriction small subunits of the ribosome (Harms et al., 2001). enzymes, T4 DNA ligase and DNA polymerases were used as Similar results were obtained with L25 from E. coli by recommended by the manufacturers. DNA fragments were purified immunological mapping (Herfurth and Wittmann-Lie- from agarose gels using the Nucleospin extract kit (Macherey and bold, 1995). While L25 is made up of just one (the N- Nagel). Pfu DNA polymerase was used for the polymerase chain reaction (PCR) as recommended by the manufacturer. DNA se- terminal domain), its D. radiodurans counterpart is quences were determined using the dideoxy chain termination method composed of three domains: the N-terminal domain (Sambrook et al., 1989). Chromosomal DNA of B. subtilis was isolated that binds 5S rRNA, a middle domain that is homologous as described (Kunst and Rapoport, 1995). B. subtilis was transformed with plasmid DNA according to the two-step protocol (Kunst and to the C-terminal domain of Ctc and a third domain that Rapoport, 1995). Transformants were selected on SP plates contain- 1 has no counterparts in any other Ctc homologues ing spectinomycin (Spc, 100 mgmlÀ ). (Harms et al., 2001). The middle domain of D. radio- durans Ctc fills a gap between the 5S rRNA and the L11 Construction of a Dctc Mutant Strain protein. This might point to the function of Ctc in B. To delete the ctc gene from the chromosome of B. subtilis,weused plasmid pGP803 which contains the flanking regions of ctc and a spc subtilis ribosomes: it was recently shown that L11 is gene conferring resistance to spectinomycin instead of ctc.pGP803 B required forstressactivationofs ,the master regulator was constructed in several steps as follows: A fragment of 309 bp of the general stress response (Zhang et al., 2001). corresponding to the region of the chromosome immediately down- Thus, Ctc may somehow be involved in the regulation of stream of ctc was amplified by PCR using the primers MS6 (5 AAAGGATCCGAAGTATATGCATGCTGTACACACCCT) and MS8 the stress response. Moreover, the middle domain of 0 (50AAAGAATTCAGTTGCCATATTCAGCACCATCCTCTT). The PCR D. radiodurans Ctc interacts with a helix of the 23S rRNA product was digested with BamHI and EcoRI (restriction sites were (H38) and partially wraps the central protuberance of introduced with the PCR primers, underlined in the sequence). The + the large ribosomal subunit. These interactions are fragment was cloned into pBluescriptIISK (Stratagene) cut with the same enzymes to give plasmid pGP801. The region upstream of ctc thought to provide additional stability (Harms et al., (279 bp fragment) was amplified using the primers MS4 2001). This function may be of special significance (50 AAAGAATTCGAAAACGAACAATAATAGCTTAAGGCG) and MS5 under the adverse conditions that D. radiodurans or (50 AAAAGCTTTAACAAGTAGAACCTTTTTGCCGGAAA). The PCR product was digested with EcoRI and HindIII and cloned into pGP801. T. thermophilus are often exposed to. Moreover, it might The resulting plasmid was pGP802. A 1.4 kb EcoRI fragment of pSpec also be an important function for B. subtilis Ctc, to (P. Trieu-Cuot, Institut Pasteur, France) containing the spc gene, stabilize the ribosome under stress conditions. which confers resistance to spectinomycin, was inserted into the If Ctc was required for the stabilization of the unique EcoRI site of pGP802. The resulting plasmid, pGP803, was linearized with ScaI and used for transformation of B. subtilis 168. The ribosome under stress conditions or for the activation of successful deletion of ctc in the chromosome of the resulting strain the stress response, one would expect that ctc mutants GP500 was verified by analyzing the chromosomal DNA by PCR with might exhibit some defects under stress conditions. several appropriate primer pairs. However, the complete general stress regulon is not essential unless essayed under very specific conditions Overexpression of Ctc-His6 To facilitate the purification of Ctc, we fused the protein to a C-terminal (Hecker and Vo¨ lker, 2001; Price, 2002). Similarly, hexahistidine sequence. The ctc coding region was amplified using the experiments with our Dctc mutant did not reveal any primers MS11 (50 AAACATATGGCAACTTTAACGGCAAAAGAA) and growth defects or specific deficiencies in survival under MS13 (50 AAAGGATCCCATTTAGTGATGGTGATGGTGATG- stress conditions. Moreover, defects in translation of a CATTTGTTCGTTTTCACCTTCAGGCTG). MS13 was designed to allow to attach a DNA fragment encoding a hexahistidine sequence ctc-bgaB fusion that is induced upon heat stress could to the C-terminus of Ctc. The PCR product was digested with NdeI not be observed in the Dctc mutant strain. Thus, the and BamHI and cloned into pET3c (Novagen). The resulting plasmid sporulation defect at elevated temperatures remains pGP807 was verified by DNA sequencing. the only known phenotype of a ctc mutant (Truitt et al., For overexpression, E. coli BL21(DE3)/pLysS was transformed with pGP807. Expression was induced by the addition of IPTG (final 1988). Sporulation involves a complex program of gene concentration 1 mM) to logarithmically growing cultures (OD600 of 0.6). expression which may require perfect action of all The crude extracts were passed over a Ni2+ HiTrap chelating column components of the transcription, translation, secretion (Pharmacia) followed by elution with an imidazole gradient. The Bio- Rad dye-binding assay was used to determine protein concentration. and protein folding machineries. Even subtle adverse Bovine serum albumin was used as the standard. effects caused by a ctc mutation may thus result in impaired sporulation at high temperatures. In vitro Transcription Now that the action of Ctc as a ribosomal protein is To obtain a template for the in vitro synthesis of the 5S rRNA, a 112 bp clear it will be interesting to device experiments aimed PCR product wasgenerated using chromosomal DNA of B. subtilis as template and primers MS9 (5 CTAATACGACTCACTATAGGGA- at the elucidation of the function of Ctc in the ribosome 0 GATTTGGTGGCGAT) and MS10 (50 GCTTG GCGGCGTCCTACTCT). under stress conditions. The presence of a T7 RNA polymerase recognition site on primer MS19 (underlined) allowed the use of the PCR product as a template for in Experimental Procedures vitro transcription with T7 RNA polymerase (Roche Diagnostics). As a non-specific RNA, a bicistronic 2 kb cggR-gapA transcript was prepared as described previously (Ludwig et al., 2001). The integrity Bacterial Strains and Culture Media of the RNA transcripts was analyzed by denaturating agarose gel The Bacillus subtilis strains were derivatives of the 168 Marburg strain. electrophoresis (Homuth et al., 1997). These included the wild type (trpC2), the DptsGHI mutant strain GM329 (Eiserman et al., 1988) and the ctc deletion mutant GP500 (trpC2 Dctc::spc,fordetails of construction, see below). Escherichia coli DH5a Assay of Interaction Between Ctc and 5S rRNA (Sambrook et al., 1989) and BL21(DE3)/pLysS (Studier, 1991) were Binding of Ctc-His6 to 5S rRNA was analyzedbygel retardation used for cloning and overexpression experiments, respectively. E. coli experiments. The 5S rRNA (in 10 mM MgCl2,89mMTris-borate pH8.3, and B. subtilis were grown in LB medium. LB or SP plates were 1mMEDTA) was denatured by incubation at 80Cfor5minutes and prepared by the addition of 17 g Bacto agar/l (Difco) to the medium. renatured by slowly cooling down at room temperature. If required, 500 Schmalisch et al. non-specific RNA was renatured separately and mixed with the 5S Gaidenko, T.A., and Price, C.W. 1998. General stress transcription B H rRNA prior to protein addition. Purified Ctc-His6 was added to the 5S factor s and sporulation transcription factor s each contribute rRNA and the samples were incubated for 10 minutes at room to survival of Bacillus subtilis under extreme growth conditions. temperature. After this incubation, glycerol was added to a final J. Bacteriol. 180: 3730–3733. concentration of 10% (w/v). The samples were then analyzed on 4% Gerth, U., Kru¨ ger, E., Derre´ ,I.,Msadek, T., and Hecker, M. 1998. agarose gels. Stress induction of the Bacillus subtilis clpP gene encoding a homologue of the proteolytic component of the ClpP protease and Preparation of 70S Ribosomes from B. subtilis Cells the involvement of ClpP and ClpX in stress tolerance. Mol. Microbiol. Cultures of B. subtilis were grown inLBmediumtoanOD600 of 0.3. 28: 787–802. An aliquot of the culture was transferred to 48C(heat stress). Gongadze,G.,Kashparov,I.,Lorenz,S.,Schroeder,W.,Erdmann,V.A., 30 min after exposure to heat stress, the stressed and the untreated Liljas, A., and Garber, M. 1996. 5S rRNA binding ribosomal proteins control culture were harvested and resuspended in ribosomal buffer I from Thermus thermophilus:identification and some structural (20 mM Tris-Cl pH 7.5; 100 mM NH4Cl; 10 mM MgCl2;10mM properties. FEBS Lett. 386: 260–262. 2-mercaptoethanol). After cell disruption using a French press the Gongadze, G.M., Meshcheryakov, V.A., Serganov, A.A., Fomenkova, extract was incubated with 20 units DNase (RNase free) for N.P., Mudrik, E.S., Jonsson, B.-H., Liljas, A., Nokonov, S.V., and 20 minutes on ice. After two centrifugation steps (6,400 g, 4C, Garber, M.B. 1999. N-terminal domain, residues 1–91, of ribosomal  30 min; 30,000 g, 4C, 30 min) the supernatant was layered on a protein TL5 from Thermus thermophilus binds specifically and  sugar cushion (1.1 M sucrose). After a further centrifugation strongly to the region of 5S rRNA containing loop E. FEBS Lett. (120,000 g, 4C, 18 h) the pellet containing the intact ribosomes 451: 51–55.  was washed with ice-cold ribosomal buffer II (20 mM Tris-Cl pH 7.5; Gryaznova, O.I., Davydova, N.L., Gongadze, G.M., Jonsson, B.H., 100 mM NH4Cl; 6 mM MgCl2;3mMdithiothreitol) and suspended in Garber, M.B., and Liljas, A. 1996. A ribosomal protein from Thermus the same buffer. After a final centrifugation (10,000 g, 4C, 10 min) thermophilus is homologous to a general shock protein. Biochimie  the pure ribosomes were present in the supernatant. The concentra- 78: 915–919. tion of the ribosomes was adjusted to 500 A260/mlandthesamples Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, were stored at 80C. I., Bartels, H., Franceschi, F., and Yonath, A. 2001. High resolution À structure of the large ribosomal subunit from a mesophilic eubacter- Western Blot Analysis ium. Cell 107: 679–688. Purified Ctc-His6 was injected to rabbits to generate polyclonal Hecker, M., Schumann, W., and Vo¨ lker, U. 1996. Heat-shock and antibodies. For Western blot analysis, B. subtilis cell extracts and general stress response in Bacillus subtilis.Mol.Microbiol.19: ribosomes were separated on 12.5% SDS-PAA gels and transferred to 417–428. apolyvinylidene difluoride membrane (Fluorotrans) by electroblotting. Hecker, M., and Vo¨ lker, U. 2001. General stress response of Bacillus Ctc and HPr were detected with polyclonal antibodies. Antibodies subtilis and other bacteria. Adv. Microbial Physiol. 44: 35–91. raised against His-tagged HPr from B. subtilis (Monedero et al., 2001) Henkin, T.M. 2002. Ribosomes, protein synthesis factors, and tRNA were a kind gift from J. Deutscher. synthetases. In Bacillus subtilis and its closest relatives: From genes to cells. A.L. Sonenshein, J.A. Hoch, and R. Losick, eds. Washington, DC: American Society for Microbiology Press, pp. 313– Acknowledgements 322. Herfurth, E., and Wittmann-Liebold, B. 1995. Determination of peptide We wish to thank Matthias Go¨ rlach and Anders Liljas for drawing our regions exposed at the surface of the bacterial ribosome with attention to Ctc. We are grateful to Rolf Wagner for useful tips for the antibodies against synthetic peptides. Biol. Chem. Hoppe Seyler preparation of ribosomes and Josef Deutscher for the gift of antibodies 376: 81–90. against HPr from B. subtilis. Uwe Vo¨ lker and Matthias Brigulla are Hilden, I., Krath, B.N., and Hove-Jensen, B. 1995. Tricistronic operon acknowledged for helpful discussions. expression of the genes gcaD (tms), which encodes N-acetylgluco- This work was supported by the Deutsche Forschungsgemeinschaft samine 1-phosphate uridyltransferase, prs,whichencodes phos- through SFB 473 ‘‘Schaltvorga¨ nge der Transkription’’. I.L. was phoribosyl diphosphate synthetase, and ctc in vegetative cells of supported by a personal grant from the Boehringer Ingelheim Fonds. Bacillus subtilis.J.Bacteriol. 177: 7280–7284. Homuth, G., Masuda, S., Mogk, A., Kobayashi, Y., and Schumann, W. 1997.ThednaK operon of Bacillus subtilis is heptacistronic. References J. Bacteriol. 179: 1153–1164. Karlin, S., Mrazek, J., Campbell, A., and Kaiser, D. 2001. Character- Antelmann, H., Engelmann, S., Schmid, R., and Hecker, M. 1996. ization of highly expressed genes of four fast-growing bacteria. General and oxidative stress response in Bacillus subtilis:cloning, J. Bacteriol. 183: 5025–5040. expression, and mutation of the alkyl hydroperoxide reductase Kempf, B., and Bremer, E. 1998. Uptake and synthesis of compatible operon. J. Bacteriol. 178: 6571–6578. solutes as microbial stress responses to high-osmolality environ- Benson, A.K., and Haldenwang, W.G. 1992. Characterization of a ments. Arch. Microbiol. 170: 319–330. B regulatory network that controls s expression in Bacillus subtilis. Kru¨ ger, E., Vo¨ lker,U., and Hecker, M. 1994. Stress induction of clpC J. Bacteriol. 174: 749–757. in Bacillus subtilis and its involvement in stress tolerance. Bernhardt, J., Vo¨ lker, U., Vo¨ lker, A., Antelmann, H., Schmid, R., J. Bacteriol. 176: 3360–3367. Mach, H., and Hecker, M. 1997. Specific and general stress proteins Kunst, F., and Rapoport, G. 1995. Salt stress is an environmental in Bacillus subtilis –atwo-dimensional protein electrophoresis study. signal affecting degradative enzyme synthesis in Bacillus subtilis. Microbiology 143: 999–1017. J. Bacteriol. 177: 2403–2407. Deckert, G., Warren, P.V., Gaasterland, T., Young, W.G., Lenox, A. L., Ludwig, H., Homuth, G., Schmalisch,M., Dyka, F.M., Hecker, M., and Graham, D.E., Overbeek, R., Snead, M.E., Keller, M., Aujay, M., Stu¨ lke, J. 2001. Transcription of glycolytic genes and operons in Huber, R., Feldman, R.A., Short, J.M., Olsen, G.J., and Swanson, R.V. Bacillus subtilis:evidence for the presence of multiple levels of 1998. The complete genome of the hyperthermophilic bacterium control of the gapA operon. Mol. Microbiol. 41: 409–422. Aquifex aeolicus.Nature 392: 353–358. Monedero, V., Poncet, S., Mijakovic, I., Fieulaine, S., Dossonnet, V., Eisermann, R., Deutscher, J., Gonzy-Tre´ boul, G., and Hengsten- Martin-Verstraete, I., Nessler, S., and Deutscher, J. 2001. Mutations berg, W. 1988. Site-directed mutagenesis with the ptsH gene of lowering the phosphatase activity of HPr kinase/phosphatase switch Bacillus subtilis. J. Biol. Chem. 263: 17050–17054. off carbon metabolism. EMBO J. 20: 3928–3937. Engelmann, S., Lindner, C., and Hecker, M. 1995. Cloning, nucleotide Ollington, J.F., Haldenwang, W.G., Huynh, T.V., and Losick, R. 1981. B sequence, and regulation of katE encoding a s -dependent catalase Developmentally regulated transcription in a cloned segment of the in Bacillus subtilis.J.Bacteriol. 177: 5598–5605. Bacillus subtilis chromosome. J. Bacteriol. 147: 432–442. Fedorov, R., Meshcheryakov, V.,Gongadze, G., Fomenkova, N., Petersohn, A., Bernhardt, J., Gerth, U., Ho¨ per, D., Koburger, T., Nevskaya, N., Selmer, M., Laurberg, M., Kristensen, O., Al-Karada- Vo¨ lker, U., and Hecker, M. 1999. Identification of sB-dependent ghi, S., Liljas, A., Garber, M., and Nikonov, S. 2001. Structure of genes in Bacillus subtilis using a promoter consensus-directed ribosomal protein TL5 complexed with RNA provides new insights into search and oligonucleotide hybridization. J. Bacteriol. 181: theCtc family of stress proteins. Acta Cryst. Sect. D 57: 968–976. 5718–5724. Function of the General Stress Protein Ctc 501

Petersohn, A., Brigulla, M., Haas, S., Hoheisel, J.D., Vo¨ lker, U., and complex shows performed and induced recognition. EMBO J. 18: Hecker, M. 2001. Global analysis of the general stress reponse of 6508–6521. Bacillus subtilis.J.Bacteriol. 183: 5617–5631. Studier, F.W. 1991. Use of bacteriophage T7 lysozyme to improve an Price, C.W., Fawcett, P., Ce´ re´ monie, H., Su, N., Murphy, C.K., and inducible T7 expression system. J. Mol. Biol. 219: 37–44. Youngman, P. 2001. Genome-wide analysis of the general stress Truitt, C.L., Weaver, E.A., and Haldenwang, W.G. 1988. Effects on response in Bacillus subtilis.Mol. Microbiol. 41: 757–774. growth and sporulation of inactivation of a Bacillus subtilis gene (ctc) Price, C.W. 2002. General stress response. In: Bacillus subtilis and its transcribed in vitro by minor vegetative cell RNA polymerases closest relatives: From genes to cells. Sonenshein, A.L., Hoch, J. A., (E-s37,E-s32). Mol. Gen. Genet. 212: 166–171. and Losick, R. eds. Washington, DC: American Society for Micro- Vo¨ lker, U., Engelmann, S., Maul, B., Riethdorf, S., Vo¨ lker, U., biology Press, pp. 369–384. Schmid, R., Mach, H., and Hecker, M. 1994. Analysis of the Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: induction of general stress proteins of Bacillus subtilis.Microbiology alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold 140: 741–752. Spring Harbor, N.Y. Vo¨ lker, U., Maul, B., and Hecker, M. 1999. Expression of the sB- Stoldt, M., Wo¨ hnert, J., Go¨ rlach, M., and Brown, L.R. 1998. The NMR dependent general stress regulon confers multiple stress resistance structure of Escherichia coli ribosomal protein L25 shows homology in Bacillus subtilis.J.Bacteriol. 181: 3942–3948. to general stress proteins and glutamyl-tRNA synthetases. EMBO J. Zhang, S., Scott, J.M., and Haldenwang, W.G. 2001. Loss of 17: 6377–6384. ribosomal protein L11 blocks stress activation of the Bacillus subtilis Stoldt, M., Wo¨ hnert, J., Ohlenschla¨ ger, O., Go¨ rlach, M., and Brown, L.R. transcription factor sB.J.Bacteriol. 183: 2316–2321. 1999. The NMR structure of the 5S rRNA E-domain-protein L25