Myrosinase in Leafy Brassica

Home , Acephala group, Myrosinase

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by ScholarBank@NUS

MYROSINASE IN LEAFY BRASSICA

HE BINGJIE [B.Sc. (THU, PRC)]

A THESIS SUBMITTED

FOR THE DEGREE OF MASTER OF SCIENCE

DEPARTMENT OF BIOLOGICAL SCIENCES

NATIONAL UNIVERSITY OF SINGAPORE

2006

────────────────────────────────

ACKNOWLEDGEMENTS

────────────────────────────────

I would like to express my gratitude to all those who gave me the possibility to complete this thesis.

I want to thank the National University of Singapore and the Department of Biological Sciences for providing me the opportunity and scholarship to sponsor my study here.

I am deeply indebted to my supervisor, Dr. Ong Bee Lian, whose help, stimulating suggestions and encouragement helped me in all the time of research for and writing of this thesis.

My colleagues, Miss Lim Hui Qin, Mr. Dennis Heng Mok Wei and Mr.

Edmund Chen Xuan Ting from the Department of Biological Science supported me in my research work. I want to thank them for all their help, support, interest and valuable hints.

Especially, I would like to give my special thanks to my parents, Mr He

Yuying and Ms Wang Lianrong, whose patient love enabled me to complete this work.

────────────────────────────────

CONTENTS

────────────────────────────────

ACKNOWLEDGEMENTS...... I CONTENTS...... i LIST OF TABLES...... iv LIST OF PLATES ...... v LIST OF FIGURES ...... vi SUMMARY...... ix

CHAPTER I. INTRODUCTION...... 1

CHAPTER II. LITERATURE REVIEW ...... 3 2.1. Brassica vegetables...... 3 2.2. Glucosinolates ...... 6 2.2.1. Composition and level of glucosinolates...... 8 2.2.2. Products of glucosinolates hydrolysis ...... 11 2.3. Myrosinase ...... 12 2.3.1. Occurrence of myrosinases...... 14 2.3.2. Factors affecting myrosinase activity ...... 14 2.3.3. The myrosin cell...... 15 2.3.4. Cellular and subcellular localization of myrosinase...... 17 2.3.5. Distribution of myrosinase isoenzymes...... 20 2.3.6. Myrosinase subfamilies...... 22 2.3.7. Gene structure of Myrosinase...... 27 2.4. The Glucosinolates-Myrosinase system...... 32 2.4.1. Organisation of the myrosinase-glucosinolates system...... 32 2.4.2. Role of the myrosinase-glucosinolates system...... 35

CHAPTER III. MATERIALS AND METHODS ...... 38 3.1. Plant Materials ...... 38 3.1.1. Effects of temperature and pH on myrosinase activity of Chinese flowering cabbage and Chinese kale...... 38 3.1.2. Chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity and myrosinase activity of marketable Brassica vegetables ...... 38 3.1.3. Effects of post harvest storage on chlorophyll concentration, total anti-oxidant capacity, and myrosinase activity in the leaves of Chinese flowering cabbage and Chinese kale ...... 40 3.1.4. Effects of plant age and different [N] fertilizers on chlorophyll concentration, total anti-oxidant capacity and myrosinase activity in different plant organs of the seedlings of Chinese flowering cabbage during early establishment...... 41 3.1.5. Effects of plant age on chlorophyll concentration, anti-oxidant capacity, and myrosinase activity in different organs of mature plants of Chinese flowering cabbage 42 3.1.6. Drought effects on chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity, and myrosinase activity in the leaves of Chinese flowering cabbage ...... 42

i 3.1.7. Total anti-oxidant capacity and myrosinase activity in the leaves of 16 different cultivars of Chinese flowering cabbage (of marketable types) ...... 43 3.1.8. Molecular study on myrosinase in the leaves of 16 different cultivars of Chinese flowering cabbage ...... 43 3.2. Preparation of Hoagland solution...... 45 3.3. Chlorophyll concentration...... 45 3.4. Chlorophyll fluorescence ...... 47 3.5. Total anti-oxidant capacity ...... 47 3.6. Crude extraction of myrosinase and activity determination...... 48 3.7. Total soluble protein concentration ...... 50 3.8. Molecular study on myrosinase...... 50 3.8.1. Total DNA extraction...... 50 3.8.2. Primer description and PCR (polymerase chain reaction)...... 52 3.8.3. Gradient PCR and sequencing...... 53

CHAPTER IV. RESULTS...... 56 4.1. Effects of temperature and pH on myrosinase activity of Chinese flowering cabbage and Chinese kale ...... 56 4.1.1. Optimal temperature for myrosinase ...... 56 4.1.2. Optimal pH value for myrosinase...... 58 4.2. Chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity, and myrosinase activity of marketable Brassica vegetables ...... 59 4.2.1. Chlorophyll concentration...... 61 4.2.2. Chlorophyll fluorescence parameters ...... 63 4.2.3. Total anti-oxidant capacity ...... 65 4.2.4. Myrosinase activity ...... 65 4.3. Effects of post harvest storage on chlorophyll concentration, total anti-oxidant capacity, and myrosinase activity in the leaves of Chinese flowering cabbage and Chinese kale ...... 68 4.3.1. Effects of post harvest storage on chlorophyll concentration...... 68 4.3.2. Effects of post harvest storage on total anti-oxidant capacity ...... 72 4.3.3. Effects of post harvest storage on myrosinase activity...... 72 4.4. Effects of plant age and different [N] fertilizers on chlorophyll concentration, total anti-oxidant capacity and myrosinase activity in different plant organs of the seedlings of Chinese flowering cabbage during early establishment ...... 79 4.4.1. Chlorophyll concentration...... 79 4.4.2. Total anti-oxidant capacity ...... 85 4.4.3. Myrosinase activity ...... 87 4.5. Effects of plant age on chlorophyll concentration, total anti-oxidant capacity, and myrosinase activity in different organs of mature plants of Chinese flowering cabbage...... 92 4.5.1. Chlorophyll concentration...... 92 4.5.2. Total anti-oxidant capacity ...... 94 4.5.3. Myrosinase activity ...... 96 4.6. Drought effects on chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity, and myrosinase activity in the leaves of Chinese flowering cabbage ..97 4.6.1. Drought effect on chlorophyll concentration...... 99 4.6.2. Drought effect on chlorophyll fluorescence parameters...... 101 4.6.3. Drought effect on total anti-oxidant capacity ...... 101 4.6.4. Drought effect on myrosinase activity...... 101 4.7. Total anti-oxidant capacity and myrosinase activity in the leaves of 16 different cultivars of Chinese flowering cabbage (of marketable types)...... 105 4.7.1. Total anti-oxidant capacity ...... 105 4.7.2. Myrosinase activity ...... 107 4.8. Molecular study on myrosinase in the leaves of 16 different cultivars of Chinese flowering cabbage ...... 110

CHAPTER V. DISCUSSION...... 112 5.1. Effects of temperature and pH on myrosinase activity of Chinese flowering cabbage and

ii Chinese kale ...... 117 5.1.1. Optimum temperature for myrosinase...... 117 5.1.2. Optimum pH value of myrosinase activity...... 119 5.2. Chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity, and myrosinase activity of the marketable Brassica vegetables ...... 120 5.2.1. Chlorophyll concentration and chlorophyll fluorescence parameters ...... 120 5.2.2. Total anti-oxidant capacity ...... 124 5.2.3. Myrosinase activity ...... 125 5.3. Effects of post harvest storage on chlorophyll concentration, total anti-oxidant capacity, and myrosinase activity in the leaves of Chinese flowering cabbage and Chinese kale ...... 126 5.3.1. Effects of post harvest storage on chlorophyll concentration...... 127 5.3.2. Effects of post harvest storage on total anti-oxidant capacity ...... 128 5.3.3. Effects of post harvest storage on myrosinase activity...... 129 5.4. Effects of plant age and different [N] fertilizers on chlorophyll concentration, total anti-oxidant capacity and myrosinase activity in different organs of the seedlings of Chinese flowering cabbage during early establishment...... 131 5.4.1. Chlorophyll concentration...... 132 5.4.2. Total anti-oxidant capacity ...... 134 5.4.3. Myrosinase activity ...... 135 5.5. Effects of plant age on chlorophyll concentration, total total anti-oxidant capacity, and myrosinase activity in different organs of mature plants of Chinese flowering cabbage...... 137 5.5.1. Chlorophyll concentration...... 138 5.5.2. Total antioxidant capacity...... 139 5.5.3. Myrosinase activity ...... 140 5.6. Drought effects on chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity, and myrosinase activity in the leaves of Chinese flowering cabbage 141 5.6.1. Drought effect on chlorophyll concentrations ...... 143 5.6.2. Drought effect on chlorophyll fluorescence ...... 144 5.6.3. Drought effect on anti-oxidant capacity ...... 145 5.6.4. Drought effect on myrosinase activity...... 145 5.7. Total antioxidant capacity and myrosinase activity in the leaves of 16 different cultivars of Chinese flowering cabbage ...... 147

CHAPTER VI. GENERAL CONCLUSIONS ...... 149

CHAPTER VII. REFERENCE...... 152

iii

────────────────────────────────

LIST OF TABLES

────────────────────────────────

Table 1. Basic information of the 16 tested cultivars of Chinese flowering cabbage as provided by Agri-Food & Veterinary Authority of Singapore...... 44 Table 2. Ingredients of Hoagland solutions with different nitrogen concentrations. All solutions were made up to one liter with distilled water...... 46 Table 3. Basic information of the primer [MYRO] that was tested...... 54 Table 4. PCR programs for the primer [MYRO] that was tested...... 55

────────────────────────────────

LIST OF PLATES

────────────────────────────────

Plate 1. Commonly consumed marketable Brassica vegetables: Chinese kale (A), Chinese flowering cabbage (B), broccoli (C), cauliflower (D), cabbage (E) and Chinese white cabbage (F)...... 39 Plate 2. Agarose gel electrophoresis of PCR products. The PCR programs were performed according to the annealing temperatures of the pair of primers of MYRO gene. The PCR products of 16 cultivars were loaded as indicated...... 111

────────────────────────────────

LIST OF FIGURES

────────────────────────────────

Figure 1. Influences of temperature on myrosinase activity in Chinese flowering cabbage and Chinese kale. The properties investigated were total activity of myrosinase. Each datum point is presented as mean standard error (vertical bar); n=4...... 57 Figure 2. Influences of pH on myrosinase activity in Chinese flowering cabbage and Chinese kale. The phosphate buffer was adjusted to different pH values for this experiment. The properties investigated were total activity of myrosinase (A), specific activity of myrosinase (B) and total soluble protein concentration (C). Each datum point is presented as mean standard error (vertical bar). n=4 ...... 60 Figure 3. Total chlorophyll concentrations (A), chlorophyll a to chlorophyll b ratios (B), total carotenoid concentrations (C) and total chlorophyll to total carotenoid ratios (D) of six commonly eaten Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4.62 Figure 4. Chlorophyll fluorescence parameters of the leaves of four leafy Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4...... 64 Figure 5. Total anti-oxidant capacity (mg AA g-1 FW) of six commonly eaten Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4...... 66 Figure 6. Total myrosinase activity (A), specific activity of myrosinase (B) and total soluble protein concentration (C) in six commonly eaten Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4...... 67 Figure 7. The effects of duration and temperature of post harvest storage on the total chlorophyll concentration (A), chlorophyll a/b ratio (B), total carotenoid concentration (C) and total chlorophyll to total carotanoids ratio (D) in the leaves of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4...... 69 Figure 8. The effects of duration and temperature of post harvest storage on the total chlorophyll concentration (A), chlorophyll a/b ratio (B), total carotenoid concentration (C) and total chlorophyll to total carotanoids ratio (D), in the leaves of Chinese kale. Each datum point is presented as mean standard error (vertical bar). n=4...... 70 Figure 9. The effects of duration and temperature of post harvest storage on the

vi total anti-oxidant capacity in the leaves of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.73 Figure 10. The effects of duration and temperature of post harvest storage on the total anti-oxidant capacity in the leaves of Chinese kale. Each datum point is presented as mean standard error (vertical bar). n=4...... 74 Figure 11. The effects of duration and temperature of post harvest storage on the total myrosinase activity (A), specific activity of myrosinase and total soluble protein concentration (C) in the leaves of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4...... 76 Figure 12. The effects of duration and temperature of post harvest storage on the total myrosinase activity (A), specific activity of myrosinase and total soluble protein concentration (C) in the leaves of Chinese kale. Each datum point is presented as mean standard error (vertical bar). n=4...... 77 Figure 13. Effects of plant age and plant organ on total chlorophyll concentration (A: leaves, E: stems, I: roots), chlorophyll a/b ratio (B: leaves, F: stems, J: roots), total carotenoid concentration (C: leaves, G: stems, K: roots) and total chlorophyll to total carotenoid ratio (D: leaves,H: stems, L:roots) in the seedlings of Chinese flowering cabbage fertilized with 1N, 0.5N and 0N Hoagland solutions. Each datum point is presented as mean standard error (vertical bar).n=4...... 81 Figure 14. Effects of plant age and plant organ on total anti-oxidant capacity in the leaves (A), stems (B), roots (C) of the seedlings of Chinese flowering cabbage fertilized with 1N, 0.5N and 0N Hoagland solutions. Each datum point is presented as mean standard error (vertical bar). n=4...... 86 Figure 15. Effects of plant age and plant organ on total myrosinase activity (A: leaves, D: stems, G: roots), specific activity of myrosinase (B: leaves, E: stems, H: roots) and total soluble protein concentration (C: leaves, F: stems, I: roots) in the Chinese flowering cabbage seedlings fertilized with 1N, 0.5N and 0N Hoagland solutions. Each datum point is presented as mean standard error (vertical bar). n=4...... 89 Figure 16. Effects of plant age on total chlorophyll concentration (A), chlorophyll a/b ratio (B), total carotenoid concentration (C) and total chlorophyll to total carotenoid ratio (D) in different plant organs of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4...... 93 Figure 17. Effects of plant age on total anti-oxidant capacity in different plant organs of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4...... 95 Figure 18. Effects of plant age on total myrosinase activity of myrosinase (A), specific activity of myrosinase (B) and total soluble protein concentration (C) in different plant organs of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4...... 98 Figure 19. Drought effects on total chlorophyll concentration (A), chlorophyll a to b ratio (B), total carotenoid concentration (C), total chlorophyll to total carotanoid ratio (D) in the leaves of Chinese flowering cabbage. The

vii experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar). n=4...... 100 Figure 20. Drought effects on potential quantum efficiency of open PSII reaction centers (Fv/Fm) (A), efficiency of excitation energy capture by open PSII reaction centers (Fv'/Fm') (B), potential for non-cyclic electron transport (DF/Fm') (C), photochemical quenching (qP) (D), non-radiative dissipation via xanthophylls cycle (NPQ) (E) in the leaves of Chinese flowering cabbages. The experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar). n=4...... 102 Figure 21. Drought effects on total anti-oxidant capacity in the leaves of Chinese flowering cabbage. The experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar)...... 103 Figure 22. Drought effects on total myrosinase activity (A),specific activity of myrosinase (B) and total soluble protein concentration (C) in the leaves of Chinese flowering cabbages. The experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar). n=4...... 104 Figure 23. Total anti-oxidant capacity of the leaves of sixteen different cultivars of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4...... 106 Figure 24. Total myrosinase activity (A), specific activity of myrosinase (B) and total soluble protein concentration (C) in the leaves of sixteen different cultivars of Chinese flowering cabbages. Each datum point is presented as mean standard error (vertical bar). n=4. Details of cultivars, see table 1.108 Figure 25. Correlation between total myrosinase activity and total anti-oxidant capacity in 16 cultivars of Chinese flowering cabbage. Details of cultivars, see table 1...... 109

viii

────────────────────────────────

SUMMARY

────────────────────────────────

The aim of this series of study was to investigate the behavior of the myrosinase system together with other physiochemical characters, such as total anti-oxidant capacity and chlorophyll concentration, in commonly eaten

Brassica vegetables in Asia during a broad range of pre- and post-harvest treatments varying in temperature, irrigation and fertilizer. Experimental materials were either purchased from local market or planted in the green house of the Department in NUS.

Analyses of temperature optimum and pH dependence of myrosinase were carried out on the Chinese flowering cabbage. Using sinigrin as the substrate, the optimum condition for myrosinase assay in Chinese flowering cabbage and

Chinese kale was found to be 35~40°C and pH 6~6.5.

The following parameters, chlorophyll concentration and chlorophyll fluorescence parameters, total anti-oxidant capacity, myrosinase activity and total soluble protein concentration, were totally different in six commonly edible

Brassica vegetables consumed by Asian people.

Post harvest storage at cooler temperatures could efficiently delay the symptoms of senescence (in terms of chlorophyll concentration, total anti-oxidant capacity and myrosinase activity) in both Chinese flowering cabbage and Chinese kale.

ix Nitrogen concentration in the fertilizer did not affect chlorophyll concentration, total anti-oxidant capacity or myrosinase activity in seedlings of

Chinese flowering cabbage. In the Chinese flowering cabbage seedlings, both total chlorophyll concentration and total carotenoid concentration were much higher in leaves than those of stem and roots of Chinese flowering cabbage under all treatments studied. Leaves also had the highest anti-oxidant capacity while roots had the lowest total anti-oxidant capacity in Chinese flowering cabbage watered with various fertilizers containing different nitrogen concentration. Total myrosinase activity was similar in the leaves and stems, but lower in the roots during the developmental stages of plants watered with various fertilizers.

Chinese flowering cabbage cultivated in small pots grew much better than those grown in GA7™ container with the different nutritient solutions. The results obtained showed that chlorophyll concentration, total anti-oxidant capacity and myrosinase activity were highly dependent on the different organs but did not have much correlation with the developmental stage of mature

Chinese flowering cabbage.

Drought stress had great effects on chlorophyll concentration, total anti-oxidant capacity, especially myrosinase activity (both total and specific activity) in Chinese flowering cabbages. Myrosinase activities decreased rapidly when the plants suffered from severe drought treatment. However, the results obtained showed that drought did not affect total soluble protein concentation of

Chinese flowering cabbage.

Even within the same species, anti-oxidant capacity, myrosinase activities could be still quite different in the different cultivars of the same plant species.

x All the cultivars of Chinese flowering cabbages tested in this study exhibited myrosinase activity and anti-oxidant capacity. Thus the consumption of Brassica vegetables could provide benefits on people’s health.

────────────────────────────────

CHAPTER I. INTRODUCTION

────────────────────────────────

The cruciferous vegetables include broccoli, cabbage, Brussels sprouts, cauliflower, mustard greens, collard greens, turnips, and kale. These vegetables are the most commonly edible food for Asians.

Besides their appetizing flavor, cruciferous vegetables are rich in many nutrients as well. The most amazing property of Brassica vegetables is that they contribute almost exclusively to our intake of a group of phytochemicals called glucosinolates, which are beneficial for human health. When raw cruciferous vegetables are chewed, the plant cells are broken and myrosinase [EC 3.2.3.1] is released to hydrolyze the glucosinolates (Fenwick et al., 1994). The role of the myrosinase-mediated breakdown products of glucosinolates in reducing various types of cancers in human and animal cell models, and in plant defense against pest attack have also been widely studied (Rask et al., 2000).

Much attention has been given to the study of glucosinolates but few to myrosinase (EC 3.2.3.1), the -thioglucosidase enzyme responsible for the hydrolysis of the intact glucosinolates. The potential of some intrinsic and extrinsic factors for controlling/altering activity of myrosinase from cruciferous vegetables was investigated in this project. The changes in chlorophyll concentration, chlorophyll fluorescence parameters, and total anti-oxidant capacity of these vegetables under different environment and/or treatment were

1 also determined.

The project was divided into the following parts:

1. To investigate the effects of temperature and pH value on the myrosinase

activity of Chinese flowering cabbage and Chinese kale.

2. To investigate and compare the following parameters of six commonly

edible Brassica vegetables: chlorophyll concentration and chlorophyll

fluorescence parameters, total anti-oxidant capacity, myrosinase activity

and total soluble protein concentration.

3. To determine the effects of post harvest storage on chlorophyll

concentration and chlorophyll fluorescence parameters, total anti-oxidant

capacity and myrosinase activity in plants of Chinese flowering cabbage

and Chinese kale.

4. To study the effects of different nitrogen concentrations on chlorophyll

concentration, total anti-oxidant capacity and myrosinase activity in the

seedlings of Chinese flowering cabbage

5. To investigate the effects of plant age on chlorophyll concentration, total

anti-oxidant capacity and myrosinase activity in different plant organs of

mature plants of Chinese flowering cabbage.

6. To study the changes of chlorophyll concentration, total anti-oxidant

capacity and myrosinase activity in plants of Chinese flowering cabbage

under drought stress.

7. To determine the total anti-oxidant capacity and myrosinase activity of

different varieties of Chinese flowering cabbage

8. To study the molecular biology of myrosinase in Chinese floweing

cabbage

────────────────────────────────

CHAPTER II. LITERATURE REVIEW

────────────────────────────────

2.1. Brassica vegetables

Plants belonging to the mustard family or Brassicaceae are widely known as cruciferous vegetables. It is one of the healthiest and most nutritious vegetable groups (Higdon, 2005).

All true cabbages belong to the Brassica genus, a group within the

Cruciferae or Brassicaceae (mustard) family, comprising about 30 species of annual, biennial and occasionally perennial herbs with yellow or white flowers

(Higdon, 2005). The members of this genus may be collectively known either as cabbages, or as mustards. The name crucifer comes from the shape of the flowers, with four diagonally opposite petals in the form of a cross (Higdon,

2005). Occurring in the wild in Western Europe, the Mediterranean and temperate regions of Asia, this remarkable genus contains more important agricultural and horticultural crops than any other genus. Species of Brassica are also grown as vegetables, fodder or sources of oils and condiments. Almost all parts of these plants may have been developed for food - roots (e.g. swedes, turnips), stems (e.g. kohlrabi), leaves (e.g. cabbage, Brussels sprouts), flowers

(e.g. cauliflower, broccoli), and seeds (including mustard seed and oilseed rape).

Some forms with white or purple foliages or flowerheads are also grown for

3 ornamental purposes. Over the years, the utilization of oilseed Brassica is steadily increasing (Sovero, 1993).

Widely consumed Brassica vegetables include cabbage (Capitata Group of

Brassica oleracea), broccoli (Italica Group of B. oleracea), cauliflower (Botrytis

Group of B. oleracea), collard greens (Acephala Group of B. oleracea), kohlrabi

(Gongylodes Group of B. oleracea), Brussels sprouts (Gemmifera Group of B. oleracea), Chinese kale or Chinese broccoli (Alboglabra Group of B. oleracea), broccolini (Italica x Alboglabra Group of B. oleracea), and broccoflower (Italica x Botrytis Group of B. oleracea). These plants are classified by the arrangement of their parts (Gomez-Campo, 1999). If the leaves are tightly folded to form a ball, it is head cabbage. Kale and collards have leaves that are loose and open.

Plants that resemble miniature heads are called Brussels sprouts. Chinese cabbage, also called Napa, is light green or white and looks a lot like Romaine lettuce. Bok choy is a vegetable that looks more like thick, white celery with leaves, but it is still a cabbage. Even stranger is kohlrabi, which looks like a turnip but is still part of the family as cabbages (Gomez-Campo, 1999).

Brassica vegetables have been cultivated for several thousands of years.

Most Brassica vegetables are good sources of oil that may be used for edible and industrial purposes. Due to their agricultural importance, Brassica plants have been the subject of much scientific interest. All of these cultivars are jampacked with nutrients (Ensminger & Esminger, 1986). Brassica vegetables also contribute almost exclusively to our intake of a very powerful group of phytochemicals called glucosinolates, which can have important implications for human health. The glucosinolates are largely responsible for the taste and smell of cruciferous vegetables and are important anti-cancer agents. The active

4 compounds are not the glucosinolates themselves but their hydrolysis products, isothiocyanates (Bones, 1990). It has been shown that an extract of cruciferous vegetables added to human breast cancer cells strongly inhibits growth of the cells, and the degree of inhibition is related to the amount of extract in the growth medium (Finley, 2003; Verhoeven et al., 1996; Willcox et al., 2003).

Another unique feature of plants in the crucifer family, such as broccoli, is that they are an excellent source of three notable anti-oxidants: vitamin E, vitamin C and vitamin A (through their concentration of beta-carotene) (Finley, 2003).

These three vitamins team up to scavenge free radicals, which are excessively interactive molecules that not only cause damage to the molecules with which they interact, and are also linked to a host of different diseases and health conditions. These particular antioxidant vitamins have been proven to improve immune functions and are widely sold as nutritional supplements. The cruciferous vegetables are also known to be beneficial in the prevention of other major illnesses such as Alzheimer’s disease, cataracts, and some of the functional declines associated with ageing such as age-related eye diseases

(Granado et al., 2003). Their added value towards vegetable quality can be ascribed to their health promoting properties by a role in the prevention of various cancers.

Cabbage, Chinese kale and other Brassica vegetables have a unique sharp taste. This taste is partly due to isothiocyanates arising from the action of the enzyme, myrosinase, on glucosinolates conjugates. Glucosinolates are precursors of isothiocyanates. When the raw vegetables are chewed, the plant cells are broken and myrosinase is released to hydrolyze the glucosinolates into isothiocyanates (Fenwick et al., 1994). In a variety of animal models, these

5 isothiocyanates have been observed to inhibit chemically induced cancers

(Cinciripini et al., 1997; Hecht, 2000; London et al., 2000). The mechanism involves the inhibition of the so-called Phase I enzymes. Phase I enzymes normally prepare foreign molecules for detoxification and excretion, but sometimes they also generate highly reactive intermediates capable of far more damage than the original substrates (Baghurst et al., 1999).

2.2. Glucosinolates

Plants produce a high diversity of secondary metabolites for defense and survival in the ecosystem. More than 100,000 secondary metabolites have been identified in different plants till now (Wink, 1988). Secondary metabolites are sought after because they are known to exhibit numerous biological activities that promote positive health effects. These activities include antibacterial, anticancer, antifungal, and antioxidant activities that are utilized in the agricultural, food and pharmaceutical industries (Wink, 1999). Several large groups of secondary metabolites, such as iridoid glycosides, cardenolides, terpenoids, and cyanogenic glycosides, have been implicated in plant defense systems (Wink, 1999). The glucosinolates found in mustards (and a few other families) are also thought to serve this defensive function.

Glucosinolates, also known as mustard oil glycosides, are oxime-derived sulfur-containing compounds whose breakdown products include the familiar pungent principles of mustard, radish, and capers (Fenwick et al., 1994). The compounds are a class of secondary compounds related to cyanogenic glucosides, which are present in more than 90 forms in cruciferous species but

6 are mainly present in the order Capparales (Rodman et al., 1993; Rodman et al.,

1998). Glucosinolates have been studied most extensively in the Brassicaceae, since many oilseed and vegetable crops belong to this family.

Since glucosinolates were first isolated from Sinapis alba seeds as early as in 1831 by Robiquet and Boutron, over 120 additional glucosinolates have been identified (Fahey et al., 2001). Glucosinolates are especially abundant among families of the order Capparales: Tovariaceae, Resedaceae, Capparaceae,

Moringaceae, and Brassicaceae. Families outside the order exhibit occasional occurrence and include the Caricaceae, Euphorbiaceae, Gyrotemonaceae,

Limnathaceae, Salvadoraceae and Tropaeolaceae families (Fahey et al., 2001).

The basic structure of glucosinolates was elucidated by Ettlinger and

Lundeen in 1956 (Bones & Rossiter, 1996). The glucosinolates share a core structure containing a β-D-glucopyranose residue linked via a sulfur atom to a

(Z)-N-hydroximino sulfate ester, and are distinguished from each other by a variable R group, derived from one of several amino acids (Fahey et al., 2001).

Depending on whether they are derived from aliphatic amino acids (most commonly methionine), phenylalanine or tyrosine, or tryptophan, glucosinolates are grouped into three categories, aliphatic, aromatic, or indolyl (heterocyclic) glucosinolates respectively (Halkier & Du, 1997).

The biosynthesis of glucosinolates comprises three independent stages:

First, some amino acids, such as methionine and phenylalanine, are elongated by one or several methylene groups. Second, the precursor amino acids are converted to the parent glucosinolates. And, finally, the parent glucosinolates can undergo secondary modifications (Wittstock & Halkier, 2002).

Glucosinolates have always been documented as feeding stimulants,

7 attractants, or oviposition cues for beetles, butterflies, moths, and aphids (Louda

& Mole, 1991; Schooven et. al., 1998). Both intact glucosinolates and their hydrolysis products are responsible for the pungent and hot flavors characteristic of mustard seeds. The toxic and anti-nutritive effects of glucosinolates have limited the use of Brassica species for human and animal feed (Sørensen, 1990).

Reducing or removing glucosinolates from rape tissues may reduce predation by specialists, but leave the plants open to increased attack from many other organisms (Glen et al., 1990). So, it is important to fully understand the structure and function of glucosinolates so that appropriate glucosinolates profiles can be bred or engineered into the crop.

2.2.1. Composition and level of glucosinolates

In previous studies, the composition and the level of glucosinolates have been found to vary widely both between different species and between different developmental stages, as well as tissues within a given plant species (Fieldsend

& Mildford, 1994a & b; Koroleva et al., 2000; Li et al., 2002; Porter et al.,

1991).

Petersen et al. (2002) studied the composition and content of glucosinolates at different stages of plant growth in Arabidopsis thaliana. They determined the concentration and turnover of 20 different glucosinolates from seed to seedling stage and found tissue-specific variation in the type and amount of glucosinolates present. In comparing the glucosinolates composition of different organs, they found that seeds and fruits had the highest diversity of individual compounds, which might also reflect the need to maximize the

8 defensive potential of these reproductive organs. This trend was observed in

Brassica species as well (Kirkegaard & Sarwar, 1998; Rosa, 1997). All of these observations suggest that glucosinolates in seeds are especially important for successful germination, possibly acting to prevent pathogen infection or herbivory at this crucial stage, or as allelopathic compounds (Choesin & Boerner,

1991; Siemens et. al., 2002). During the ensuing rapid growth period, additional glucosinolates accumulate (Clossais-Besnard & Larher, 1991). However, the concentration of glucosinolates in fully-expanded leaves is low (Porter et al.,

1991). During flowering, there is a reduction in glucosinolates concentration in the vegetative parts of the plant, and also in the inflorescence which contains relatively large amounts of glucosinolates. In contrast, during seed maturation glucosinolates are synthesized in large amounts in the siliques and probably are transported from the pod shells to the seeds (Clossais-Besnard & Larher, 1991).

During this period, glucosinolates also accumulate at low levels in the root

(Clossais-Besnard & Larher, 1991).

Glucosinolates levels in plants can also be affected by environmental conditions. Drought will induce glucosinolates accumulation in cultivated

Brassica (Bouchereau et al., 1996; Jensen et al., 1996) and in wild Capparales

(Louda & Mole, 1991), a phenomenon that has also been found for other secondary metabolites. However, increased levels of glucosinolates have also been observed in plants which grow in moist soil, compared to those grown in dry soil (Louda & Mole, 1991). Thus, no consistent relationship between glucosinolates concentration and their water availability to the growing place of plants has been demonstrated.

Shelp et al. (1993) evaluated glucosinolates distribution in two broccoli

9 cultivars of Brassica oleracea var. Italica grown at three different growing sites.

They reported that differences in glucosinolates levels among growing sites were greater than differences between cultivars. Other studies showed that factors that might have contributed to these differences included soil type, sulfate and nitrate fertilizer application, plant spacing, and date of harvest (Griffiths et al., 1991;

Heaney & Fenwick, 1980; Rosa et al., 1996). Higher levels of glucosinolates were found in plants grown on clay soil than on sandy soil and in plants treated with sulfate than in plants treated with nitrate (Heaney & Fenwick, 1980). In a study on Brassica napus, it was reported that higher nitrogen application increased the proportion of progoitrin at the expense of sinigrin (Zhao et al.,

1994).

Glucosinolates types in plant species are highly variable. For example, the main glucosinolates in radish seeds (Raphanus sativus) is 4-methylsulphinyl-

3-butenyl glucosinolate, while it is propenyl glucosinolate in mustard seeds

(Brassica juncea). Cabbage seeds (Brassica oleracea) contain mainly propenyl and 2-hydroxy-3-butenyl glucosinolate; rapeseeds (Brassica napus) contain four major glucosinolates: 2-hydroxy-3-butenyl, 3-butenyl, 4-pentenyl, and

2-hydroxy-4-pentenyl (Sang et al., 1984). Similar differences in glucosinolate types are observed when comparing vegetative plant parts (Hill et al. 1987).

Most plant species are believed to contain only a limited number of major glucosinolates (usually six or less) with a few others present in trace amounts.

However, as many as thirty-four glucosinolates have been found in Arabidopsis thaliana (Kliebenstein et. al., 2001a). Kliebenstein et al. (2002) studied glucosinolates profiles in thirty-nine different ecotypes and analyzed them with respect to the number of loci involved in glucosinolates regulation. They found

10 that polymorphism at only five loci were sufficient to generate fourteen qualitatively different leaf glucosinolates profiles. The fact that such a small set of polymorphic loci could generate a modular alteration in glucosinolates profile suggested that this defensive system might be built to respond rapidly to changes in herbivory or other selective pressures (Kliebenstein et al., 2001b).

2.2.2. Products of glucosinolates hydrolysis

Upon tissue disruption, for example by herbivores, glucosinolates are

degraded in a reaction catalyzed by myrosinases, yielding toxic isothiocyanates,

nitriles or other products via the unstable thiohydroximate-O-sulphonates

(Halkier 1999; Rask et al., 2000). The chemical structures of the hydrolysis

products of glucosinolates vary depending on the precursors in different plant

species, and different endogenous or exogenous factors such as pH values and

the concentration of ferrous ions (Chew, 1988; Duncon, 1991; Larsen, 1991).

The presence or absence of protein factors such as epithiospecifier proteins also

accounts for some of the variations in the hydrolysis products (Wittstock &

Halkier, 2002).

The hydrolysis products are responsible for the characteristic flavor of

Brassicaceous vegetables. As mentioned before, these hydrolysis products have

different biological effects, ranging from antimicrobial and cancer-preventing

to inflammatory and goitrogenic activities, and thus Brassicaceous vegetables

consumed by higher animals and humans have toxic as well as protective

properties (Mithen et al., 2000; Poppel et al., 1999).

Glucosinolates and their breakdown products have been the focus of many

11 studies because of the possibility of using them as natural pesticides (Tsao et al.,

1996). However, it is considered that glucosinolates themselves have limited biological activity until they are hydrolyzed (Borek et al., 1994). The breakdown products are generally relatively small molecules which make many of them volatile. In addition, glucosinolates are used as flavoring compounds and as cancer-prevention compounds (Mithen et al., 2000; Verhoeven et al.,

1997).

2.3. Myrosinase

As mentioned before, myrosinases (EC 3.2.3.1) are β-thioglucosidases involved in the hydrolysis of the very stable water-soluble glucosinolates. A glucose and sulfate are released in the reaction in addition to nitrile, isothiocyanate, thiocyanate, epithionitrile, oxazolidine-2-thione, or other less prevalent products. Myrosinase activity has been detected in all glucosinolates containing plants and tissues that have been investigated, and it is likely that myrosinases occur in all plants which produce glucosinolates (Al-Turkib &

Dick, 2003).

Myrosinases belong to the group of O-Glycosyl hydrolases which constitute a large hydrolytic superfamily. Glycosidases have been divided into different families (Henrissat, 1991). These families can often also be grouped into clans (Henrissat & Bairoch, 1996). The number of families is, at present,

70 and a glycosidase database is continuously updated on the ExPASy server at http://expasy.ch/cgi-bin/lists?glycosid.txt. The organization of glycosidases into families is based on amino acid sequence similarities. Although it is a

12 thioglucosidase, myrosinase has been included in the O-glucosidases and has been assigned to family 1 (and clan GH-A) together with prokaryotic and eukaryotic O-β-glucosidases, 6-phospho-β-glucosidases, 6-phospho-β- galactosidases, β-galactosidases and lactase/phlorizin hydrolase (Rask et al.,

2000).

Myrosinase is not properly identified as a single enzyme, but rather as a family or group of similar-acting enzymes. Multiple forms of the enzymes exist, both among species and within a single plant (Bones & Slupphaug, 1989; Falk et al., 1992&1995a; Lenman et al., 1990&1993a; Xue et al., 1995), and all perform a similar function (Björkman, 1976). Although their genetic sequences are similar to other β-glycosidases (Lenman et al., 1993b), myrosinases are fairly specific toward glucosinolates (Durham & Poulton, 1990). These enzymes cleave the sulfur-glucose bond regardless of either the enzyme or substrate source. However, the particular enzyme and glucosinolates substrate influence reaction kinetics (Bones, 1990; MacLeod & Rossiter, 1986).

In addition to plants, myrosinases have been discovered in the plant bacterium, Enterobacter cloacae, in the fungus, Aspergillus sydowi and

Aspergillus niger, in the intestinal bacteria Enterobacter cloacae and

Paracolobactrum aerogenoides, in mammalian tissues and in the cruciferous aphids Brevicoryne brassicae and Lipaphis erisimi (Bones & Rossiter, 1996;

MacLeod & Rossiter, 1986). Myrosinase-like activity has also been observed in soils (Borek et al., 1996).

13 2.3.1. Occurrence of myrosinases

Myrosinase and glucosinolates were first discovered in black mustard

seeds (Brassica nigra [L.] Koch) by Bussy as early as 1840. The myrosinases

always appear to be accompanied by one or more glucosinolates (Bones &

Rossiter, 1996). They occur in all species of Brassicaceae (Cruciferae)

examined and have also been found in Akaniaceae, Bataceae,

Bretschneideraceae, Capparaceae, Caricaceae, Drypetes (Euphorbiaceae),

Gyrostemonaceae, Limnanthaceae, Moringaceae, Pentadiplantdraceae,

Resedaceae, Salvodoraceae, Tovariaceae, Tropaeolaceae (Rodman, 1991).

The level of myrosinase activity found in seeds from cultivars of S. alba, B.

campestris and B. napus has been examined by Bjørkman & Lønnerdal in 1973,

Bones in 1990 and Henderson & McEwen in 1972 (Bones & Rossiter, 1996).

The myrosinase activity was found to be about ten times higher in S. alba than

in B. campestris, and the myrosinase activity in B. napus was slightly higher

than that in B. campestris (Bones, 1990).

2.3.2. Factors affecting myrosinase activity

Ludikhuyze et al. (2000) summarized the potential of some intrinsic

(MgCl2, ascorbic acid, pH) and extrinsic (temperature, pressure) factors that could control or alter the activity of myrosinase from broccoli. A combination of

MgCl2 and ascorbic acid was found to enhance enzyme activity. Concentrations

-1 -1 resulting in optimal activity were determined as 0.1 g L of MgCl2 and 2 g L of ascorbic acid (Ludikhuyze et al., 2000). Whether the enzyme activators are

14 present or not, the optimal pH of myrosinase activity was observed to be between 6.5 and 7.0, corresponding to the natural pH of fresh broccoli juice

(Ludikhuyze et al., 2000). At atmospheric pressure, the enzyme was optimaly active at a temperature about 30°C (Ludikhuyze et al., 2000). Application of low pressure (50 to 100 MPa) slightly enhanced the activity of myrosinase while at higher pressure (300 MPa) myrosinase activity was largely reduced (Ludikhuyze et al., 2000). Bones & Slupphaug (1989) observerd that high concentrations of ascorbic acid could inhibit myrosinase activity and low concentrations of ascorbic acid could activate the activity. However, only L-ascorbic acid could activate plant myrosinase, whereas ascorbic acid analogs did not (Ohtsuru &

Hata, 1979). Ohtsuru & Hata (1979) also found that the optimal ascorbic acid concentration for myrosinase from Armoracia rusticana was 1.8 mM.

2.3.3. The myrosin cell

The term “myrosin cell” was first used by Guignard in 1890 and it has later

been used to describe this special type of cell, which was discovered by

Heinricher in 1884 and assumed to contain myrosinase (Bones & Rossiter,

1996). These myrosin cells showed deviant histochemical staining

characteristics and differed both in size and morphology from adjacent cells

(Bones & Iversen, 1985). They were later shown to stain specifically with

several different reagents. These cells have been referred to as

protein-accumulating idioblasts, “myrosin tubes”, and later “myrosin cells”

(Bones & Iversen, 1985).

The importance of myrosin cells as a taxonomic tool has been generally

15 accepted. Jørgensen (1981) used the occurrence and the distribution of myrosin cells as two of several criteria for the classification of the order Capparales. As a consequence of the taxonomic investigations, some information about the occurrence and the distribution of myrosin cells was generated. Myrosin cells were observed in seeds, parenchymatic tissues, epidermis and in some guard cells (Bones, 1991; Bones & Iversen, 1985). Double-staining employing reagents such as “Millon’s reagent” and antibodies against myrosinase showed that myrosin cells contained myrosinase (Höglund et al., 1991; Thangstad et al.,

1990). It was later shown by in situ hybridization experiments that myrosinase transcripts were present in these cells and that they presumably synthesized the enzyme (Falk et al., 1995b; Lenman, 1993a; Xue et al., 1995).

The morphology of myrosin cells varies and depends on the plant organ and tissue in which they are present, as well as the age of the tissue (Bones &

Iversen, 1985). In cotyledons of S. alba and Raphanus sativus, two morphologically distinct types of myrosin cells were observed. In the palisade tissue of these cotyledons in S. alba and Raphanus sativus, elongated myrosin cells were frequently observed. In the parenchyma tissue both elongated and isodiametric cells were observed (Bones & Iversen, 1985). In roots and hypocotyls myrosin cells were generally found in the elongated form in longitudinal sections (Bones & Iversen, 1985). Compared to normal cortical cells they were 1-6 times the size of surrounding cells.

The main organelles in the myrosin cells are the spherical myrosin grains containing homogeneous electron-dense material (Bones, 1990). The grain size varies from 2.5 to 10μm and they are interspersed with oleosomes. During the differentiation of the myrosin cells, the myrosin grains seem to fuse. Indeed,

16 confocal immunofluorescence microscopy using a monoclonal antibody against myrosinase showed that the grains in myrosin cells from embryo cotyledons of

B. napus were continuous, forming a trabecular network in the cell (Thangstad et al., 2001). As shown by Bones et al. (1991), myrosin cells in B. napus do undergo considerable developmental changes during the first 14 days after germination. This seems to include a dramatic change of the compartmentation of the enzyme and substrate due to a reorganization of the protein bodies/vacuoles (Bones et al., 1991).

2.3.4. Cellular and subcellular localization of myrosinase

The first attempt to localize myrosinase at the cellular level was reported by Guignard in 1890. Since then many attempts, using different techniques, have been performed but with strikingly different results (Lüthy & Matile,

1984).

The first localization of myrosinase based on a cytochemical method was reported by Peche in 1913 (Bones & Rossiter, 1996). The method employed was based on the enzymatic hydrolysis of the substrate sinigrin, which produced sulphate in situ on fresh sections of Raphanus sativus. By including barium chloride in the substrate, a precipitate of insoluble barium sulphate was deposited on the site of the enzyme reaction (Andréasson et al., 2001). This cytochemical method showed that myrosinase could be localized in myrosin cells.

In 1970 Iversen concluded that most of the myrosinase activity was confined to the dilated cisternae of the endoplasmic reticulum and in a limited

17 extent to the mitochondria (Bones & Rossiter, 1996). Using the same cytochemical technique, Maheswari et al. concluded in 1981 that myrosinase was largely associated with the plasmalemma of most cells (Bones & Rossiter,

1996). Lüthy and Matile (1984), using subcellular fractionation, suggested that most of the myrosinase activity was associated with the tonoplast, plasmalemma and endoplasmic reticulum, and that although myrosinase was present in the cytosol it had a remarkable tendency to adhere to membrane surfaces. Matile suggested in 1980 that myrosinase was a cytosolic enzyme, while the glucosinolates were compartmentalized in the vacuoles (Bones & Rossiter,

1996). Pihakaski and Iversen concluded in 1976 that the myrosinase activity was mainly found in dictyosomes and smooth endoplasmic reticulum (Bones &

Rossiter, 1996).

Immunocytochemical studies of Höglund et al. (1991) on B. napus tissues using a monoclonal antibody against myrosinase showed that the enzyme was only present in a small number of cells. In seedling cotyledons and young leaves, myrosinases were mainly present in some guard cells as well as in scattered cells in the parenchyma (Höglund et al., 1991). In addition, young leaves contained anti-myrosinase reactive antibody cells in the vascular tissue close to the phloem. In the stem, a major location for the enzyme was the xylem cells, and in the root myrosinase-containing cells were mainly located in the cortex region. In petals, siliques and older leaves, myrosinases were located in scattered parenchymal cells and in the vascular tissue (Höglund et al., 1991).

The fact that myrosinase was expressed in guard cells in certain tissues of B. napus clearly showed that the activity of the corresponding genes was not limited to the myrosin cells. Also, recent results showed that myrosinase could

18 be induced locally in young B. napus cotyledons around the sites of fungal infection (Thangstad et al., 2004).

The intracellular localization of myrosinase has been much debated throughout the years, especially in relation to the storage site of glucosinolates.

Some evidence for the localization of the latter substances in vacuoles was obtained from subcellular fractionation of A. lapathifolia myrosinase root cells

(Grob & Matile, 1979; Helmlinger et al., 1983). Partly based on these results,

Lüthy and Matile (1984) formulated “the mustard oil bomb hypothesis”, according to which glucosinolates were localized in the myrosin grains

(vacuoles) of the myrosin cells and the myrosinase associated with membranes in the cytoplasm. This hypothesis explained how glucosinolates could become accessible for myrosinase first upon tissue damage (Lüthy & Matile, 1984).

However, by the use of antibodies against myrosinase (Höglund et al., 1992;

Thangstad et al., 1991) and the glucosinolates sinigrin (Kelly et al., 1998), it was found that the myrosin grains were labelled only with the anti-myrosinase antibody and sinigrin was localized to protein bodies in aleurone-like cells but shown to be absent from myrosin cells. These results showed that myrosinase was localized to the interior of the myrosin grains but the glucosinolates was localized to protein bodies in non-myrosin cells in seeds. Therefore, the

“mustard oil bomb hypothesis” is still valid, although it has to be modified to account for the fact that the enzyme (myrosinase) and the substrate

(glucosinolates) are not formed in the same cell, but are compartmentalized in different cells.

19 2.3.5. Distribution of myrosinase isoenzymes

Multiple isoforms of myrosinase are present in a number of different myrosinase-containing plants (James & Rossiter, 1991; Lenman et al., 1993a;

Phelan & Vaughan, 1980). Isoenzymes of myrosinase were first discovered by activity staining of native gels and isoelectric focusing gels (Phelan & Vaughan

1980). By analytical gel electrophoresis, various authors demonstrated the separation of several myrosinase isoenzymes (Buchwaldt et al., 1986).

In 1970, MacGibbon and Allison examined the isoenzyme pattern after electrophoretic separation of myrosinases of seven species of Rhoeadales. Each species was found to have a distinct pattern of isoenzyme and the number of detectable bands varied from 1 to 4 (Bones & Rossiter, 1996). MacGibbon and

Allison also found in 1970 that the different patterns depended on whether the extracts were made from leaf, stem, root or seed (Bones & Rossiter, 1996).

(Buchwaldt et al. 1986). The isolation of cDNA and genomic clones encoding myrosinases also enabled more accurate studies of the existence of myrosinase isoforms and their tissue distribution (Chadchawan et al., 1993; Machlin et al.,

1993; Xue et al., 1992; Xue et al., 1995; Xue & Rask, 1995).

All plant myrosinase isoenzymes characterized are glycoproteins with a carbohydrate content varying between 9 and 23% of the total molecular mass

(Bones & Slupphaug 1989). Different degrees of glycosylation can partially explain the observed charge heterogeneity of the different isoenzymes (Bones &

20 Rossiter, 1996). Myrosinase isoenzymes differ in physico-chemical and kinetic properties and in their response to ascorbic acid (James & Rossiter, 1991;

Wilkinson et al., 1984) and hydrolysis rates of different glucosinolates (James

& Rossiter, 1991).

James and Rossiter (1991) separated two myrosinases from cotyledons of five days old B. napus seedlings. The most striking difference between these two myrosinases was the degree of glycosylation. Myrosinase I was similar to myrosinase C reported by Bones and Slupphaug (1989), while myrosinase II was reported to be considerably less glycosylated. By immunoblots with polyclonal antibodies against myrosinase and by periodic acid Schiff staining, these two myrosinases were shown to be different (James & Rossiter, 1991).

When tested for substrate specificity against five glucosinolates, the degree of activation by ascorbic acid of these two myrosinases was also different.

Although myrosinase isoenzymes have been isolated from several different sources (Bones & Rossiter, 1996; Rask et al., 2000), till now not much is known about the substrate specificity of myrosinase isoenzymes still. When considering substrate specificity one should also be aware of the possibility that it could be affected by factors like epithiospecifier protein, myrosinase binding protein or other myrosinase associated proteins or components (Andréasson et al., 2001). To clarify the question of substrate specificity, it will be necessary to examine isoenzymes of myrosinase from different developmental stages in combination with the known associated factors (Andréasson et al., 2001). The two myrosinases in the experiments of James and Rossiter (1991) degraded different glucosinolates at different rates. However, these two isoenzymes showed highest activity against aliphatic glucosinolates and least activity

21 against indole glucosinolates. These observations indicated that members of a given class of glucosinolates were almost degraded at approximately the same rate in vitro. The results from A. thaliana also indicated that myrosinases could react with a wide range of glucosinolates substrates (Xue et al., 1992).

Several different myrosinase isoenzymes have been characterized in seeds, seedlings, and vegetative tissues of the oilseed rape, B. napus (Lenman et al.,

1993). Several myrosinase isoenzymes have been also isolated from S. alba seeds (Xue et al., 1992). All myrosinases isolated and purified so far have been reported to be glycoproteins (Bones & Rossiter, 1996). The carbohydrate content varies from 9 to 23% of the total molecular mass. Molecular mass of purified myrosinases normally range from 125 kDa to over 150 kDa. One exception is the myrosinase from Wasabia japonica which was reported to have molecular mass of 580 kDa (Ohtsuru & Kawatani, 1979). Isoelectric points vary between 4.6 and 6.2 (Björkman, 1976). The different myrosinase families are expressed in an organ- and a tissue-specific manner (James & Rossiter, 1991;

Lenman et al., 1993a; Xue et al., 1992).

2.3.6. Myrosinase subfamilies

Isolation of cDNA and genomic clones from the seeds of S. alba and B. napus showed that at least three different subfamilies of myrosinases exist: the

Myrosinase A (MA), Myrosinase B (MB) and Myrosinase C (MC) subfamilies

(Falk et al., 1992&1995a; Lenman et al., 1993b; Thangstad et al., 1993; Xue et al., 1992). Active transcripts have only been reported for two of these genes, which are MA and MB subfamilies, and they are supposed to be able to degrade

22 the 23 different glucosinolates reported to be present in A. thaliana (Haughn et al., 1991).

The expression of the three myrosinase gene subfamilies has been studied in B. napus by northern blot and in situ hybridization analyses using subfamily specific probes (Falk et al. 1992&1995a; Lenman et al., 1993a). In parallel, the localization of MA and MB transcripts to different organs of S. alba was documented (Xue et al., 1995). MA myrosinase genes in both species of B. napus and S. alba were exclusively expressed in the myrosin cells of the seed embryo, preferentially in the axis, whereas MB mRNA was present in myrosin cells in the entire embryo and in most mature plant organs, although the highest amounts were found in young tissues (Falk et al., 1992; Lenman et al., 1993a;

Xue et al., 1993). The myrosinase isoenzymes found in B. napus were encoded by around 13 MB genes and 4 5 MA genes (Lenman et al., 1993b). The 3-4

MC genes found were exclusively expressed in developing seeds, but not in the vegetative tissues investigated (Falk et al., 1995a). In situ hybridizations in developing seeds showed that the MC genes were well expressed equally in the myrosin cells of the embryo axes and the cotyledons of B. napus.

Till now, only MA and MB myrosinase transcripts have been identified in

S. alba, and these two subfamilies comprise fewer genes than those of B. napus

(Xue et al., 1992). Eriksson et al. (2001) used sequence analysis of myrosinase cDNAs isolated from seeds, cotyledons and leaves of S. alba to confirm the result that the MA isoforms were expressed only in seed tissue, while MB myrosinases were found in all tissues. Furthermore, seeds and leaves of S. alba contained unique MB myrosinase transcripts, suggesting organ-specific expression of individual MB genes (Eriksson et al., 2001). The majority of

23 expressed myrosinase genes belong to the MB family, which also seems to be the most complex gene family according to Southern blot analysis and reversed transcription-polymerase chain reaction analysis (Xue et al., 1992). None of the mRNA amplified or analysed peptide sequences from different organs of S. alba could be classified to the MC family. The MC family is only characterized from tissues of B. napus seeds till now (Falk et al., 1995b). There is no evidence for the existence of myrosin cells expressing exclusively MA, MB or MC myrosinase in different plant organs, in which genes of all myrosinase sub-families are actively transcribed, as in the embryonic axes of both

Arabidopsis and B. napus (Andréasson et al., 2001). During seed development,

MA, MB, and MC myrosinases transcripts accumulate in parallel in B. napus

(Rask et al., 2000). Transcripts are detectable at 20-25 days after pollination

(DAP) and reach their highest levels at 30-35 DAP.

Northern blot analyses have shown the presence of MB mRNA in B. napus seedling cotyledons, leaves, stems, pedicels, petals and siliques, but not in roots

(Falk et al., 1995a&1995b). The amount of MB mRNA is higher in young leaves than in older ones. The failure to detect myrosinase mRNA in roots with the three subfamily probes available might indicate the presence of still another subfamily of myrosinase genes in the Brassicaceae, since myrosin cells have been identified in the roots and the presence of myrosinase verified by immunocytochemical (Högland et al., 1991) and western blot analyses of young roots (Lenman et al., 1993a). It should be pointed out that the probes used in the studies reviewed above were subfamily-specific, not gene-specific. That means that it is possible or even likely that different MB genes are transcribed in different organs and under different conditions.

24 The myrosinases extracted from B. napus embryo have been assigned to the different subfamilies by comparison of their peptide sequences to cDNA and genomic sequence (Rask et al., 2000). Western blot analysis of protein extracts from B. napus seeds showed the presence of three classes of myrosinase subunits with apparent molecular sizes of ca. 75, 70, and 65 kDa. The 75 kDa myrosinases are encoded by MA genes, the 70 kDa forms by MC genes, and the

65 kDa forms by MB genes (Falk et al., 1995a; Lenman et al., 1993).

Different extents of glycosylation is probably the main reason that lead to the size differences of the myrosinases, since the protein moieties of MA, MB and MC myrosinases have similar molecular masses (Rask et al., 2000). When myrosinases from B. napus seeds are solubilized under non-denaturing conditions, only the 75 kDa MA myrosinases occur as free dimers. The other two myrosinases, MB and MC from B. napus seeds, exist together with other proteins in complexes of molecular masses from 250 to 800 kDa (Lenman et al.,

1990). In S. alba seed protein extracts, only MA myrosinases are soluble

(Eriksson et al., 2001). The MB seed myrosinases in this species can only be solubilized with denaturing agents (Eriksson et al., 2001). The reason for the insolubility of S. alba seed MB myrosinases is unknown. Myrosinase isoenzymes have varying degrees of glycosylation (James & Rossiter, 1991), which probably to some extent influence the solubility of different myrosinases

(Eriksson et al., 2001). The MA isoform is the most extensively glycosylated myrosinase and, thereby, probably adapted to its particular environment in the dehydrated seed (Burmeister et al., 1997). Peptide sequencing showed that all soluble myrosinases in S. alba seeds were MA myrosinases, while all insoluble myrosinases characterized belonged to the MB family (Eriksson et al., 2001). It

25 is of interest that MB myrosinases are soluble in ordinary buffers when extracted from seedling cotyledons. Two of these soluble myrosinases extracted from seedling cotyledons also had the same sizes as the insoluble MB proteins in the seeds (Eriksson et al., 2001). Although the identical peptide sequences from these proteins do not guarantee sequence identity throughout the molecule, these findings suggest that some factor non-covalently interacts with MB myrosinases in seeds making them insoluble (Eriksson et al., 2001) However whether or not this interaction occurs prior to or after homogenization remains to be determined.

Falk et al. (1992) found the highest expression of myrosinase mRNA in young leaves, cotyledons and developing seeds in B. napus, where it was detected from day 15 to day 30 after pollination. In a later report Xue et al.

(1992) found that two myrosinase genes showed a tissue preferential expression during embryo and seedling development in S. alba. Northern blots with mRNA from seeds and young leaves of B. napus probed with MA (Myr1) and MB

(Myr2) specific probes showed that the two subgroups of the myrosinase gene family were differentially expressed (Lenman et al., 1993). The highest level of expression of MA (Myr1) was found in seeds, whereas MB (Myr2) expression was found to be highest in leaves. The large number of genes, which were transcriptionally active, indicated that the myrosinase-glucosinolates system must play an important role in the life of the plants of Brassicaceae (Bones &

Rossiter, 1996).

Furthermore, western blot analysis of protein extracts from different B. napus organs excised at different time points of plant development showed developmentally regulated changes in the organ-specific myrosinase isoenzyme

26 patterns (Lenman et al., 1993). During seedling development there was a turnover of the myrosinase pool such that in 5-d-old seedlings the 75-, 70-, 66-, and 65-kD myrosinases were present, with the 70- and 75-kD myrosinases most abundant. Sixteen days later the same myrosinases were present in the seedlings, but the 66- and 65-kD myrosinase species were predominating. At flowering, the mature leaves as well as stems, pedicels, petals, and siliques had only the 72 kDa myrosinases. To predict the isoenzyme pattern in different organs seems to be a difficult task. Isoenzyme pattern changes during germination, hence it is very difficult to predict the isoenzyme pattern in different plant organs

(Eriksson et al., 2001). Not only are the isoenzyme pattern of myrosinase enzymes influenced by the developmental stage of the plant, but also by other factors, such as wounding (Taipalensuu et al., 1997a&b) and sulfur deficiency conditions (Bones et al., 1994).

The most likely reason for the occurrence of myrosinases of different molecular masses in vegetative organs at different stages during plant development seem to be the differential expression of MB genes (Rask et al.,

2000). The molecular masses of the protein chain in all types of myrosinases are similar. However, the numbers of potential sites for N-linked glycosylation varies between different MB proteins, and therefore, the differences in apparent molecular masses observed on western blots are probably due to different degrees of glycosylation of individual myrosinase chains.

2.3.7. Gene structure of Myrosinase

More than 20 myrosinase genes seem to be present in the B. napus (Xue et

27 al., 1992), but few of these genes or cDNAs have been cloned as yet. Recently a significant amount of work has been put into the cloning of myrosinase genes.

As a result, several myrosinase genes from S. alba, B. napus and A. thaliana have been isolated and characterized (Chadchawan et al., 1993; Falk et al., 1992

& 1995a; Thangstad et al., 1993; Xue et al., 1992).

The first cDNA gene encoding the myrosinase was isolated from S. alba by

Xue et al. (1992). A full-length cDNA clone (MB3) and three partial clones

(MA1, MB1 and MB2) were isolated from a S. alba cDNA library. Nucleotide sequence analysis of these clones revealed that they were encoded by a gene family (Xue et al., 1992). Southern blot analysis with gene-specific probes showed that this gene family consisted of at least two subfamilies (MA and MB) each with several members both in S. alba and in B. napus. In A.thaliana only three myrosinase genes seem to be present (Xue et al., 1992). The amino acid sequence similarities between myrosinases belonging to the MB family are that more than 90% and between the MA and MB myrosinases about 60% (Xue et al., 1992). These data are, however, based on only one full-length cDNA clone. cDNA encoding myrosinases from B. napus and A. thaliana have also been reported (Chadchawan et al., 1993; Falk et al., 1992). There are approximately four myrosinase MA genes and more than 10 MB genes in B. napus. The myrosinase genes of B. napus were found to be of 91.2% identical to the MB3 clone from S. alba and 67.5% identical to the MA1 clone at the amino acid level, and therefore belonged to the Myr2 subtype (=MB) of the gene family (Rask et al., 2000).

Myrosinases are encoded by a large gene family in both S. alba and B. napus. Thangstad et al. (1993) estimated the number of myrosinase genes in B.

28 napus to be 14-17. A similar result was also reported by Lenman et al. (1993) which estimated that there were 13 Myr2 (MB) genes and 3-4 Myr1 (MA) genes in S. alba. Some of these genes may be pseudogenes (Lenman et al., 1993).

Present results indicate that these estimates may be low (Falk et al., 1995). In A. thaliana a small myrosinase gene family with only three genes has also been found (Chadchawan et al., 1993; Xue et al., 1995).

Six genes, each encoding a myrosinase, have been characterized in detail by sequence determination so far. Three of them were from B. napus (Lenman et al., 1993; Thangstad et al., 1993). One was from B. campestris (Machlin et al., 1993). The other two were from A. thaliana (Xue et al., 1995). The exon/intron organization of all functional myrosinase genes characterized is conserved with 12 exons separated by 11 introns. Two genes, the MA Myr1 from B. napus (Thangstad et al., 1993) and tgg1 from B. campestris (Machlin et al., 1993), were originally reported to contain only 11 exons, lacking exon 9.

However, a re-evaluation showed that B. napus and S. alba MA genes also contained exon 9 (Taipalensuu et al., 1995), which might be also present in the

B. campestris tgg1 gene. One of the B. napus genes was a non-functional MA pseudogene (Lenman et al., 1993). This gene shared the basic exon/intron organization with the functional genes. The first two genomic myrosinase genes from B. napus were Myr1.Bn1 and Myr2.Bn1 (Thangstad et al., 1993). The

Myr1 gene cloned from B. napus has a 19 amino acid signal peptide and consists of 11 exons of sizes ranging from 54 to 256 bp and 10 introns of sizes from 75 to 229 bp (Rask et al., 2000). The Myr2 gene has a 20 amino acid signal peptide and consists of 12 exons ranging in size from 35 to 262 bp and 11 introns of sizes from 81 to 131 bp. The exons from the two genes showed 83%

29 homology at the amino acid level. The intron-exon splice sites are of GT..AG consensus type. The signal peptides and presence of sites for N-linked glycosylation suggest transport and glycosylation through the ER-Golgi complex (Thangstad et al., 1993). Thangstad et al. (1993) concluded that

Myr1.Bn1 most likely encoded a major seed myrosinase, and Myr2.Bn1 encoded a vegetative type myrosinase. Xue et al. (1995) sequenced two of the three myrosinase genes in A. thaliana, TGG1 and TGG2 genes. These two genes were found to be located in an inverted mode with their 3' ends 4.4 kb apart. Their organization was highly conserved with 12 exons and 11 short introns.

Comparison of the nucleotide sequences of TGG1 and TGG2 exons revealed an overall 75% similarity. In contrast, the overall nucleotide sequence similarity in introns was only 42%. In intron 1 the unusual 5' splice border GC was used.

Phylogenetic analyses using both distance matrix and parsimony programs suggested that the Arabidopsis genes could not be grouped with either MA or

MB genes. Consequently, these two gene families arose only after Arabidopsis had diverged from the other Brassicaceae species (Rask et al., 2000). In situ hybridization experiments showed that TGG1 and TGG2 expressing cells are present in leaf, sepal, petal, and gynoecium of A. thaliana. In developing seeds of A. thaliana, a few cells reacted with the TGG1 probe, but not with the TGG2 probe, indicating a partly different expression of these genes (Xue et al., 1995).

A myrosinase pseudogene has also been reported in B. napus (Lenman et al. 1993b). Pseudogenes are inactive sequences of genomic DNA which have a similar sequence to known functional genes. Because of this similarity, pseudogenes are normally considered to be evolutionary relatives to normally functioning genes. Myrosinase isoenzymes are known to be encoded by two

30 different families of genes, MA and MB. Nucleotide sequence analysis of a B. napus genomic clone, containing a gene for myrosinase, revealed it to be a pseudogene of the MA family (Lenman et al. 1993b). The pseudogene was found to span more than 5 kb and contain at least 12 exons. The exon sequence of the gene was highly similar to myrosinase cDNA sequences. However, a portion of the 5´-end was missing. This gene displayed three potential or actual pseudogene characters. Southern blot analysis using probes from the 3' portions of the genomic and B. napus MA and MB cDNA clones showed that MA type myrosinases were encoded by approximately four genes, while MB type myrosinases are encoded by more than 10 genes in B. napus (Lenman et al.,

1993). Northern blots with mRNA from seeds and young leaves of B. napus probed with the MA- and MB-specific probes showed that the MA and MB myrosinase gene families were differentially expressed. Sequence comparisons with myrosinase cDNA grouped this pseudogene to the Myr1 (MA) subgroup of the gene family. A multiple sequence alignment with the cDNA from Falk et al.

(1992) and several other β-glycosidases and β-galactosidases revealed that myrosinases could be grouped to the BGA family of β-glycosidases (Lenman et al., 1993b).

Based on the conserved regions in cDNA from three species, PCR

(polymerase chain reaction) primers were obtained, and used to amplify and characterize the structure of the myrosinase genes in B. napus, B. chinensis (B. campestris var. chinensis), B. campestris, B. oleracea, Cheiranthus cheiri,

Raphanus sativus and S. alba (Bones & Rossiter, 1996). The strong similarity of nucleotide sequence, intron-exon structure and gene copy number among all the seven species compared indicated that the myrosinase genes are similarly

31 organised in these species.

2.4. The Glucosinolates-Myrosinase system

The wide range of biological activities of products derived from the glucosinolates-myrosinase system is biologically and economically important.

On one hand, the degradation products of glucosinolates play an important role in the defense of plants against herbivores. On the other hand, these compounds have toxic (e.g. goitrogenic) as well as protective (e.g. cancer-preventing) effects in higher animals and humans. There is a strong interest in the ability to regulate and optimize the levels of individual glucosinolates tissue-specifically to improve the nutritional value and pest resistance of crops.

2.4.1. Organisation of the myrosinase-glucosinolates system

Matile concluded in 1980 that the stability of glucosinolates in the intact

root tissues of horseradish (Armoracia rusticana) appeared to be due to the

location of glucosinolates and myrosinase in distinct subcellular compartments

of the same cell (Bones & Rossiter, 1996). Andréasson et al. (2001) found that

myrosinase was present in the myrosin cells in both A. thaliana and B. napus.

However, there is a difference in the localization of myrosinase between A.

thaliana and B. napus (Andréasson et al., 2001). In A. thaliana, myrosinase is

confined to cells of the phloem parenchyma, whereas in B. napus myrosinase is

expressed in both the ground tissue and the phloem tissue. The expression

32 pattern of myrosinase in A. thaliana is in agreement with the in situ hybridization analysis of the published myrosinase genes in A. thaliana, TGG1 and TGG2 (Xue et al., 1995). The glucosinolates-containing S-cells (Koroleva et al., 2000) with translucent vacuoles are structurally different from the phloem myrosin cells with protein-containing vacuoles. This probably means that myrosinase and glucosinolates are not colocalized in the same cells, at least not in pedicels of A. thaliana (Andréasson et al., 2001). Kelly et al. (1998) also showed the presence of glucosinolates in non-myrosin cells in imbibed seeds of

B. juncea. These observations are in contrast to the "mustard oil bomb" theory

(Lüthy & Matile, 1984), which predicted myrosinase to be inactivated and localized in the same cell as glucosinolates. The presence of glucosinolates in the S-cells and myrosinase in myrosin cells of A. thaliana, with the cells adjacent and sometimes in contact with each other, is an important structural aspect considering the proposed functions of the system in nutrition and defense.

In both cases, products may need to be rapidly distributed throughout the plant.

Transport of secondary compounds, like alkaloids (Hashimoto & Yamada, 1994;

St-Pierre et al., 1999) and glucosinolates (Brudenell et al., 1999; Lykkesfeldt &

Møller, 1993; Merritt, 1996) have been shown in several species. Glucosinolates have been proposed to be transported by the phloem and not by the xylem because myrosinase has been claimed to be present in the latter tissue (Brudenell et al., 1999).

More evidences for the localization of glucosinolates are needed, but are hard to obtain because of the solubility of this group of compounds. Since glucosinolates are hydrolyzed only after the plant is injured, there are three possible locations of substrate and enzyme: they are in different cells, in

33 different compartments of the same cell (e.g. different vacuoles in the same cell), or inside the same compartment of the same cell but in an inactive form (Bones

& Rossiter, 1996).

Among these three possibilities, a localization of glucosinolates and myrosinase in different vacuoles in the same cell is not likely (Bones & Rossiter,

1996). During seedling development, fisions and fusions of the vacuoles in the cells are the most remarkable and after that the vacuoles of a myrosin cell will undergo considerable changes (Bones et al., 1991). Mechanism for sorting and fusion of glucosinolates or myrosinase containing vacuoles is necessary to maintain the stability of such a system. However no such kind of mechanisms has been observed till now. A more likely system would include compartmentation of glucosinolates in vacuoles of some cells and myrosinases in vacuoles of myrosin cells (Bones & Rossiter, 1996). The demolition of subcellular compartmentation by mechanical disruption or by micro- or macro-organisms feeding on the plants would cause the necessary contact between enzyme and substrate. Another possibility is that myrosinase is localized in myrosin cells and other components of the system in separate cells.

To activate such a system enzymes or substrates must be transported or the organization of a tissue broken.

The three sub-groups of myrosinases reported by Thangstad et al. (1993) and Falk et al. (1995) may also have relevance to the organization of the glucosinolates-myrosinase system. The two genes belonging to the Myr1 and

Myr2 subgroups of the gene family were reported to have 3 and 9 potential glycosylation sites (Thangstad et al., 1993). Since glycosylation may be a requisite for a vacuolar localization due to the hydrophilic properties added with

34 the carbohydrates, this could indicate that myrosinase also can be localized in

other places than the vacuole/myrosin grain (Bones & Rossiter, 1996).

From the above mentioned it can be concluded that the cellular

organization of the myrosinase-glucosinolates system is still unclear. Evidence

shows that myrosinases, glucosinolates and ascorbic acid are localized in

vacuoles, but with the exception of myrosinase which is localized in myrosin

cells, the cellular localization of the other components including myrosinase

associated proteins are unknown.

2.4.2. Role of the myrosinase-glucosinolates system

The glucosinolates-myrosinase system is generally believed to be part of the plant’s defense against insects, and possibly also against pathogens. It may have multiple functions in plant-pest interactions, providing not only feeding and ovipositioning stimulants but also compounds acting as toxins and feeding deterrents to generalist insect herbivores (Bones & Rossiter, 1996). The glucosinolates-myrosinase system is highly complex and plants contain many different myrosinase genes (Xue et al., 1992) in addition to a number of structurally different glucosinolates with aliphatic, aromatic or indolylic side chains (Fenwick et al., 1994). The glucosinolates may be a sink for nutrients like nitrogen and sulfur, helping with sulfur and nitrogen metabolism and growth regulation (Bones & Rossiter, 1996). The degradation products may be involved in defense system of the plants against microorganisms, insects, and other phytopathogens (Bones & Rossiter, 1996). The number of different glucosinolates and isoenzymes reported so far may indicate that specific

35 hydrolysis products are needed for certain situations or developmental stages

(Bones & Rossiter, 1996). For example, indoleglucosinolates may be a sink for production of the growth factor indole acetic acid (IAA) and thereby be involved in growth regulation. The complexity of the myrosinase-glucosinolates system should indicate an important role in the life of the cruciferous plants.

Actually plant secondary metabolites such as glucosinolates are shown to

serve as mediators in plant-insect interactions in several ways. Hartman (1996)

suggested that the great chemical diversity and intraspecific variability of

secondary metabolism were the result of processes of natural selection which

acted upon highly variable chemical structures. Biochemical and physiological

properties of myrosinase-glucosinolates system are in accordance with such a

view. This system stimulates insect feeding and oviposition, defends plants

directly, and provides cues to natural enemies of herbivores even contribute to

indirect plant defense (Hartman, 1996).

Effects of the glucosinolates-myrosinase system on specialist and

generalist herbivores display heterogeneous results that do not strictly adhere to

chemical defense theory (Kliebenstein et al., 2002). For example, increasing

glucosinolates levels in B. juncea reduced feeding by a generalist lepidopteran

herbivore, Spodoptera eridania, while the specialist Plutella xylostella was

unaffected by glucosinolates concentration in B. juncea. Further, increased

glucosinolates levels in B. rapa also led to decreased feeding by both the

specialist, Pieris rapae, and the generalist, Trichoplusia ni (Stowe, 1998).

Elevated myrosinase levels had the opposite effect and decreased herbivory by

the specialist, P. xylostella (Li et al., 2000). In contrast, elevated glucosinolates

levels inhibited feeding of P. xylostella on B. rapa plants (Siemens &

36 Mitchell-Olds, 1996). Many studies have shown that specialist herbivores are attracted by glucosinolates and their breakdown products (Bartlet et al., 1997;

Griffiths et al., 2001; Huang & Renwick, 1994; Moyes & Raybould, 2001;

Pivnick. et al., 1994; Rojas, 1999; Stadler et al., 1995). In contrast, these compounds may play a defensive role by attracting a parasitoid of aphid herbivores (Bradburne & Mithen, 2000). Simultaneous analysis of the joint effects of glucosinolates and myrosinase together might clarify the defensive role of this secondary metabolic system.

It has become very clear recently that the glucosinolates/myrosinase system is dynamic, responding to environmental changes and to plant damage.

Pre-treatment with elicitor compounds, which stimulate glucosinolates accumulation (Doughty et al., 1995; Kiddle et al., 1994), can enhance resistance of the plant to subsequent infection by pathogens (Doughty et al.,

1995). More work is required to establish the underlying biochemical mechanisms that control this glucosinolates/myrosinase system.

────────────────────────────────

CHAPTER III. MATERIALS AND METHODS

────────────────────────────────

3.1. Plant Materials

3.1.1. Effects of temperature and pH on myrosinase activity of Chinese

flowering cabbage and Chinese kale

The effects of temperature and pH value on myrosinase activity were investigated only with mature and fresh plants of Chinese kale [B. oleracea var. alboglabra] and Chinese flowering cabbage [B. chinensis var. parachinensis

(Bailey)]. Plant materials were obtained from a local farm and then used as the experimental materials immediately. The second fully expanded leaves of the vegetative were chosen for experiments.

3.1.2. Chlorophyll concentration, chlorophyll fluorescence parameters, total

anti-oxidant capacity and myrosinase activity of marketable Brassica

vegetables

In this part of the study, mature and fresh plants of commonly consumed

Brassica vegetables (Plate 1), including Chinese kale [B. oleracea var.

Plate 1. Commonly consumed marketable Brassica vegetables: Chinese kale (A), Chinese flowering cabbage (B), broccoli (C), cauliflower (D), cabbage (E) and Chinese white cabbage (F).

39 alboglabra], cabbage [B. oleracea L. Capitata], broccoli [B. oleracea L. Italica],

cauliflower [B. oleracea L. Botrytis], Chinese flowering cabbage [B. chinensis

var. parachinensis (Bailey)] and Chinese white cabbage [B. campestris L.

pekinensis], were purchased from a local supermarket (The above nomenclature

of these Brassica vegetables follows that of Gray, 1989). They were

immediately used for the various experiments upon arrival in the laboratory. In

this series of study, only the second fully expanded leaves of the vegetative

shoots of the leafy vegetables were chosen for experiments, unless otherwise

stated. In both broccoli and cauliflower, florets from the middle parts of the 2nd

or 3rd branch from the inside were chosen for the experiments.

3.1.3. Effects of post harvest storage on chlorophyll concentration, total

anti-oxidant capacity, and myrosinase activity in the leaves of Chinese

flowering cabbage and Chinese kale

The effects of post harvest storage on chlorophyll concentration, total anti-oxidant capacity and the myrosinase activity of the vegetables were studied with mature plants of Chinese kale [B. oleracea var. alboglabra] and Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)], which were freshly obtained from a local farm. The Brassica vegetables were placed in zip-block bags to minimize moisture loss and create a high humidity storage environment immediately upon arrival in the laboratory. Also, plants of both

Chinese flowering cabbage and Chinese kale were divided into two groups for two different treatments: In treatment A the vegetables was kept in the refrigerator at 4°C for 10 days until they started to show symptom of

40 decomposition. In treatment B the vegetables was kept under room temperature at 25°C. Both treatments were subjected to dark storage. The second fully expanded leaves of the vegetative shoots of Chinese flowering cabbage and

Chinese kale were collected on day 0, 2, 4, 6, 8 and 10 of storage for analyses.

3.1.4. Effects of plant age and different [N] fertilizers on chlorophyll

concentration, total anti-oxidant capacity and myrosinase activity in different

plant organs of the seedlings of Chinese flowering cabbage during early

establishment

The effects of fertilizers with different nitrogen concentration, plant age and plant organ were studied with young seedlings of Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)]. Chlorophyll concentration, total anti-oxidant capacity and myrosinase activity were determined immediately after the harvest of the plants. The above parameters were also investigated in the various organs of the harvested plants, including leaves, stems and roots of the seedlings of Chinese flowering cabbage. All the plants were cultivated in

GA7™ containers for 11 days after sowing. The seeds were purchased from

Known-You Seed Co. LTD. Plants were watered with Hoagland solutions with full-strenth (1N), nitrogen-free (0N) and half-nitrogen concentration of the full-strengths Hoagland solution (0.5N) respectively. Tissue samples from the leaves, stems and roots of various Hoagland solutions treated plants were collected for the determination of chlorophyll concentration, total anti-oxidant capacity and myrosinase activity on day 3, 5, 7, 9 and 11 after sowing. Tissue samples from the leaves, stems and roots of the other two kinds of Hoagland

41 solution treated plants (0N and 0.5N) were also collected for the determination of the myrosinase activity on day 3, 5, 7, 9 and 11 after sowing.

3.1.5. Effects of plant age on chlorophyll concentration, anti-oxidant capacity,

and myrosinase activity in different organs of mature plants of Chinese

flowering cabbage

In this part of the study, seeds of Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)] purchased from Known-You Seed Co.

LTD were cultivated in small pots (12cm in diameter). The germinated plants were allowed to grow for different periods with full-strength Hoagland solution being supplied every three days. Then samples of the leaves, stems and petioles from the cultivars were collected on day 10, 15, 20, 25 after sowing. Chlorophyll concentration, total anti-oxidant capacity and myrosinase activity were determined with the tissues from different organs immediately after picking up the samples.

3.1.6. Drought effects on chlorophyll concentration, chlorophyll fluorescence

parameters, total anti-oxidant capacity, and myrosinase activity in the leaves

of Chinese flowering cabbage

In this part of the study, bigger plants of Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)] were grown in pots in Agri-Food &

Veterinary Authority of Singapore for twenty days. They were then transferred to the greenhouse of Department of Biological Sciences in NUS for further

42 experiments. One group of Chinese floweing cabbage used for the experiments were well-watered everyday. The other group of plants was grown under drought condition by withholding irrigation for various durations. All the cultivars were exposed to natural variations of PPFD levels. The daily PPFD levels ranged from 50-250 µmol m-2s-1 and it was highest during mid-day. Air temperature of the green house was 25-35°C. As above, only the second fully expanded leaves of the vegetative shoots of Chinese flowering cabbage were chosen for experiments.

3.1.7. Total anti-oxidant capacity and myrosinase activity in the leaves of 16

different cultivars of Chinese flowering cabbage (of marketable types)

Different cultivars of Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)] were used for the study of myrosinase antivity and total anti-oxidant capacity. These plants were cultivated for 28 days after growing and then were freshly harvested from Agri-Food & Veterinary Authority of

Singapore and immediately brought to the laboratory for experimentation. The study was carried only on the second fully expanded leaves of the vegetative shoots of the plants. All the 16 varieties are as shown in Table 1.

3.1.8. Molecular study on myrosinase in the leaves of 16 different cultivars of

Chinese flowering cabbage

Different cultivars of Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)], all the same with the materials used in selection of

Table 1. Basic information of the 16 tested cultivars of Chinese flowering cabbage as provided by Agri-Food & Veterinary Authority of Singapore.

Label Common Name Company

C1 Medium Flower Choy Sam Seed Ban Lee Huat

C2 Early Flower Choy Sam seed Ban Lee Huat

C3 211 Ban Lee Huat

1 Pai Tsai #1316KY-early Know-You Seed Co

4 Caisim flower stem type East-West Seed Co

5 Caixin Chai Tai Seed Co

6 Bang Luang 006 (caixin) Chai Tai Seed Co

7 Flowering Pak Choy Chai Tai Seed Co (Dark green type) 9 Chye Sim Flowering Faithful Provider

10 Chye Sim a Faithful Provider

11 Chye Sim b Faithful Provider

12 Chye Sim c Faithful Provider

15 Tosakan PT. East West Seed (Caisum Bangkok) Indonesia 16 Tsoi Sum Tropical Seed Co

17 Sawi Hibrida Super King Seed Co

18 Sawi Manis Chai Tai Seed Co

44 3.1.7, were used for the molecular study of myrosinase. Leaf samples were

collected from the plants, frozen in liquid nitrogen and stored at -80ºC until

future used.

3.2. Preparation of Hoagland solution

Hoagland solution was one of the standard research nutrient solutions for hydroponics. The full-strength Hoagland solution was prepared as shown in

Table 2. The preparation of the other two kinds of modified Hoagland solutions with 0N and 0.5N were also shown in Table 2.

3.3. Chlorophyll concentration

Fresh tissues samples 0.5 g of leaves, petioles, stems or roots were weighed and cut into small pieces (about 1 mm wide). These tissue pieces were ground with a mortar and pestle in 2-3 ml of 100% acetone. The homogenate was transferred to a falcon tubes and topped up the volume to 5 ml with pure acetone. After that the tubes were stored in the dark for 15 min. Then the slurries were centrifuged for 10 min, 4,000 rpm (Hermle Z200A) to separate solid compound elements. The absorbances of the samples were read at 663, 645 and

460nm by the UV-vis spectrophotometer and used for the calculation of chlorophyll concentration according to Embry & Nothnagel (1994), where A is absorption at given wavelengths:

Total chlorophyll (mg/ml) = 20.2 (A645) + 8.02 (A663)

Chlorophyll a (mg/ml) = 12.7 (A663) - 2.69 (A645)

Table 2. Ingredients of Hoagland solutions with different nitrogen concentrations.

All solutions were made up to one liter with distilled water.

Chemicals 0N 0.5N 1N

-3 -3 KNO3 Nil 2.5×10 M 5×10 M

-3 -3 Ca(NO3)2 Nil 2.5×10 M 5×10 M

-3 -3 -3 KH2PO3 1×10 M 1×10 M 1×10 M

-3 -3 -3 MgSO4 2×10 M 2×10 M 2×10 M

-3 -3 KCl2 5×10 M 2.5×10 M Nil

-3 -3 CaCl2 5×10 M 2.5×10 M Nil

-1 -1 -1 B (from H3BO3) 0.5mg·L 0.5mg·L 0.5mg·L

-1 -1 -1 Mn (from MnCl2 · 4H2O) 0.5mg·L 0.5mg·L 0.5mg·L

-1 -1 -1 Zn (from ZnSO4 · 7H2O) 0.5mg·L 0.5mg·L 0.5mg·L

-1 -1 -1 Cu (from CuSO4 · 5H2O) 0.02mg·L 0.02mg·L 0.02mg·L

-3 -3 -3 Mo (from 85% MoO3) 0.02×10 g 0.02×10 g 0.02×10 g

Fe (from Fe-EDTA) 0.2 M 0.2 M 0.2 ml

46 Chlorophyll b (mg/ml) = 22.9 (A645) - 4.68 (A663)

Carotenoids (mg/ml) = 5(A460) - 14.87(A645) + 2.84(A663)

3.4. Chlorophyll fluorescence

Chlorophyll fluorescence was determined at room temperature (20°C) with a pulse-modulated fluorometer (FMSII, Hansatech, England). The selected leaf samples were dark-adapted using leaf-clips (Hansatech, England) for 30 min, allowing the PSII reaction centers to relax before starting the measurements. The actinic light level used was 70 μmol m-2s-1 and saturation light pulse (4000 μmol m-2s-1 each) were switched on every 60 s; the duration of each measurement was

30 min. The following chlorophyll fluorescence parameters were determined: Fo

(minimal fluorescence yield under dark-adapted conditions), Fm (maximal fluorescence yield under dark-adapted conditions), Fv/Fm (potential quantum efficiency of open PSII reaction centers), Fo’ (minimal fluorescence yield under light-adapted conditions), Fm’ (maximal fluorescence yield under light-adapted conditions), Fv’/Fm’ (efficiency of excitation energy capture by open PSII reaction centers), qP (photochemical quenching), qNP or NPQ

(non-photochemical quenching), and ΔF/Fm’ (potential for non-cyclic electron transport). All parameters determined were calculated according to Maxwell &

Johnson (2000).

3.5. Total anti-oxidant capacity

Brand-Williams et al. (1995) suggested that the DPPH [2, 2-di

47 (4-tert-octylphenyl) -1- picrylhydrazyl] radical scavenging assay was an easy and accurate method for determining the antioxidant capacity of fruit and vegetable juices or extracts. DPPH is a stable free radial with a purple color

(absorbs at 517 nm).

Plant samples of 0.1 g were ground into fine powder and dissolved in 1 ml distilled water. Each of the slurry was centrifuged (Hermle Z200A) for 15 min with 10,000 rpm at 4ºC to separate solid compound elements.

The DPPH free radical scavenging assay was performed according to the method of Kirby and Schmidt (1997). Standard curve was established by mixing different amounts of 0.5 ml/ml methanolic solutions of ascorbic acid and distilled water, at 6 different concentrations. The DPPH solution was prepared at a concentration of 0.1 mM in methanol. In one set of cuvettes, 2.95 ml DPPH solution plus 50 μl sample solution were added. In the other set of cuvettes, 2.95 ml methanol plus 50 μl sample were added. Both the two sets of cuvettes were kept in the dark at room temperature for 30 min. The absorbances of the samples were measured at 517 nm using pure methanol as blank. In this series of experiments, the results were expressed as mg of ascorbic acid equivalents per

100 g, i.e. the quantity of ascorbic acid required to produce the same scavenging activity as the extract in 100 g of sample (L-ascorbic acid equivalent antioxidant capacity, AEAC).

3.6. Crude extraction of myrosinase and activity determination

Myrosinase activity was assayed according to the method of Palmieri et al.

(1982). Plant tissue samples of either leaves, petioles, stems or roots, 0.1 g each,

48 were ground into powder with a mortar and pestle and extracted in 1 ml extraction buffer [10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1% w/v PVP

(polyvinylpyrrolidone) and 1 mM DTT (dithiothreitol)]. Each of the slurry was centrifuged (Hettich Universal 32R refrigerator centrifuge) for 15 min with

10,000 rpm at 4°C to remove precipitates and stored at 4°C in the ice box until utilized. The supernatant fluid contained the crude extract of the thioglucosidase protein, myrosinase.

The myrosinase activity assay was based on the release of glucose from the reaction of hydrolysis of a known amount 2-propenyl glucosinolate (sinigrin) added to the reaction media by the crude extracted myrosinase. Sample solution was the supernatant fluid obtained from above. Sinigrin solution was prepared by adding 15 mg sinigrin in 1 ml distilled water. Tubes were divided into two sets: reaction tubes and control tubes. In each of the reaction tube, assays were carried out using 0.35 ml potassium phosphate buffer of 33 mM at pH 6.0, containing 0.05 ml sample solution, in a total volume of 0.5 ml together with 0.1 ml sinigrin solution. In each of the control tube, assays were carried out using

0.35 ml the same potassium phosphate buffer, containing 0.05 ml sample solution, in a total volume of 0.4 ml without sinigrin solution. All the tubes were incubated in a waterbath at 37°C for 30 min. Then the reaction was stopped by inactivating the myrosinase activity at 100°C for 5 min. After that 0.1 ml sinigrin solution was mixed with the solution in each control tube.

A glucose diagnostic kit (Sigma Chemical Co., St. Louis, MO) was used to determine the amount of glucose released upon enzymatic hydrolysis of sinigrin. The glucose diagnostic kit was reconstituted according to the manufacturer's specification. The absorbance of the pink color of the

49 quinoneimine complex formed was determined with a spectrophotometer at 540 nm. A standard curve were prepared by mixing 0, 10, 20, 30 and 40 μl of glucose stock solution (1.0 mg glucose per ml distilled water) with 500, 490, 480,

470 and 460 μl of distilled water respectively to obtain a total volume of 0.5 ml in each tube. Then 1 ml of reagents constructed from the diagnostic kit was added into all the tubes including reaction, control and standard curve tubes and then incubated in a waterbath at 37ºC for 30 min. Two ml of sulfuric acid of 12

M were added to each tube to stop reaction and a pink color was formed.

Absorbances were read at 540 nm (Shimadzu UV-visible recording spectrophotomer UV-160).

To determine the effect of pH value on myrosinase activity, pH value of the potassium phosphate buffer was adjusted to range from 4.65 to 8.00. For the determination of temperature effect on myrosinase activity, reaction temperature was adjusted to range between 20 to 60 ºC.

3.7. Total soluble protein concentration

The concentration of total soluble proteins was measured by the method described by Bradford (1976) using the Bio-Rad protein assay (Sigma, USA).

Bovine serum albumin (BSA) (Sigma, USA) was used as the standard.

3.8. Molecular study on myrosinase

3.8.1. Total DNA extraction

The second fully expanded leaves of the vegetative shoots of different

50 varieties of Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)]

(described previously in section 3.1.8) were collected for the extraction of DNA.

Total genomic DNA was extracted according to the manufacturer’s instruction of Plant DNA Extraction (DNAzol®, Invitrogen™).

Plant tissues of 0.2 g were pulverized in liquid nitrogen using a mortar and pestle. Liquid nitrogen was replenished in the mortar 2-3 times until a fine homogeneous powder was obtained. The powders were transferred to a centrifuge tube containing 600 µl of DNAzol. After that, samples were stored at room temperature for 5 min with mixing by inversion or mechanical rotation.

Chloroform (1 ml of chloroform per 1 ml of DNAzol ES) was added and then the mixture was shaked vigorously for 5 min. The mixture was then centrifuged at 12,000 g for 10 min. During these procedures pigments and insoluble plant debris were removed by the chloroform extraction.

Following centrifugation, the upper aqueous phase was transferred to a clean tube. 450 µl of 100% ethanol was added to the supernatant to precipitate

DNA. Samples were mixed after the addition of ethanol by inverting the tubes

8-10 times and stored at room temperature for 5 min. After that precipitated

DNA was sedimented at 5,000 g for 4 min and the resulting supernatant was discarded.

DNAzol-ethanol wash solution was prepared by mixing 1 volume of

DNAzol ES with 0.75 volume of 100% ethanol.

The supernatant was removed by decanting. The 600 µl of

DNAzol-ethanol wash solution prepared above was added to the pellet. Each

DNA pellet was washed for 5 min by intermittent vortexing and the DNA was sedimented at 5,000 g for 4 min. A second ethanol wash would be employed if

51 plant pigments were visible in the ethanol wash solution.

The ethanol wash was removed by decanting and the tubes were stored vertically for 1-2 min. Excess ethanol was removed from the DNA pellet with a micropipette. Then the pellet was air-dried.

The pellet was resuspended in 70 µl of TAE buffer (40 mM Tris-acetate

[pH 8.0], 1 mM disodium EDTA) if the pellet would be used immediately. An aliquot of the resuspended DNA was added to 1 ml of autoclaved distilled water.

OD260 and OD280 were measured to determine the concentration and purity of extracted DNA. The pellet was stored in 95% ethanol at 4ºC.

3.8.2. Primer description and PCR (polymerase chain reaction)

Basic information of one pair of primer [MYRO] tested was listed out in

Table 3. PCR programs were set up for the [MYRO] primers (Table 4). After an initial denaturing step [95°C for MYRO; according to the manufacturer’s description (Proligo LLC, USA)] for 5 min, PCR cycles were performed according to Table 4, followed by final extensions at 72°C for 7 min.

The PCR amplification was performed in a half eaction mixture with a total volume of 25 µl for each sample. Each of this mixture contained 1.5 mM of

MgCl2, 10 µM of deoxynucleotide triphosphate (dNTPs, Promega, US), 2.5 µl of 10 × PCR buffer (including 500 mM KCl, 100 mM Tris pH 9.0, 1% Triton

X-100, 20 mM MgCl2), 10 µM of primers (both forward and reverse), 1 µl of

Taq Polymerase (50 mM Tris pH 8.0, 50 mM KCl, 0.1mM EDTA, 1 mM DTT,

1 mM PMSF, 50% glycerol), 25 ng of template DNA; 17.5 µl of autoclaved distilled water were added to adjust the total volume to 25 µl. The PCR

52 amplification used the programmable thermal controller according to the manufacture’s protocol (PTC-200, MJ).

3.8.3. Gradient PCR and sequencing

Gradient PCR programs were performed for the determination of the optimal annealing temperatures, which were chosen randomly by the programmable thermal controller (PTC-200, MJ) according to the temperatures described for the primers [MYRO].

Ten microgram (µg) of PCR products were analyzed using 1% agarose gel electrophoresis in the gel tank (Bio-Rad, Singapore). Big-dye PCR was conducted to prepare the samples for sequencing. The products obtained from

Big-dye PCR were sequenced using an ABI PRISM genetic analyzer according to the manufacturer’s protocol (3100A, Applied Biosystems, Japan).

Table 3. Basic information of the primer [MYRO] that was tested.

Name of the primer Sequence (5’-3’) of the primer Primer size (base-pair) Annealing Temperature

MYRO F 5’- GCTTCTTCATGGACTCGCTTTAG-3’ 23 54ºC

R 5’- GAAAATCATATGAACCAGCAACGAG - 3’ 25 56ºC

* The references of the pair of primer were from NCBI data base. MRYO stands for Myrosinase in Brassica rapa var. parachinensis

Table 4. PCR programs for the primer [MYRO] that was tested.

Name Denaturing PCR cycles Final extension Keep

MYRO 95°C 5min 30 cycles Denature at 95°C 1 min 72°C 7 min 4°C infinity

Anneal at 54.3°C for 1 min

Extend at 72°C for 1 min

────────────────────────────────

CHAPTER IV. RESULTS

────────────────────────────────

4.1. Effects of temperature and pH on myrosinase activity of Chinese

flowering cabbage and Chinese kale

We used two parameters to express myrosinase activity: total and specific activity of myrosinase. Assessment of myrosinase activity was based on measuring glucose released when the leaf tissue was incubated with the substrate sinigrin. Specific myrosinase activity was expressed as unit per mg of protein.

One unit of myrosinase activity was defined as the amount of enzyme that catalyzed the hydrolysis of 1 µmol sinigrin per minute under the described conditions.

Using sinigrin as the substrate, the optimum condition for myrosinase assay in Chinese flowering cabbage and Chinese kale was achieved at 35~40°C and pH 6~6.5.

4.1.1. Optimal temperature for myrosinase

The influence of incubation temperature on total myrosinase activity was studied in Chinese flowering cabbage and Chinese kale. Since specific myrosinase activity was expressed as unit per mg of protein and total soluble

Chinese flowering cabbage Chinese kale

0.90

0.80 FW) -1 0.70

0.60

0.50

0.40

0.30

0.20

Total myrosinase activity (unit g 0.10

0.00 20 25 30 35 40 45 50 55 60 Temperature of reaction buffer (ºC)

57 protein was extracted under the same temperature, we only obtained the result of total myrosinase activity under different temperature.

In both vegetables, total myrosinase activity (unit g-1 fresh weight of leaves) increased as the incubation temperature increased from 21°C to 40°C

(Fig. 1). At 40°C, total myrosinase activities were about 11 and 12 times of those at 21°C in Chinese flowering cabbage and Chinese kale, respectively (Fig. 1).

These values then declined rapidly as temperatures increased further (Fig. 1). At

60°C, only about 10% of the myrosinase activity at 40°C was detected in the two

Brassica vegetables (Fig. 1). The optimum temperature for myrosinase activity was 40°C in both Chinese flowering cabbage and Chinese kale (Fig. 1). At optimal temperature, total activity was 0.432 ± 0.003 unit g-1 FW in Chinese flowering cabbage and 0.734 ± 0.029 unit g-1 FW in Chinese kale (Fig. 1).

4.1.2. Optimal pH value for myrosinase

The influence of pH value of reaction buffer on total and specific myrosinase activity was studied in Chinese flowering cabbage and Chinese kale.

The effects of pH on myrosinase activity of the crude extracts of both Chinese flowering cabbage and Chinese kale were shown in Fig. 2. Total activity of myrosinase increased steadily as the pH values increased from pH 4.65 to pH

6.50 in both Chinese flowering cabbage and Chinese kale (Fig. 2A). Total activity remained relatively high (more than 90% of maximal total activity of myrosinase) between pH 6.0 and 6.5 (Fig. 2A). Total myrosinase activity in both vegetables decreased as pH value increased (Fig. 2A). The pH optimum of these two Brassica vegetables was between pH 6.0 and 6.5 (Figs. 2A & 2B). At the

58 optimal pH, total activities of myrosinase were 0.396 ± 0.023 units g-1 FW in

Chinese flowering cabbage and 0.700 ± 0.023 unit g-1 FW in Chinese kale (Fig.

2A). The changes in specific activity of myrosinase were almost the same as those of total myrosinase activity. Specific activity of myrosinase also increased as the pH increased from pH 4.65 to 6.00 in both Chinese flowering cabbage and

Chinese kale (Fig. 2B). The highest specific activity of myrosinase was obtained at pH 6.0 (Fig. 2B). At pH 6.0, both Chinese flowering cabbage (0.021 ± 0.002 unit mg-1 protein) and Chinese kale (0.0312 ± 0.001 unit mg-1 protein) showed the highest specific activity of myrosinase (Fig. 2B).

Total soluble protein concentration in Chinese kale was always a bit higher, on the average, around 22% more than in Chinese flowering cabbage (Fig. 2C).

Total soluble protein concentration increased as pH values increased in both

Chinese flowering cabbage and Chinese kale (Fig. 2C).

4.2. Chlorophyll concentration, chlorophyll fluorescence parameters, total

anti-oxidant capacity, and myrosinase activity of marketable Brassica

vegetables

Six commonly eaten Brassica vegetables, Chinese kale [B. oleracea L.

Alboglabra], cabbage [Brassica. oleracea L. Capitata], broccoli [B. oleracea L.

Italica], cauliflower [B. oleracea L. Botrytis], Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)] and Chinese white cabbage [B. campestris

L. pekinensis], purchased from the supermarket, were used in this part of the study.

Of the six Brassica vegetables studied, leaves of four leafy vegetables,

Chinese kale Chinese flowering cabbage A 0.8 0.7

FW) 0.6 -1 0.5 0.4 0.3 0.2 Total myrosinase

activity (unit g 0.1 0.0 4 4.5 5 5.5 6 6.5 7 7.5 8 8.5 9 pH value of reaction buffer

B 0.04

0.03

protein) 0.02 -1 myrosinase 0.01 (unit mg Specific activity of

0.00 4 4.5 5 5.5 6 6.5 7 7.5 8 8.5 9 pH value of reaction buffer

C 35.0

30.0

FW) 25.0 -1 -1 20.0

15.0

10.0 content (mg g

Total soluble protein 5.0

0.0 4 4.5 5 5.5 6 6.5 7 7.5 8 8.5 9 pH value of reaction buffer

Figure 2. Influences of pH on myrosinase activity in Chinese flowering cabbage and Chinese kale. The phosphate buffer was adjusted to different pH values for this experiment. The properties investigated were total activity of myrosinase (A), specific activity of myrosinase (B) and total soluble protein concentration (C). Each datum point is presented as mean standard error (vertical bar). n=4 .

60 including Chinese kale, cabbage, Chinese flowering cabbage and Chinese white cabbage, were used to determine their chlorophyll concentrations (Fig. 3), chlorophyll fluorescence parameters (Fig. 4), anti-oxidant capacities (Fig. 5) and myrosinase activity (Fig. 6). The other two, which were broccoli and cauliflower, were non-leafy vegetables with floret heads. These two Brassica vegetables were used for the determination of only chlorophyll concentration (Fig. 3), anti-oxidant capacity (Fig. 5) and myrosinase activity (Fig. 6).

4.2.1. Chlorophyll concentration

Total chlorophyll concentration was highest in the green leaves of the

Chinese flowering cabbage (237.650 ± 9.760 mg g-1 FW) (Fig. 3A). Cabbage

and cauliflower contained the lowest amounts of total chlorophylls (3.367 ±

0.167 mg mg-1 and 2.743 ± 0.210 mg g-1 FW, respectively) (Fig. 3A).

Average values of chlorophyll a to chlorophyll b ratios were also different

for the different vegetables (Fig. 3B). This ratio was no more than 1.000 in the

cabbage and cauliflower (0.951 ± 0.131 and 0.818 ± 0.050 respectively) (Fig.

3B). The highest ratio of chlorophyll a to chlorophyll b was found in the leaves

of Chinese kale and Chinese floweing cabbage (2.435 ± 0.102 and 2.453 ±

0.096 respectively) (Fig. 3B).

Total carotenoid concentration was highest in the leaves of Chinese

flowering cabbage (30.765 ± 0.878 mg g-1 FW) (Fig. 3C). Cauliflower and

Chinese white cabbage contained the lowest amount of total carotenoid (0.208 ±

0.009 mg g-1 FW and 0.2456 ± 0.030 mg g-1 FW, respectively) (Fig. 3C).

Average values of total chlorophyll to total carotenoid ratios was between

A 300.0 250.0 200.0 FW)

-1 150.0 100.0 (mg g (mg 50.0 0.0 Chinese cabbage cauliflower broccoli Chinese Chinese Total Chlorophyll concentration concentration Chlorophyll Total kale flowering white cabbage cabbage B 3.0 2.5 2.0 1.5 1.0 0.5 0.0 Chlorophyll a/b ratios Chinese cabbage cauliflower broccoli Chinese Chinese kale flowering white cabbage cabbage C 35.0 FW)

-1 30.0 25.0 20.0 15.0 10.0 5.0 Total carotenoid carotenoid Total 0.0 concentration (mg g (mg concentration Chinese cabbage cauliflower broccoli Chinese Chinese kale flowering white cabbage cabbage D 16.0 14.0 12.0 10.0 8.0 6.0 4.0 carotenoid 2.0 0.0 Chinese cabbage cauliflower broccoli Chinese Chinese Total chlorophyll: total kale flowering white cabbage cabbage

Figure 3. Total chlorophyll concentrations (A), chlorophyll a to chlorophyll b ratios (B), total carotenoid concentrations (C) and total chlorophyll to total carotenoid ratios (D) of six commonly eaten Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4.

62 6 to 13 in the six Brassica vegetables studied (Fig. 3D). Cauliflower and

Chinese white cabbage showed the highest values of 13.192 ± 0.810 and 12.372

± 1.920, respectively (Fig. 3D).

4.2.2. Chlorophyll fluorescence parameters

Parameters of chlorophyll fluorescence in the four leafy Brassica vegetables studied were quite different. The potential quantum efficiency of open PSII reaction centers in the dark-adapted state (Fv/Fm) was lowest in cabbage (0.521 ± 0.003), and were all above 0.800 in the other three leafy vegetables (Chinese kale, Chinese flowering cabbage and Chinese white cabbage) (Fig. 4). The efficiency of excitation energy captured by open PSII reaction centers (Fv’/Fm’) was also lowest in the cabbage (0.246 ± 0.016) and were all above 0.750 in the remaining three vegetables studied (Fig. 4). The potential for non-cyclic electron transport (ΔF/Fm’) was lowest in cabbage as well (0.125 ± 0.001) and it was above 0.700 in the other three leafy Brassica vegetables studied (Fig. 4).

Photochemical quenching (qP) was high in both Chinese flowering cabbage (0.962 ± 0.041) and Chinese kale (0.953 ± 0.065), and it was lowest in cabbage (0.508 ± 0.011) (Fig. 4). Non-radiative dissipation via the xanthophyll cycle (NPQ) was high in the Chinese white cabbage (0.495 ± 0.037) and cabbage (0.582 ± 0.048), and it was low in both Chinese flowering cabbage

(0.126 ± 0.002) and Chinese kale (0.185 ± 0.012) (Fig. 4).

Fv/Fm Fv'/Fm' DF/Fm' qP NPQ

1.1 1.0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 Chlorophyll fluorescence parameters fluorescence Chlorophyll 0.1 0.0 Chinese kale cabbage Chinese Chinese flowering white cabbage cabbage

Figure 4. Chlorophyll fluorescence parameters of the leaves of four leafy Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4.

64 4.2.3. Total anti-oxidant capacity

Total anti-oxidant capacity of the six vegetables studied was determined as

the ascorbic acid equivalent (Fig. 5). Total anti-oxidant capacity was relatively

high in Chinese kale, broccoli and Chinese flowering cabbage, and it was low in

cabbage, cauliflower and Chinese white cabbage (Fig. 5). Among them, Chinese

flowering cabbage showed the highest total anti-oxidant capacity (4.523 ± 0.577

mg AA g-1 FW) (Fig. 5), while cauliflower showed the lowest total anti-oxidant

capacity (0.018 ± 0.002 mg AA g-1 FW) (Fig. 5).

4.2.4. Myrosinase activity

In the six Brassica vegetables studied, total and specific activity of myrosinase were quite different. Total activities of myrosinase were all above

0.08 unit g-1 FW (Fig. 6A). It was 1.179 ± 0.022 units g-1 FW in the Chinese kale, and 1.265 ± 0.073 unit g-1 FW in the broccoli. The lowest total myrosinase activity was found in the cabbage (0.083 ± 0.018 units g-1 FW) (Fig. 6A).

Average specific activities of the six vegetables studied were all above

0.018 unit mg-1 protein (Fig. 6B). Chinese white cabbage showed the highest specific activity of myrosinase (0.125 ± 0.013 unit mg-1 protein). Chinese flowering cabbage showed the lowest average specific activity (0.019 ± 0.003 unit mg-1 protein) (Fig. 6B).

The concentration of total soluble proteins in broccoli was the highest

(20.895 ± 2.072 mg g-1 FW) (Fig. 6C). The lowest concentration of total soluble proteins was observed in cabbage (1.694 ± 0.270 mg g-1 FW) (Fig. 6C).

6.0 FW) -1 5.0

4.0

3.0

2.0

1.0

Total anti-oxidant capacity (mg AA g AA (mg capacity anti-oxidant Total 0.0 Chinese cabbage cauliflowerbroccoli Chinese Chinese kale flowering white cabbage cabbage

Figure 5. Total anti-oxidant capacity (mg AA g-1 FW) of six commonly eaten Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4.

66 A 1.5 FW) -1 -1

1.0

0.5

Total activity (unit g 0.0 Chinese cabbage cauliflower broccoli Chinese Chinese kale flowering white cabbage cabbage B 0.15

0.10 protein) -1

0.05 Specific activity (unit mg

0.00 Chinese cabbage cauliflower broccoli Chinese Chinese kale flowering white cabbage cabbage

25.0 FW)

-1 20.0

15.0

10.0

5.0 Total soluble protein

concentration (mg g 0.0 Chinese cabbage cauliflower broccoli Chinese Chinese kale flowering white cabbage cabbage

Figure 6. Total myrosinase activity (A), specific activity of myrosinase (B) and total soluble protein concentration (C) in six commonly eaten Brassica vegetables. Each datum point is presented as mean standard error (vertical bar). n=4.

67 4.3. Effects of post harvest storage on chlorophyll concentration, total

anti-oxidant capacity, and myrosinase activity in the leaves of Chinese

flowering cabbage and Chinese kale

Different post harvest treatments had different effects on chlorophyll concentration, total anti-oxidant capacity and myrosinase activity in the leaves of Chinese flowering cabbage and Chinese kale. The Brassica vegetables stored at 4°C in the refrigerator remained green in color for more than 10 days, while those vegetables stored at normal room temperature became yellow rapidly. On the 4th day, vegetables stored at normal room temperature had already been yellow. Values of chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity and myrosinase activity showed less changes under refrigerated storage than those kept in the room storage.

4.3.1. Effects of post harvest storage on chlorophyll concentration

During the ten days of refrigerated storage, total chlorophyll concentration declined with increased time of both refrigerated and room storage in the leaves of both Chinese flowering cabbage and Chinese kale (Fig. 7A & Fig. 8A). But it decreased more rapidly in the leaves of both Chinese flowering cabbage and

Chinese kale stored at room temperature (Fig. 7A & Fig. 8A). On day 10 of refrigerated storage, total chlorophyll concentration was 65% and 73% of those in the leaves of Chinese flowering cabbage and Chinese kale at the beginning of the storage respectively (Fig. 7A & Fig. 8A). On day 4 of room storage, total chlorophyll concentration already dropped to 52% and 64% of those in the

68 refrigerated storage room storage A 3.0 2.5 2.0 FW)

-1 1.5

Total 1.0 (mg g chlorophyll

concentration 0.5 0.0 024681012 days of storage

B 3.0 2.5 2.0 1.5

ratio 1.0 0.5

Chlorophyll a/b 0.0 024681012 days of storage

0.40 C

0.30 FW) -1 0.20 (mg g

concentration 0.10 Total carotenoid

0.00 024681012 days of storage D

14.0 12.0 10.0 8.0 6.0 ratio 4.0 2.0 Total chlorophyll

to total carotenoid 0.0 024681012 days of storage

Figure 7. The effects of duration and temperature of post harvest storage on the total chlorophyll concentration (A), chlorophyll a/b ratio (B), total carotenoid concentration (C) and total chlorophyll to total carotanoids ratio (D) in the leaves of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.

refrigerated storage room storage A

2.5 2.0

FW) 1.5 -1

Total 1.0 (mg g chlorophyll 0.5 concentration 0.0 024681012 days of storage

3.0 2.5 2.0 1.5 ratio 1.0 0.5 ChLorophyll a/b 0.0 024681012 days of storage

0.30

FW) 0.20 -1

0.10 (mg g concentration Total carotenoid 0.00 024681012 days of storage

D 15.0

10.0

ratio 5.0

0.0 Total chlorophyll

to total carotenoid 024681012 days of storage

Figure 8. The effects of duration and temperature of post harvest storage on the total chlorophyll concentration (A), chlorophyll a/b ratio (B), total carotenoid concentration (C) and total chlorophyll to total carotanoids ratio (D), in the leaves of Chinese kale. Each datum point is presented as mean standard error (vertical bar). n=4.

70 leaves of Chinese flowering cabbage and Chinese kale at the beginning of the experiment respectively (Fig. 7A & Fig. 8A).

Chlorophyll a to b ratio did not show any obvious trend of change in the leaves of both Chinese flowering cabbage and Chinese kale under refrigerated storage (Fig. 7B & Fig. 8B). However, chlorophyll a to b ratio on the last day of refrigerated storage was lower than that on the first day of experiment, in both

Chinese flowering cabbage and Chinese kale under refrigerated storage (Fig. 7A

& Fig. 8B). At room temperature, chlorophyll a/b ratio declined quickly in the leaves of both Chinese flowering cabbage and Chinese kale. On the day 4 of room temperature storage, chlorophyll a/b ratio was only 72% and 87% of the ratio at the beginning of experiments, in the leaves of Chinese flowering cabbage and Chinese kale respectively (Fig. 7B & Fig. 8B).

Total carotenoid concentration did not show any obvious trend of change in the leaves of both Chinese flowering cabbage and Chinese kale under refrigerated storage (Fig. 7C & Fig. 8C). However, total carotenoid concentration on the last day of refrigerated storage was lower than that on the first day of experiment in both Chinese flowering cabbage and Chinese kale under refrigerated storage (Fig. 7C & Fig. 8C). This parameter decreased more rapidly at room temperature in the leaves of both Chinese flowering cabbage and

Chinese kale (Fig. 7C & Fig. 8C). On day 4 of room temperature storage, total carotenoid concentration already decreased to 60% and 75% of those at the beginning of the experiment, in the leaves of Chinese flowering cabbage and

Chinese kale respectively (Fig. 7C & Fig. 8C).

Total chlorophyll to total carotenoid ratio did not show any obvious trend of change in the leaves of both Chinese flowering cabbage and Chinese kale

71 under refrigerated storage (Fig. 7D & Fig. 8D). At room temperature storage, the ratio of total chlorophyll to total carotenoid dropped in both Chinese flowering cabbage and Chinese kale (Fig. 7D & Fig. 8D).

4.3.2. Effects of post harvest storage on total anti-oxidant capacity

During the ten days of refrigerated storage, total anti-oxidant capacity decreased slightly in the leaves of both Chinese flowering cabbage and Chinese kale (Fig. 9 & Fig. 10). No correlation between total anti-oxidant capacity and the duration of post harvest storage in the refrigerator was observed in the leaves of both Chinese flowering cabbage and Chinese kale. At room temperature, rapid decreases in total anti-oxidant capacity could be observed in the leaves of both Chinese flowering cabbage and Chinese kale (Fig. 9 & Fig. 10).

4.3.3. Effects of post harvest storage on myrosinase activity

The results obtained showed that myrosinase activity under the optimum assay conditions was highly dependent on the vegetable species and the conditions of post harvest storage (Fig. 11 & Fig. 12). Both the total activity and specific activity of myrosinase in the leaves of Chinese kale were at least two times higher than those in Chinese flowering cabbage (Figs. 11A & B & Figs.

12A & B). During refrigerated storage, the total and specific activities of myrosinase declined during storage and were associated with a decrease in the quality of the vegetables (Figs. 11A & B & Figs. 12A & B). However, these two parameters declined more rapidly in both Chinese flowering cabbage and

refrigerated storage room storage

6.0

5.0

4.0 FW) -1 3.0

(mg AA g 2.0 Total anti-oxidant capacity anti-oxidant Total 1.0

0.0 024681012 days of storage

Figure 9. The effects of duration and temperature of post harvest storage on the total anti-oxidant capacity in the leaves of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.

73 refrigerated storage room storage

6.0

5.0

4.0 FW) -1 3.0

(mg AA g 2.0 Total anti-oxidant capacity 1.0

0.0 024681012 days of storage

Figure 10. The effects of duration and temperature of post harvest storage on the total anti-oxidant capacity in the leaves of Chinese kale. Each datum point is presented as mean standard error (vertical bar). n=4.

74 Chinese kale stored at room temperature (Figs. 11A, B & Figs. 12A, B).

In Chinese flowering cabbage, total activity of myrosinase remained almost unchanged from the day it was brought from the farm until the 4th day of refrigerated storage (Fig. 11A). Thereafter, total myrosinase activity in the leaves of Chinese flowering cabbage decreased as the duration of storage increased (Fig. 11A). By the 10th day of refrigerated storage, it was only around

7% of the total myrosinase activity at the beginning of the experiment (Fig. 11A).

Under room storage, total myrosinase activity already dropped sharply from the day it was brought from the farm (Fig. 11A). By the 4th day of room storage, it was only around 6% of the total myrosinase activity at the beginning of the experiment (Fig. 11A).

In Chinese kale, such a decrease was observed on the 6th day under refrigerated storage (Fig. 12A). Before day 6, total myrosinase activity remained almost constant (Fig. 12A). Thereafter, total myrosinase activity in the leaves of

Chinese kale decreased as the duration of storage increased (Fig. 12A). By the

10th day of storage, total activity of myrosinase, though lower, was still around

80% of that at the beginning of the experiment (Fig. 12A). Under room temperature, total myrosinase activity dropped sharply from the day it was brought from the farm (Fig. 12A). It was still around 48% of the total myrosinase activity by the 4th day of room storage, compared to that at the beginning of the experiment (Fig. 12A).

In the leaves of both Chinese flowering cabbage and Chinese kale under refrigerated storage, specific activity of myrosinase did not decline until the 4th day of storage (Fig. 11B & Fig. 12B). On the 4th day, specific activity was even higher than the earlier days of storage in the leaves of both Brassica vegetables

refrigerated storage room storage A 0.4

FW) 0.3 -1

0.2

Total myrosinase 0.1 activity (unit g

0.0 024681012 days of storage

0.03 B

0.02 protein) -1

myrosinase 0.01 (unit mg Specific activity of

0.00 024681012 days of storage

C 25.0 FW) 20.0 -1

15.0

10.0

5.0 Total soluble protein concentration (mg g 0.0 024681012 days of storage

Figure 11. The effects of duration and temperature of post harvest storage on the total myrosinase activity (A), specific activity of myrosinase and total soluble protein concentration (C) in the leaves of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.

76 refrigerated cold storage room storage A 1.5

1.0 FW) -1

(unit g 0.5 Total myrosinase activity

0.0 024681012 days of storage

B 0.08 0.07 0.06 0.05

protein) 0.04 -1 0.03 myrosinase 0.02 (unit mg Specific activity pf 0.01 0.00 024681012

days of storage

C 25.0 FW)

-1 20.0

15.0

10.0

5.0 Total soluble protein Total concentration (mg g concentration 0.0 024681012 days of storage

Figure 12. The effects of duration and temperature of post harvest storage on the total myrosinase activity (A), specific activity of myrosinase and total soluble protein concentration (C) in the leaves of Chinese kale. Each datum point is presented as mean standard error (vertical bar). n=4.

77 (Fig. 11B & Fig. 12B). After day 4, specific enzyme activity in the leaves of

Chinese flowering cabbage decreased faster than that in Chinese kale, as the duration of storage increased (Fig. 11B & Fig. 12B). On the 10th day of refrigerated storage, specific activity of myrosinase in the leaves of Chinese flowering cabbage was only 8% of that at the beginning, while it was still around 93% of that at the start of the experiment in the leaves of Chinese kale

(Fig. 11B & Fig. 12B). At room temperature, specific activities of myrosinase in the leaves of both Chinese flowering cabbage and Chinese kale decreased more rapidly than those stored in the refrigerators (Fig. 11B & Fig. 12B). By the 4th day of room temperature storage, it was only 11% and 61% of the specific myrosinase activity at the beginning of the experiment in the leaves of Chinese flowering cabbage and Chinese kale respectively (Fig. 11B & Fig. 12B).

Total soluble protein concentration in the leaves of both Chinese flowering cabbage and Chinese kale stored in the refrigerator did not show large change during the ten days of storage (Fig. 11C & Fig. 12C). However, total soluble protein concentration on the last day of refrigerated storage was lower than that on the first day of experiment in the leaves of both Chinese flowering cabbage and Chinese kale (Fig. 11C & Fig. 12C). Total soluble protein concentration decreased from the first day of room storage and declined quickly in the leaves of Chinese flowering cabbage and Chinese kale stored at the room temperature

(Fig. 11C & Fig. 12C).

78 4.4. Effects of plant age and different [N] fertilizers on chlorophyll concentration, total anti-oxidant capacity and myrosinase activity in different plant organs of the seedlings of Chinese flowering cabbage during early establishment

Seeds of Chinese flowering cabbage were grown in GA7™ containers in

Hoagland solutions with different concentration of inorganic nitrogen (NH4NO3).

All plants germinated on the 3rd day after sowing. The seedlings were allowed to grow for 11 days after sowing, to investigate to response of the seedling. Seeds were sown at a density of 0.1 g seeds in the area of 5×5 cm2. The seedlings were watered with the respective growth solutions every three days.

Tissue samples of the leaves, stems and roots of the differently treated

Chinese flowering cabbage plants were collected every other day from the 3rd day till the 11th day after sowing. Chlorophyll concentration, total anti-oxidant capacity and myrosinase activity were determined immediately after the harvest of the different plants.

4.4.1. Chlorophyll concentration

Concentrations of chlorophylls and carotenoids were determined in the leaves, stems and roots of all seedlings, and they changed differently in the different organs (Fig. 13).

The total concentration of chlorophylls was different in the leaves of seedlings of Chinese flowering cabbage watered with 0N, 0.5N and 1N

Hoagland solution and it increased with the age of the seedlings (Fig. 13A). It was higher in the leaves of seedlings watered with 1N Hoagland than those

79 1N 0.5N 0N A E I

0.10

0.20 FW)

1.6 FW) -1 -1 fw) 1.4 0.08

-1 0.15 1.2 0.06 1.0 0.10 0.8 0.04

0.6 roots (mg g Total chlorophyll Total stems (mg g 0.05 0.02 0.4 Total chlorophyll concentration in the concentration in the Total chlorophyll leaves (mg g 0.2 0.00 0.00 concentration in the 0.0 0123456789101112 0123456789101112 0123456789101112 days after sowing days after sowing days after sowing

B F J

3.0 2.0 2.5 1.5 2.0 3.0 1.5 1.0 2.5 1.0 0.5 2.0 0.5 the stems the the roots the

the leaves the 1.5 0.0 0.0 1.0 01234567891011120123456789101112 0.5 days after sowing days after sowing 0.0 Chlorophyll a/b ratio in ratio a/b Chlorophyll Chlorophyll a/b ratio in in ratio a/b Chlorophyll Chlorophyll a/b ratio in in ratio a/b Chlorophyll 0123456789101112

days after sowing

C G K

0.4 0.04 0.010 FW) 0.3 FW) 1FW) -1 -1 - 0.008 0.3 0.03

0.2 0.006 0.02 0.2 5 0.004

Total carotenoid 0.1 stems (mg g stems leaves (mg g Total carotenoid 0.01 0.002 roots (mg g Total carotenoid

concentration in the 0.1 concentration in the

concentration in the 0.000 0.0 0.00 0123456789101112 0123456789101112 days after sowing 0123456789101112 days after sowing days after sowing

D H L 20.0 10.0 20.0 8.0 15.0 15.0 6.0 10.0 10.0 4.0 5.0 2.0 5.0

0.0 0.0 stems the in 0.0 0123456789101112 roots the in

0123456789101112leaves the in 0123456789101112

days after sowing to chlorophyll Total days after sowing days after sowing Total chlorophyll to to chlorophyll Total total carotenoid ratio ratio carotenoid total Total chlorophyll to to chlorophyll Total total carotenoid ratio ratio carotenoid total total carotenoid ratio ratio carotenoid total

Figure 13. Effects of plant age and plant organ on total chlorophyll concentration (A: leaves, E: stems, I: roots), chlorophyll a/b ratio (B: leaves, F: stems, J: roots), total carotenoid concentration (C: leaves, G: stems, K: roots) and total chlorophyll to total carotenoid ratio (D: leaves,H: stems, L:roots) in the seedlings of Chinese flowering cabbage fertilized with 1N, 0.5N and 0N Hoagland solutions. Each datum point is presented as mean standard error (vertical bar).n=4.

81 watered with 0.5N and 0N solutions (Fig. 13A). The trend of change was similar in the leaves of seedlings watered with 1N and 0.5N Hoagland solution. The highest total chlorophyll concentration was observed on day 7 after sowing in both groups of plants (1.417 ± 0.034 mg g-1 FW and 1.265 ± 0.067 mg g-1 FW in the leaves watered with 1N and 0.5N Hoagland solution, respectively) (Fig.

13A). However, the highest total chlorophyll concentration was observed on day

9 after sowing in the leaves of plants watered with 0N Hoagland solution (1.202

± 0.017 mg mg-1 FW) (Fig. 13A). The lowest total chlorophyll concentration was observed on day 3 after sowing in all seedlings (0.698 ± 0.050 mg g-1 FW, 0.598

± 0.037 mg g-1 FW and 0.634 ± 0.019 mg g-1 FW in the leaves of plants watered with 1N, 0.5N and 0N Hoagland solution, respectively) (Fig. 13A).

Chlorophyll a/b ratio was lowest on day 3 after sowing in the leaves of all seedlings (1.983 ± 0.075, 1.899 ± 0.069 and 1.766 ± 0.069 in plants watered with 1N, 0.5N and 0N Hoagland solution, respectively) (Fig. 13B).

The total concentration of carotenoids was different in the leaves of seedlings watered with 0N, 0.5N and 1N Hoagland solution (Fig. 13C). Total carotenoid concentration changed in the same way in the leaves of Chinese flowering cabbages seedlings watered with 1N and 0.5N Hoagland solution, showing the highest total carotenoid concentration on day 7 after sowing (0.202

± 0.007 mg g-1 FW and 0.181 ± 0.007 mg g-1 FW in the leaves of plants watered with 1N and 0.5N Hoagland solution, respectively) (Fig. 13C). However the highest total carotenoid concentration in the leaves was observed on day 5 in the plants watered with 0N Hoagland solution (0.283 ± 0.002 mg g-1 FW) (Fig. 13C).

The lowest total carotenoid concentration in the leaves was observed on day 3 in all seedlings (0.098 ± 0.007 mg g-1 FW, 0.087 ± 0.002 mg g-1FW, and 0.098 ±

82 0.005 mg g-1 FW in the leaves watered with 1N, 0.5N and 0N Hoagland solution, respectively) (Fig. 13C).

Total chlorophyll to total carotenoid ratio did not show obvious changes in the leaves of the seedlings (Fig. 13D).

The highest total chlorophyll concentration in the stems was observed on day 3 after sowing (0.143 ± 0.002 mg g-1 FW, 0.139 ± 0.002 mg g-1 FW and

0.129 ± 0.003 mg g-1 FW in the stems of plants watered with 1N, 0.5N and 0N

Hoagland solution, respectively) (Fig. 13E). The lowest total chlorophyll concentration was observed on day 7 after sowing in the stems of plants watered with various Hoagland solutions (0.042 ± 0.003 mg g-1 , 0.052 ± 0.007 mg g-1 and 0.058 ± 0.003 mg g-1 in the plants watered with 1N, 0.5N and 0N Hoagland solution, respectively) (Fig. 13E).

Chlorophyll a/b ratio in the stems also increased with the age of the seedlings (Fig. 13F). No obvious trends of change were observed in the stems of

Chinese flowering cabbage seedlings watered with 0N, 0.5N and 1N Hoagland solution (Fig. 13F).

The total concentration of carotenoid in the stems of plants increased from the 7th day after sowing and it was constantly low in all seedlings up to the 7th day (Fig. 13G).

Total chlorophyll to total carotenoid ratio in the stems decreased with increased age of the seedlings but it did not vary among the seedlings (Fig.

13H).

The total concentration of chlorophylls in the roots decreased with the age of the seedlings from day 5 after sowing (Fig. 13I). The highest total chlorophyll concentrations in the roots were observed on day 5 after sowing (0.092 ± 0.002

83 mg g-1 FW, 0.089 ± 0.003 mg g-1 FW and 0.067 ± 0.003 mg g-1 FW in the roots of plant watered with 1N, 0.5N and 0N Hoagland solution, respectively) (Fig.

13I). The lowest total chlorophyll concentrations in the roots were observed on day 11 after sowing (0.019 ± 0.000 mg g-1 FW, 0.021 ± 0.000 mg g-1 FW and

0.020 ± 0.000 mg g-1 FW in the roots of plants watered with 1N, 0.5N and 0N

Hoagland solution, respectively) (Fig. 13I)

Chlorophyll a/b ratio in the roots increased with the age of the seedlings

(Fig. 13J). No obvious trends of change were observed in the roots of Chinese flowering cabbage seedlings watered with 0N, 0.5N and 1N Hoagland solution

(Fig. 13J).

The total concentrations of carotenoids in the roots were highest on day 5 after sowing (0.007 ± 0.001 mg g-1 FW, 0.007 ± 0.001 mg g-1 FW and 0.007 ±

0.001 mg g-1 FW in the roots of plants watered with 1N, 0.5N and 0N Hoagland solution, respectively) (Fig. 13K). After day 5, total concentrations of carotenoids in the roots decreased with the increased age of the seedlings but it did not vary among the seedlings (Fig. 13K).

Total chlorophyll to total carotenoid ratio in the roots decreased with the age of the seedlings and it was observed to be lowest on day 11 after sowing

(7.332 ± 1.746, 8.823 ± 0.746, and 6.933 ± 0.693 in the roots of plants watered with 1N, 0.5N and 0N Hoagland solution, respectively) (Fig. 13L).

Total chlorophyll concentration was much higher in the leaves than that in the stems and roots and it was lowest in the roots of Chinese flowering cabbage.

The trends of changes of total chlorophyll concentration were very different in different organs of Chinese flowering cabbage seedlings (Figs. 17A, E, I)

Chlorophyll a/b ratio was similar in the leaves and stems, but lower in the

84 roots of Chinese flowering cabbage. The trends of changes of chlorophyll a/b ratio were also very different in different organs of Chinese flowering cabbages

(Figs. 17B, F, G).

Total carotenoid concentration was similar in the leaves and stems, but lower in the roots of Chinese flowering cabbage. The trends of change of total carotenoid concentration were very different in different organs of Chinese flowering cabbage seedlings (Figs. 17C, G, K).

Trends of change of total carotenoid concentration were also very different in different organs of Chinese flowering cabbage seedlings.

4.4.2. Total anti-oxidant capacity

The highest total anti-oxidant capacity of leaves was always observed on day3 after sowing (4.453 ± 0.218 mg AA g-1 FW, 4.424 ± 0.187 mg AA g-1 FW and 4.398 ± 0.200 mg AA g-1 FW in the leaves watered with 1N, 0.5N and 0N

Hoagland solutions, respectively) (Fig. 14A). It then decreased before increasing again during the later days of growth (Fig. 14A). The lowest total anti-oxidant capacity was observed on day7 (1.074 ± 0.275 mg AA g-1 FW, 1.329 ± 0.233 mg

AA g-1 FW and 1.223 ± 0.203 mg AA g-1 FW in the leaves of plants watered with 1N, 0.5N and 0N Hoagland solutions, respectively) (Fig. 14A).

The highest total anti-oxidant capacity of stems was always observed on day 3 after sowing (1.495 ± 0.160 mg AA g-1 FW, 1.510 ± 0.106 mg AA g-1 FW and 1.297 ± 0.102 mg AA g-1 FW in the stems watered with 1N, 0.5N and 0N

Hoagland solutions, respectively) (Fig. 14B). It then decreased before increasing again during the later days of growth days (Fig. 14B). The lowest total anti-

85 1N 0.5N 0N A B C 5.0 1.8 1.2 4.5 1.6 1.0 4.0 1.4 FW) -1

3.5 FW) FW) 1.2 0.8 -1 -1 3.0 1.0 2.5 0.6 0.8 2.0 0.6 0.4 1.5 stems (mg AA g 0.4 (mg AA g roots the leaves (mg AA g 1.0 0.2 Total anti-oxidant capacity in capacity Total anti-oxidant 0.5 0.2 Total anti-oxidant capacity in the Total Total anti-oxidant capacity in the Total anti-oxidant capacity 0.0 0.0 0.0 0123456789101112 0123456789101112 0123456789101112 days after sowing days after sowing days after sowing

Figure 14. Effects of plant age and plant organ on total anti-oxidant capacity in the leaves (A), stems (B), roots (C) of the seedlings of Chinese flowering cabbage fertilized with 1N, 0.5N and 0N Hoagland solutions. Each datum point is presented as mean standard error (vertical bar). n=4.

86 oxidant capacity was observed on day7 (0.876 ± 0.071 mg AA g-1 FW, 0.694 ±

0.047 mg AA g-1 FW and 0.570 ± 0.041 mg AA g-1 FW in the stems of plants watered with 1N, 0.5N and 0N Hoagland solutions, respectively) (Fig. 14B).

The highest total anti-oxidant capacity of roots was always observed on day 3 after sowing (0.872 ± 0.112 mg AA g-1 FW, 0.839 ± 0.093 mg AA g-1 FW and 0.719 ± 0.070 mg AA g-1 FW in the roots watered with 1N, 0.5N and 0N

Hoagland solutions, respectively) (Fig. 14C). It then decreased before increasing again during the later days of growth (Fig. 14C). The lowest total anti-oxidant capacity was observed on day 7 (0.378 ± 0.008 mg AA g-1 FW, 0.300 ± 0.018 mg AA g-1 FW and 0.269 ± 0.007 mg AA g-1 FW in the roots of plants watered with 1N, 0.5N and 0N Hoagland solutions, respectively) (Fig. 14C).

In leaves, stems and roots, total anti-oxidant capacity was highest on day 3 and lowest on day 7 after sowing (Fig. 14). It was highest in the leaves, lowest in the roots during the whole experiments (Fig. 14).

4.4.3. Myrosinase activity

In all the seedlings, total myrosinase activity of the leaves in the seedlings of Chinese flowering cabbage increased from the 3rd day after sowing and reached the highest value on the 7th day after sowing (Fig. 15A), thereafter it declined (Fig. 15A). Before it reached the maximum value, the concentration of inorganic nitrogen supplied to the seedlings did not affect the total myrosinase activity (Fig. 15A). However after the 7th day after sowing, total myrosinase activity was the lowest in the leaves of Chinese flowering cabbage seedlings watered with Hoagland solution containing no nitrogen (0N). On the 7th day

87 after sowing, it was only 26% of the total myrosinase activity (Fig. 15A). In the leaves of the seedlings watered with 1N Hoagland solution, total myrosinase activity was still 83% of that on the 7th day after sowing (Fig. 15A). In the leaves of the seedlings of Chinese flowering cabbage watered with 0.5N

Hoagland solution, total myrosinase activity was 46% of that on the 7th day after sowing (Fig. 15A).

Specific myrosinase activities of the leaves seemed to be affected by the

amount of inorganic nitrogen supplied to the plants (Fig.15B). From the 3rd day

after sowing, specific activity of myrosinase increased until it reached the

highest value, and it then declined until the last day of measurement in the

leaves of plants watered with Hoagland solutions with different nitrogen

concentration (Fig. 15B). Although the lowest specific activity of the seedlings

was observed on the 3rd day after sowing (0.005 ± 0.000 unit mg-1 protein, 0.005

± 0.002 unit mg-1 protein and 0.005 ± 0.001 unit mg-1 protein in seedlings

watered with 0N, 0.5N and 1N Hoagland solutions, respectively), the highest

specific myrosinase activity in the leaves watered with 1N and 0.5N Hoagland

solution was observed on the 7th day after sowing (0.189 ± 0.001 unit mg-1

protein and 0.284 ± 0.013 unit mg-1 protein in the 0.5N and 1N Hoagland

solutions, respectively); it was highest on the 9th day after sowing in the leaves

of the seedlings watered with 0N Hoagland solutions (0.061 ± 0.006 unit mg-1

protein) (Fig. 15B).

Total soluble protein concentration in the leaves of all the seedlings

decreased with increased seedling age (Fig. 15C).

As in the leaves, total myrosinase activity of the stems of the Chinese

flowering cabbage seedlings increased from the 3rd day after sowing and

88 0N 0.5N 1N A D G 0.9 1.0 0.6 FW)

0.8 -1 FW) FW)

0.8 -1 0.5 -1 0.7 0.6 0.6 0.4 0.5 0.3 0.4 0.4 0.3 0.2 0.2 0.2 0.1 0.1 0.0 in the stems (unit g Total myrosinase activity 0.0 0.0 activity myrosinase Total g (unit roots the in Total myrosinase activity in the leaves (unit g 0123456789101112 0123456789101112 0123456789101112 days after sowing days after sowing days after sowing

B E H 0.4 0.4 0.4

0.3 0.3 0.3 1 protein) 0.2 protein) 0.2 -1 -1 0.2 protein) 0.1 mg (unit 0.1 0.1 (unit mg (unit mg (unit Specific activity of of activity Specific specific activity of 0.0 Specific activity of myrosinase in the roots roots the in myrosinase myrosinase in the leaves myrosinase in the stems 0.0 0.0 0123456789101112 0123456789101112 0123456789101112 days after sowing days after sowing days after sowing

C F I 60.0 20.0 7.0 50.0 6.0 FW)

-1 15.0 FW) 40.0 5.0 -1 4.0 30.0 10.0 FW) -1 3.0 20.0 (mgg stems (mg g (mg stems 5.0 2.0

10.0 the in concentration

Total soluble protein protein soluble Total 1.0 leaves (mg g (mg leaves concentration in the the in concentration Total soluble protein protein soluble Total 0.0 0.0 protein soluble Total 0.0

0123456789101112 0123456789101112 roots the in concentration 0123456789101112 days after sowing days after sowing days after sowing

Figure 15. Effects of plant age and plant organ on total myrosinase activity (A: leaves, D: stems, G: roots), specific activity of myrosinase (B: leaves, E: stems, H: roots) and total soluble protein concentration (C: leaves, F: stems, I: roots) in the Chinese flowering cabbage seedlings fertilized with 1N, 0.5N and 0N Hoagland solutions. Each datum point is presented as mean standard error (vertical bar). n=4.

89 reached the highest value on the 7th day after sowing, thereafter it declined (Fig.

15D). Total myrosinase activity was highest in the stems of seedlings watered with 1N Hoagland solution and lowest in the stems of seedlings watered with

0N Hoagland solution (Fig. 15D). From the 7th day after sowing, total myrosinase activity decreased most sharply in the stems of the seedlings watered with 0N Hoagland solution, and it was only 17% of the total myrosinase activity on the 7th day after sowing, by the end of the experiments

(Fig. 15D). In the stems of the seedlings watered with 0.5N and 0N Hoagland solutions, total myrosinase activity was 83% and 76% respectively of that on the

7th day after sowing (Fig. 15D).

Specific myrosinase activity in the stems of seedlings showed similar change to that of total myrosinase activity (Fig. 15D). The specific myrosinase activity was lowest on the 3rd day after sowing (0.032 ± 0.002 unit mg-1 protein,

0.028 ± 0.005 unit mg-1 and 0.029 ± 0.001 unit mg-1 protein in the seedlings watered with 0N, 0.5N and 1N Hoagland solutions, respectively) (Fig. 15D).

The highest specific myrosinase activity in seedlings watered with 1N and 0.5N

Hoagland solutions was observed showed in the stems on the 7th day after sowing (0.207 ± 0.000 unit mg-1 protein and 0.354 ± 0.004 unit mg-1 protein in the 0.5N and 1N Hoagland solutions, respectively). It was highest on the 9th day after sowing in the stems of the seedling watered with 0N Hoagland solution

(0.122 ± 0.001 unit mg-1 protein) (Fig. 15E).

Total soluble protein concentration in the stems of the seedlings watered with various fertilizers did not show obvious trends of changes during the whole period of growth (Fig. 15F).

Total myrosinase activity of the roots in the Chinese flowering cabbages

90 seedlings increased from the 3rd day after sowing and reached the highest value on the 7th day after sowing; thereafter it declined (Fig. 15G).

Specific myrosinase activity of the roots differed with different fertilizers

(Fig. 15H). The lowest specific myrosinase activity was observed in the seedlings on the 3rd day after sowing (0.063 ± 0.002 unit mg-1 protein, 0.064 ±

0.001 unit mg-1 protein and 0.070 ± 0.003 unit mg-1 protein in the seedlings watered with 0N, 0.5N and 1N Hoagland solutions respectively). The highest specific myrosinase activity in the roots watered with 1N and 0.5N Hoagland solutions were observed on the 7th day after sowing (0.220 ± 0.001 unit mg-1 protein and 0.344 ± 0.022 unit mg-1 protein in the 0.5N and 1N Hoagland solutions respectively). The highest specific myrosinase activity in the roots watered with 0N Hoagland solution was observed on the 9th day after sowing in the roots of the seedlings (0.220 ± 0.016 unit mg-1 protein) (Fig.15H).

Total soluble protein concentration in the roots of the Chinese flowering cabbage seedlings watered with various fertilizers did not show obvious trends of changes during the whole period of growth (Fig. 15I).

Total myrosinase activity was highest in the stems and lowest in the roots.

The trends of changes in the leaves, stems and roots were quite similar in the

Chinese flowering cabbage seedlings (Figs. 15A, D, G).

Specific activity of myrosinase was similar in the stems and roots, but lower in the leaves. The trends of changes in the leaves, stems and roots were quite similar in all the Chinese flowering cabbage seedlings (Figs. 15B, E, H).

Total soluble protein concentration was highest in the leaves and lowest in the roots. The trends of changes in the stems and roots were similar but different in the leaves of the Chinese flowering cabbage seedlings (Figs. 15 C, F, I).

91 4.5. Effects of plant age on chlorophyll concentration, total anti-oxidant

capacity, and myrosinase activity in different organs of mature plants of

Chinese flowering cabbage

Seeds of Chinese flowering cabbage were grown in small pots, watered with full-strength Hoagland solution every three days. Germination of seeds started from the 5th day after sowing. By the 10th day after sowing, the leaves, stems and petioles were already formed and easily separated. These three parts were collected every five days from day 10 after sowing until the 25th day after sowing for experiments.

4.5.1. Chlorophyll concentration

Total chlorophyll concentration was much higher in the leaves than those in the stems and petioles (Fig. 16A). It was lowest in the stems (Fig. 16A). In the leaves, the highest total chlorophyll concentration was observed on the 15th day after sowing (1.426 ± 0.053 mg g-1 FW); thereafter it decreased to 73% of that of on the 15th day after sowing (Fig. 16A). Total chlorophyll concentration in the stems and petioles remained almost unchanged during the whole period of growth (Fig. 16A).

In the leaves, the highest chlorophyll a to b ratio was observed on the 15th day after sowing (2.513 ± 0.182); thereafter it decreased (Fig. 16B). However in the stems and petioles, the highest ratio was observed on the 10th day after sowing (2.566 ± 0.182 and 2.562 ± 0.215 in the stems and petioles, respectively), and it decreased in both plant parts as the plant ages increased (Fig. 16B).

Total carotenoid concentration was always highest in the leaves and it was

92 Leaf Stem Petiole A 1.6 - 1.4 1.2 1.0

FW) 0.8 1 0.6 0.4

Total chlorophyll 0.2 concentration (mg g 0.0 0 5 10 15 20 25 30 days after sowing

B 3.0 2.5 2.0 1.5 1.0 0.5

Chloropyll a/b ratio 0.0 0 5 10 15 20 25 30 days after sowing

C 0.3

0.2 FW) -1 -1 0.1 (mg g concentration

Total carotenoid 0.0 0 5 10 15 20 25 30

days after sowing

D 16.0 14.0 12.0 10.0 8.0 6.0

ratio 4.0 2.0 0.0 total carotenoid

Total chlorophyll to 0 5 10 15 20 25 30

days after sowing

Figure 16. Effects of plant age on total chlorophyll concentration (A), chlorophyll a/b ratio (B), total carotenoid concentration (C) and total chlorophyll to total carotenoid ratio (D) in different plant organs of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.

93 lowest in the stems (Fig. 16C). In the leaves, the highest total chlorophyll

concentration was observed on the 15th day after sowing (0.225 ± 0.010 mg mg-1

FW); thereafter it decreased to 47% of that on the 15th day after seeds growing

in the leaves (Fig. 16C). Total carotenoid concentration in the stems and

petioles remained almost unchanged during the whole period of growth (Fig.

16C).

Total chlorophyll to total carotanoid ratio seemed to increase with increased plant age in the leaves of the Chinese flowering cabbage plant (Fig.

16D). It showed no obvious trend of change in the stems and petioles of the

Chinese flowering cabbage plant (Fig. 16D).

4.5.2. Total anti-oxidant capacity

Total anti-oxidant capacity of all the different organs of the Chinese flowering cabbage plants increased with plant age. It was highest in the leaves and lowest in the stems (Fig. 17). The lowest value of total anti-oxidant capacity was observed in all parts of the plants on the 10th day after sowing (1.636 ±

0.055 mg AA g-1 FW, 1.222 ± 0.068 mg AA g-1 FW and 1.326 ± 0.063 mg AA g-1 FW in the leaves, stems and petioles, respectively) (Fig. 17). On the 20th day after sowing, it was highest in all three parts of the Chinese flowering cabbages plants (3.299 ± 0.118 mg AA g-1 FW, 1.562 ± 0.173 mg AA g-1 FW and 1.963 ±

0.185 mg AA g-1 FW in the leaves, stems and petioles, respectively) (Fig. 17).

On the 25th day after sowing, anti-oxidant capacity in all plant parts was only slightly higher than that observed at the beginning of the experiment (2.641 ±

0.255 mg AA g-1 FW, 1.434 ± 0.242 mg AA g-1 FW and 1.671 ± 0.154 mg AA

Leaf Stem Petiole

4.0

3.5

3.0

2.5 FW) -1 2.0

1.5 (mg AA g

1.0 Total anti-oxidant capacity

0.5

0.0 0 5 10 15 20 25 30 days after sowing

Figure 17. Effects of plant age on total anti-oxidant capacity in different plant organs of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.

95 g-1 FW in the leaves, stems and petioles, respectively) (Fig. 17).

4.5.3. Myrosinase activity

The results obtained showed that total activity and specific activity of myrosinase were different in the different parts of the shoot of the Chinese flowering cabbage plants; they also varied with plant age (Fig. 18).

Total myrosinase activity decreased with increased plant ages. In the leaves, stems and petioles of the Chinese flowering cabbage plant cultivated in the small pots, the highest total myrosinase activity was observed on the 10th day after sowing in all three organs (0.597 ± 0.055 units g-1 FW, 0.509 ± 0.043 units g-1 FW and 0.478 ± 0.020 units g-1 FW in the leaves, stems and petioles, respectively) (Fig. 18A). Thereafter, total myrosinase activity decreased as the duration of growth increased in all the three organs of Chinese flowering cabbage (Fig. 18A). Total myrosinase activity of the plants observed on the 25th day after sowing was only about 39%, 35% and 33% of that on the 10th day after sowing in the leaves, stems and petioles respectively (Fig. 18A). Total myrosinase activity in the leaves was much higher than those observed in the stems and in the petioles (Fig. 18A). Total activity myrosinase in the stems was slightly higher than that observed in the petioles (Fig. 18A).

The highest specific myrosinase activity in the leaves, stems and petioles of the Chinese flowering cabbage plants was also observed on the 10th day after sowing (0.080 ± 0.010 units mg-1 protein, 0.727 ± 0.063 units mg-1 protein and

0.184 ± 0.019 units mg-1 protein in the leaves, stems and petioles, respectively)

(Fig. 18B). Thereafter, specific myrosinase activity decreased as the duration of

96 growth increased in all the three parts (Fig. 18B). Compared to the corresponding values at the beginning of the experiment, specific myrosinase activity was only around 27% in the leaves, 30% in the stems, and 32% in the petioles by the 25th day after sowing (Fig. 18B). The specific myrosinase activity was much higher in the stems of Chinese flowering cabbage than those in the leaves and petioles. The leaves exhibited the lowest specific myrosinase activity

(Fig. 18B).

Total soluble protein concentration in the leaves was much higher than those in the petioles and stems (Fig. 18C) and it was lowest in the stems (Fig.

18C). It increased with increased age in the leaves of the plants. But no obvious trends of change were observed in the stems and roots during the whole period of growth days (Fig. 18C).

4.6. Drought effects on chlorophyll concentration, chlorophyll fluorescence

parameters, total anti-oxidant capacity, and myrosinase activity in the

leaves of Chinese flowering cabbage

Chinese flowering cabbage was grown in pots for 20 days after sowing in the field station of Agri-Food & Veterinary Authority of Singapore and then was brought to the green house of Department of Biological Sciences in NUS and used as experimental materials. The plants were divided into 2 groups: Plants in one group were well-watered every day as the experimental control; Plants in the other group were not watered at all throughout the experimental period. On the

97 Leaf Stem Petiole A

0.7

0.6

0.5 FW)

-1 0.4

0.3 (unit g 0.2

Total myrosinase activity 0.1

0.0 0 5 10 15 20 25 30

days after sowing

B 0.9 0.8 0.7 0.6 0.5 protein)

-1 0.4 0.3 0.2 (unit mg 0.1

Specific activity of myrosinase 0.0 0 5 10 15 20 25 30

days after sowing

14.0

FW) 12.0 -1 10.0 8.0 6.0 4.0 2.0 Total soluble protein

concentration (mg g 0.0 0 5 10 15 20 25 30

days after sowing

Figure 18. Effects of plant age on total myrosinase activity of myrosinase (A), specific activity of myrosinase (B) and total soluble protein concentration (C) in different plant organs of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.

98 3rd days without watering, leaves of the drought Chinese flowering cabbage plant became yellow.

4.6.1. Drought effect on chlorophyll concentration

During the three days of drought experiments, the well-watered vegetables remained green in color. But the vegetables under drought treatment turned from green to yellow color day by day.

Total chlorophyll concentration in the leaves of Chinese flowering cabbage without watering decreased with the increased duration of drought (Fig.

19A). It was lowest on the third day of the experiment (1.483 ± 0.103 mg g-1 FW)

(Fig. 19A). However, in the control vegetables watered every day, total chlorophyll concentration was almost constant (Fig. 19A).

The ratio of chlorophyll a to chlorophyll b decreased slightly in the leaves of Chinese flowering cabbage without watering during the three days of drought treatment (Fig. 19B). It was lowest on the third day of the experiment (2.142 ±

0.044) (Fig. 19B). However in the control vegetables watered every day, the ratio of chlorophyll a to chlorophyll b was almost constant (Fig. 19B).

Total carotenoid concentration in the leaves of Chinese flowering cabbage without watering decreased with the increased duration of drought (Fig. 19C). It was lowest on the third day of the experiment (1.179 ± 0.011 mg g-1 FW) (Fig.

19C). However, in the control vegetables watered every day, total carotenoid concentration was almost constant (Fig. 19C).

The ratio of total chlorophyll to total carotenoid increased slightly in the leaves of Chinese flowering cabbage without watering during these three days of

99 drought control A 2.5 - 2.0

1.5 FW)

1 1.0

0.5 Total chlorophyll concentration (mg g 0.0 01234 days of drought

B 3.0 2.5 2.0 1.5 1.0 0.5 0.0

Chlorophyll a/b ratio 01234

days of drought

C 0.4 0.3 0.3 FW) 0.2 -1 -1 0.2

(mg g 0.1 concentration

Total carotenoidl 0.1 0.0 01234 days of drought D 10.0 8.0 6.0

ratio 4.0 2.0 total carotenoid

Total chlorophyll to 0.0 01234

days of drought

Figure 19. Drought effects on total chlorophyll concentration (A), chlorophyll a to b ratio (B), total carotenoid concentration (C), total chlorophyll to total carotanoid ratio (D) in the leaves of Chinese flowering cabbage. The experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar). n=4.

100 It was highest on the third day of the experiment (8.667 ± 0.412) (Fig. 19D).

However in the control vegetables watered every day, the ratio of total chlorophyll to total carotenoid was almost constant (Fig. 19D).

4.6.2. Drought effect on chlorophyll fluorescence parameters

During the three days of drought experiment, the potential quantum

efficiency of open PSII reaction centers in the dark-adapted state (Fv/Fm), the

efficiency of excitation energy capture by open PSII reaction centers (Fv’/Fm’),

and potential for non-cyclic electron transport (ΔF/Fm’) remained fairly

constant in both control and drought treated vegetables (Figs. 20A-C).

Photochemical quenching (qP) was also fairly constant throughout the

three days in both control and drought treated vegetables (Fig. 20D).

Non-radiative dissipation via the xanthophyll cycle (NPQ) in both control and

drought treated vegetables remained almost unchanged during the three days of

experiment (Fig. 20D).

4.6.3. Drought effect on total anti-oxidant capacity

Total anti-oxidant capacity was almost unchanged in the well-watered vegetables throughout the experiment (Fig. 21). It increased with increased drought treatment days in the vegetables under drought treatment (Fig. 21).

4.6.4. Drought effect on myrosinase activity

During the three days of drought experiment, both the total myrosianse

101 drought control A D

1.0 1.1 0.9 1.0 0.8 0.9 0.7 0.8 0.6 0.7 0.5 0.6 qP Fv/Fm 0.4 0.5 0.4 0.3 0.3 0.2 0.2 0.1 0.1 0.0 0.0 01234 01234 days of drought days of drought B E

0.3 0.9 0.8 0.7 0.2 0.6 0.5 NPQ 0.4

Fv'/Fm' 0.1 0.3 0.2 0.1 0.0 0.0 01234 01234 days of drought days of drought

C 0.9 0.8 0.7 0.6 0.5

DF/Fm' 0.4 0.3 0.2 0.1 0.0 01234 days of drought

Figure 20. Drought effects on potential quantum efficiency of open PSII reaction centers (Fv/Fm) (A), efficiency of excitation energy capture by open PSII reaction centers (Fv'/Fm') (B), potential for non-cyclic electron transport (DF/Fm') (C), photochemical quenching (qP) (D), non-radiative dissipation via xanthophylls cycle (NPQ) (E) in the leaves of Chinese flowering cabbages. The experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar). n=4.

102 Drought control

3.0

2.5

2.0 FW) -1 1.5

(mg AA g AA (mg 1.0 Total anti-oxidant capacity anti-oxidant Total 0.5

0.0 01234 days of drought

Figure 21. Drought effects on total anti-oxidant capacity in the leaves of Chinese flowering cabbage. The experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar).

103 drought control A

0.7 0.6 0.5 FW)

-1 -1 0.4 0.3

(unit g 0.2 0.1 Total myrosinase activity 0.0 01234

days of drought

0.06

0.05

0.04 protein)

-1 0.03

myrosinase 0.02 (unit mg

Specific activity of 0.01

0.00 01234

days of drought

14.0 FW) 12.0 -1 10.0 8.0 6.0 4.0 2.0 Total soluble protein

concentration (mg g 0.0 01234 days of drought

Figure 22. Drought effects on total myrosinase activity (A),specific activity of myrosinase (B) and total soluble protein concentration (C) in the leaves of Chinese flowering cabbages. The experimental control was plants that were well-watered everyday. Each datum point is presented as mean standard error (vertical bar). n=4.

104 activity and the specific activity of myrosinase were fairly constant in the well-watered plants of Chinese flowering cabbage (Fig. 22). However, both these two parameters decreased rapidly in the leaves of Chinese flowering cabbage under drought treatment (Fig. 22A & Fig. 22B). The vegetables without watering for 3 days showed only 0.067 ± 0.002 unit g-1 FW of total myrosinase activity and specific activity of 0.006 ± 0.004 unit mg-1 protein, which were both around 11% of the well-watered control vegetables. Total soluble protein concentration of the well-watered and drought treated vegetables remained almost unchanged (around 11-12 mg g-1 FW) during this period (Fig. 22C).

4.7. Total anti-oxidant capacity and myrosinase activity in the leaves of 16

different cultivars of Chinese flowering cabbage (of marketable types)

Sixteen different cultivars of Chinese flowering cabbage freshly harvested

from Agri-Food & Veterinary Authority of Singapore were used for the

determination of their myrosinase activity and anti-oxidant capacity. The results

showed that although the plants belonged to the same species [B. chinensis var.

parachinensis (Bailey)], they exhibited large differences in both total

anti-oxidant capacity and myrosinase activity.

4.7.1. Total anti-oxidant capacity

The results obtained showed that anti-oxidant capacities varied greatly in the

leaves of all the cultivars studied (Fig. 23). The total anti-oxidant capacity was

highest in the cultivar of C2 (3.137 ± 0.225 mg AA g-1 FW) and lowest in the

cultivar of 9 (0.316 ± 0.020 mg AA g-1 FW) (Fig. 23).

105

4.0

3.5

3.0

2.5 FW) -1 2.0

1.5 (mg AA g

1.0 Total anti-oxidant capacity

0.5

0.0 C2 18 11 5 17 6 4 12 7 C1 1 15 16 10 C3 9

Chinese flowering cabbage cultivars

Figure 23. Total anti-oxidant capacity of the leaves of sixteen different cultivars of Chinese flowering cabbage. Each datum point is presented as mean standard error (vertical bar). n=4.

106 4.7.2. Myrosinase activity

The results obtained showed that both total and specific activities of myrosinase were highly dependent on the variety of Chinese flowering cabbage

(Fig. 24A & Fig. 24B). Plants of Chinese flowering cabbage that showed high total myrosinase activity also exhibited high specific myrosinase activity (Fig.

24A & Fig. 24B).

Total and specific activities of myrosinase were very low in the cultivars of C2 (0.032 ± 0.001 unit g-1 FW and 0.002 ± 0.000 unit mg-1 protein, respectively), 1 (0.043 ± 0.001 unit g-1 FW and 0.003 ± 0.000 unit mg-1 protein, respectively) and 17 (0.032 ± 0.002 unit g-1 FW and 0.002 ± 0.000 unit mg-1 protein, respectively) (Fig. 24A and Fig. 24B). Total and specific activities of myrosinase were very high in the cultivars of 15 (2.963 ± 0.157 unit g-1 FW and

0.161 ± 0.011 unit mg-1 protein, respectively), 11 (2.566 ± 0.072 unit g-1 FW and

0.157 ± 0.015 unit mg-1 protein, respectively) and 7 (2.152 ± 0.084 unit g-1 FW and 0.136 ± 0.006 unit mg-1 protein, respectively) (Fig. 24A & Fig. 24B).

Total soluble protein concentration varied in all the cultivars and their values were between 13 to 23 mg g-1 FW (Fig. 24C). The highest value was observed in the cultivar of C1 (22.619 ± 1.203 mg g-1 FW) and it was lowest in the cultivar of C3 (10.946 ± 0.684 mg g-1 FW) (Fig. 24C).

In these 16 cultivars, the cultivar with high total anti-oxidant capacity had low total myrosinase activity (Figs. 23&24). Fig. 25 showed the correlation between total anti-oxidant capacity and total myrosinase activity in the 16 cultivars. The correlation coefficient (R2) value obtained was 0.9594, which showed the high correlation between these two parameters (Fig. 25).

107

A 3.5

3.0

2.5 FW)

-1 2.0

1.5 (unit g 1.0

Total myrosinase activity Total myrosinase 0.5

0.0 C2181151764127C11151610C39

different cultivars

B 0.20

0.15

protein) 0.10 -1 myrosinase 0.05 (unit mg Specific activity of

0.00 C2181151764127C11151610C39 different cultivars

C 30.0

FW) 25.0 -1 -1 20.0

15.0

10.0

5.0 Total soluble protein concentration (mg g 0.0 C2 18 11 5 17 6 4 12 7 C1 1 15 16 10 C3 9 different cultivars

Figure 24. Total myrosinase activity (A), specific activity of myrosinase (B) and total soluble protein concentration (C) in the leaves of sixteen different cultivars of Chinese flowering cabbages. Each datum point is presented as mean standard error (vertical bar). n=4. Details of cultivars, see table 1.

108

3.5

3.0 y = -0.1575x + 3.0621 R2 = 0.9594 2.5

2.0 FW) -1 1.5

(mg AA g 1.0

Total anti-oxidant capacity 0.5

0.0 0.0 5.0 10.0 15.0 20.0

Total myrosinase activity (unit g-1)

Figure 25. Correlation between total myrosinase activity and total anti-oxidant capacity in 16 cultivars of Chinese flowering cabbage. Details of cultivars, see table 1.

109 4.8. Molecular study on myrosinase in the leaves of 16 different cultivars of

Chinese flowering cabbage

Some molecular work was conducted in order to study the homology of myrosinase sequence in the different cultivars of Chinese flowering cabbage [B. chinensis var. parachinensis (Bailey)]. Leaf samples collected from the various plants were used for total genomic DNA extraction. PCR programs were setup according to the annealing temperature of primer (Table 3 & 4).

Among the 16 cultivars, the MYRO gene was successfully detected only in the leaves of cultivar 6. More than one band of MYRO gene was detected in cultivars 4, 5 and 18. In the leaf samples of other cultivars, no band for the

MYRO gene was detected with gel electrophoresis analysis after PCR (Plate 2).

However, the sequencing analysis of the PCR product of MYRO gene from

cultivar 6 was not good enough to show sequence due to too much noise at the

background.

110

Plate 2. Agarose gel electrophoresis of PCR products. The PCR programs were performed according to the annealing temperatures of the pair of primers of MYRO gene. The PCR products of 16 cultivars were loaded as indicated.

111

────────────────────────────────

CHAPTER V. DISCUSSION

────────────────────────────────

Cruciferous vegetables are one of the healthiest and most nutritious vegetables. Within this group (or so called Cruciferae or Brassicaceae family), there is the Brassica genus which has both economic and scientific significance.

The members of this genus may be collectively known either as cabbages, or as mustards.

Many commonly eaten vegetables in Asia belong to Brassica genus, including Chinese kale [Brassica. oleracea L. Alboglabra], cabbage [B. oleracea L. Capitata], broccoli [B. oleracea L. Italica], cauliflower [B. oleracea

L. Botrytis] and Chinese flowering cabbage [B. chinensis var. parachinensis],

Chinese white cabbage [B. campestris L. pekinensis]. Most of these species or cultivars are also good sources of oil that may be used for edible purposes. All

Brassica vegetables are jampacked with nutrients. For instance cabbage and cauliflower are good sources of eight vitamins, seven minerals, dietary fiber and proteins (Ensminger & Esminger, 1986). The most amazing property of Brassica vegetables is that they contribute almost exclusively to our intake of a group of phytochemicals called glucosinolates, which are beneficial for human health.

The glucosinolates are largely responsible for the sharp taste and pungent smell of cruciferous vegetables and are important anti-cancer agents (Fenwick et al.,

1994). However, the active compounds are not the glucosinolates themselves but

112 their hydrolysis products, isothiocyanates for instance. It has been shown that an extract of cruciferous vegetables, such as broccoli and cabbages, added to human breast cancer cells strongly inhibits growth of the cells, and the degree of inhibition is related to the amount of extract in the growth medium (Finley, 2003;

Verhoeven et al., 1996; Willcox et al., 2003). When raw cruciferous vegetables are chewed, the plant cells are broken and myrosinase [EC 3.2.3.1] is released to hydrolyze the glucosinolates (Fenwick et al., 1994). The role of the myrosinase-mediated breakdown products of glucosinolates in reducing various types of cancers in human and animal cell models, and in plant defense against pest attack have also been widely studied (Rask et al., 2000).

Another unique feature of plants in the crucifer family such as broccoli is that they are an excellent source of three notable anti-oxidants: vitamin E, vitamin C and vitamin A (through their high concentration of β-carotene)

(Finley, 2003). These three vitamins team up to scavenge free radicals, which are highly interactive molecules that not only cause damage to the molecules with which they interact, but are also linked to a host of different diseases and health problems. These antioxidant vitamins have been proven to improve immune functions and are widely sold as nutritional supplements.

The cruciferous vegetables are also known to be beneficial in the prevention of age-associated illnesses such as Alzheimer’s disease and cataracts

(Granado et al., 2003).

Although all fruits and vegetables are believed to contribute toward health-promoting benefits, the commonly eaten Brassica vegetables such as

Chinese kale, cabbage, broccoli, cauliflower, Chinese flowering cabbage and

Chinese white cabbage, make especially important contributions to Asian people

113 due to their high popularity of consumption in Asia. The level of glucosinolates ingested by humans depends on a variety of factors along the production and post harvest handling chain of Brassica vegetables (Mithen et al., 2000). Most likely, processing and food preparation of the vegetables affect mostly the glucosinolate content and consequently determine the final intake levels of health protective compounds. Processes such as chopping, cooking, or freezing influence the extent of hydrolysis of glucosinolates and the composition of the final hydrolysis products (Mithen et al., 2000). As most vegetables are processed in some way before consumption, the effects of processing should be taken into account in order to make accurate estimates of dietary intake of these protective compounds (Mithen et al., 2000). Hence, control of glucosinolate levels and myrosinase activity in Brassica vegetables is highly desirable.

Myrosinase (EC 3.2.3.1), a thioglucoside glucohydrolase, is the only enzyme complex able to hydrolyse glucosinolates, a unique family of molecules bearing an anomeric O-sulfated thiohydroximate function (Bourderioux et al.,

2005). The results of Husebye et al. (2002) suggest a cellular separation of the enzyme of myrosinase and the substrate of glucosinolates, and that myrosinase is contained in distinct cells. Li and Kushad (2004) also found that there were no correlations between total glucosinolates levels and myrosinase activity in the roots and leaves, suggesting that the two are independently regulated and are site specific. Over the years, most research has been focused on the study of health effects of glucosinolates and their reaction products (Myzak et al., 2004).

However, the enzyme, myrosinase, which is responsible for the hydrolysis of glucosinolates, has long been overlooked. Only little information about myrosinase stability during processing is available.

114 The aim of this series of studies was to investigate the behavior of the myrosinase system together with other physiological characters, such as total anti-oxidant capacity and chlorophyll concentration, in commonly eaten

Brassica vegetables in Asia, exposed to a broad range of pre- and post-harvest treatments. Data obtained would provide an extensive profile of myrosinase and other phytochemical properties of these Brassica vegetables, for a better understanding of their nutritional value. The variation of myrosinase- glucosinolate system can dramatically impact a plant's fitness in response to attack by various pests (Tsao et al., 1996). Thus our study on the glucosinolate-myrosinase system, typical of the Brassicaceae family, may also provide a natural alternative for controlling some soil borne pathogens due to the negative effect of the glucosinolate-myrosinase system on herbivores.

Up to now, a wide array of methods for the determination of myrosinase activity has been described. These vary from simple photometric estimation to highly sophisticated assays using radioactively labelled substrates (Kleinwächter

& Selmar, 2004). A commonly used method is the hydrolysis of glucosinolate

(sinigrin), which produces detectable amounts of D-glucose that can be colorimetrically measured and used as a quantitative measure of myrosinase activity in the vegetables. Several studies have measured the amount of glucose released from glucosinolates to quantify the activity of myrosinase purified from plant tissues (Jwanny et al., 1995; Ludikhuyze et al., 1999; Wilkinson et al.,

1984). Sinigrin, a glucosinolate extracted from horseradish (Armoracia rusticana), has been used in these studies routinely as a substrate for myrosinase.

Antioxidants have received increased attention by nutritionists and medical researchers for their potential effects in the prevention of chronic and

115 degenerative diseases such as cancer and cardiovascular disease as well as aging

(Ames et al., 1993 & 1995; Diaz et al., 1997; Young & Woodside, 2001).

Epidemiological studies have provided evidence of an inverse association between diets rich in fruits and vegetables and these diseases (Block et al., 1992;

Joshipura et al., 1999; Ness & Powles, 1997). These health promotive effects may be related to components in the foods with antioxidant activity (Kaur &

Kapoor, 2001). The ability of antioxidants to scavenge free radicals in the human body and thereby decrease the amount of free radical damage to biological molecules like lipids and DNA may be one of their protective mechanisms (Wu et al., 2004).

The accurate assessment of oxidative stress in biological systems is a problem for all investigators working on the role of free radical damage in disease. Numerous assays have been described to measure various free radical damage products or antioxidant status, and the concept of a single test that might reflect total antioxidant capacity is an attractive one. The total antioxidant capacity refers to a full spectrum of antioxidant activity against various reactive oxygen/nitrogen radicals. Several methods have been developed recently for measuring the total antioxidant capacity of food and beverages (Benzie & Strain,

1999; Pellegrini et al., 2000; Wang et al., 1997); these assays differ in their chemistry (generation of different radicals and/or target molecules) and in the way end points are measured (Pellegrini et al., 1999). Because different antioxidant compounds may act in vivo through different mechanisms, no single method can fully evaluate the total anti-oxidant capacity of foods. A rapid, simple and inexpensive method to measure antioxidant capacity of food involves the use of the free radical, 2,2-diphenyl-1-picrylhydrazyl (DPPH) (Miliauskas et

116 al., 2004). The DPPH free radical method is widely used to test the ability of compounds to act as free radical scavengers or hydrogen donors, and to evaluate antioxidant activity of foods. It has also been used to quantify antioxidants in complex biological systems in recent years. The DPPH free radical method can be used for solid or liquid samples and is not specific to any particular antioxidant component, but applies to the overall antioxidant capacity of the sample. A measure of total antioxidant capacity will help us understand the functional properties of the vegetables. This is also an easy, rapid and accurate method for determining the antioxidant capacity of fruit and vegetable juices or extracts, suggested by Kirby and Schmidt (1997).

5.1. Effects of temperature and pH on myrosinase activity of Chinese

flowering cabbage and Chinese kale

Chinese kale and Chinese flowering cabbage were chosen for the experiments because of their popularity in food recipes of Asia.

5.1.1. Optimum temperature for myrosinase

The total and specific myrosinase activities were much higher in the

Chinese kale than in the Chinese flowering cabbage. The optimum temperature for myrosinase assay in Chinese flowering cabbage and Chinese kale was within the range of 35~40°C. Total myrosinase activity was relatively low under 30°C and above 50°C (below half of the maximum value).

Previous studies have shown that thermal treatment could inactivate

117 myrosinase. Jwanny (1995) showed that optimal myrosinase activity from radish root tissues was 37°C and complete deactivation of the myrosinase enzyme was achieved at temperature above 45°C. This optimum temperature value (37°C) was also found with turnip leaf myrosinase (Jwanny & El-Sayed, 1994), while the optimum temperature of S. alba and B. napus seed myrosinases was 60°C

(Björkman, 1976). Springett and Adams (1989) showed that optimum temperature for myrosinase extracted from Brussels sprouts was 50°C and the inactivation temperature was at 60°C. The kinetics of myrosinase inactivation during thermal treatment has also been investigated in crude broccoli extracts by

Ludikhuyze et al. (1999), who determined that thermal inactivation of myrosinase from broccoli proceeded in the temperature range 30-60°C.

Myrosinase in a crude extract from red cabbage was stable up to 60°C, while myrosinase in a crude white cabbage extract was stable only up to 50°C (Yen &

Wei, 1993). Thus, the optimum temperature and temperature stability of myrosinase extracted from the leaves of Chinese kale and Chinese flowering cabbages in this study was similar to those of myrosinase from other sources.

These results indicated that myrosinase is rather thermolabile, as compared with other food quality related enzymes such as polyphenol oxidase and peroxidase.

For instance, peroxidase could recover its activity after heat treatment and in horseradish peroxidase, reactivation has been reported to take place after partial inactivation at 70, 90 or 110°C (Thongsook & Barret, 2005). Polyphenol oxidase extracted from banana had an optimum temperature of 30ºC and was stable even after a heat treatment at 70ºC for 30min (Yang et al., 2000).

118 5.1.2. Optimum pH value of myrosinase activity

The pH value range used for this study was from 4.5 to 8.0. With sinigrin as the substrate, the optimum total and specific activities of myrosinase from the leaves of Chinese kale and Chinese flowering cabbages were shown to be pH 6.5.

From pH 5.5 to pH 7, the myrosinase from Chinese flowering cabbage and

Chinese kale also exhibited relatively high activities.

The optimum pH value for myrosinese activity in leaves of Chinese kale and Chinese flowering cabbage in the present study was similar with some previous studies. Ohtsuru and Kawatani (1979) found that the optimum pH value for the myrosinase activity from Wasabia japonica was 6.5. Iori et al. (1996) also found that the optimum pH value for the myrosinase activity from ripe seeds of S. alba was 6.5. However, Yen and Wei (1993) reported that the optimum pH for myrosinase purified from cabbages (B. oleracea) was at pH 8.0.

Bones & Rossiter (1996) showed that the optimum pH values for the myrosinase extracted from white mustard and rapeseed ranged from pH 4.5 to 4.9.

Burmeister et al. (1997) suggested that several structural features might have contributed to the stability of myrosinase under the optimum pH values, which included high glycosylation of its surface, presence of numerous salt bridges, three disulfide bonds, and the reduced exposed surface due to the dimerization of the enzyme. The results from the present study showed that, at pH 4.0, myrosinase from both the Chinese flowering cabbage and Chinese kale had lost most of its activity, suggesting that it could not survive the acidic environment of the stomach (pH 4.0) and thus would not be able to breakdown intact glucosinolates in the digestive tract (Rouzaud et al., 2004). This lost of myrosinase activity might be due to partial deactivation of the enzyme (Rouzaud

119 et al., 2004).

5.2. Chlorophyll concentration, chlorophyll fluorescence parameters, total

anti-oxidant capacity, and myrosinase activity of the marketable Brassica

vegetables

Fully developed leaves from four commonly eaten Brassica vegetables,

Chinese kale, cabbage, Chinese flowering cabbage and Chinese white cabbage, and floret head from other two commonly eaten Brassica vegetables broccoli and cauliflower, purchased from the supermarket, were used in this part of the study. Of the six Brassica vegetables studied, leaves of four leafy vegetables, including Chinese kale, cabbage, Chinese flowering cabbage and Chinese white cabbage, were used to determine their chlorophyll concentration, chlorophyll fluorescence parameters, total anti-oxidant capacity and myrosinase activity. The other two, which were broccoli and cauliflower, were non-leafy vegetables with floret heads. These two Brassica vegetables were used for the determination of only chlorophyll concentration, total anti-oxidant capacity and myrosinase activity.

5.2.1. Chlorophyll concentration and chlorophyll fluorescence parameters

In the present study, the growth conditions of six Brassica vegetables were

unknown as they were all purchased from the market. These four leafy Brassica

vegatebles showed different chlorophyll and carotenoid concentrations (on a

leaf area basis). On a fresh weight basis, the concentration of total chlorophyll

120 of Chinese flowering cabbage was the highest among the six Brassica vegetables studied. This might be due to the much darker and more succulent leaves of Chinese flowering cabbage. Cabbage and cauliflower had the lowest amount of chlorophyll concentration among the six Brassica vegetables studied.

This might be due to the pale color of the leaves of these two Brassica vegetables.

Chlorophyll a:b ratio was also quite different in these six Brassica vegetables. This parameter is often used to characterize the development state of the photosynthetic apparatus and it is rather stable in fully green leaves of higher plants (Kouril et al., 1999); it can vary greatly depending on the physiological state of the plant. For instance, the chlorophyll a:b ratio of plants can be high at the beginning of the greening process (Schoefs et al., 1998) but it can reach much lower values during senescence (Grover & Mohanty, 1993).

Chlorophyll a:b ratio is also higher in plants growing under higher PPFD

(Photosynthetic photon flux density) than lower PPFD levels. For example,

Fetene et al. (1990) observed that during acclimation to shade (a transfer from

700-800 to 20-30 μmol m-2 s-1) of Bromelia humilis, chlorophyll a:b ratio reduced from 2.61 to 2.35 (in plants with nitrogen supplement) and 2.83 to 2.32

(in plants without nitrogen supplement). Havaux et al. (2000) reported that chlorophyll a:b ratios were higher in the mature leaves of both wild-type

(chlorophyll a:b = 2.25) and npq1 mutant (chlorophyll a:b = 2.42) plants of

Arabidopsis under HL (high light, 1,500 μmol m-2 s-1) than those under LL (low light, 250 μmol m-2 s-1, 2.01 and 2.06 for wild-type and npq1 mutant plants, respectively). Müller-Moulé et al. (2003) reported that chlorophyll a:b ratio increased slightly in both wild type and mutant plants of A. thaliana after 5 days

121 in HL (10h at 1,800 μmol m-2 s-1).

Four out of six Brassica vegetables were tested for the chlorophyll fluorescence parameters as they were the ones with leaves. Chlorophyll fluorescence provides a good, non-intrusive in vivo determination of photosynthetic radiant energy utilization (Maxwell & Johnson, 2000).

One of the most common parameters used in fluorescence is the Fv/Fm ratio. Dark-adapted values of Fv/Fm reflect the potential quantum efficiency of

PSII (Kitao et al., 2000); a reduction in Fv/Fm in plants might be associated with thermal damage of PSII reaction centers (Demmig & Bjökman, 1987; Weis

& Berry, 1987), photoinhibitory mechanisms (Maxwell et al., 1994), and/or down-regulation of photosynthetic capacity (Herppich & Peckmann, 2000).

Healthy terrestrial leaves have an Fv/Fm value of 0.832 ± 0.004, and any loss of this ratio is a stress response (Bolhàr-Nordenkampf & Öquist., 1993). Among these four vegetables, Chinese kale, Chinese flowering cabbage and Chinese white cabbage showed almost similar Fv/Fm values, typical of healthy plants and reflecting that these three Brassica vegetables were not subjected to photoinhibition and were optimally adapted to their prevailing growth conditions. But the Fv/Fm value of cabbage was very low, which might be related to their low chlorophyll concentration.

In higher plants, Fv'/Fm', defined as (Fm' Fo')/Fm', reflects the photochemical efficiency of open PS II centers under a given light acclimation status (Genty et al., 1989). Fv'/Fm' generally varies inversely with qN, since nonphotochemical energy dissipation (qN) lowers the photochemical efficiency of PSII below the maximum levels reflected by Fv/Fm. A decrease in Fv/Fm, as occurs during photoinhibition of PS II activity, also results in a decrease in

122 Fv'/Fm'. Thus, in a plant, changes in the Fv'/Fm' parameter reflect the combined regulation of PSII through both reversible nonphotochemical quenching and photoinhibitory inactivation of PSII.

The potential for non-cyclic electron transport (ΔF/Fm’) is an indicator of linear photosynthetic electron transport. The value of ΔF/Fm’ is related to photochemical quenching (qP) and the efficiency of excitation energy capture by open PSII reaction centers (Fv’/Fm’) as follows: [ΔF/Fm’ = qP ×

(Fv’/Fm’)] (Genty et al., 1989; Maxwell & Johnson, 2000). The much lower

ΔF/Fm’ value of cabbage leaves compared with other three Brassica vegetables could be attributed to a low proportion of open PSII reaction centers (qP), and decreased efficiency of light energy capture by PSII (Fv’/Fm’) (Haag-Kerwer et al., 1996; de Mattos & Lüttge, 2001), which might be all related to the low chlorophyll concentration of these leaves.

qP reflects the balance between excitation of PS II centers, which closes them, and removal of electrons from PS II by the electron transport chain, which reopens the centers. This balance, or excitation pressure on PS II, responds not only to incident light intensity (Clarke et al., 1995) but also to factors influencing electron flow away from PS II, such as temperature (Campbell et al.,

1995; Maxwell et al., 1995; Öquist et al., 1993) and the availability of terminal electron acceptors such as CO2 or O2 (Miller et al., 1990; Vermaas et al., 1994).

Indeed, the pivotal position of PSII in photosynthetic electron transport means that environmental and metabolic signals are integrated into qP, which is thus a general index of the balance between energy capture and consumption.

The Stern-Volmer formula, NPQ = (Fm-Fm’)/Fm’, is to measure the ratio of quenched to remaining fluorescence (Krause et al., 1982). NPQ indicates the

123 proportion of excess light energy radiated as heat, reflecting the proportion of

closed PSII centers and the decreased capacity for absorbed light utilization

(Bilger & Björkman, 1990; Kooten & Snel, 1990). High NPQ values in the

Chinese white cabbage and cabbage could be the result of low photosynthetic

capacity, as explained above.

5.2.2. Total anti-oxidant capacity

The relative total anti-oxidant capacity of the six Brassica vegetables evaluated by DPPH assays was as follows: Chinese flowering cabbage > broccoli Chinese kale > Chinese white cabbage > cabbage > cauliflower.

However, some previous studies obtained different results. In the study of Kaur and Kapoor (2002), total anti-oxidant capacity of cabbage > mustard > cauliflower. In the study of Ou et al. (2000), total anti-oxidant capacity of broccoli > cauliflower > Chinese white cabbage. These differences might be resulted from differences in stages of development and levels of plant maturity

(Bones & Rossiter, 1996; Shapiro et al., 2001).

The total antioxidant capacity refers to a full spectrum of antioxidant activity against various reactive oxygen/nitrogen radicals. Low total antioxidant capacity could be indicative of oxidative stress or increased susceptibility to oxidative damage. Thus, in terms of the nutritional value of antioxidants,

Chinese flowering cabbage was the highest while cauliflower was the lowest in these six commonly eaten Brassica vegetables in Asia.

124 5.2.3. Myrosinase activity

Total myrosinase activities in the leaf tissues of the six vegetables studied were very variable, ranging from 1.179 ± 0.022 units g-1 FW (in Chinese kale) to

0.083 ± 0.018 units g-1 FW (in cabbage). Total myrosinase activity was high in both Chinese kale and broccoli. Total soluble protein concentration was also high in these two vegetables; hence, their specific activity of myrosinase was lower than Chinese white cabbage, which contained a relatively lower concentration of total soluble protein. Specific myrosinase activities in the leaf tissues of the six vegetables studied were highest in Chinese white cabbage

(0.125 ± 0.013 unit mg-1 protein) and lowest in Chinese flowering cabbages

(0.019 ± 0.003 unit mg-1 protein).

The level of myrosinase activities studied in the six commercial Brassica vegetables studied were not the same with that found previously in other studies.

For example, Li et al. (2002) found that specific myrosinase activity in cotyledon tissues of Brassica juncea was 0.35 unit g-1 FW in terms of the rate of hydrolysis of exogenous sinigrin by soluble protein extract of the cotyledons.

These differences might be the result of differences in stages of plant development and levels of plant maturity (Bones & Rossiter, 1996; Shapiro et al.,

2001). Different plant cultivars, cultivation practices, climatic conditions and laboratory (extraction, purification and assay) techniques are also known to affect myrosinase activity (Bones & Rossiter, 1996)

Bones (1990) reported that hypocotyls of B. napus had higher specific activity than cotyledons, but cotyledons had higher total activity and higher protein concentrations. Differences in protein concentration could be due to the extraction method being non-specific for the myrosinase protein. Also, different

125 proteins might accumulate in plant at different treatments. For example, heat shock proteins accumulate at high temperatures and cold acclimation proteins accumulate at low temperatures (Gilmour et al., 1988; Lindquist & Craig, 1988).

Such variations in other plant proteins in addition to myrosinase could account for the observed changes when comparing total activity against specific activity across species.

5.3. Effects of post harvest storage on chlorophyll concentration, total

anti-oxidant capacity, and myrosinase activity in the leaves of Chinese

flowering cabbage and Chinese kale

Brassica vegetables are highly perishable, and they can be stored for only a brief period up to 7 days under room temperature. Longer storage of Brassica vegetables is undesirable because leaves discolor, buds may yellow and drop off, tissues soften, and nutrition lost. Post harvest storage of vegetables is interesting in that metabolism continues to occur, although the vegetables are detached from the nutrient source. Post harvest senescence in Brassica vegetables results in phenotypic changes similar to those seen in developmental leaf senescence, such as the loss of chlorophylls, deterioration of cellular structure and, finally, cell death (Page et al., 2001). The goal of post harvest storage technology is to manipulate vegetable metabolism during storage to extend product shelf life. In most cases, this involves slowing respiratory metabolism through low-temperature storage or storage in a high carbon dioxide atmosphere

(Hardenburg et al., 1986). The results obtained suggested that storage at cooler temperatures could delay the symptoms of senescence in both Chinese flowering

126 cabbage and Chinese kale.

5.3.1. Effects of post harvest storage on chlorophyll concentration

During the storage period, leaves turned yellow as the obvious degradation of total chlorophylls occurred in both Chinese flowering cabbage and Chinese kale stored at room temperature. Such a change is a typical phenomenon of leaf senescence and it was also found in other crops such as Pisum sativum (sugar peas) (Ontai et al., 1992), Capsicum annuum (bell peppers) and Spinacia oleracea (spinach) (Watada et al., 1987), B. juncea (Indian mustard) and

Amaranthus caudatus (Lazan et al., 1987). However, in the present study, this rapid loss of chlorophylls was retarded by refrigerated storage at 4ºC in Chinese flowering cabbage and Chinese kale.

The present study showed that at room temperature, chlorophyll a to b ratio dropped quickly in the leaves of both Chinese flowering cabbage and

Chinese kale. The progressive decrease of chlorophyll a to b ratio of Chinese flowering cabbage and Chinese kale stored at room temperature indicated a more rapid disappearance of chlorophyll a than chlorophyll b. The main role of the process of leaf senescence during normal plant development is to mobilize nutrients from the leaf for use in other parts of the plant. However, in harvested

Brassica vegetables, senescence is induced artificially, as a stress response resulting from the removal of nutrient and water supplies (Page et al., 2001).

Chlorophyll a may be more sensitive to this stress than chlorophyll b. Thus chlorophyll a to b ratio decreased quickly along with the storage duration. Cold storage could efficiently retard the degradation of chlorophyll a to a certain

127 extent.

Total carotenoid concentration did not show any obvious change in the leaves of both Chinese flowering cabbage and Chinese kale under refrigerated storage. No correlation of the ratio of total chlorophyll to total carotanoid and the storage time at 4ºC was found either. Losses in total carotenoid concentration were reported in the leaves of some vegetables, especially under conditions favorable to wilting, high temperature, and light exposure (Kopas-Lane &

Warthesen 1995; Simonetti et al., 1991). Both sweet pepper and Petroselinum crispum (parsley) lost over 20% of their total carotenoid concentration at cold room storage (7ºC) for nine days (Rodriguez-Amaya, 1997). Kale, collard, turnip greens, and rape underwent more rapid losses of carotenes under conditions favorable to wilting; high storage temperature aggravated these losses

(Rodriguez-Amaya, 1997). In kale, average carotene losses were 1.6% at 0ºC,

22.4% at 10ºC, and 66.7% at 21ºC after four days of storage. The corresponding losses for collard were 7.5, 34.3, and 67.9%. This loss of carotenoid probably was slower than the loss of chlorophyllS, thus leading to the slow decline of the total chlorophyll to total carotanoid ratio in the two Brassica vegetables studied.

5.3.2. Effects of post harvest storage on total anti-oxidant capacity

Antioxidants have important effects in the prevention of chronic and degenerative diseases such as cancer and cardiovascular disease as well as aging

(Ames et al., 1993 & 1995; Diaz et al., 1997; Young & Woodside, 2001). The ability of antioxidants to scavenge free radicals in the human body and thereby decrease the amount of free radical damage to biological molecules like lipids

128 and DNA may be one of their protective mechanisms (Wu et al., 2004). Brassica vegetables are also rich in these healthy anti-oxidants. As the consumption of fresh-cut Brassica increases, it is important to take into account that processing

(minimal processing or cooking) may affect total antioxidant capacities. To minimize the degradation of these antioxidant metabolites, it is essential to know the variation during storage and after post harvest processing.

During refrigerated storage, neither of the two Brassica vegetables studied demonstrated an obvious decrease in their total antioxidant capacity. Thus, the antioxidant health benefits from these vegetables could be retained well after harvest if they could be properly preserved in the refrigerator until consumers eat them. However, a decrease in antioxidant activity was observed for those

Brassica vegetables stored at normal room temperature in the present study. This was easy to understand, considering that at higher temperatures, oxidation process in plants would accelerate the decline of the antioxidants. These results were in agreement with some previous studies, such as the study of Vallejo et al.

(2003). They found that room temperature could significantly reduce the levels of health-promoting compounds of post harvest broccoli but refrigerated storage could help to preserve the useful anti-oxidants in broccoli. The study of

Bergquist et al. (2005) also showed that, for baby spinach, storage at 2ºC resulted in a smaller reduction in total anti-oxidant capacity than storage at 10ºC.

5.3.3. Effects of post harvest storage on myrosinase activity

The results obtained in this study showed that myrosinase activity in the two leafy Brassica vegetables under the optimum assay conditions was highly

129 dependent on the vegetable species and the conditions of post harvest storage.

Leaves of Chinese kale showed higher myrosinase activity than the leaves of

Chinese flowering cabbage. During storage at 4ºC, the activities of myrosinase declined more slowly and the decreases were associated with a slower deterioration of the quality of the Brassica vegetables than those stored at room temperature of 25ºC.

The reason for the decreases of myrosinase activity was possibly that, during post harvest storage, cells of the Brassica vegetables might become disintegrated. Upon cell breakdown, myrosinase catalyses the hydrolysis of glucosinolates, producing D-glucose, sulfate ion and a series of compounds such as isothiocyanate, thiocyanate and nitrile, which also show toxicity to a range of fungi (Chew, 1988). However, refrigerated storage at 4ºC could successfully help retain the myrosinase activity for a longer time in the Brassica vegetables.

There is limited information available relating to myrosinase metabolism in

Brassica vegetables after harvest. The study of Page et al. (2001) showed that storage at 4ºC delayed the symptoms of senescence at both the biochemical and gene expression levels compared with storage at room temperature in broccoli.

Gillies and Toivonen (1995) also suggested that refrigeration was the best preservation processes for maintaining high levels of some useful compounds in

Brassica vegetables.

The reduction in levels of total soluble proteins that occurred during the storage was similar to those previously reported. In the study of Zhuang et al.

(1997), total soluble protein concentration decreased by more than 70% in broccoli buds stored at 23ºC, but storage of samples at 2°C maintained quality and prevented deterioration of proteins. The data obtained showed that the total

130 soluble protein concentration declined more markedly at room temperature than those stored at 4ºC and that might be due to the retardation of protein degradations under lower temperature (Zhuang et al., 1997).

In summary, the results obtained showed that refrigerated storage at 4ºC could help to preserve myrosinase activity in Brassica vegetables better than those stored at room temperature of 25ºC. Consumers could have more health benefits from eating fresh, unspoiled Brassica vegetables that has been properly stored, where the myrosinase activity has been protected through the process of storage or preservation. In the present study, myrosinase activity of the leaves of

Chinese flowering cabbage decreased a lot on the fourth day of storage at 4ºC although the color of the leaves still remained green under refrigerated storage.

Thus the health benefits from consumption of the Chinese flowering cabbage after the fourth day under refrigerated storage decreased. The results obtained also indicated that myrosinase activity might be also used as an important indicator of the freshness of the vegetables. This indicator could be more reliable than the physical properties of vegetables in terms of nutritional value.

5.4. Effects of plant age and different [N] fertilizers on chlorophyll

concentration, total anti-oxidant capacity and myrosinase activity in

different organs of the seedlings of Chinese flowering cabbage during early

establishment

Since glucosinolates contain a significant proportion of sulfur and nitrogen, it might be expected that fertilizers will influence the myrosinase levels and glucosinolate concentrations in Brassica crops (Bones & Rossiter, 1996). It has

131 been suggested that under conditions of sulfur deficiency, sulfur bound in glucosinolates of Brassica species can be remobilized by enzymatic cleavage with myrosinase (Bones & Rossiter, 1996). A decreasing sulfur supply to the plants results in a decrease of free sulphate and glucosinolate concentrations and an increase in myrosinase activity (Bones & Rossiter, 1996). This implies that the increase in myrosinase activity during sulfur stress could have the function of remobilization of sulphate sulfur from glucosinolates, because sulphate and isothiocyanates can be utilized as sulfur sources in the primary metabolism of the plants (Bones & Rossiter, 1996). Sulphate has also been shown to induce differential expression of myrosianses (Bones et al., 1994).

This series of studies was designed to test whether nitrogen, like sulfur, would influence myrosinase activity and other physiological properties of the seedlings of Chinese flowering cabbage during early establishment. Seeds of

Chinese flowering cabbage were grown in GA7™ containers in Hoagland solutions with different concentration of inorganic nitrogen (NH4NO3) under non-sterile conditions.

5.4.1. Chlorophyll concentration

Both total chlorophyll concentration and total carotenoid concentration were much higher in leaves than those of stem and roots of Chinese flowering cabbage seedlings under all treatments studied. These might have resulted from the different functions of plant organs. The leaf of a plant serves two basic functions, one is photosynthesis and the other is cellular respiration. The stems of plants provide support for the plant and transportation between roots and

132 leaves. The root system of a plant anchores the plant and absorbs water and mineral from the soil. Since leaves are better oriented for light capture and have higher coefficients of light absorption than stems and roots (Nilsen, 1992), they are the main plant organ with higher total concentration of chlorophylls to capture light for photosynthesis.

From the present study, it seemed that nitrogen did not have obvious effect

on chlorophyll parameters. Both the ratio of total chlorophyll to total carotanoid

and chlorophyll a to b ratio in Chinese flowering cabbage seedlings changed

irregularly along with the duration of growth. No obvious correlation between

the ratio of total chlorophyll to total carotanoid and the duration of growth or

the different parts of Chinese flowering cabbage seedlings was observed. Also,

no obvious correlation between Chlorophyll a to b ratio and the different parts

of Chinese flowering cabbage was observed.

Nitrogen has the most direct impact on plant growth, but influence of

nitrogen on phytonutritional quality is contradictory (Chenard et al., 2005). In

the study of Chenard et al. (2005), increasing N in the nutrient solution

increased plant chlorophyll and carotenoid concentrations in parsley. However

Mozafar (1993) reported that N fertilization increased, decreased, or had no

effect on vitamin and carotene contents of several vegetable species.

Some previous studies showed that, although maternal plants endowed

each seedling with sufficient nitrogen for initial development (Kitajima, 2002;

Milberg et al., 1998; Walters & Reich, 2000), low nitrogen concentration in soil

or nutrition solutions might substantially constrain subsequent plant growth in

gaps (Bungard et al., 2000; Coomes & Grubb 2000). Photodamage was

especially pronounced in plants with low nitrogen (Bungard et al., 2000).

133 Chlorophyll a to b ratios decreased slightly with leaf age in Ipomoea tricolor

(Hikosaka, 1996). For tropical rainforest tree species, Bungard et al. (2000)

found little response in chlorophyll a/b ratios to nitrogen, whereas Thompson et

al. (1992) found lower chlorophyll a/b ratios in low nitrogen plants, a response

opposite to the theoretical prediction. Increases of chlorophyll a/b ratios during

acclimation of tropical woody seedlings to nitrogen limitation were also found

by Kitajima & Hogan (2003).

5.4.2. Total anti-oxidant capacity

Leaves showed the highest anti-oxidant capacity while roots showed the lowest total anti-oxidant capacity in Chinese flowering cabbage seedlings watered with different nitrogen fertilizers. Leaves were expected to show highest antioxidant capacity because they were exposed to the air with the largest area, and they were also responsible for absorbing light for photosynthesis. High antioxidant activity was also found in the leaves of barley, Prunus, and

Eucalytus, although the chemical properties and physiological role of their active principles are not yet fully understood (Osawa, 1994). However Nilsson et al. (2005) found that there were no variations in total antioxidant capacities between the various parts of the plants.

In leaves, stems and roots of Chinese flowering cabbage seedlings watered with various fertilizers, the lowest total antioxidant capacity was observed on the

7th day after sowing. The results obtained showed that total antioxidant capacity of Chinese flowering cabbage seedlings might be influenced by seedling age.

Wu et al. (2004) also suggested that a number of factors including

134 environmental, genetics, and all of factors included in times of sampling as well as processing could impact the levels of antioxidants present in fruits and vegetables. These differences have to be considered in developing a database of food antioxidant capacity. Nitrogen did not have obvious effects on total anti-oxidant capacity in Chinese flowering cabbage seedlings. However, negative correlations were frequently found between the concentration of N in fruit during growth and at maturity in apples (Awad & Jager, 2002).

5.4.3. Myrosinase activity

Myrosinase activities changed along with the age of the plant in all three fertilizer treatments and in all three plant parts. They increased from the beginning and reached the highest level in the middle of the experimental process and then deceased with increased plant age. In the study of Wallace &

Eigenbrode (2002), myrosinase levels in cotyledons declined with seedling age in B. juncea. Changes in the myrosinase activity throughout the plant’s development possibly have implications for the protection against pests and diseases.

Total myrosinase activity was similar in the leaves and stems, but lower in the roots during growth of the seedlings watered with different fertilizers. These results were in agreement with that of Springett and Adams (1989). They investigated the distribution of myrosinase in Brussels sprouts (B. oleracea L. var. bullata subvar. gemmifera). Myrosinase activity was 4-5 times higher in the outer (older) leaves of the Brussels sprouts than in other plant organs (stalk, inner leaves and centre). However, Bones determined that roots of fully grown

135 plants had the highest myrosinase activity than other organs of mature plants

(Bones, 1990). The different myrosinase activity showed in different organs may also be due to the different substrate specificity of different isoenzymes.

Distribution of the myrosinase isoenzymes seems to be both organ-specific and species-specific (Bones & Rossiter, 1996). However little is known about the physiological reason for this difference. MacGibbon and Allison examined the isoenzyme pattern after electrophoretic separation of myrosinases of 7 species of

Rhoeadales in 1970 (Bones & Rossiter, 1996). Each species was found to have a distinct pattern and the number of detectable bands varied from 1 to 4.

MacGibbon and Allison also found different patterns depending on whether the extracts were made from leaf, stem, root or seed (Bones & Rossiter, 1996).

Buchwaldt et al. (1986) reported that the crude extract from seeds of S. alba contained at least fourteen myrosinase isoenzymes. Isoelectric focusing in polyacrylamide gels of ethanol-powder preparations revealed two bands for B. nigra and B. napus and seven bands for S. alba (Buchwaldt et al., 1986). These different isoenzymes in different organs might have different substrate specificity. However little is known about the substrate specificity of myrosinase isoenzymes. The two myrosinases examined by James and Rossiter (1991) degraded different glucosinolates at different rates. However, both isoenzymes showed highest activity against aliphatic glucosinolates and least activity against indole glucosinolates. From their results it was evident that members of a given class of glucosinolates were apparently degraded at approximately the same rate in vitro.

Nitrogen concentration in the fertilizer did not affect total myrosinase activity much in seedlings of Chinese flowering cabbage. However, specific

136 activity of myrosinase was quite different in Chinese flowering cabbage seedlings watered with different fertilizers. Specific activity of myrosinase was higher in the seedlings of Chinese flowering cabbage irrigated with 1N fertilizer than watered with 0.5N and 0N fertilizers. No previous studies tested the effect of nitrogen supplied to the plants on myrosinase activity.

5.5. Effects of plant age on chlorophyll concentration, total total

anti-oxidant capacity, and myrosinase activity in different organs of

mature plants of Chinese flowering cabbage

Myrosinase activity has been detected in all glucosinolate containing plants and tissues that have been investigated and it is especially abundant in

Brassica vegetables. Almost all parts of Brassica vegetable of various ages may have been developed for food. However, there have been few reports with a systematic analysis of the variation in myrosinase activity in plants at different developmental stages and organs. In this part of the project, the effects of plant age and plant organ on the variations of chlorophyll concentration, antioxidant capacity and myrosinase activity in the plant of Chinese flowering cabbage cultivated in small pots were investigated. Seeds of Chinese flowering cabbage were grown in the small pots, watered with full-strength Hoagland solution every three days. Germination of seeds started from the 5th day after sowing. By the 10th day after sowing, the leaves, stems and petioles were already formed and easily separated. These three parts were collected every five days from the 10th until the 25th day after sowing.

The results obtained showed that Chinese flowering cabbage cultivated in

137 small pots with a commercial peat-based growth substrate grew much better than those grown in GA7™ containers. The results obtained showed that chlorophyll concentration, total anti-oxidant capacity and myrosinase activity were highly different in the different organs but did not have much correlation with the developmental stage of mature Chinese flowering cabbage.

5.5.1. Chlorophyll concentration

Both total chlorophyll concentration and total carotenoid concentration were much higher in leaves than that of stems and petioles of Chinese flowering cabbage. These might be the result of the different functions of plant organs. As mentioned earlier, the leaf of a plant serves two basic functions, one is photosynthesis and the other is cellular respiration. The stem of the plant provides support for the plant and transportation between roots and leaves. The petioles of the plant are the generally non-leafy part of the leaf that attaches the leaf blade to the stem. Since leaves are better oriented for light capture and have higher coefficients of light absorption than stems and petioles (Nilsen, 1992), they would contain higher chlorophyll concentration for increased and better absorption of light for photosynthesis.

From the present study, it seemed that plant age did not affect chlorophyll

parameters. Total chlorophyll concentration in the stems and petioles remained

almost unchanged during the whole period of growth. No obvious correlation

was observed between the ratio of total chlorophyll to total carotanoid and the

duration of growth days or the different parts of Chinese flowering cabbage.

Also, no obvious correlation between chlorophyll a to b ratio and the different

138 parts of Chinese flowering cabbage was observed. However, in the study of

Hikosaka (1996), chlorophyll a to b ratios decreased slightly with leaf age in

Ipomoea tricolor.

5.5.2. Total antioxidant capacity

The results obtained showed that the total antioxidant capacity varied among different organs and with plant age in Chinese flowering cabbage. Leaves had the highest antioxidant capacity while stems had the lowest total antioxidant capacity during the growth period. High antioxidant activity was also found in the leaves of barley, Prunus, and Eucalytus (Osawa, 1994). However Nilsson et al (2005) found that there were no variations in total antioxidant capacities between the various parts of the plants.

In leaves, stems and petioles in the plants of Chinese flowering cabbage, the highest total antioxidant capacities was observed on the 20th day after sowing.

After that, total antioxidant capacity declined. The results obtained showed that total antioxidant capacity of Chinese flowering cabbage might be influenced by plant age. Wu et al. (2004) also suggested that a number of factors including environmental, genetics, and all of those that are included in times of sampling as well as processing impact the levels of antioxidants present in fruits and vegetables. These differences need to be considered in developing a database of food antioxidant capacity.

139 5.5.3. Myrosinase activity

The results obtained showed that total activity and specific activity of myrosinase were highly dependent on plant age and plant organ in the Chinese flowering cabbage.

The present study showed that in the mature Chinese flowering cabbage, leaves exhibited much higher total myrosinase activity than stems and petioles in both total activity and specific activity. Leaves also had highest total soluble protein concentration. Total myrosinase activities in stems and petioles were similar to each other. However stems had the highest specific activities of myrosinase and leaves had the lowest specific activity. Both total and specific myrosinase activities started to decline from the 10th day after sowing in all three organs of the Chinese flowering cabbage, possibly suggested that myrosinase activity declined along with the increased age of Chinese flowering cabbage.

These results obtained were in agreement with that of Springett and

Adams (1989). They investigated the distribution of myrosinase in Brussels sprouts. Total myrosinase activity was 4-5 times higher in the outer leaves of the

Brussel sprouts than in other regions (stalk, inner leaves and centre). However

Bones showed that roots of fully grown plants had the highest myrosinase activity than other organs of mature plants in B. napus. (Bones, 1990). The reported myrosinase activity in different tissues varied, but all tested organs/tissues contained some myrosinase activity and that myrosinase activity and total soluble protein concentration would vary along with the developmental stages of Brassica vegetables.

There have been few reports with a systematic analysis of the variation in myrosinase activity in plants at different developmental stages and organs.

140 Bones (1990) examined the myrosinase activity at different deveolopmental stages and in different parts of plant in a full life cycle in B. napus. The results obtained by Bones (1990) showed that hypocotyls contained the highest specific myrosinase activity of the seedling organs of B. napus. The specific activity in hypocotyls was always more than twice the activity in cotyledons and normally several times the activity in seedling roots of B. napus (Bones, 1990). In a study of the myrosinase expression in S. alba, Xue et al. (1993) detected myrosinase mRNAs in cotyledons, hypocotyl, roots and leaves of 6, 8 and 14 day old seedlings of A. thaliana. Highest levels of myrosinase mRNA accumulation were observed for hypocotyls at 6 and 8 day after germination, and in leaves 14 days after germination of A. thaliana. (Xue et al., 1995).

Not only are the activity of myrosinase enzymes influenced by the developmental stage of the plant, but also by other factors, such as wounding

(Taipalensuu et al., 1997a & b) and sulfur deficiency conditions (Bones et al.,

1994). Differences among the different studies may be also due to the use of different cultivars, cultivation practices, climatic conditions and laboratory

(extraction, purification and measurement) techniques. The influence of these factors on myrosinase activity in Brassica species might affect the potential benefits of the glucosinolates-myrosinase system.

5.6. Drought effects on chlorophyll concentration, chlorophyll fluorescence

parameters, total anti-oxidant capacity, and myrosinase activity in the

leaves of Chinese flowering cabbage

Drought, which is caused by insufficient soil moisture, is among the chief

141 causes of poor growth or poor health in plants. It is responsible for slow growth and, in severe cases, dieback of stems (Richards & Thurling, 1978a&b). It also makes plants more susceptible to disease and less tolerant of insect feeding

(Richards & Thurling, 1978a & b). Deficiency of water also disrupts the normal bilayer structure of membranes and results in membranes becoming exceptionally porous when desiccated (Lauriano et al., 2000). Stress within the lipid bilayer may also result in displacement of membrane proteins and this contributes to loss of membrane integrity, selectivity, disruption of cellular compartmentalization and a loss of activity of enzymes, which are primarily membrane based (Lauriano et al., 2000). In addition to membrane damage, cytosolic and organelle proteins may exhibit reduced activity or may even undergo complete denaturation when dehydrated (Lauriano et al., 2000). The high concentration of cellular electrolytes due to the dehydration of protoplasm may also cause disruption of cellular metabolism (Lauriano et al., 2000). Plant responses to water scarcity are complex, involving adaptive changes and/or deleterious effects (Lauriano et al., 2000).

In the present study, physiological responses of Chinese flowering cabbage to drought, especially the myrosinase activity, were investigated.

Results obtained showed that myrosinase activity (both total and specific activity) was significantly affected by drought stress. It decreased rapidly when the plants suffered from severe drought treatment. However, the results obtained showed that drought did not affect total soluble protein concentation of Chinese flowering cabbage.

142 5.6.1. Drought effect on chlorophyll concentrations

The results obtained showed that total concentration of chlorophylls decreased under drought stress in Chinese flowering cabbage. Chlorophyll loss is a negative consequence of stress; on the other hand, it has also been considered as an adaptive feature in plants grown under extreme climatic conditions, when exposed to an excess of excitation energy (Kyparissis et al.,

1995; Maslova & Popova 1993; Munné-Bosch & Alegre, 1999). Chlorophyll loss reduces the amount of light intercepted by leaves and at the same time reduces the possibility of further damage to the photosynthetic machinery by the formation of activated oxygen under high light.

The ratio of chlorophyll a to chlorophyll b slightly decreased along with the severy of drought stress in the vegetables, indicating that chlorophyll a and b levels were not equally sensitive to drought stress. Muthuchelian et al. (1997) showed that the level of chlorophyll a in seedlings of Erythrina variegate L. significantly reduced (by 60%) under drought stress and it decreased faster than that of chlorophyll b (by 44%), leading to the reduction in chlorophyll a to b ratio (from 2.88 to 2.05). It was also reported that significant reductions by about

80% in both chlorophyll a and chlorophyll b levels were observed in Nicotiana tabacum plant exposed to high light combined with water stress, leading to the stress-induced photoinhibition and destruction of photosynthetic pigments

(Verhoeven et al., 2001).

The present results obtained also showed a decline in total carotenoid concentration under drought stress in Chinese flowering cabbage. This was in agreement with the results of Al-Hamdani & Barger (1994), who also reported the decreases in carotenoid concentration in three Sorghum genotypes under

143 drought.

It was observed that the ratio of total chlorophylls to total carotanoids slightly increased in the vegetables with drought treatment. This was led by the more rapid decrease of total carotanoid concentration than that of total chlorophyll concentration along with the severities of drought stress in Chinese flowering cabbage.

5.6.2. Drought effect on chlorophyll fluorescence

No significant variation in the Fv/Fm ratio was found, suggesting that the

efficiency of the quantum yield of PSII was not affected. The unaffected Fv/Fm

meant that there was possibly no loss in the yield of PSII photochemistry and

confirmed the resistance of the photosynthetic machinery to water deficit

(Chaves et al., 2002; Cornic & Fresneau, 2002).

Other chlorophyll fluorescence parameters obtained did not show

significant changes under drought in the present results. The results obtained

suggested that although dehydration was severe, the inhibition of the electron

transport between QA and QB was not greatly inhibited under these conditions of

drought stress (Levitt, 1980). The imposition of severe drought stress caused

rapid dehydration but PSII retained its efficiency. These results suggested that

PSII was weakly affected by the imposed drought stress in the Chinese

flowering cabbage in this study.

144 5.6.3. Drought effect on anti-oxidant capacity

In the present study, total anti-oxidant capacity increased with increased number of drought days in the Chinese flowering cabbage.

Most physiological stresses lead to disturbance in plant metabolism and cause oxidative injuries by enhancing the production of reactive oxygen species

(Alexieva et al., 2001). On the other hand, plant resistance to stress factors is associated with their antioxidant capacity, and the increased levels of the antioxidant constituents may prevent stress damage (Monk et al., 1989).

Additionally, Beggs et al. (1986) proposed that when plant growth was restricted by some stress factor, other repair mechanisms such as photoreactivation, quenching and free radical scavenging could be activated in order to alleviate the stress and prevent the damage before it could become lethal. In this study, an increase in total antioxidant capacity was observed in the leaves of Chinese flowering cabbage subjected to drought stress, which was in agreement with the above proposal of Beggs et al. (1986).

5.6.4. Drought effect on myrosinase activity

Myrosinase activity was known to be affected by environment factors. For instant, in the study by Charron et al (2005a & b), total myrosinase activity showed a negative linear relationship with temperature, and a positive linear but negative quadratic relationship with PPFD. Specific activity of myrosinase showed a positive linear and a negative quadratic relationship with both temperature and PPFD in the Brassica vegetables studied, including broccoli,

Brussels sprouts, cabbage cauliflower and kale. Therefore the influence of

145 environment factors on myrosinase activity in Brassica species may affect the potential benefits of the glucosinolate-myrosinase system.

Although is is known that environment factors could affect myrosinase activity, there are no reports that describe how drought treatment during plant growth affect myrosinase activity. In the present study, during the four days of drought, both the total myrosianse activity and the specific activity of myrosinase decreased rapidly in the leaves of Chinese flowering cabbage. The fact that drought stress decreased myrosinase activity could be due to a few reasons.

First, it was plausible that, in the present study, drought affected plant nutrient uptake which might be necessary for myrosinase synthesis or activation

(Himelrick & McDuffie, 1983). For example, myrosinase activity in buds of S. alba plants grown without manganese or sulfate was inhibited compared to plants having sufficient access to these nutrients (Visvalingam et al., 1998).

Second, drought stress might indirectly influence myrosinase activity by regulating the synthesis and accumulation of ascorbic acid. Ascorbic acid could regulate myrosinase activity because myrosinase activity is elevated at low concentrations of ascorbic acid but suppressed at high concentrations (Bones &

Slupphaug, 1989). Future work might include the determination of whether ascorbic acid amount increases under drought conditions and how this would affect mysorinase activity.

Thus, drought might affect myrosinase activity indirectly either by regulating the plant nutrient uptake or synthesis and accumulation of ascorbic acid.

146 5.7. Total antioxidant capacity and myrosinase activity in the leaves of 16

different cultivars of Chinese flowering cabbage

The different total antioxidant capacities and myrosinase activitis tested in

the leaves of 16 different cultivars of Chinese flowering cabbage clearly showed

that, even within the same species ( [B. chinensis var. parachinensis (Bailey)]),

antioxidant capacity and myrosinase activity could be still quite different.

Although these vegetables were cultivated in the same environment (AVA) and were of the same age, their intrinsic factors might determine their different myrosinase activities. The substrate specificity of myrosinase isoenzyme should be also considered. Different myrosinase isoenzyme in different varieties of

Chinese flowering cabbage might exhibit different substrate specificity to sinigrin, which was used in these experiments.

In B. oleracea, the level of glucosinolates depends on the genotype

(Charron et al., 2005a), whereas myrosinase enzymatic activity shows variations explained by changes in climate and genotype (Charron et al., 2005b).

Glucosinolates have been shown to vary among species and cultivars within the same species. Evaluation of the total glucosinolate content in cultivars of broccoli (Brassica oleracea L. Italica group), Arcadia, Emperor, Green Comet,

Green Valiant, Marathon, Packman, Premium Crop and Shogun, showed that the cultivar Shogun had the highest value with 29.8 mmol g-1 FW, while the cultivar

Emperor had the lowest amount at 0.5 mmol g-1 FW.

Despite the different amounts, all the cultivars of Chinese flowering cabbages tested in our study had myrosinase activity and anti-oxidant capacity.

Thus the consumption of Brassica vegetables could provide benefits on people’s health.

147 The results obtained showed that, in these 16 cultivars, the cultivar with high total anti-oxidant capacity had low total myrosinase activity. The two parameters showed high correlation. There were possibly two explanations for this high correlation. One was probably that, the main ingredient of the antioxidant extracted in these 16 cultivars was ascorbic acid, which could regulate myrosinase activity because myrosinase activity is elevated at low concentrations of ascorbic acid but suppressed at high concentrations (Bones &

Slupphaug, 1989). The other was probably that, the cultivars which had high total antioxidant capacity would be more vulnerable by pathogen because of the low myrosinase activity. The results obtained by Young et al. (2005) indicated that, the organic system provided an increased opportunity for insect attack, resulting in a higher level of total phenolic agents (with high antioxidant capacity) in Chinese flowering cabbage samples.

148

────────────────────────────────

CHAPTER VI. GENERAL CONCLUSIONS

────────────────────────────────

In this project, the potential of some intrinsic and extrinsic factors for controlling/altering activity of myrosinase from Brassica vegetables was investigated. The effects of these factors on chlorophyll concentration and total anti-oxidant capacity in Brassica vegetables were also studied.

With sinigrin as the substrate, the optimum total and specific activities of myrosinase from the leaves of Chinese kale. These results obtained were in agreement with some previous studies, which showed that myrosinase is rather thermolabile, as compared to other food quality related enzymes such as polyphenol oxidase and peroxidase.

The amount of myrosinase activity, together with chlorophyll concentration and chlorophyll fluorescence parameters, total antioxidant capacity and total soluble protein concentration, found in leaves from cultivars of six commonly edible Brassica vegetable has been examined. Total myrosinase activity was high in both Chinese kale and broccoli while specific myrosinase activity in the leaf tissues of the six vegetables studied was highest in Chinese white cabbage and lowest in Chinese flowering cabbages.

Post harvest storage at cooler temperatures could efficiently delay the symptoms of senescence (in terms of chlorophyll concentration, total antioxidant capacity and myrosinase activity) in both Chinese flowering cabbage and

149 Chinese kale. The results obtained also indicated that myrosinase activity might be also used as an important indicator of the freshness of the vegetables, which was more reliable than the physical properties of vegetables in terms of nutritional value.

Nitrogen concentration in the fertilizer did not affect the phytochemical properties (chlorophyll concentration, total anti-oxidant capacity or myrosinase activity) of Chinese flowering cabbage seedlings. However, these phytochemical properties were affected by plant organ.

Phytochemical properties were highly dependent on the different organs but did not have much correlation with the developmental stage of mature

Chinese flowering cabbage.

Drought stress had different effects on the phytochemical properties of

Brassica vegetables. Lossing chlorophylls and carotenoids was the negative consequence of drought stress; PSII was weakly affected by the imposed drought stress in the Brassica vegetables in this study; Total antioxidant capacity increased with increased severity of drought. Myrosianse activity decreased rapidly in the leaves of Chinese flowering cabbage under drought treatment.

Drought might affect myrosinase activity indirectly by regulating plant nutrient uptake or synthesis and accumulation of ascorbic acid.

The differences in total antioxidant capacity and myrosinase activitys in the leaves among 16 different cultivars of Chinese flowering cabbage clearly showed that, even within the same species, total antioxidant capacity and myrosinase activity could be still quite different.

In these 16 cultivars, the cultivar with high total anti-oxidant capacity had low total myrosinase activity. The two parameters showed high correlation. One

150 reason for this high correlation was probably that, the main ingredient of the antioxidant extracted in these 16 cultivars was ascorbic acid, which could regulate myrosinase activity. On the other hand, the cultivars which had high total antioxidant capacity would be more vulnerable by pathogen because of the low myrosinase activity.

Data and analysis obtained in our study provide extensive profile of myrosinase and other phytochemical properties of Asian Brassica vegetables and help consumers and researchers understand the properties of myrosinase in

Brassica vegetables better.

151

────────────────────────────────

CHAPTER VII. REFERENCE

────────────────────────────────

Alexieva V., Sergiev I., Mapelli S. & Karanov E. (2001) The effect of drought and ultraviolet radiation on growth and stress markers in pea and wheat. Plant, Cell & Environ. 24(12): 1337-1344.

Al-Hamdani S.H. & Barger T.W. (1994) Influence of water stress on selected physiological responses of three Sorghum genotypes. Ital. J. Agron. 7(1): 15-22.

Al-Turkib A.I. & Dick W.A. (2003) Myrosinase Activity in Soil. Soil Sci. Soc. Am. J. 67(1): 139-145.

Ames B.N., Gold L.S. & Willet W.C. (1995) The causes and prevention of cancer. Proc. Natl. Acad. Sci. 92: 5258-5265.

Ames B.N., Shigena M.K. & Hagen T.M. (1993) Oxidants, antioxidants and the degenerative diseases of aging. Proc. Natl. Acad. Sci. 90:7915-7922.

Andréasson E., Bolt J.L., Höglund A.S., Rask L. & Meijer J. (2001) Different myrosinase and idioblast distribution in Arabidopsis and Brassica napus. Plant Physiol. 127: 1750-1763.

Arnon D. (1949) Copper enzymes in isolated chloroplasts; polyphenol oxidases in Beta vulgaris. Plant Physiology 24: 1- 15.

Awad M.A. & de Jager A. (2002) Relationships between fruit nutrients and concentrations of flavonoids and chlorogenic acid in Elstar apple skin. Scientia Hort. 92: 265-276.

Baghurst P., Beaumont-Smith N., Baghurst K. & Cox D. (1999) The relationship between the consumption of fruits and vegetables and health status. Report to Department of Health and Aged Care and the Strategic Intergovernmental Nutrition Alliance. http://www.nphp.gov.au/publications/signal/fvstat.pdf.

Bartlet E., Blight M.M., Lane P. & Williams I.H. (1997) The responses of the cabbage seed weevil Ceutorhynchus assimilis to volatile compounds from oilseed rape in a linear track olfactometer. Entomol. Exp. Appl. 85: 257-262.

Beggs C.J., Schneider-Ziebert U. & Wellmann E. (1986) UV-B radiation and adaptive mechanisms in plants. In: Worrest R.C. & Caldwell M.M. (Eds.)

152 Stratospheric ozone reduction, solar ultraviolet radiation and llant life, Vol. 8, Springer-Verlag, Berlin. pp. 235-250.

Benzie I.F.F. & Strain J.J. (1999) Ferric reducing antioxidant power assay: direct measure of total antioxidant activity of biological fluids and modified version for simultaneous measurement of total antioxidant power and ascorbic acid concentration. Methods Enzymol. 299: 15-27.

Bergquist S.A.M., Gertsson U.E. & Olsson M.E. (2005) Influence of growth stage and post harvest storage on ascorbic acid and carotenoid content and visual quality of baby spinach (Spinacia oleracea L.). J. Sci. Food Agric. 86(3): 346-355.

Bilger W. & Björkman O. (1990) Role of different quantum flux densities. In: Lange O.L., Nobel P.S., Osmond C.B. & Ziegler H. (Eds.) Physiological Plant Ecology. Encyclopedia of Plant Physiology. Springer-Verlag, Berlin. pp. 31-45.

Björkman R. (1976) Properties and function of plant myrosinases. In: Vaughan J.G., MacLeod A.J. & Jones B.M.G. (Eds). The Biology and Chemistry of Cruciferae. Academic Press, London, UK. pp. 191-205.

Block G., Patterson B. & Suber A. (1992) Fruits, vegetables and cancer prevention: a review of the epidemiological evidence. Nutr. Cancer 18: 1-29.

Bolhàr-Nordenkampf H.R. & Ö quist G. (1993) Chlorophyll fluorescence as a tool in photo-synthesis research. In: Hall D.O., Scurlock M.O.J., Bolhàr-Nordenkampf H.R., Leegood R.C., Long S.P. (Eds). Photosynthesis and Production in a Changing Environment: a Field and Laboratory Manual. Chapman and Hall. New York. pp. 193-206.

Bones A.M. & Iversen T.H. (1985) Myrosin cells and myrosinase. Isr. J. Bot. 34: 351-375.

Bones A.M. & Slupphaug G.. (1989) Purification, characterization and partial amino acid sequencing of β-thioglucosidase from Brassica napus L. J. Plant Physiol. 134: 722-729.

Bones A.M. (1990) Distribution of β-thioglucosidase activity in intact plants, cell and tissue cultures and regenerated plants of Brassica napus L. J. Exp. Bot. 41(6): 737-744.

Bones A.M. (1991) Compartmentation and molecular properties of thioglucoside glucohydrolase (myrosinase). Dr-thesis. Unigen Center for Molecular Biology, Department of Botany, University of Trondheim, pp.1-195.

Bones A.M., Thangstad O.P., Haugen O.A. & Espevik T. (1991) Fate of myrosin cells: Characterization of monoclonal antibodies against myrosinase. J. Exp. Bot. 42: 1541-1549.

Bones A.M., Visvalingam S. & Thangstad O.P. (1994) Sulphate can induce differential expression of thioglucoside glucohydrolases (myrosinases). Planta

153 193: 558-566.

Bones A.M. & Rossiter J.T. (1996) The myrosinase-glucosinolate system - an innate defense system in plants. Physiol Planta. 97 (1): 194-208.

Borek V., Morra M.J., Brown P.D. & McCaffrey J.P. (1994) Allelochemicals produced during sinigrin decomposition in soil. J. Agric. Food Chem. 42: 1030-1034.

Borek V., Morra M.J., & McCaffrey J.P. (1996) Myrosinase activity in soil extracts. Soil Sci. Soc. Am. J. 60:1792-1797.

Bouchereau A., Clossais-Besnard N., Bensaoud A., Leport L. & Renard M. (1996) Water stress effects on rapeseed quality. Eur. J. Agron. 5: 19-30.

Bourderioux A., Lefoix M., Gueyrard D., Tatibouet A., Cottaz S., Arzt S., Bourmeister W.P. & Rollin P. (2005) The glucosinolate-myrosinase system. New insights into enzyme-substrate interactions by use of simplified inhibitors. Org. Biomol. Chem. 3(10):1872-1879.

Bradburne R.P. & Mithen R. (2000) Glucosinolate genetics and the attraction of the aphid parasitoid Diaeretiella rapae to Brassica. Proc. R. Soc. Lond. Ser. B Biol. Sci. 267: 89-95.

Bradford M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 7(72): 248-254.

Brand-Williams W., Cuvelier M.E. & Berset C. (1995) Use of a free radical method to evaluate antioxidant activity. Lebensm. Wiss. Technol. 28: 25-30.

Brudenell A.J.P., Griffiths H., Rossiter J.T. & Baker D.A. (1999) The phloem mobility of glucosinolates. J. Exp. Bot. 50: 745-756.

Buchwaldt L., Larsen L.M., Plöger A. & Sørensen H. (1986) Fast polymer liquid chromatography isolation and characterization of plant myrosinase, β-thioglucoside glucohydrolase, isoenzymes. J. Chromatography 363: 71-80.

Bungard R.A., Press M.B. & Sholes J.D. (2000) The influence of nitrogen on rain forest dipterocarp seedlings exposed to a large increase in irradiance. Plant Cell Environ. 23: 1183-1194.

Burmeister W.P., Cottaz S., Driguez H., Iori R., Palmieri S. & Henrissat B. (1997) The crystal structures of Sinapis alba myrosinase and a covalent glycosyl-enzyme intermediate provide insights into the substrate recognition and active-site machinery of an S-glycosidase. Structure 5: 663-675.

Campbell D., Zhou G., Gustafsson P., Öquist G.. & Clarke A.K. (1995) Electron transport regulates exchange of two forms of Photosystem II D1 protein in the cyanobacterium Synechococcus. EMBO. J. 14: 5457-5466.

154

Chadchawan S., Bishop J., Thangstad O.P., Bones A.M., Mitchell-Olds T. & Bradley D. (1993) Arabidopsis cDNA sequence encoding myrosinase. Plant Physiol. 103: 671-672.

Charron C.S., Saxton A.M. & Sams C.E. (2005a) Relationship of climate and genotype to seasonal variation in the glucosinolate-myrosinase system. I. Glucosinolate content in ten cultivars of Brassica oleracea grown in fall and spring seasons. J. Sci. Food Agric. 85: 671-681.

Charron C.S., Saxton A.M. & Sams C.E. (2005b) Relationship of climate and genotype to seasonal variation in the glucosinolate-myrosinase system. I. Myrosinase activity in ten cultivars of Brassica oleracea grown in fall and spring seasons. J. Sci. Food Agric. 85: 682-690.

Chaves M.M., Maroco J.P. & Pereira J.S. (2003) Understanding plant responses to drought-from genes to the whole plant. Funct. Plant Biol. 30: 239-264.

Chaves M.M., Pereira J.S., Maroco J.P., Rodrigues M.L., Picardo C.P.P., Osorio M.L., Carvalho I., Faria T. & Pinheiro C. (2002) How plants cope with water stress in the field. Photosynthesis and growth. Ann. Bot. 89: 907-916.

Chenard C.H., Kopsell D.A. & Kopsell D.E. (2005) Nitrogen concentration affects nutrient and carotenoid accumulation in parsley. J. Plant Nut. 28: 285-297.

Chew F.S. (1988) Biological effects of glucosinolates, In: Cutler H.G. (Ed). Biologically active natural products: potential use in agriculture. American Chemical Society, Washington D.C., USA, pp. 156-181.

Choesin D.N. & Boerner R.E.J. (1991) Allyl isothiocyanate release and the allelopathic potential of Brassica napus (Brassicaceae). Am. J. Bot. 78(8): 1083-1090.

Cinciripini P.M., Hecht S.S., Henningfield J.E., Manley M.W. & Kramer B.S. (1997) Tobacco addiction: implications for treatment and cancer prevention. J. Natl. Cancer Inst. 89: 1852-1867.

Clarke A.K., Campbell D., Gustafsson P. & Öquist G.. (1995) Dynamic responses of photosystem II and phycobilisomes to changing light in the cyanobacterium Synechococcus sp. PCC 7942. Planta 197: 553-562.

Clossais-Besnard N. & Larher F. (1991) Physiological role of glucosinolates in Brassica napus. Concentration and distribution pattern of glucosinolates among plant organs during a complete life cycle. J. Sci. Food Agric. 56: 25-38.

Coomes D.A. & Grubb P.J. (2000) Impacts of root competition in forests and woodlands: a theoretical framework and review of experiments. Ecol. Monogr. 70: 171-207.

Cornic G.. & Fresneau C. (2002) Photosynthetic carbon reduction and oxidation

155 cycles are the main electron sinks for photosystem II activity during a mild drought. Ann. Bot. 89: 887-894. de Mattos E.A. & Lüttge U. (2001) Chlorophyll fluorescence and organic acid oscillations during transition from CAM to C3-photosynthesis in Clusia minor L. (Clusiaceae). Ann. Bot. 88: 457-463.

Demmig B. & Bjökman O. (1987) Comparison of the effect of excessive light on chlorophyll fluorescence (77k) and photon yield of O2 evolution in leaves of higher plants. Planta. 171: 171-184.

Diaz M.N., Frei B. & Keaney Jr. J.F. (1997) Antioxidants and atherosclerotic heart disease. New England J. Med. 337: 408-416.

Doughty K.J., Kiddle G.A., Pye B.J., Wallsgrove R.M. & Pickett J.A. (1995) Selective induction of glucosinolates in oilseed rape leaves by methyl jasmonate. Phytochem. 38: 347-350.

Duncon A.J. (1991) Glucosinolates. In: D'Mello J.P.F., Duffus C.M. & Duffus J.H. (Eds). Toxic substances in crop plans. The Royal Society of Chemistry, Cambridge, UK. pp. 126-147.

Durham P.L. & Poulton J.E. (1990) Enzymic properties of purified myrosinase from Lepidium sativum seedlings. Z. Naturforsch. 45: 173-178.

Embry J.L. & Nothnagel E.A. (1994) Photosynthetic light-harvesting during leaf senescence in Panicum miliaceum. Plant Sci. 95: 141-152.

Ensminger A.H. & Esminger M.K.J. (1986) Food for Health: A Nutrition Encyclopedia. Pegus Press, Clovis, California,

Eriksson S., Ek B., Xue J., Rask L. & Meijer J. (2001) Identification and characterization of soluble and insoluble myrosinase isoenzymes in different organs of Sinapis alba. Plant Physiol. 111(3): 353-364.

Fahey J.W., Zalcmann A.T. & Talalay P. (2001) The chemical diversity and distribution of glucosinolates and isothiocyanates among plants. Phytochem. 56 (1): 5-51.

Falk A., Ek B., Rask L. (1995a) Characterization of a new myrosinase in Brassica napus. Plant Mol. Biol. 27: 863-874.

Falk A., Taipalensuu J., Ek B., Lenman M., & Rask L. (1995b) Characterization of rapeseed myrosinase-binding protein. Planta 195: 387-395.

Falk A., Xue J., Lenman M. & Rask L. (1992) Sequence of a cDNA clone encoding the enzyme myrosinase and expression of myrosinase in different tissues of Brassica napus. Plant Sci. 83: 181-186.

Fenwick G.R., Heany R.K. & Mullin J.W. (1994) Glucosinolates and their

156 breakdown products in food and food plants. CRC Crit. Rev. Food Sci. Nutr. 18: 123-201.

Fetene M., Lee H.S.J. & Lüttge U. (1990) Photosynthetic acclimation in terrestrial CAM bromeliad, Bromelian humilis Jacq. New Phytol. 114: 399-406.

Fieldsend J. & Mildford G..F. (1994a) Changes in glucosinolates during crop development in single- and double-low genotypes of winter oilseed rape (Brassica napus). I. Production and distribution in vegetative tissues and developing pods during development and potential role in recycling of sulphur within the crop. Ann. Appl. Biol. 124: 531-542.

Fieldsend J. & Milford G..F. (1994b) Changes in glucosinolates during crop development in single- and double-low genotypes of winter oilseed rape (Brassica napus). II. Profiles and tissue-water concentration in vegetative tissues and developing pods. Ann. Applied. Biol. 124: 543-555.

Finley J.W. (2003) The antioxidant responsive element (ARE) may explain the protective effects of cruciferous vegetables on cancer. Nut. Rev. 61(7): 250-254.

Genty B., Briantais J. & Baker N.R. (1989) The relationship between the quantum yield of photosynthetic electro transport and quenching of chlorophyll fluorescence. Biochim. Biophys. Acta. 990: 87-92.

Gillies S.L. & Toivonen P.M.A. (1995) Cooling method influences the postharvest quality of broccoli. HortScience 30: 313-315.

Gilmour S.J., Hajela R.K. & Thomashow M.F. (1988) Cold acclimation in Arabidopsis thaliana. Plant Physiol. 87: 745-750.

Glen D.M., Jones H. & Fieldsend J.K. (1990) Damage to oilseed rape seedlings by the field slug Deroceras reticulatum in relation to glucosinolate concentrations. Ann. Appl. Biol. 117: 197-208.

Gomez-Campo C. (1999) Biology of Brassica coenospecies. Elsevier Science Ltd.

Granado F., Olmedilla B. & Blanco I. (2003) Nutritional and clinical relevance of lutein in human health. Br. J. Nutr. 90(3): 487-502.

Gray A.R. (1989) Taxonomy & evolution of broccolis & cauliflowers. Baileya 23 (1): 28-46.

Griffiths D.W., Bradshaw J.E., Taylor J. & Gemmell D. (1991) Effect of cultivar and harvest date on the glucosinolate and S-methylcystein sulphoxide content of swedes (Brassica napus ssp rapifera). J. Sci. Food Agric. 56: 539-549.

Griffiths D.W., Deighton N., Birch A.N.E., Patrian B. & Baur R. (2001) Identification of glucosinolates on the leaf surface of plants from the Cruciferae and other closely related species. Phytochem. 57: 693-700.

157 Grob K. & Matile P. (1979) Vacuolar location of glucosinolates in horseradish root cells. Plant Sci. Lett. 14: 327-335.

Grover A. & Mohanty P. (1993) Leaf senescence- induced alterations in structure and function of higher plant chloroplasts. In: Abrol Y.P., Mohanty P. & Govindjee (Eds.) Photosynthesis: Photoreactions to plant productivity. Kluwer Academic Publishers, Dordecht-Boston-London. pp. 225-256.

Haag-Kerwer A., Grams T.E.E., Olivares E., Ball E., Arndt S., Popp M., Medina E. & Lüttge U. (1996) Comparative measurements of gas-exhange, acid accumulation and chlorophyll a fluorescence of different species of Clusia showing C3 photosynthesis, or crassulacean acid metabolism, at the same field site in Venezuela. New Phytol. 134: 215-226.

Halkier B.A. & Du L.C. (1997) The biosynthesis of glucosinolates. Trends Plant Sci. 2 (11): 425-431.

Halkier B.A. (1999) Glucosinolates. In: Ikan R. (Ed) Naturally occurring glycosides. Wiley, New York, pp. 193-223.

Hardenburg R.E., Watada A.E. & Wang C.Y. (1986) The commercial storage of fruits, vegetables, and florist and nursery stocks. USDA, Agric. Handbook No. 66.

Hartman T. (1996) Diversity and variability of plant secondary metabolism: a mechanistic view. Entomol. Exp. Appl. 80: 177-188.

Hashimoto T. & Yamada Y. (1994) Alkaloid biogenesis: molecular aspects. Annu. Rev. Plant Physiol. Plant Mol. Biol. 45: 257-285.

Haughn G.W., Davin L., Giblin M. & Underhill E.W. (1991) Biochemical genetics of plant secondary metabolites in Arabidopsis thaliana. 1. The glucosinolates. Plant Physiol. 97: 217-226.

Havaux M., Bonfils J-P., Lütz C., Niyogi K.K. (2000) Photodamage of the photosynthetic apparatus and its dependence on the leaf developmental stage in the npq1 Arabidopsis mutant deficient in the xanthophyll cycle enzyme violaxanthin de-epoxidase. Plant Physiol. 124: 273-284.

Heaney R.K. & Fenwick G.R. (1980) Glucosinolates in Brassica vegetables. Analysis of 22 varieties of Brussuels sprouts (Brassica oleracea L. var. Gemmifera). J. Sci. Food Agric. 31: 785-793.

Hecht S.S. (2000) Inhibition of carcinogenesis by isothiocyanates. Drug Metab. Rev. 32: 395-411.

Helmlinger J., Rausch T. & Hilgenberg W. (1983) Localization of newly synthesized indole-3-methylglucosinolate (D glucobrassin) in vacuoles in horseradish (Armoracia rusticana). Physiol. Plant 58: 302-310.

Henrissat B. (1991) A classification of glycosyl hydrolases based on amino acid

158 sequence similarities. J. Biochem. 280: 309–316.

Henrissat B. & Bairoch A. (1996) Updating the sequence-based classification of glycosyl hydrolases. J. Biochem. 316: 695–696.

Herppich W.B. & Peckmann K. (2000) Influence of drought on mitochondrial activity, photosynthesis, nocturnal acid accumulation and water relations in the CAM plants Prenia sladeniana (ME-type) and Crassula lycopodioides (PEPCK-type). Ann Bot. 86: 611-620.

Higdon J., Cruciferous vegetables (Last updated 07/21/2005) provided by Linus Pauling Institute. http://lpi.oregonstate.edu/infocenter/

Hikosaka K. & Terashima I. (1996) Nitrogen partitioning among photosynthetic components and its consequence in sun and shade plants. Funct. Ecol. 10: 335-343.

Hill C.B., Williams P.H., Carlson D.G. & Tookey H.L. (1987) Variation in glucosinolates in oriental Brassica vegetables. J. Amer. Soc. Hort. Sci. 112(2): 309-313.

Himelrick D.G. & McDuffie R.F. (1983) The calcium cycle: uptake and distribution in apple trees. HortScience 18:147-151.

Höglund A.S., Lenman M., Falk A. & Rask L. (1991) Distribution of myrosinase in rapeseed tissues. Plant Physiol. 95: 213-221.

Höglund A.S., Lenman M. & Rask L. (1992) Myrosinase is localized to the interior of myrosin grains and is not associated to the surrounding tonoplast membrane. Plant Sci. 85: 165-170.

Huang X. & Renwick J.A.A. (1994) Relative activities of glucosinolates as oviposition stimulants for Pieris rapae and P. napi oleracea. J. Chem. Ecol. 20: 1025-1037.

Husebye H., Chadchawan S., Winge P., Thangstad O.P. & Bones A.M. (2002) Guard cell- and phloem idioblast-specific expression of thioglucoside glucohydrolase 1 (myrosinase) in Arabidopsis. Plant Physiol. 128(4): 1180-1188.

Iori R., Rollin P., Streicher H., Thiem J. & Palmieri S. (1996) The myrosinase-glucosinolate interaction mechanism studied using some synthetic competitive inhibitors. FEBS Lett. 358: 87-90.

James D.C. & Rossiter J.T. (1991) Development and characteristics of myrosinase in Brassica napus during early seedling growth. Physiol. Plant 82: 163-170.

Jensen C.R., Mogensen V.O., Mortensen G., Fieldsend J.K., Milford G.F.J., Andersen M.N. & Thage J.H. (1996) Seed glucosinolate, oil and protein contents of field-grown rape (Brassica napus L.) affected by soil drying and evaporative demand. Field Crop Res. 47: 93-105.

159

Jørgensen L.B. (1981) Myrosin cells and dilated cisternae of the endoplasmic reticulum in the order Capparales. Nord. J. Bot. 1: 433-445.

Joshipura K.J., Ascherio A., Manson J.E., Stampfer M.J., Rimm E.B., Speizer F.E., Hennekens C.H., Spiegelman D. & Willett W. (1999) Fruit and vegetable intake in relation to risk of ischemic stroke. J. Am. Med. Assoc. 282: 1233-1239.

Jwanny E.W., El-Sayed S.T. (1994) Glycosidases of turnip leaf tissues. II. Isolation, purification, and some physiochemical characterization. Appl. Biochem. Biotechnol. 49 (1): 23-34.

Jwanny E.W., El-Sayed S.T., Rashad M.M., Mahmoud A.E. & Abdallah N.M. (1995) Myrosinase from roots of Raphanus sativus. Phytochemistry, 39(6): 1301-1303.

Kaur C. & Kapoor H.C. (2002) Anti-oxidant activity and total phenolic content of some Asian vegetables. Int. J. Food Sci. Tech. 37: 153-163.

Kelly P.J., Bones A.M. & Rossiter J.T. (1998) Sub-cellular immunolocalization of the glucosinolate sinigrin in seedlings of Brassica juncea. Planta 206: 370-377.

Kiddle G.A., Doughty K.J. & Wallsgrove R.M. (1994) Salicylic acid-induced accumulation of glucosinolates in oilseed rape (Brassica napus L.) leaves. J. Exp. Bot. 45: 1343-1346.

Kirby, A.J. & Shmidt R.J. (1997) A study of the antioxidant activity of Chinese herbs for eczema, compared with placebo herbs. J. Ethnopharmacol. 56(2): 103-108.

Kirkegaard J.A. & Sarwar M. (1998) Biofumigation potential of Brassicas. I. Variation in glucosinolate profiles of diverse field-grown Brassicas. Plant Soil 201: 71–89.

Kitajima K. (2002) Do shade-tolerant tropical tree seedlings depend longer on seed-reserve? Functional growth analysis of three Bignoniaceae species. Funct. Ecol. 16: 433-444.

Kitajima K. & Hogan K.P (2003) Increases of chlorophyll a/b ratios during acclimation of tropical woody seedlings to nitrogen limitation and high light. Plant Cell Environ. 26(6): 857-865.

Kitao M., Lei T.T., Koike T., Tobita H., Maruyama Y., Matsumoto Y. & Ang L.H. (2000) Temperature response and photoinhibition investigated by chlorophyll fluroscence measurements for four distinct species of dipterocarp trees. Plant Physiol. 109: 284-290.

Kleinwächter M. & Selmar D. (2004) A novel approach for reliable activity determination of ascorbic acid depending myrosinases. J. Biochem. Biophys. Methods. 59(3): 253-265.

160

Kliebenstein D.J., Kroymann J., Brown P., Figuth A., Pedersen D., Gershenzon J. & Mitchell-Olds T. (2001a) Genetic control of natural variation in Arabidopsis glucosinolate accumulation. Plant Physiol. 126 (2): 811-825.

Kliebenstein D.J., Lambrix V.M., Reichelt M., Gershenzon J. & Mitchell-Olds T. (2001b) Gene duplication in the diversification of secondary metabolism: Tandem 2-oxoglutarate-dependent dioxygenases control glucosinolate biosynthesis in Arabidopsis. Plant Cell 13 (3): 681-693.

Kliebenstein D.J., Pedersen D., Barkerb B. & Mitchell-Oldsa T. (2002) Comparative analysis of quantitative trait loci controlling glucosinolates, myrosinase and insect resistance in Arabidopsis thaliana. Genetics 161: 325-332.

Kooten O. & Snel J.F.H. (1990) The use of chlorophyll fluorescence nomenclature in plant stress physiology. Photosynth. Res. 25: 147-150.

Kopas-Lane L.M. & Warthesen J.J. (1995) Carotenoid photostability in raw spinach and carrots during cold storage. J. Food Sci. 60: 773-776.

Koroleva O.A., Davies A., Deeken R., Thorpe M.R., Deri Tomos A. & Hedrich R. (2000) Identification of a new glucosinolate-rich cell type in Arabidopsis flower stalk. Plant Physiol. 124: 599-608.

Kouril R., Ilik P., Naus J. & Schoefs B. (1999) On the limits of applicability of spectrophotometric and spectrofluorimetric methods for the determination of chlorophyll a/b ratio. Phytosynth. Res. 62: 107-116.

Krause G.H., Vernotte C. & Briantais J.M. (1982) Photoinduced quenching of chlorophyll fluorescence in intact chloroplasts and algae. Resolution into two components. Biochim. Biophys. Acta. 679: 116-124.

Kumaratilake A.R. & Christopher P. (2005) Low temperature reduces glufosinate activity and translocation in wild radish (Raphanus raphanistrum). Weed Sci 53(1): 10-16.

Kyparissis A., Petropoulou Y. & Manetas Y. (1995) Summer survival of leaves in a soft-leaved shrub (Phlomis fructicosa L., Labiatae) under Mediterranean field conditions: avoidance of photoin-hibitory damage through decreased chlorophyll contents. J. Exp. Bot. 46: 1825-1831.

Larsen P.O. (1991) Glucosinolates. In: Stumpf P.K. & Conn E.E. (Eds). The Biochemistry of Plants. Academic Press Inc., New York, USA. pp. 501-525.

Lauriano J.A., Lidon F.C., Carvalho C.A. & Campos P.S. (2000) Drought effects on membrane lipids and photosynthetic activity in different peanut cultivars. Photosynthetica. 38(1): 7-12.

Lazan H., Ali Z.M., Mohd A. & Nahar F. (1987) Water stress and quality decline during storage of tropical leafy vegetables. J. Food Sci. 52: 1286-1288.

161

Lenman M., Falk A., Rödin J., Höglund A.S., Ek B. & Rask L. (1993a) Differential expression of myrosinase gene families. Plant Physiol. 103: 703-711.

Lenman M., Falk A., Xue J. & Rask L. (1993b) Characterization of a Brassica napus myrosinase pseudogene: Myrosinases are members of the BGA family of β-glycosidases. Plant Mol. Biol. 21: 463-474.

Lenman M., Rödin J., Josefsson L.G. & Rask L. (1990) Immunological characterization of rapeseed myrosinase. Eur. J. Biochem. 194: 747-753.

Levitt J. (1980) Responses of plants to environmental stresses. In: Water, Radiation, Salt and Other Stresses vol. II, Academic Press, New York, pp. 3-211.

Li Q., Eigenbrode S., Stringham G.. & Thiagarajah M. (2000): Feeding and growth of Plutella xylostella and Spodoptera eridania on Brassica juncea with varying glucosinolate concentrations and myrosinase activities. J. Chem. Ecol. 26: 2401-2419.

Li Q., Brown J. & Eigenbrode S.D. (2002) Variation of myrosinase activity in the cross progenies of two Brassica juncea lines with relatively low and high myrosinase activities. Can. J. Plant Sci. 82: 579-582.

Li X. & Kushad M.M. (2004) Correlation of glucosinolate content to myrosinase activity in Horseradish (Armoracia rusticana). J. Agric. Food Chem. 52 (23): 6950 -6955.

Lindquist S. & Craig E.A. (1988) The heat-shock proteins. A. Rev. Gen. 22: 631-677.

London S.J., Yuan J.M. & Chung F.L. (2000) Isothiocyanates, glutathione S-transferase M1 and T1 polymorphisms, and lung cancer risk: a prospective study of men in Shanghai, China. Lancet 356(9231): 724-729.

Louda S. & Mole S. (1991) Glucosinolates, chemistry and ecology. In: Rosenthal G.A., Berenbaum M.R. (Eds). Herbivores: Their interactions with secondary plant metabolites. Academic Press, San Diego, CA, pp.123-164.

Ludikhuyze L., Ooms V., Weemaes C. & Hendrickx M. (1999) Kinetic study of the irreversible thermal and pressure inactivation of myrosinase from broccoli (Brassica oleracea L. cv. Italica). J. Agri. Food Chem. 47: 1794–1800.

Ludikhuyze L., Rodrigo L. & Hendrickx M. (2000) The activity of myrosinase from broccoli (Brassica oleracea L. cv. Italica): influence of intrinsic and extrinsic factors. J. Food Prot. 63(3): 400-403.

Lüthy B. & Matile P. (1984) The mustard oil bomb: Rectified analysis of the subcellular organisation of the myrosinase system. Biochem. Physiol. Pflanzen 179: 5-12.

162 Lykkesfeldt J. & Møller B.L. (1993) Synthesis of benzylglucosinolate in Tropaeolum majus L.: isothiocyanates as potent enzyme inhibitors. Plant Physiol. 102: 609-613.

MacGibbon D.B. & Allison R.M. (1970): A method for the separation and detection of plant glucosinolases (myrosinases). Phytochem. 9: 541-544.

MacLeod A.J. & Rossiter J.T. (1986) Isolation and examination of thioglucoside glucohydrolase from seeds of Brassica napus. Phytochem. 25:1047-1051.

Machlin S., Mitchell-Olds T. & Bradley D. (1993) Sequence of a Brassica campestris myrosinase gene. Plant Physiol. 102: 1359-1360.

Maslova T.G. & Popova I.A. (1993) Adaptive properties of the plant pigment systems. Photosynthetica 29: 195-203.

Maxwell K., Griffiths H. & Young A.J. (1994) Photosynthetic acclimation to light regime and water-stress by the C3-CAM epithyte Guzmania monostachia: gas exchange characteristic, photochemical efficiency and the xanthophylls cycle. Funct. Ecol. 8: 746-754.

Maxwell D.P., Falk S. & Huner N.P.A. (1995) Photosystem II excitation and development of resistance to photoinhibition. Plant Physiol. 107: 687-694.

Maxwell K. & Johnson G.N. (2000) Chlorophyll fluorescence - a practical guide. J. Exp. Bot. 51(345): 659-668.

Merritt S.Z. (1996) Within plant variation in concentrations of amino acids, sugar, and sinigrin in phloem sap of black mustard, Brassica nigra (L) Koch (Cruciferae). J. Chem. Ecol. 22: 1133-1145.

Milberg P., Pérez-Fernández M.A. & Lamont B.B. (1998) Seedling growth response to added nutrients depends on seed size in three woody genera. J. Ecol. 86: 624-632.

Miliauskas G.., Venskutonis P.R. & van Beek T.A. (2004) Screening of radical scavenging activity of some medicinal and aromatic plant extracts. Food Chem. 85(2): 231-237.

Miller A.G., Espie G.S. & Canvin D.T. (1990) Active transport of inorganic carbon increases the rate of O2 photo-reduction by the cyanobacterium Synechococcus UTEX 625. Plant Physiol. 88: 6-9.

Mithen R.F., Dekker M., Verkerk R., Rabot S. & Johnson I.T. (2000) The nutritional significance, biosynthesis and bioavailability of glucosinolates in human foods. J. Sci. Food Agric. 80: 967-984.

Monk L.S., Fagerstedt K.V. & Crawford R.M.M. (1989) Oxygen toxicity and superoxide dismutase as an antioxidant in physiological stress. Physiol. Plant. 76: 456–459.

163

Moyes C.L. & Raybould A.F. (1998) Herbivory by the cabbage seed weevil (Ceutorhynchus assimilis) in natural populations of Brassica oleracea ssp. oleracea. Acta Horticulturae. 459: 315-322.

Mozafar A. (1993) Nitrogen fertilizers and the amount of vitamins in plants: A review. J. Plant Nut. 16(12): 2479-2506.

Müller-Moulé P., Havaux M. & Niyogi K.K. (2003) Zeaxanthin deficiency enhances the high light sensitivity of an ascorbate-deficient mutant of Arabidopsis. Plant Physiol. 133: 748-760.

Munné-Bosch S. & Alegre L. (1999) Role of dew on the recovery of water-stressed Melissa officinalis L. plants. J. Plant Physiol 154: 759-766.

Muthuchelian K., Murugan C., Nedunchezhian N. & Kulandaivelu G. (1997) Photosynthesis and growth of Erythrina variegata as affected by water stress and triancontanol. Photosynthetica 33 (2): 241-248.

Myzak M.C., Karplus P.A. & Chung F.L. (2004) A novel mechanism of chemoprotection by sulforaphane: inhibition of histone deacetylase. Cancer Res. 64: 5767-5774.

Ness A.R. & Powles J.W. (1997) Fruit and vegetables, and cardiovascular disease: a review. Int. J. Epidemiol. 26: 1-13.

Nilsen E.T. (1992) Partitioning growth and photosynthesis between leaves and stems during nitrogen limitation in Spartium junceum. Am. J. Bot. 79: 1217-1223.

Nilsson J., Olsson K., Engqvist,G., Ekvall J., Olsson M., Nyman M. & Akesson B. (2005) Variation in the content of glucosinolates, hydroxycinnamic acids, carotenoids, total antioxidant capacity and low-molecular-weight carbohydrates in Brassica vegetables. J. Sci. Food Agric. 86(4): 528-538.

Ohtsuru M. & Hata T. (1979) The interaction of L-ascorbic acid with the active center of myrosinase. Biochem. Biophys. Acta. 567(2): 384-391.

Ohtsuru M. & Kawatani H. (1979) Studies of the myrosinase from Wasabia japonica: Purification and some properties of Wasabi myrosinase. Agric. Biol. Chem. 43: 2249-2255.

Ontai S.L., Paull R.E. & Saltveit Jr. M.E. (1992) Controlled-atmosphere storage of sugar peas. HortScience 27(1): 39-41.

Öquist G., Hurry V.M. & Huner N.P.A. (1993) Low-temperature effects on photosynthesis and correlation with freezing tolerance in spring and winter cultivars of wheat and rye. Plant Physiol. 101: 245-250.

Osawa T. (1994) Novel natural antioxidants for utilization in food and biological systems. In: Uritani I., Garcia V.V. & Mendoza E.M.T. (Eds) Postharvest

164 biochemistry of plant food-materials in the tropics. Japan Scientific Society Press: Tokyo, Japan, pp. 241-251.

Ou B.X, Huang D.J, Hampsch-Woodill M., Flanagan J.A. & Deemer E.K. (2002) Analysis of antioxidant activities of common vegetables employing oxygen radical absorbance capacity (ORAC) and ferric reducing antioxidant power (FRAP) assays: A comparative study. J. Agric. Food Chem. 50: 3122-3128.

Page T., Griffiths G. & Buchanan-Wollaston V. (2001) Molecular and biochemical characterization of postharvest senescence in broccoli. Plant Physiol. 125(2): 718–727.

Palmieri S., Leoni O. & Iori R. (1982) A steady-state kinetics study of myrosinase with direct ultraviolet spectrophotometric assay. Anal. Biochem. 123: 320-324.

Pellegrini N., Re R., Yang M. & Rice-Evans C.A. (1999) Screening of dietary carotenoids and carotenoid-rich fruit extracts for antioxidant activities applying the 2,2'-azobis(3-ethylenebenzothiazoline-6-sulfonic) acid radical cation decolorization assay. Methods Enzymol. 299: 379-389.

Pellegrini N., Simonetti P., Gardana C., Brenna O., Brighenti F. & Pietta P.G. (2000) Polyphenol content and total antioxidant activity of Vini novelli (young red wines). J. Agric. Food Chem. 48: 732-735.

Petersen B.L., Chen S.X. & Hansen C.H. (2002) Composition and content of glucosinolates in developing Arabidopsis thaliana. Planta. 214 (4): 562-571.

Phelan J.R. & Vaughan J.G.. (1980) Myrosinases in Sinapis alba L. J. Exp. Bot. 31: 1425-1433.

Pivnick K.A., Jarvis B.J. & Slater G.P. (1994) Identification of olfactory cues used in host-plant finding by diamondback moth, Plutella xylostella (Lepidoptera, Plutellidae). J. Chem. Ecol. 20: 1407-1427.

Poppel van G., Verhoeven D.T., Verhagen H. & Goldbohm R.A. (1999) Brassica vegetables and cancer prevention. Epidemiology and mechanisms. Adv. Exp. Med. Biol. 472:159-168.

Porter A.J.R, Morton A.M., Kiddle G.., Doughty K.J. & Wallsgove R.M. (1991) Variation in the glucosinolate content of oilseed rape (Brassica napus L.). I. Effects of leaf age and position. Ann. Appl. Biol. 118: 461-467.

Rangkadilok N., Tomkins B., Nicolas M.E., Premier R.R., Bennett R.N., Eagling D.R. & Taylor P.W.J. (2002) The effect of post-harvest and packaging treatments on glucoraphanin concentration in Broccoli (Brassica oleracea var. italica). J. Agric. Food Chem. 50 (25): 7386-7391.

Rask L., Andreasson E., Ekbom B., Eriksson S., Pontoppidan B. & Meijer J. (2000) Myrosinase: gene family evolution and herbivore defense in Brassicaceae. Plant Mol. Biol. 42:93-113.

165

Richards R.A. & Thurling N. (1978a) Variation between and within species of rapeseed (Brassica campestris and B. napus) in response to drought stress. I. Sensitivity at different stages of development. Aus. J. Agri. Res. 29(3): 469-477.

Richards R.A. & Thurling N. (1978b) Variation between and within species of rapeseed (Brassica campestris and B. napus) in response to drought stress. I. Sensitivity at different stages of development. Aus. J. Agri. Res. 29(3): 479-490.

Rodman J.E. (1991) A taxonomic analysis of glucosinolate-producing plants, Part 1. Phenetics. Syst. Bot. 16: 598-618.

Rodman J., Price R.A., Karol K., Conti E., Sytsma K.J. & Palmer J.D. (1993) Nucleotide sequences of the rbcL gene indicate monophyly of mustard oil plants. Ann. Miss. Bot. Gard. 80: 686-699.

Rodman J.E., Soltis P.S., Soltis D.E., Sytsma K.J. & Karol K.G. (1998) Parallel evolution of glucosinolate biosynthesis inferred from congruent nuclear and plastid gene phylogenies. Am. J. Bot. 85: 997-1006.

Rodriguez-Amaya D.B. (1997) Carotenoids and food preparation: The retention of provitamin A carotenoids in prepared, processed, and stored foods. Arlington VA: John Snow, Inc/OMNI Project

Rojas J.C. (1999) Electrophysiological and behavioral responses of the cabbage moth to plant volatiles. J. Chem. Ecol. 25: 1867-1883.

Rosa E.A., Heaney R.K., Portas C.A. & Roger G. (1996) Changes in glucosinolate concentrations in Brassica crops (B. oleracea and B. napus) throughout growing seasons. J. Sci. Food Agric. 71: 237-244.

Rosa E.A. (1997) Daily variation in glucosinolate concentrations in the leaves and roots of cabbage seedlings in two constant temperature regimes. J. Sci. Food Agric. 73: 364-368.

Rouzaud G., Young S.A. & Duncan A.J. (2004). Hydrolysis of glucosinolates to isothiocyanates after ingestion of raw or microwaved cabbage by human volunteers. Cancer Epidemiol. Biomarkers Prev. 13: 125-131.

Sánchez-Moreno C. (2002) Review: Methods used to evaluate the free radical scavenging activity in foods and biological systems. Food Sci. Tech. Int. 8: 121-137.

Sang, J.P., Minchinton I.R., Johnstone P.K. & Truscott R.J.W. (1984) Glucosinolate profiles in the seed, root and leaf tissue of cabbage, mustard, rapeseed, radish and swede. Can. J. Plant Sci. 64: 77-93.

Schoefs B., Bertrand M. & Lemoine Y. (1998) Changes in the photosynthetic pigments in bean leaves during the first photoperiod of greening and the

166 subsequent dark-phase, comparison between old (10-d-old) leaves and young (2-d-old) leaves. Photosynth. Res. 57: 203-213.

Schooven L.M., Jermy T. & van Loon J.J.A (1998) Insect plant biology. Chapman and Hall, London

Schreiber U., Bilger W. & Neubauer C. (1994) Chlorophyll fluorescence as a nonimtrusive indicator for rapid assessment of in vivo photosynthesis. In: Schulze E.D. & Caldwell M.M. (Eds.), Ecophysiology or Photosynthesis. Spring-Verlag, Berlin-New York. pp.49-67.

Senn, T.L. & Kingman A.R. (1973) A review of Humus and Humic Acids. Research Series No. 145, S. C. Agricultural Experiment Station, Clemson, South Carolina, USA.

Shapiro T.A., Fahey J.W., Wade K.L., Stephenson K.K. & Talalay P. (2001) Chemoprotective glucosinolates and isothiocyanates of broccoli sprouts: metabolism and excretion in humans. Cancer Epidemiol. Biomarker Prev. 10: 501-508.

Shelp B.J., Liu L. & McLellan D. (1993) Glucosinolate composition of broccoli (Brassica oleracea var. Italica) grown under various boron treatments at three Ontario sites. Can. J. Plant Sci. 73: 885-888.

Siemens D.H. & Mitchell-Olds T. (1996) Glucosinolates and herbivory by specialists (Coleoptera: Chrysomelidae, Lepidoptera: Plutellidae): consequences of concentration and induced resistance. Environ. Entomol. 80: 231-237.

Siemens D.H., Garner S.H., Mitchell-Olds T. & Callaway R.M. (2002) Cost of defense in the context of plant competition: Brassica rapa may grow and defend. Ecology 83 (2): 505-517.

Simonetti P., Porrini M. & Testolin G. (1991) Effect of environmental factors and storage on vitamin content of Pisum sativum and Spinacea oleracea. Italian J. Food Sci. 3: 187-196.

Sovero M. (1993) Rapeseed, a new oilseed crop for the United States. In: Janick J. & Simon J.E. (Eds.), New crops. Wiley J.C. Press, New York. pp. 302-307.

Springett M.B. & Adams J.B. (1989) Properties of brussels sprouts thioglucosidase. Food Chem.33: 173-186.

Stadler E., Renwick J.A.A., Radke C.D. & Sachdevgupta K. (1995) Tarsal contact chemoreceptor response to glucosinolates and cardenolides mediating oviposition in Pieris rapae. Physiol. Entomol. 20: 175-187.

Stowe K.A. (1998) Realized defense of artificially selected lines of Brassica rapa - effects of quantitative genetic variation in foliar glucosinolate concentration. Environ. Entomol. 27: 1166-1174.

167 St-Pierre B., Vazquez-Flota A. & de Luca V. (1999) Multicellular compartmentation of Catharanthus roseus alkaloid biosynthesis predicts intercellular translocation of pathway intermediate. Plant Cell 11: 887-900.

Sørensen H. (1990) Glucosinolates: structure, properties, function in rapeseed/canola: production, chemistry, nutrition and processing technology. In: Shahidi F. (Ed), van Nostrand Reinhold Publisher, New York. pp.149–172.

Taipalensuu J., Lundgren S. & Rask L. (1995) No evidence for the ascorbic activation site of myrosinase being encoded by end of exon 9, beginning of exon 10. Hereditas 122: 95-98.

Taipalensuu J., Falk A. & Rask L. (1997a) Myrosinase-binding proteins are derived from a large wound-inducible and repetitive transcript. Eur. J. Biochem. 243: 605-611.

Taipalensuu J., Eriksson S., Rask L. (1997b) The myrosinase-binding protein from Brassica napus seeds possesses lectin activity and has a highly similar vegetatively expressed wound-inducible counterpart. Eur. J. Biochem. 250: 680-688.

Thangstad O.P., Iversen T.H, Slupphaug G.. & Bones A.M. (1990) Immunocytochemical localization of myrosinase in Brassica napus L. Planta 180: 245-248.

Thangstad O.P., Evjen K. & Bones A.M. (1991) Immunogold-EMlocalization of myrosinase in Brassicaceae. Protoplasma 161: 85-93.

Thangstad O.P., Winge P., Husebye H. & Bones A.M (1993) The thioglucoside glucohydrolase (myrosinase) gene family in Brassicaceae. Plant Mol. Biol. 23: 511-524.

Thangstad O.P., Bones A.M., Holtan S., Moen L. & Rossiter J.T. (2001) Microautoradiographic localisation of a glucosinolate precursor to specific cells in Brassica napus L. embryos indicates a separate transport pathway into myrosin cells. Planta 213(2): 207-213.

Thangstad O.P., Gilde B., Chadchawan S., Seem M., Husebye H., Bradley D. & Bones A.M. (2004) Cell specific, cross-species expression of myrosinases in Brassica Napus, Arabidopsis Thalina and Nicotiana Tabacum. Plant Mol. Biol. 54: 597-611.

Thompson W.A., Huang L.K. & Kriedemann P.E. (1992) Photosynthetic response to light and nutrients in sun-tolerant and shade-tolerant rain-forest trees. II. Leaf gas-exchange and component processes of photosynthesis. Aus. J. Plant Phys. 19: 19-42.

Thongsook T & Barrett D.M. (2005) Heat inactivation and reactivation of broccoli peroxidase J. Agric. Food Chem. 53(8): 3215-3222.

168 Tsao R., Reuber M., Johnson L. & Coats J.R. (1996) Insecticidal toxicity of glucosinolate-containing extracts from crambe seeds. J. Agric. Entomol. 13: 109-120.

Vallejo F., Tomas-Barberan F. & Garcia-Viguera C. (2003) Health-promoting compounds in broccoli as influenced by refrigerated transport and retail sale period. Agric. Food Chem. 51 (10): 3029-3034.

Verhoeven D.T.H., Verhagen H., Goldbrohm R.A., van den Brandt P.A. & Poppel van G. (1997) A review of mechanisms underlying anticarcinogenicity by brassica vegetables. Chemico-Biological Interactions 103(2): 79-129.

Verhoeven D.T.H, Goldbohm R.A., Poppel van G, Verhagen H. & van den Brandt P.A. (1996) Epidemiological studies on Brassica vegetables and cancer risk. Cancer Epidemiol. Biomarker Prev. 5(9): 733-748.

Verhoeven A.S., Bugos R.C. & Yamamoto H.Y. (2001) Transgenic tobacco with suppressed zeaxanthin formation is susceptible to stress-induced photoinhibition. Photosynth. Res. 67: 27-39.

Vermaas W.F.J., Shen G.. & Styring S. (1994) Electrons generated by photosystem II are utilized by an oxidase in the absence of photosystem I in the cyanobacterium Synechocystis sp. PCC 6803. FEBS Lett. 337: 103-108.

Visvalingam S., Hønsi T.G. & Bones A.M. (1998) Sulphate and micronutrients can modulate the expression levels of myrosinases in Sinapsis alba plants. Plant Physiol. 104: 30-37.

Wallace S.K. & Eigenbrode S.D. (2002) Changes in the glucosinolate-myrosinase defense system in Brassica juncea cotyledons during seedling development. J. Chem. Ecol. 28(2): 243-256.

Walters M.B. & Reich P.B. (2000) Seed size, nitrogen supply and growth rate affect tree seedling survival in deep shade. Ecology 81: 1887-1901.

Wang H., Cao G. & Prior R.L. (1997) Oxygen radical absorbing capacity of anthocyanins. J. Agric. Food Chem. 45: 304-309.

Watada A.E., Kim S.D., Kim K.S. & Harris T.C. (1987) Quality of green beans, bell peppers and spinach stored in polyethylene bags. J. Food Sci. 52: 1637-1641.

Weis E. & Berry J.A. (1987) Quantum efficiency of photosystem II in relation to “energy”-dependent quenching of chlorophyll fluroscence. Biochim. Biophys. Acta. 894: 198-208.

Wilkinson A.P., Rhodes M.J.C. & Fenwick R.G. (1984) Myrosinase activity of cruciferous vegetables. J. Sci. Food Agric. 35: 543-552.

Willcox J.K., Catignani G.L. & Lazarus S. (2003) Tomatoes and cardiovascular health. Crit. Rev. Food Sci. Nutr. 43(1): 1-18.

169

Wink M. (1988) Plant breeding: importance of plant secondary metabolites for protection against pathogens and herbivores. Theor. Appl. Genet. 75 (2): 225-233.

Wink M. (1999) Functions of plant secondary metabolites and their exploitation in biotechnology. CRC Press, Boca Raton, Florida

Wittstock U. & Halkier B.A. (2002) Glucosinolate research in the Arabidopsis era. Trends Plant Sci. 7 (6): 263-269.

Wu X.L., Gua L.W., Holdenb J., Haytowitzb D.B., Gebhardtb S.E, Beecherb G. & Priora R.L. (2004) Development of a database for total antioxidant capacity in foods: a preliminary study. J. Food Compos. Anal. 17: 407-422.

Xue J., Jørgensen M., Philgren U. & Rask L. (1995) The myrosinase gene family in Arabidopsis thaliana: gene organisation, expression and evolution. Plant Mol. Biol. 27: 911-922.

Xue J., Lenman M., Falk A. & Rask L. (1992) The glucosinolate-degrading enzyme myrosinase in Brassicaceae is encoded by a gene family. Plant Mol. Biol. 18: 387–398.

Xue J. & Rask L. (1995) The unusual 50 splicing border GC is used in myrosinase genes of the Brassicaceae. Plant Mol. Biol. 29: 167-171.

Yang C.P., Fujita S. Ashrafuzzaman M.D., Nakamura N. & Hayashi N. (2000) Purification and characterization of polyphenol oxidase from banana (Musa sapientum L.) pulp. J. Agric. Food Chem. 48 (7): 2732-2735.

Yen G.C. & Wei Q.K. (1993) Myrosinase activity and total glucosinolate content of cruciferous vegetables, and some properies of cabbage myrosinase in Taiwan, J. Sci. Food Agri. 61: 471–475.

Young I.S. & Woodside J.V. (2001) Antioxidant in health and disease. J. Clin. Pathol. 54: 176-186.

Young J.E., Zhao X., Carey E.E., Welti R., Yang S.S. & Wang W. (2005) Phytochemical phenolics in organically grown vegetables. Mol. Nutr. Food Res. 49(12): 1136-1142.

Zhao F., Evans E., Bilsborrow P. & Syers J.K. (1994) Influence of nitrogen and sulphur on the glucosinolate profile of rapeseed (Brassica napus L). J. Sci. Food Agric. 64: 295-304.

Zhuang H., Hildebrand D.F. & Barth M.M. (1997) Temperature influenced lipid peroxidation and deterioration in broccoli buds during post harvest storage. Postharvest Biol. Technol. 10: 49-58.

170