University of New Hampshire University of New Hampshire Scholars' Repository
Master's Theses and Capstones Student Scholarship
Fall 2018
POPULATION GENETICS AND MALE SOCIAL BEHAVIOR IN THE AUSTRALIAN SMALL CARPENTER BEE, CERATINA AUSTRALENSIS
Robert L. Oppenheimer University of New Hampshire, Durham
Follow this and additional works at: https://scholars.unh.edu/thesis
Recommended Citation Oppenheimer, Robert L., "POPULATION GENETICS AND MALE SOCIAL BEHAVIOR IN THE AUSTRALIAN SMALL CARPENTER BEE, CERATINA AUSTRALENSIS" (2018). Master's Theses and Capstones. 1234. https://scholars.unh.edu/thesis/1234
This Thesis is brought to you for free and open access by the Student Scholarship at University of New Hampshire Scholars' Repository. It has been accepted for inclusion in Master's Theses and Capstones by an authorized administrator of University of New Hampshire Scholars' Repository. For more information, please contact [email protected]. i
POPULATION GENETICS AND MALE SOCIAL BEHAVIOR IN THE AUSTRALIAN
SMALL CARPENTER BEE, CERATINA AUSTRALENSIS
BY
ROBERT L OPPENHEIMER
BS Biological Sciences, George Washington University, 2013
THESIS
Submitted to the University of New Hampshire
in Partial Fulfillment of
the Requirements for the Degree of
Master of Science
in
Biological Sciences: Integrative and Organismal Biology
September, 2018
ii
This thesis has been examined and approved in partial fulfillment of the requirements for the degree of Master of Science in Biological Sciences: Integrative and Organismal Biology by:
Thesis Director, Sandra M. Rehan, Assistant Professor, Biological Sciences
Donald S. Chandler, Professor/ Interim Department Chair, Biological Sciences
Daniel Howard, Assistant Professor, Biological Sciences
On June 22, 2018
Original approval signatures are on file with the University of New Hampshire Graduate
School.
iii
TABLE OF CONTENTS
ACKNOWLEDGEMENTS…………………………………………………………………….iv ABSTRACT….…………………………………………………………………………………..v INTRODUCTION………………………………………………………………………………1 I. Phylogeography and population genetics…..…………………………………………25
Introduction………………………………………………………………………………26
Methods………………………………………………………………………………...... 29
Results……………………………………………………………………………………33
Discussion………………………………………………………………………………..35
II. Male nesting behavior and inclusive fitness ……………………………………...... 39
Introduction………………………………………………………………………………40
Methods………………………………………………………………………………...... 43
Results……………………………………………………………………………………48
Discussion………………………………………………………………………………..53
CONCLUSIONS…………………………………………………………...……………...... 57
References…………………………………………………………………………………...... 61
Figures and Tables
Chapter I…………………………………………………………………………………74
Chapter II………………………………………………………………………………...84
iv
ACKNOWLEDGEMENTS
I would like to thank my advisor Sandra Rehan for her guidance and support throughout the entirety of this master’s project. I would like to thank my committee members, Don Chandler and Daniel Howard, for their time and helpful critiques and suggestions. I would also like to thank Wyatt Shell, Mike Steffan, Rebecca Dew, and all members of the Rehan Lab for their assistance and guidance in helping me to find some footing in the collaborative study of C. australensis. I am also thankful for and to my family and friends for being there and making life all the better.
v
ABSTRACT
POPULATION GENETICS AND MALE SOCIAL BEHAVIOR IN THE AUSTRALIAN
SMALL CARPETNER BEE, CERATINA AUSTRALENSIS
by
Robert L Oppenheimer
University of New Hampshire, September, 2018
Small carpenter bees (Xylocopinae: Ceratinini) in the genus Ceratina are a cosmopolitan group of stem nesting bees. All Ceratina show a degree of mutual tolerance for nestmates as they nest together in pre-dispersal assemblages and display extended maternal care. Many Ceratina also nest facultatively with multiple females per nest. Males usually disperse before the beginning of the reproductive season. Ceratina have emerged as model organisms to study the evolution of social behavior within the Hymenoptera (ants, bees and wasps). As hymenopteran sex is determined by the haplodiploid sex determination system wherein males are haploid and females are diploid, the result is a relatedness asymmetry between brothers and sisters, whereby sisters share a greater proportion of similar genes compared to brothers. Kin selection theory predicts that daughters are more likely to help rear sisters compared to brothers and is used to explain the prevalence of social behavior within the Hymenoptera.
Here the relatedness between populations and within nests of the Australian small carpenter bee Ceratina (neoceratina) australensis is examined with the use 8 polymorphic vi
microsatellite loci. In chapter 1, the eight microsatellite loci are described and applied to three known populations of Ceratina australensis within Australia. Chapter 1 provides evidence for migration from north to south following the river systems of the Murray-Darling River Basin
(MRDB). The MRDB has undergone substantial anthropogenic alterations to the natural vegetation communities since European settlement. Chapter 1 provides evidence for the hypothesis that C. australensis expansion into Australia has been aided by the introduction of pithy stemmed plants and establishes how patterns of dispersal can affect the social biology of this species. Chapter 2 deals directly with understanding the presence of male bees within nests of C. australensis that were found predominately, but not exclusively, within the most genetically homogenous population from chapter 1. The existence of inbreeding was not confirmed by visual inspection of genotypes or relatedness estimates between male adults and female offspring. Nests with males had lower brood survivorship compared to solitary nests but reproductive females in nests with males did not have significantly lower fitness compared to reproductive females in other nest types. The inclusive fitness of non-reproductive females was significantly lower than the fitness of reproductive females and the inclusive fitness of males was zero. I speculate that males were potentially delaying reproduction though it is odd that males were not forcefully removed by females. These findings underscore the importance of factors related to the timing of dispersal within the study of social insects.
1
INTRODUCTION
Most Hymenopterans (ants, bees, wasps, and sawflies) are solitary: one reproductive female receives no help in rearing offspring from conspecifics (Wilson 1971). Cooperative behavior has evolved multiple times within the Hymenoptera (Rehan and Toth 2015), with highly cooperative taxa which produce sterile, female, workers. The evolution of sterility, also known as altruistic behavior, represents an evolutionary paradox (Wilson 1975) that is predicted to evolve predominantly between kin (Hamilton 1964, 1972). Kin selection theory can be tested empirically with species that nest solitarily and socially within the same population. The reproductive output of each strategy can be compared to each other with reference to the degree of relatedness between offspring and helpers. This has been carried out numerous times with evidence to suggest that kin selection theory is robust (Yagi and Hasegawa 2012) yet dependent upon environmental variation and dominance interactions among nest mates (Richards et al.
2005, Kapheim et al. 2015, Shell and Rehan 2018).
The degree of relatedness between individuals within a population can be measured by both the inbreeding coefficient (FIS) and coefficient of relatedness (r; reviewed in Wilson, 1975, ch. 4). FIS represents the probability that two alleles at particular loci within a population are identical by descent, while r represents the fraction of identical alleles across loci between two individuals. As FIS increases (within population genetic homogeneity), r (shared allelic diversity between individuals) increases as well. As subpopulations exchange genetic variation by migration, FIS and r decrease. However, due to behavioral traits such as territoriality and aggregative nesting, fine-scale, localized measures of r are often significantly greater than sub- population averages. Such events are typical within the Hymenoptera which are characterized by 2
a relatedness asymmetry between males and females. Sister r approximates 0.75 while brothers never share more than 50% of their genes with siblings (Trivers and Hare 1976). It is in great part because of this asymmetry that female worker behavior, in theory and observation, evolves significantly more often within Hymenopteran societies compared to males (Bartz 1982).
This thesis examines the degree of relatedness between populations and individuals of the
Australian small carpenter bee Ceratina (neoceratina) australensis (Perkins 1912). The main purpose of this thesis is to examine the factors that promote social behavior within this species.
Social behavior occurs at consistently low rates within populations of C. australensis (Rehan et al. 2010, Dew et al. 2018) and only limited evidence for the promotion of social behavior by kin selection has been found (Rehan et al. 2014). Recently, males were observed cohabiting with females in actively reproductive nests. Males usually only reside with females before and rarely during hibernation (Michener 1962, Rehan et al. 2010). This observation represents a potential exception to the rule of female-biased worker behavior within the Hymenoptera and is examined with reference to measures of FIS (chapter 1) and r (chapter 2).
Cooperative behavior
Cooperative behavior is defined as any behavior between individuals that provides some adaptive benefit for those involved (West et al. 2007a). From the prerequisites of mutual tolerance and communication (Lin and Michener 1972), social groups can arise that collectively care for offspring, guard resources, and differentiate tasks among members. Following the framework of Lin and Michener (1972), there are three general forms of social behavior from the standpoint of the individuals’ genotype: selfish behavior, mutualistic social behavior (sometimes 3
referred to as selfish), and altruistic social behavior (specifically, non-reciprocated behavior).
Selfish and mutualistic behaviors should increase individuals’ fitness by allowing individuals to rear more of their own progeny, or higher quality offspring, and are thus under direct evolutionary selection. Mutual, reciprocated behaviors might be selfish if by cooperating, or helping a conspecific, the actor accrues some benefit or ensures they will be ‘helped’ later-on.
Non-reciprocated, altruistic, cooperative behaviors, acts indirectly on the altruist’s genes by increasing the number or quality of offspring sharing a similar genetic makeup to the actor
(Hamilton 1964).
For instance, male pied kingfishers (Ceryle rudis L) who cannot find a mate in their first year will help at the nest. Two types of helpers in this situation can be either mutualistic or altruistic. Mutualistic helpers are those who are not related to nest mates and help forage for offspring significantly less than the breeder. Helpers are related to the breeder and work as hard as the breeder to forage. The odds of mating in the second year are significantly greater for mutualists, as is the probability of survival into the second year, compared to altruists. The altruist however, compensates for this apparent cost by increasing the number of related offspring that are produced overall. Though the altruist may not directly pass on its genes in the first or second year, the indirect benefits of helping a breeder with shared genetic material compensates for this loss. However, the relative benefit of each behavior is dependent on mating opportunities for the males in their first year; if there are sufficient opportunities, the benefit of helping at the nest decreases. As mate availability is determined by food availability in the environment, the benefits of cooperative behavior are thus dependent on both environmental 4
constraints on direct reproduction and the degree of relatedness among group members (Reyer
1984).
As can be seen by the example of the kingfisher, where altruists have a higher mortality in their first year, cooperative behavior can be costly. Even when helping does not correlate with increases in mortality and reduction in fecundity (Heinsohn and Legge 1999), helping can be energetically expensive. Helping behavior in cichlid fish for instance, correlates with reduced growth rate due to helpers’ subordinate position in cichlid social hierarchy and being on the receiving end of aggressive interactions (Taborsky 1984). Similarly group living can limit the amount of food available for all members and can end up limiting group size as happens in carnivorous megafauna (Baird and Dill 1995). Increases in group size can also lead to competition for reproduction (Hogendoorn and Velthuis 1993, Leadbeater et al. 2011), elevate signaling to parasites/predators (Lin and Michener 1972), increased transmission of pathogens
(Hughes et al. 2002), and higher risk of infanticide or oophagy (Johnson et al. 2002). However, increases in group size may also lead to increased prey capture (Cangialosi 1990, Stevens et al.
2007, West et al. 2007b) and the number of brood produced (Taborsky, 1984) which indirectly benefits helpers. The presence of guards can also protect group members from predators (Lin,
1964-65; Lin and Michener, 1972; Wcislo and Cane, 1996; Zammit et al, 2008). Even if a behavior is at first costly, as in the case of the helper kingfishers, later payoffs or indirect fitness benefits can offset the initial cost of cooperation. If environmental conditions restrain the ability of actors to directly reproduce, incurring these short-term costs would allow for long term benefits and, over many generations, helper phenotypes could become fixed into populations under natural selective pressure. 5
Eusociality
A rare, yet highly successful form of cooperative behavior is called eusociality.
Eusociality is defined by the presence of alloparental brood care, generational overlap, and reproductive division of labor entailing a sterile worker caste (Wilson, 1971). Eusociality has evolved primarily in the Hymenoptera though it has appeared in other lineages within the insects
(aphids and termites) and outside insects (naked mole rats and Synalpheus shrimp; Tofts and
Franks 1992, Subramoniam 2017). Hymenopteran worker castes probably date back to the
Cretaceous (ants) or Eocene (bees; Lin and Michener, 1972), or potentially earlier (Engel 2001).
According to the cost-benefit paradigm mentioned above, helper phenotypes become fixed if the costs of cooperation (i.e. extra energy expenditure, reduced mating opportunities) are outweighed by the benefits (i.e. ability to wait out environmental reduction in resources, indirect benefits of helping related reproductives). However, eusocial societies contain an ‘altruistic’, sterile caste which never directly reproduces, and offer no direct comparison to solitary phenotypes to assess the relative costs and benefits of altruistic behavior. How a sterile life history can provide enough benefit to an organism to become a fixed phenotype is a long standing evolutionary paradox
(Wilson, 1971).
The order Hymenoptera exhibit a wide range of sociality, from nests containing two or more females which share in reproduction, to advanced eusocial societies with sterile castes. The ants (Formicidae) contain around 16,000 species, all of which live in advanced eusocial societies excepting some parasitic forms (Wilson, 1971). Wasps contain around 1000 social species whose behaviors range from primitive behavioral differentiation among nest mates to clear queen- worker dimorphism (Ross and Carpenter 1991; Wilson, 1971). Nested within a subset of social 6
wasps are the bees (Apoidea: Anthophila), which number around 20,000 species. Eusociality has arisen multiple times within the bees, and today around 1,200 (6%) bee species live in eusocial societies (Danforth 2007, Kocher and Paxton 2014). It has long been thought that the ecological successes of eusocial species indicate the inherent benefit of containing highly specialized castes for increased foraging efficiency and nest defense (Wilson, 1971). However, eusociality has arisen and been lost multiple times within the bees (Danforth 2007) indicating that the benefit of highly social societies is dependent upon environmental conditions.
Bees that do not meet all three criteria for advanced eusociality fall somewhere along the
‘social spectrum’ or ‘social ladder’ (Rehan and Toth 2015). The social ladder is a useful concept for organizing the many life histories of bee societies that have been previously defined by
Michener (1974). Most bees live solitary lives. Females independently found nests and provision eggs with enough pollen and nectar to last the larvae until pupation. She provides no parental care for larvae. If a female bee which nests solitarily provides extended brood care, her nest is considered subsocial. If multiple females nest in close proximity, they can form aggregate nest sites and if multiple females inhabit the same nest, they are colonial and incipiently social. If all females in a colony reproduce equally, they are quasisocial (Michener, 1974). If females of the same generation reproduce asymmetrically with one or more females contributing more eggs while other females help forage and guard the nest, the females are semi-social nesters. Separate from these incipiently social nests are eusocial nests that can be either primitive or advanced, the difference being whether castes are morphologically distinct (Michener, 1974). It is presumed that the advanced eusocial ants and bee lineages (Apis and Meliponini) have passed an evolutionary point of no return and are not capable of reversions to solitary life (Wilson, 1971). 7
After altruistic worker behavior becomes fixed within a population or species, the morphological dimorphism between queens and workers should prevent worker reproduction and thus preclude reversions to solitary life (Wilson, 1971). There have however been multiple reversions from primitively eusocial forms, especially within the sweat bees (Halictidae) where there have been
12 such reversions (Danforth 2002). In addition, some bees can live in social colonies facultatively and these bees offer direct cost-benefit comparisons between social and solitary forms while controlling for phylogeny and ecological constraints (Yagi and Hasegawa 2012,
Rehan et al. 2014, Kapheim et al. 2015, Shell and Rehan 2018).
As in the case of the kingfisher, cooperative group formation involves the limited dispersal of a helper phenotype. Limited dispersal from natal nesting areas can lead to fine scale genetic structure that may lead to increased interactions among related individuals (Hamilton
1964). The mechanisms of dispersal are, however, complex (Matthysen 2012) and involve ecological factors such as resource availability and climate (Johnson et al. 2002, Kocher et al.
2014), an organisms’ natural history and phylogenetic context (West-Eberhard 1987, Ross and
Carpenter 1991), and genetic and physiological constraints on dispersal ability (Sokolowski
2001, Niitepõld et al. 2009) coupled with behavioral interactions among nestmates (Kapheim et al. 2011, Shell and Rehan 2018). Recent work on multiple genomes of bees from across the social spectrum provide further evidence that there are probably as many paths to sociality as there are social species (Kapheim et al. 2015); below I discuss a few proposed mechanisms relevant to this thesis.
8
Mechanisms of Eusocial Evolution i. Kin selection, haplodiploidy, and lifetime monogamy
Hamilton (1964) posited that the indirect benefits of altruistic traits increase with increased relatedness (r); individuals will be more likely to forgo reproduction if they are more related to produced offspring. Hamilton’s rule, as it is known, removes the paradox of altruism by accounting for indirect fitness benefits. Kin selection can further be thought of narrowly, by acting upon interactions between related individuals (Hamilton’s rule), or broadly, by acting on a shared ‘gene of interest’ (green-beard effect; West et al. 2007b). The green-beard effect requires a single gene, or many tightly linked genes inherited together, plus the ability to recognize this trait. If conspecifics give preferential treatment to individuals with the gene, or genes, of interest- a hypothetical ‘green-beard’- then cooperative behavior could evolve in unrelated groups (West et al. 2007b, Nonacs 2011). Whether defined broadly or narrowly, kin selection can be thought of as natural selection acting on social interactions (West et al. 2007b).
Kin selection is particularly relevant for Hymenoptera as sex in this order is determined via haplodiploidy. Haplodiploid sex determination entails that fertilized eggs are female while unfertilized eggs are male. This means that females are diploid and contain a set of chromosomes from both parents while males inherit one set of chromosomes from their mother and are thus haploid. Hamilton reasoned that daughters in this scenario would then share 75% of their genes on average, while sharing only 50% with their own offspring. Thus, by helping their mothers raise their own sisters, daughters indirectly increase their own fitness.
Haplodiploidy is further disposed to kin selection by male haploidy. Genomes contain many recessive alleles. In diploid genomes, these alleles can accumulate in populations with low 9
rates of dispersal and will be less likely to spread throughout populations with high levels of dispersal (Lin and Michener 1972). Diploid genomes are subject to the effects of inbreeding depression and simultaneously faced with the inability to spread recessive beneficial alleles (Lin and Michener 1972, Bateson 1983). Haploid males shield populations from the deleterious effects of inbreeding as dominant deleterious recessive alleles will readily be removed from the population. Similarly, dominant beneficial alleles will more readily spread throughout populations (Lin and Michener, 1972). So highly related groups containing sterile workers can evolve and be maintained over many generations.
An important assumption of haplodiploidy selection is that only one reproductive female, who has mated with only one male, is present in any nest at a time (Lin and Michener 1972,
West-Eberhard 1987, Hughes et al. 2008). An increase in the mating frequency from one to two mates decreases the average relatedness of siblings from 0.75 to 0.5 (equivalent to a diploid mating system) and relatedness among siblings decreases with each successive mating. Thus, multiple mating shifts the emphasis of Hamilton’s inequality from the relatedness coefficient to the relative costs and benefits of social phenotypes (Lin and Michener 1972, Boomsma 2007).
Honeybees (Apis mellifera) have been shown to mate an average of 17.25 times (Page and
Metcalf 1982) and doing increases the genetic diversity and immunity to pathogens of the colony. In line with kin selection, Hughes et al. (2008) provided phylogenetic evidence for ancestral monogamy within the Hymenoptera and found that monogamous mating systems were more prevalent in primitively, incipiently, and subsocial species compared to eusocial species
(Hughes et al. 2008). More so, diploid eusocial organisms such as the termites (Isoptera) and
Synalpheus snapping shrimp most likely arose from pair-bonding monogamous relationships 10
(Boomsma 2007, Hughes et al. 2008, Chak et al. 2017, Subramoniam 2017). Monogamy ensures that the average relatedness among siblings (brothers and sisters) never falls below 50%, regardless of chromosome number, and tips the scale of Hamilton’s inequality away from the impacts of relatedness and towards the degree of benefit conferred by the cooperative arrangement (Boomsma 2007). The monogamy hypothesis corroborates Wilson’s (1971)
‘evolutionary point of no return’: after the fixation of a sterile phenotype, multiple mating
(polyandry) could evolve and increase the fitness of the colony via increased genetic diversity and immunity (Page and Metcalf 1982).
ii. Parasite Pressure
One of the most primitive forms of helping behavior, and one of the earliest explanations for limited dispersal in animals, is defensive behavior of the nest (Wilson 1971, Lin and
Michener 1972, Michener 1974, Michener and Brothers 1974). Animals which store food are highly susceptible to theft (Lin and Michener 1972, Wcislo and Cane 1996) and bees store food in cells which are eaten by larvae upon hatching. Consequently, brood parasites of bees can infect 100% of cells in a nest (Lin and Michener 1972). It has been hypothesized that the nesting strategy employed by bees can differentially affect parasitism rates (Michener 1974). While parasites of stick-nesting species navigate through a three-dimensional interface, parasites of soil-nesting species have one less dimension to navigate through to find nests. Furthermore, soil- nesting can lead to aggregate nesting, which may increase possible detection by parasites due to the presence of more hosts in a single area. While intriguing, this hypothesis does not appear to be supported by empirical evidence (Wcislo 1996, Wcislo and Cane 1996) and pressure from 11
parasites greatly impacts fitness (Spear et al. 2016) and reproductive potential (Smith et al. 2008) of stem nesting bees. However, defense against parasitism can lead to the evolution of cohabitation where multiple breeders live together (Lin and Michener 1972), as the presence of a guard at the nest greatly reduces parasite induced mortality across the bees (Sakagami and Maeta
1977, Wcislo and Cane 1996, Rehan et al. 2014).
iii. Mutually beneficial selection and Ecological Constraints
Kin selection, when viewed through the lens of inclusive fitness, appears to benefit both actors, indicating mutualism as opposed to altruism. Kin selection can almost be viewed as a form of sequential reciprocal altruism or byproduct reciprocity (West et al. 2007a, 2007b).
Byproduct reciprocity occurs when a trait positively impacts the fitness of both players involved
(West et al., 2007b). For example, the helping behavior of a subordinate worker could increase the fitness of the queen, which, due to the workers’ high relatedness to queen’s offspring, would also increase her own fitness. If cooperation increases the fitness of all individuals in a group, compared to individuals in a separate group, then traits that increase cooperation should be selected for.
The benefits of cooperative behavior may increase with the number of cooperative individuals in a group. For instance, in the Japanese small carpenter bee Ceratina japonica, reproductive efficiency increases with number of females in multi-female nests (Sakagami and
Maeta 1984) and the average number of cells increased by 6 (~3.7%) per individual in a study on the sweat bee Lasioglossum (Dialictus) lineatulus (Eickwort 1986). Entering into a reproductive hierarchy at the expense of nest founding can be offset as well if helpers have potential 12
opportunities to reproduce at some point. If the primary breeder in a social nest characterized by reproductive skew were to die, the nest would be inherited by secondary, disadvantaged helpers
(Leadbeater et al. 2011). Even if the potential to inherit a nest is low, the potential fitness benefits may be high enough to provide enough incentive for helping behavior. For instance, subordinate primitively eusocial paper wasps, Polistes dominulus, have a low probability of nest inheritance, 13% (Leadbeater et al. 2011). This low potential is still significant enough to account for inclusive fitness benefits accrued by remaining on the nest. Interestingly, this effect is apparent even among unrelated individuals who ‘drift’ into the nest. More so, P. dominulus subordinate females do have increased incentive in the absence of nest inheritance, as they will lay a small number of eggs in the presence of the dominant.
In summary, selection should act to increase philopatry and group aggregation. Bee nest aggregations can lead to alloparental care and in turn these aggregations will reap benefits of increased group size. Some of these benefits include access to nesting sites as subordinates may have difficulties in nest founding, low survivorship of new nests due to the lack of a second individual to guard, there may be potential to lay haploid males, or to inherit the nest altogether
(Michener and Brothers 1974). Benefits should be greatest for the sex most likely to remain close to the nest (West et al. 2007a), i.e. females in Hymenoptera. Subsequently, if males disperse and mate more than once, then female worker genes can spread throughout the population (Lin and
Lavine 2018).
Limited Dispersal and Alternating Viscosity 13
Hamilton (1964) referred to selection that promotes interactions among related individuals as population viscosity; e.g. limited dispersal increases viscosity. Taylor (1992) argued that while viscosity may enhance the spread of altruistic alleles by promoting cooperation among kin, viscosity may also oppose cooperation by increasing interspecific competition. For instance, in the bacteria Pseudomona aeruginosa, production of iron-scavenging siderophore molecules can lead to cooperation among siderophore producing bacteria. Cheaters that do not produce siderophores proliferate through experimental populations when relatedness among individuals is low and competition is high such that competition for resources precludes cooperation (West et al., 2007a). Under this scenario, cooperative behavior should be selected against in most cases, especially as limited dispersal should also provide a genetically homogenous population structure that can be affected by the deleterious effects of inbreeding
(Hamilton 1964, Harpur et al. 2013).
However, natural populations are composed of individuals that migrate at different stages of development (Cahan et al. 2002). Alternating viscosity characterizes a population structure containing two stages- a viscous stage where groups of altruists and non-altruists promote differential productivities and a dispersal stage were altruistic alleles spread throughout populations (Wilson et al. 1992). Taylor (1992) demonstrated using mathematical modeling that the benefit of altruism will equal the costs in a viscous population and will therefore not be favored by limited dispersal among breeding females. However, he goes on to explain that selection for altruism will be heavily influenced by timing, and conditions prior to dispersal are favorable for altruism. Similarly, Wilson et al. (1992) simulated purely viscous populations and found that altruistic alleles only rarely provide net benefit to individuals and are thus prevented 14
from spreading throughout the population. There must then be a mechanism for both the accumulation and spread of altruistic alleles. As dispersal increases, viscosity decreases so altruism can only evolve under situations of alternating viscosity. If resources are limiting, groups of breeding females may nest together in the absence of better choices (early spring in temperate climates) and disperse later in the year when resources are more abundant (Michener and Brothers 1974, West-Eberhard 1987). Again, Hymenoptera seem to be primed for caste evolution as, given the right environmental conditions, cohabitating females will reap the benefits of kin selection while dispersing males will spread altruistic genes.
However, West-Eberhard (1987) noted that this argument might be biased by the predominance of scientists working in temperate regions. Seasonality may have selected for large, well-nourished queens who can survive winters and seasonally malnourished daughters
(first brood, seasonally disadvantaged) who would be at a disadvantage were they to found nests on their own. For instance, in the North American sweat bee Lasioglossum zephyrum, summer females weighed less then autumn females, which resulted in differences in reproductive potential (Michener and Brothers 1974). Thus, size differences within reproductive hierarchies need not be induced strictly by manipulation of pollen provisions. Cooler temperatures would also keep colonies small, allowing for easier policing as occurs in primitively eusocial wasps
(West-Eberhard 1987) and bumble bees (Amsalem et al. 2015). Bumble bees (Bombus spp.) are a prime example of the academic-by-latitude bias. While most Bombus typically occur in temperate-arctic climates with an annual life cycle, tropical bumble bees are perennial and switch from having 1 reproductive individual (monogyny) to multiple reproductives (polygyny) throughout the season (Michener and Amir 1977, Gonzalez et al. 2004). As Bombus spp. likely 15
originated somewhere in the cooler mountainous regions of east Asia and subsequently migrated into tropical climates (Hines 2008), Bombus polygyny is most likely a derived trait that evolved with increased season length. As with some temperate Halictid sweat bees such as Lasioglossum malachurum (Richards et al. 2005, Soro et al. 2009), temperate Bombus species produce males at the end of the reproductive season (Amsalem et al. 2015). First brood females emerge under times of resource scarcity and are easily coerced into limited dispersal and helping at the nest; these altruistic genes are then dispersed by males who have little genetic similarity with their siblings and are thus more likely to disperse and seek direct reproductive opportunities.
Furthermore, the inclination for sexually receptive females to mate should be selected against if male and female production is not synchronized (Seger 1983, Ross and Carpenter 1991), thus providing more seasonal disadvantage for some first brood females.
Mating Strategy and Male Behavior
An increase in cooperative behavior is expected to parallel a decrease in sexually complex behavior. This is because sexual selection creates conflict over reproduction amongst kin while cooperation minimizes conflict (Wilson 1975, Boomsma 2009). Males of polyandrous
(multiply mated) wasp and bee species display a tendency to seek out females away from the nest, stake out territory, or form swarms that attract females. This strategy selects for intrasexual competition with certain male phenotypes better able to defend territories or benefit from swarms
(Alcock et al. 1978). Monogamous species take the opposite strategy and tend to seek out virgin females. In such species, males emerge first and sexual selection is reduced. Males may mate multiple times but females store the sperm from their first copulation for life (Boomsma et al. 16
2005). Longevity of stored sperm infers partner-commitment for life even if males mate more than once and sexual selection is reserved for post-copulatory sperm competition (Boomsma et al. 2005). It is interesting that every eusocial organism studied to date has passed through a monogamous ancestor, including diploid species (Hughes et al. 2008, Boomsma 2009, Chak et al. 2017). One of the major flaws of haplo-diploid theory is that overall sibling relatedness is equal to 0.50 (daughter r=0.75, brother-sister r=0.25), and thus is no different from a diploid mating system. Monogamy however, shifts the emphasis of kin selection away from relatedness and towards the benefits of cooperative behavior so long as relatedness among kin does not drop below 0.50 as it would with polyandry (Boomsma 2009).
Mating strategies of males also depend on patterns of female dispersal. Males will tend to search at nest sites if females live in aggregations, while males will patrol and establish territories if females are dispersed at greater distances (Alcock et al. 1978). Thus female aggregations could select against male sexual traits and increase the benefits of cooperative breeding. Most annual, non-parasitoid aculeate wasps mate before hibernation, as do highly social honey bees (Apis spp.) and bumble bees (Bombus spp.) in the family Apidae (Wilson
1975, Michener 2007). Solitary bees on the other hand are thought to mate in spring after hibernation (Eickwort and Ginsberg 1980). Interestingly, the subsocial Ceratina flavipes can supposedly mate before and after hibernation (Kidokoro et al. 2003, 2006). Microsatellite loci were used to estimate inbreeding coefficients of females and sperm taken from their spermathecae before, during, and after hibernation. Inbreeding was higher before and during hibernation then it was post-dispersal, suggesting that mating occurs within natal nests prior to 17
hibernation and after hibernation with varying levels of population genetic effects (Kidokoro et al. 2006).
Seger (1983) claims that eusociality will most likely evolve in partially bivoltine species that undergo diapause with mated females. A female-biased first brood would awaken when conditions would favor limited dispersal and they could either found their own nests, help their mothers, or wait out the season and go into diapause (Seger 1983, Yanega 1992, Yagi and
Hasegawa 2012). Mated females would have a jump start on reproduction at the beginning of the foraging season.
While promiscuity is common within the animal kingdom- selection pressures individuals to have as many mating attempts as possible- social insects are constrained by ‘the principle of allocation’ (Wilson 1975). In other words, species which are not limited by food or predation pressures can allocate time and energy to elaborate sexual displays. Social insects are food limited and spend most of their lives engaged in foraging or nest maintenance and consequently are under greater social, kin, selection compared to sexual selection (Wilson 1975).
Though rare, Hymenoptera paternal care has been observed in some cases. Instances of hymenopteran paternal care documented in the literature are either experimentally induced and/or infrequent (Cameron, 1985; 1986; Sen and Gadagkar, 2006), or difficult to distinguish from sexually selected behavior (Lucas and Field, 2011; Brockman, 1992). For instance, nest ‘defense’ by males has been observed in the social Apoid wasp Microstigmus nigropthalmus, though males were only rarely observed to ward off intruders and only did so when females were absent from the nest. Further, M. nigropthalmus males will remain in abandoned nests and so ‘defense’ in this species may be a passive byproduct of male presence in nests as they wait for mating opportunities 18
(Lucas and Field 2011). The solitary wasps Tachytes distinctus and Trypoxylon spp. patrol and defend nest sites from intruders. While the former defends non-kin associated nests, the latter only defends the nests containing its own young (Lin and Michener 1972). Males of the solitary Sphecid wasp Oxybelus subulatus actively patrol and defend female nests from other males and passively guard against brood parasitism by remaining within the nest entrance (Peckham 1977).
Interestingly though, males can also encourage parasitism in some cases: females will carry prey, impaled on their ovipositor, back to their nests where they can be met by male O. subulatus. During copulation, the prey item can be parasitized by the Miltogrammine fly Senotainia trilineata, though
S. trilineata can parastize brood regardless of a copulatory event (Peckham 1977).
Ceratina (Neoceratina) australensis
Sociality evolved four times in the bees: twice in the Halictidae (Gibbs et al., 2012) and twice in the Apidae (Cardinal and Danforth, 2012; Rehan et al., 2012). Within the Apidae, sociality occurs in the subfamily Apinae (Apis, Meliponini, Bombus; Cardinal and Danforth,
2012), and the subfamily Xylocopinae (tribes Xylocopini, Ceratinini, Allodapini, Manueliini;
Rehan et al., 2012). Within the Xylocopinae there have been many reversions to solitary and subsocial life. While the Allodapani are primarily social (Schwarz et al., 2011), the Ceratinini are primarily solitary and subsocial (Michener, 1985). Subsocial bees are those that contain solitary foundresses exhibiting extended maternal care. Because interactions with nest mates is a perquisite for social living (Michener, 1985), subsociality represents a novel stepping stone towards eventual social nesting. 19
Ceratinini are represented by the single genus Ceratina and represent around 200 species on all continents but Antarctica (Rehan et al., 2013). Ceratina are commonly known as small carpenter bees and display a wide variety of social behavior (Michener, 1974, 1985). In contrast to the large carpenter bees, Xylocopini, which can use mandibular strength to bore into wood,
Ceratina bees nest in the pith of dead stems. In contrast to the Allodapine bees that do not create partitions between each cell, Ceratina foundresses destroy and rebuild cell partitions to rear brood in different areas of the nest (Rehan and Richards, 2010). Ceratina exhibit nest fidelity their entire brood in a single stem; mothers survive until at least the end of the flight season, and inhabit the nest with her offspring. In temperate climates, she forages for them before the onset of winter (Sakagami and Maeta, 1977; Rehan et al., 2010). Most species in temperate regions have a univoltine life cycle while those in the tropics tend to have bi- or multivoltine life cycles
(Michener, 1985).
Multifemale nests and social castes exist in Ceratina, though they are usually not highly specialized (Michener, 1985). Multi-female nests have been recorded in C. okinawana where
12.6% of reused nests contained 2 females, C. japonica where 20% of nests contain 2-4 females
(Sakagami and Maeta, 1977, 1984; Michener, 1985), and C. australensis where around 12-15% of nests contain 2 females (Rehan et al, 2010, 2011, 2014). Multi-female nests have also been recorded in C. iwatai, C. (Ceratina) megastigmata, C. (Ceratina) braunsiana, C. laeta and Javan
C. (Ceratina) spp. (Michener, 1985). Under confined laboratory conditions, Chandler (1975) showed that C. calcarata lived in eusocial nests. Similarly, multifemale nests have been induced in Japanese Ceratina (Sakagami and Maeta, 1977, 1984, 1989). The ability of certain Ceratina to socially nest under certain conditions, even when social nesting is not a normal behavior 20
observed in natural environments, emphasizes that Ceratina are an appropriate species for studying how environmental conditions can facilitate sociality.
The social hierarchy of natural and induced multifemale nests vary. Michener (1962) first noted the presence of two adult females in a nest of C. australensis, reporting that both had developed ovaries. More recent work by Rehan et al. (2010, 2011, 2014, 2015) has shown that the two bees are full sisters and involved in a semisocial relationship characterized by reproductive division of labor (Rehan et al., 2014). The social secondary in this relationship does not leave the nest to forage, but also does not have developed ovaries so is not responsible for any direct reproduction; there is no size dimorphism between females (Rehan et al., 2010). In contrast, larger C. japonica females act as a guard while the smaller female forages; eggs are laid by either guard (queen) or by both females in induced multifemale associations (Sakagami and
Maeta, 1984).
Social nests are more likely to occur in reused nests. While 20% of all C. japonica nests contain more than one female, 31% of reused nests contained multifemale nests (Sakagami and
Maeta, 1989; Michener, 1985). Over 81% of these multifemale nests contained bees of the same generation (parasocial) while the rest contained a first-year female produced that spring and a second season female born in the previous summer (eosocial). Interestingly, half of all nests contained quasisocial interactions while in the other half there was an observable reproductive division of labor (Michener, 1985). Social nests of C. australensis can be found in ~98% of reused nests (Rehan et al., 2010, 2011). C. australensis is bivoltine and so in this semisocial arrangement, the mother presumably died after her offspring emerged. 21
Ceratina australensis is the sole species of the genus in Australia (Michener, 1962) and inhabits a variety of climates, from hot, dry, and inland to warm, moist, and coastal; thus C. australensis faces variable habitat and floral resources across its range (Dew et al., 2016). As mentioned, about 15% of nests contain two females, one of which acts a guard, does not leave the nest and does not have developed ovaries. There is no apparent nest-site limitation and females are not limited by insufficient foraging days as there is a low number (3-10) of foraging days required to complete each brood (Rehan et al., 2011). There are no differences in clutch size between social and solitary nests (Rehan et al., 2010). Inclusive fitness calculations predict that social reproductives have higher calculated fitness values (3.98) than solitary females (3.51); social non-reproductives have the lowest calculated fitness value (0.73; Rehan et al. 2014). The sibling relationship between the two bees precludes maternal manipulation of larval food.
Although per capita brood production in social nests was lower compared to solitary nests due to the presence of two females, brood survival to adulthood was higher in social nests indicating decreased mortality (Rehan et al., 2011, 2014). Over the course of three reproductive periods, around 4% of solitary nests failed due to parasitism and years of delayed brood development in cooler/rainier years coincided with the highest proportion of parasitism and lowest brood survival (Rehan et al., 2011); 87% of parasitized C. australensis cells are due to chalcid wasps in the genus Eurytoma. Though there was no difference in the number of brood cells parasitized between social and solitary nests during this same study, parasite attack did result in decrease larval survival in solitary nests (Rehan et al., 2011). This evidence supports the hypothesis that protection from parasite-induced mortality selects for natal philopatry in the secondary bee. The non-reproductive phenotype might be maintained if dispersal between populations carries a 22
genetic predisposition for natal philopatry that is advantageous for social nests when parasite pressure is high (Rehan et al., 2011, 2014).
A recent study (Dew et al., 2016) confirmed the presence of three distinct populations of
C. australensis in Queensland (QLD), Victoria (VIC), and South Australia (SA). Populations differed by only a single fixed base pair. This evidence indicates limited gene flow between populations. The most distinct population is South Australia (the farthest south west locality) and is comprised of a single haplotype. This is presumed to be due either to an unlikely bottleneck event, an insufficient amount of maternal gene flow to promote haplotype diversity, or the recent establishment of this population (Dew et al., 2016).
There have been at least four reversions from sociality to solitary life within the
Xylocopinae (Rehan et al., 2012) and the evidence to date that there are no overt fitness benefits for non-reproductive bees suggest sociality in this species may not be adaptive (Rehan et al.,
2014). However, an additional incentive for not dispersing may be the possibility for nest inheritance. Around 17% of nests across 4 years were inherited by the non-reproductive. These nests showed no difference in overall brood production (Rehan et al., 2014). Because the non- reproductive does not forage, she does not expose herself to predation outside of the nest. In the case that the reproductive dies, the non-reproductive can inherit the nest. However, this observed
17% nest inheritance rate was incorporated into fitness calculations and is unable to explain the social non-reproductive phenotype (Rehan et al., 2014). Future studies will attempt to explain the maintenance of social nesting in this species, which has persisted for over 100 generations
(Michener, 1962; Rehan et al., 2014), by testing the prediction that parasite-induced natal 23
philopatry has allowed for the establishment of social groups in C. austaralensis (Rehan et al.,
2014).
Thesis Aims
The main goal of this thesis is structured around understanding the presence of male bees within nests of C. australensis discovered primarily in SA in 2016. In chapter 1, the description of eight microsatellite markers were developed specifically for C. australensis are provided.
Microsatellite loci are neutral, polymorphic genetic markers frequently used to estimate relatedness between populations and individuals of the same species (Selkoe and Toonen 2006).
Chapter 1 deals specifically with the population genetics of C. australensis across its range and provides the framework for chapter 2, which focuses on C. australensis sociobiology.
Molecular markers are frequently used to reveal patterns of allelic diversity between individuals or populations of the same species. Comparisons between different markers targeting different loci can also shed light on different evolutionary and migratory histories of different phenotypes within populations. For instance as mitochondrial haplotypes reflect patterns of female lineage sorting and dispersal, while microsatellite loci contain information related to both male and female allelic diversity. Comparisons between mitochondrial DNA (mtDNA) and nuclear
DNA (nucDNA) can provide insights regarding ancestry of maternal and paternal lineages, and potential population-structuring via sex-biased dispersal (Ross and Shoemaker 1997, Jorde et al.
1998, Goudet et al. 2002, Ambrose et al. 2014, Tamang et al. 2018). In chapter 1, the development of eight microsatellites designed for C. australensis is described. Fifty-seven nests from across the
C. australensis range were screened across these 8 loci. Patterns of allelic diversity detected using 24
microsatellite loci are compared to patterns of mitochondrial diversity elucidated by Dew et al.
(2016). Dispersal patterns are then related to the ecology of C. australensis.
Dispersal is related to cooperative behavior by altering the probabilities of interactions among differently related individuals (Cahan et al. 2002). In chapter 2, relatedness between individuals within solitary, social, and bisex nests are compared. Solitary nests contain a single reproductively active female; social nests contain 2-4 females, one of whom is reproductively active. Bisex nests contain 1-3 females and a male. Males were primarily found within SA, the most genetically homogenous population from chapter 1, which suggests the possibility of brother- sister matings. Such mating have been suggested to occur in pre-dispersal assemblages of C. flavipes (Kidokoro et al. 2006). Males do not likely survive past the reproductive season and mating occurs twice at the end of each brood period (Rehan et al. 2010). It is possible that males were either seeking reproductive opportunity with kin (selfish behavior), providing benefits to the nest by guarding (altruistic behavior), or were passively guarding the nest while they awaited reproductive opportunities within the nest or elsewhere (mutualistic behavior).
25
Chapter I: Phylogeography and population genetics of the Australian small carpenter
bee, Ceratina australensis
ABSTRACT
The Australian small carpenter bee, Ceratina australensis, is the sole member of the small carpenter bees, genus Ceratina, in Australia. C. australensis is found throughout eastern
Australia in dead broken stems of weedy plant species where it makes its nests. Here \ eight microsatellite loci were developed and used to characterize the genetic structure of three populations across three distinct ecoregions that are connected by the Murray-Darling River basin. Fifty-seven female bees were genotyped and significant and geographically consistent variation in allelic diversity and heterozygosity was found between populations. Through comparisons with the results of mitochondrial DNA screening from a previous study the possibilities of male-biased dispersal and limited inter-population migration are inferred. Based on available distribution data, C. australensis expansion into arid regions appears to follow the
Murray-Darling River basin and associated waterways. This basin has undergone severe anthropogenic disturbance since European settlement of Australia with large scale changes to native vegetation communities. While it is unknown how these changes have affected local insect communities, C. australensis does not rely on a single plant species for nesting habitat.
Evidence is provided for the hypothesis that expansion of C. australensis into Australia may have been aided by the introduction of non-native pithy stemmed plants. 26
INTRODUCTION
Species distributions are highly dependent on the relative fitness of individuals under different environmental contexts (Hoffman & Blows, 1994). As a small founding population attempts to expand its range, it is likely to face novel environmental challenges and reduced fitness. Repeated cycles of attempted founding events and subsequent extirpation can leave evidence of genetic bottlenecks in populations at range edges (Eckert et al., 2008; Cortázar-
Chinarro et al., 2017). Recent or particularly severe bottlenecks are expected to decrease genetic diversity overall: removing rare alleles from a population, decreasing the effective population size (Ne), and increasing the relatedness between individuals in successive generations of the bottlenecked population (Cornuet & Luikart, 1996). If immigration into a bottlenecked population is low the effects of genetic drift will be amplified, leading to either the deleterious effects of drift and possible extirpation, or genetic segregation from source populations and evolution.
As has been observed in many invasive species, some taxa are able to overcome the deleterious effects of inbreeding despite initially small effective population sizes (Tsutsui &
Suarez, 2003; Arca et al., 2015). Such species may avoid inbreeding through behavioral adaptions, such as kin recognition (Kukuk & Decelles, 1986; Jongepier & Foitzik, 2015) or sex- biased dispersal (Baines et al., 2017; Pusey, 1987), either of which limits the probability of mating with relatives. Those organisms that do not strictly conform to patterns of Mendelian inheritance may be particularly well-equipped to reproduce successfully under limited outbreeding. Haplodiploid organisms, for instance, may be resistant to the effects of inbreeding due to the increased selective pressures on the haploid sex (Lin & Michener, 1972). 27
Studies across haplodiploid Hymenoptera have repeatedly shown that certain members of this group demonstrate a strong resilience to negative founder effects otherwise expected during iterative range expansions (Schmid-Hempel et al., 2007; Arca et al., 2015; López-Uribe et al.,
2016; Soro et al., 2017). However, Hymenoptera may be susceptible to the increased deleterious effects of reduced allelic diversity in small populations due to the single locus complementary sex determination system (SL-CSD; Asplen et al., 2009). SL-CSD is expected to produce sterile diploid males under increased inbreeding and homozygosity, greatly increasing risk of extinction
(Zayed & Packer, 2005). Male-mediated sex biased dispersal can prevent inbreeding and has been shown to structure populations of species in which females nest philopatrically (Boomsma et al., 2005, Ulrich et al., 2009, López-Uribe et al., 2014, 2015).
Ceratina small carpenter bees have a cosmopolitan distribution and are represented by about 200 species of generalist pollinators (Michener, 2007, Rehan & Schwarz, 2015). Although speciose on most continents, the genus is represented by a single species, C. australensis
(Perkins), in Australia. This species inhabits a wide variety of climates across its range, including sub-tropical and temperate forests, persistently dry grasslands, and temperate coastal dunes (Dew et al., 2016). C. australensis is largely subsocial, most nests contain a single female which provides extended maternal care to her brood (Michener, 1974; Rehan et al., 2010). However, this species also demonstrates a facultative capacity for social nesting: a low frequency of nests within a given population (3-20%) will contain two females which operate under a reproductive division of labor (Rehan et al., 2010, 2011; Dew et al., 2018). Social nesting in this species is thought to be reinforced by the limited dispersal of females from natal nests (Rehan et al., 2014).
Dispersal patterns have been similarly implicated in structuring social systems in halictid sweat 28
bees by increasing the densities of philopatric females and varying levels of drifting between nests (Kukuk & Decelles, 1986; Yanega, 1990; Ulrich et al., 2009; Johnstone et al., 2012;
Friedel et al., 2017). As such, assessing the phylogeography and population genetics of C. australensis can improve our understanding of both the historical biogeography and sociobiology of facultatively social insects.
A previous assessment of mitochondrial CO1 haplotype variation across the C. australensis range supported an ancestral dispersal out of Asia, coinciding with the last major glaciation event around 18 kya, followed by expansion south and west (Dew et al., 2016). The most southern population sampled during that study was represented by a single haplotype, which indicated either a recent genetic bottleneck, or a founding event followed by little to no additional immigration. Comparisons between mitochondrial DNA (mtDNA) and nuclear DNA
(nucDNA) shed light on maternal and paternal lineages and potential population structuring by sex-biased dispersal (Ross & Shoemaker, 1997; Jorde et al., 1998; Goudet et al., 2002; Ulrich et al., 2009; Ambrose et al., 2014; Tamang et al., 2018). Here a suite of microsatellite markers were developed for C. australensis to gain insights into the species’ population genetics and evolutionary history through analysis of the phylogeographic structure of three focal populations.
29
METHODS
Field Collections and Demographic Assessments
Bees were collected from nests representing three geographically distinct C. australensis populations in January 2015-2017 (Fig 1). The Queensland population (QLD: 28.24S,
152.09E) was drawn from subtropical temperate forests characterized by warm summers and cold winters; Victoria (VIC: 34.15S, 142.16E) from a semi-arid riverine area with hot, dry summers and cold winters; and the South Australia population (SA: 34.94°S, 138.50°E ) from coastal dunes with warm summers and cold winters (Dew et al., 2016, 2018). VIC inhabits a drier region of Australia than either QLD or SA, but is connected to both regions by a series of waterways which form the Murray-Darling river basin (MDRB; Fig. 1). Lake Alexandrina, which lies approximately 100 km southwest of the SA collection site, is not a part of the MDRB, but is fed by the Murray River. The area between Lake Alexandrina and the collection site is not restricted by arid habitat. During sampling, nests were found primarily within stems of giant fennel (Ferula communis) in QLD, dark sago-weed (Plantago drummondii) in VIC, and
European searocket (Cakile maritima) in SA (Dew et al., 2018). Collections were made during dawn and dusk, outside of C. australensis foraging hours, which greatly increases the chances of collecting all nest inhabitants. Nests were first refrigerated to sedate occupants and were then opened by cutting sticks in half lengthwise with a pocket knife. The contents of each brood cell were then carefully recorded and bees immediately frozen in liquid nitrogen and stored at -80ºC.
Microsatellite Development 30
Eight Microsatellite primers were designed using the C. australensis genome (Rehan, unpub. data) following Shell and Rehan (2016). Forward primers were designed with an M13 oligo extension following Schuelke (2000) to incorporate a universal fluorescently labeled dye
(VIC or FAM from the DS-33 set). DNA was extracted from the abdominal tissues of collected adult females using a modified phenol-chloroform extraction (Kirby, 1965). PCR was then carried out using a 10 µl total reaction volume (4.975 µl ddiH2O; 1 µl 10x Buffer, 1 µl MgCl2
[25 mM], 0.125 µl forward primer with M13 tail [10mM], 0.5 µl reverse primer [10mM], 0.5 µl
M13 oligo [10mM]; 0.2 µl dNTPs [10mM]; 0.2 µl Recombinant Taq DNA Polymerase (Fisher
Scientific, Pittsburgh, PA); and 1.5 µl of DNA template) in an Eppendorf Mastercycler gradient thermocycler (Eppendorf North America, Hauppauge, NY). PCR runs involved five stages: 1) an initial denaturing at 94º C for 1 minute; 2) a touchdown series of 10 cycles starting at 94º C for
10s, 60 ºC for 15s, then cooling incrementally to primer specific Ta, and a 72 ºC extension for
15s; 3) 20-35 cycles at 94ºC for 15s, followed by primer specific Ta for 15s; a second extension at 72 ºC for 25s; 4) 8 cycles at 94ºC for 10s, 53 ºC for 15s, 72 ºC for 20s; and 5) a final extension at 72 ºC for 10min. PCR products were sent to the DNA Analysis Facility at Yale University for fragment analysis on a 3730xl Analyzer. Allele data were then scored using Peak Scanner 2
(Applied Biosystems, Foster City, CA). The genetic profiles of 57 females from separate nests across the range of C. australensis were assessed (QLD=15, SA=31, VIC=11). These eight microsatellites were uploaded to GenBank under accession numbers MH061300- MH061307
(Table S1).
Locus Characteristics and Population Structure 31
Tests for deviation from Hardy-Weinberg equilibrium and for loci displaying linkage disequilibrium were conducted in GenePop 4.2 (Rousset, 2008) using one female per nest. Allele number (Na), effective allele number (Ae), and observed and expected heterozygosity (Ho and
He) were calculated using GenAlEx 6.502 (Peakall & Smouse, 2006). Na is a measure of allelic richness and Ae is a measure of allelic diversity. Ae accounts for the frequency of alleles, such that alleles with low frequency contribute less to Ae than alleles which occur frequently. Na, Ae,
Ho, and He were compared between populations using the Conover-Iman test for multiple comparisons (Conover & Iman, 1979) in the package conover.test in R v1.1.383 (R Core team,
2017). An Analysis of Molecular Variance (AMOVA) was carried out in Arlequin v.3.5.2.2
(Excoffier et al., 2005) to assess within, among, and between population variances during a 1000 permutation run. Genetic fixation (FST) and genetic differentiation (Dest; Jost, 2008) between each population were compared with 100 random permutations and 1000 resamplings respectively to assess statistical significance. Dest values were calculated using DEMEtics
(Gerlach et al., 2010).
The extent of genetic admixture between populations was inferred using the program
STRUCTURE v.2.3.4 (Pritchard & Stephens, 2000). STRUCTURE groups individuals into clusters based on allele frequency and then calculates probability of membership to each cluster for each individual. If an individual’s genotype appears to belong to more than one cluster, this indicates admixture between populations (Pritchard & Stephens, 2000). A population count estimate of K = 2 to 4 was provided followed by a 100,000 step Markov Chain Monte Carlo following an initial burn-in of 50,000. STRUCTURE can be calibrated with known population information to more accurately assign individuals (Pritchard & Stephens, 2000). STRUCTURE 32
only uses prior population information sets if location correlates with genetic information
(Pritchard et al., 2010). Two tests were run: one in which admixture was calibrated using prior population information, and another with no set priors (the basic model). Ten simulations were run for each test and the outputs were used to generate an average for each test type, which were compiled and visualized using CLUMPAK (Kopelman et al., 2015). CLUMPAK presents a summary estimate of the vector Q, which represents the proportion of each individual’s genome assigned to each cluster across runs (Pritchard & Stephens, 2000).
The program BOTTLENECK v.1.2.02 (Luikart & Cornuet, 1999) was used to detect any evidence for a recent bottleneck within each of the three supported populations. Recent bottlenecks (within 2Ne - 4Ne generations) exhibit reduced Na and heterozygosity.
Heterozygosity can refer to either the expected level of heterozygosity based on the relative frequency of alleles (He) or the level of heterozygosity at mutation-drift equilibrium (Heq) which is calculated using Na. During a population bottleneck, rare alleles are more readily removed from a population on average, causing a relatively rapid loss of Na compared to He. It is thus expected that He > Heq if a population bottleneck is to have reduced Ne within the last two to four reproductive generations (Luikart & Cornuet, 1999). This can be visualized using the Luikart et al. (1998) method which bins allelic frequencies into 10 frequency classes (0-0.1, 0.1-0.2…0.9-
1.0). As is recommended for microsatellite loci, I used the two-phase model (TPM) in
BOTTLENECK under an assumption of 95% single step mutations, 5% multi-step mutations, and a variance of 12 among multi-step mutations. I then assessed the degree to which He = Heq using Wilcoxon’s test with 1000 replications.
33
RESULTS
Microsatellite Descriptive Statistics
Eight microsatellite loci were successfully amplified across individuals from 57 nests collected across C. australensis’ range (Table 1). The number of total alleles per locus (Na) ranged from 3-10 (mean = 5.13 +/- 0.811) while the number of effective alleles per locus (Ae) ranged from 1.26-2.72 (mean = 1.8 +/-0.168; Table 2). Assessing across populations, three loci were found to deviate from HWE. However, within populations no loci deviated significantly from HWE after Bonferroni correction (Table 3), nor were any loci in linkage disequilibrium.
Total heterozygosity, Na and Ae was highest in QLD and lowest in SA (Table 3; Fig. 2).
2 Na was not statistically different between populations (Kruskal-Wallis: χ = 3.75, d.f. = 2, p =
0.15). Allelic diversity in SA was significantly lower than both QLD (Kruskal-Wallis: χ2 = 9.93, d.f. = 2, p = 0.01; Conover-Iman T = 3.68, p = 0.002) and VIC (Conover-Iman T = -3.18, p =
0.007), but did not differ between QLD and VIC (Conover-Iman T = 0.493, p = 0.94). Ho in SA was significantly lower than both QLD (Kruskal-Wallis: χ2 = 10.7, d.f. = 2, p < 0.0001;
Conover-Iman T = 4.17, p < 0.001) and VIC (Conover-Iman T = -2.92, p = 0.012), but did not differ between QLD and VIC (Conover-Iman T = 1.25, p = 0.34). The same pattern was
2 observed for He (Kruskal-Wallis: χ = 9.93, d.f. = 2, p = 0.01; SA-QLD Conover-Iman T = 3.68, p = 0.002; SA-VIC Conover-Iman T = -3.18, p = 0.007; QLD-VIC Conover-Iman T = 0.493, p =
0.94).
34
Population Structure
AMOVA revealed significant population substructure between all three sampled populations (Table 4). Global FST (0.237) was significant (p < 0.0001), while global FIS (0.016) was not significant (p = 0.36). Though not significantly different from expected, local FIS increased from QLD (-0.076, p = 0.85) to VIC (0.059, p = 0.27) and was highest in SA (0.105, p
= 0.09). All pairwise FST comparisons between each population were significant (p < 0.0001) as were all pairwise Dest values (p=0.003; Table 5).
The results of STRUCTURE analyses are summarized in Figure 3. Regardless of the test model specified, the most likely cluster count (K) was three. Individuals from SA form a distinct cluster from QLD and VIC. The probability of shared ancestry between individuals from VIC and individuals from QLD or SA differed based on model specification. Calibrating with population information resulted in a lower degree of admixture (alpha = 0.065) and higher shared ancestry between VIC and SA. Calibrating without prior population information resulted in more admixture (alpha = 2.83) and higher shared ancestry between VIC and QLD.
No evidence for a population bottleneck was found based on excess heterozygosity for any of the three populations (He > Heq; QLD: p = 0.73; VIC: p = 0.99; SA: p = 0.98). Both VIC and SA exhibited heterozygosity deficiencies (He < Heq; QLD: p = 0.32; VIC: p = 0.02; SA: p =
0.04). Further, BOTTLENECK revealed a population-specific shift in allele frequencies towards the 10-20% class in SA compared to QLD and VIC, as well as a loss of intermediately occurring alleles (i.e. 40-70% frequency classes; Fig. 4). SA also showed a relative increase in the number of common alleles (i.e. 70-100% frequency classes). 35
DISCUSSION
Population Genetics and Marker Comparisons
The detection of a significant decrease in genetic diversity in SA corroborates previously determined mitochondrial homogeneity for this population (Dew et al., 2016). Pairwise FST values are often much higher when calculated using mitochondrial marker data compared to microsatellite data (Carlsson et al., 2004; Goropashnaya et al., 2007) due to both the high variability of microsatellites and the lower effective population size of mtDNA (Jorde et al.,
1998). It is thus not unexpected that the FST values determined through targeting microsatellite loci were lower than those secured using mtDNA (Dew et al., 2016; Table 4).
There was a greater degree of fixation between SA and VIC compared to QLD and VIC using both mtDNA and nucDNA (Table 5). It is likely that recent and relatively isolated founding of SA has led to increased genetic differences between this population relative to range-wide diversity. Microsatellite FST values mirrored mtDNA FST except for greater fixation of mitochondrial sequences between VIC and SA (FST = 0.59) compared to QLD and SA (FST =
0.43). If females were the primary dispersing sex, or dispersed at an equal rate with males, we would predict that variation in maternally inherited loci between populations (i.e. mtDNA FST) would be consistent with loci inherited from both parents (i.e. nucDNA FST), which it is not.
Consistent differences between populations would be expected, regardless of marker, if the differences between nucDNA and mtDNA were due solely to the more extreme effects of drift acting on mtDNA (Jorde et al., 1998). In this scenario, mitochondrial alleles may not be moving between source and sink populations as quickly as are nuclear alleles. As females must begin 36
nesting at the start of the reproductive period, their ability to disperse may be limited compared to males, who do not help in nest construction (Rehan et al., 2010).
Further, these results support SA as a likely range edge for C. australensis. This species is thought to have dispersed out of Asia, moved south and east along Australia’s coast, and then headed south and west through VIC to SA (Dew et al., 2016). Ongoing migration into SA is likely very limited: although no bottleneck was detected there (Fig. S2) genetic diversity remains very low compared to the other populations (Fig. 2). Genetic differentiation (Dest values) were lowest between VIC and SA demonstrating that these populations have a similar allelic make up despite the severe genetic homogeneity of SA. While habitat fragmentation has probably restricted migration into both VIC and SA, VIC’s allelic diversity suggests this population has been in place long enough to accumulate rare alleles, while SA has not. It is unlikely that the SA population is restricted to the coastal dunes where they were collected as C. australensis have been historically collected farther inland around Adelaide (South Australia Museum). There is a chance these results may be due to sampling bias if C. australensis tend to nest in aggregations and the coastal dunes represent one such large aggregation of philopatric females. Additional sampling around the
Adelaide area could help to address this uncertainty.
Ecology and Dispersal History
By 1987, an estimated 95% of the native vegetation within the MDRB had been replaced with crop and non-native plant species (Sivertsen & Metcalfe, 1995), current estimates suggest that around sixty-nine percent of the MDRB area remains devoted to grazing pasture land 37
(ABS/ABARE/BRS, 2009). When Michener (1962) collected 52 C. australensis nests from
Queensland, New South Wales, and the island of Guinea, he found only one nest within a native plant species. He subsequently hypothesized that the introduction of non-native plants had helped facilitate C. australensis expansion into Australia. Accordingly, C. australensis are now frequently found nesting in giant fennel (Ferula communis) surrounding Warwick in QLD
(Rehan et al., 2010, 2011) and in European searocket (Cakile maritima) in SA (Dew et al.,
2018). Ferula communis is a non-native species originally from the Mediterranean and Africa, and C. maritima is a native of Europe and the Mediterranean. C. maritima, which was first recorded in Western Australia in 1897, spread to SA by 1918 (Cody & Cody, 2004) and is now a part of the climax community of the dunes there (Cordingley & Lock, 2008). Non-native plant materials have also been implicated in the spread of Ceratina invasions into Hawaii (Shell &
Rehan, 2017) and congeners in North America nest in plants associated with habitat edges and agriculture (Rehan & Richards, 2010).
The results of the population structural analyses suggest that the MDRB could explain the current distribution of C. australensis from northern Queensland (Michener, 1962) south and west to Adelaide, SA (Dew et al., 2016; Fig. 1). Specifically, the MDRB might act as a natural migration corridor through the more arid regions of inland Australia. STRUCTURE results and
Dest values support this theory by indicating that bees are dispersing from VIC into SA. While it is possible that C. australensis may be migrating along the coast of south-eastern Australia into
SA, there are no published records of populations or individuals south of the MDRB. A thorough analysis of C. australensis nesting preference for native vs non-native plants could better inform our understanding of the dispersal requirements for this species. Future investigations could also 38
strive to detect and sample additional populations along and outside of the MDRB to test the river-facilitated dispersal hypothesis.
39
Chapter II: Male nesting behavior and inclusive fitness in the socially polymorphic bee,
Ceratina australensis
ABSTRACT
Typically, male Hymenoptera do not provide help with nest construction or maintenance. Rare occurrences of male ‘helping’ behaviors are usually explained by increased mating access to resident females. Here the presence of cohabiting males is reported within nests containing reproductive females of the facultatively social small carpenter bee, Ceratina australensis. Genetic information was used from nests of varying social complexity, combined with three years of nest demographic data collected across three populations, to assess the relative fitness of reproductives, non-reproductives, and males. It was predicted that males were brothers of reproductive sisters with whom they were siring offspring. Males were related to reproductive females, but there was no evidence that they were siring offspring. In contrast to previous studies, there was no consistent pattern of female relatedness in social nests. As expected, reproductive females had significantly greater fitness compared to non-reproductives; however, males did not appear to gain any fitness benefits by remaining at the nest and negatively affected offspring survivorship compared to social and solitary nests. It is therefore odd that males were not forcefully removed from the nests by females and behavioral studies are needed to assess both the timing of and mechanisms behind dispersal in C. australensis.
40
INTRODUCTION
Sexual and kin selection are thought to be opposing forces in evolution (Wilson 1975,
Boomsma 2007, 2009). This is because relatedness amongst kin decreases with increased polygamy, decreasing the amplifying effects of high relatedness between helpers. Vice versa, under high selective pressure favoring cooperation and kin altruism, the benefits of sexually selected traits declines (Boomsma 2007). Due to the haplodiploid sex determination system of
Hymenoptera, the oppositional forces of sexual and kin selection provide different templates for the evolution of cooperative behavior between males and females. Within haplodiploids, sisters share 75% of their genes with each other and 25% of their genes with brothers. Males share 50% of their genes with their siblings, 50% with their daughters and do not pass on any genetic material to their sons (Trivers and Hare 1976). Males are less likely to gain inclusive fitness benefits by helping rear relatives. Thus male fitness is maximized under high sexual selection and promiscuity or under high selection for female alloparental care in which daughters help rear more of the male’s daughters, but not under both scenarios (Boomsma 2007, 2009). Male alloparental behavior is rare and unlikely to evolve.
Within primitively eusocial Hymenoptera, males have rarely been observed partaking in within nest care, but to a lesser extent compared to females. For instance, males have been observed fanning and directly feeding larvae in at least six different species of Polistes wasps
(Hunt and Noonan 1979, Cameron 1986), though males were never observed foraging. Similarly, in the wasp Ropalidia marginata males can feed larvae under experimental removal of females and addition of excess food (Sen and Gadagkar 2006). In both Polistes and Ropalidia it was observed that males masticated food sources for longer, most likely imbibing more of the food, 41
than females feeding larvae (Hunt and Noonan 1979, Cameron 1985, 1986, Sen and Gadagkar
2006). Cameron (1985) has also observed male incubation of pupae in natural and cage nests in two species of Bombus. Incubation occurred prior to male dispersal when males cannot fly. They likely gain benefit from exercising their flight muscles during incubation, which also provides additional benefit to the brood, though males were less effective at increasing brood temperature compared to females. Males in highly social colonies thus can provide alloparental care but contribute less to brood production compared to females.
In less social species, helping behavior can allow males greater access to reproductive females. One of the most primitive forms of social behavior involves defense of stored resources
(Lin and Michener 1972, Wilson 1975, West et al. 2007a) and resource defense is also a common male mating strategy (Alcock et al. 1978, Eickwort and Ginsberg 1980, Alcock 2017). Receptive females are essentially resources for sexually mature males (Alcock et al. 1978, Paxton 2005). For example male-female pairs of the solitary wasp Trypoxylon monteverdeae were observed cooperating in nest maintenance and defense (Brockmann 1992). Mating pairs copulate during the early stages of nest construction but remain established for an extended period of time. During this period, certain behaviors normally observed in females, such as smoothing out of mud walls, were instead performed by males, indicating the potential for a rudimentary type of division of labor
(Brockmann 1992). In another examples, the communal halictid sweat bee Lasioglossum hemichalceum demonstrates a male dimorphism involving macrocephalic males that may act as a
‘soldier’ caste (Houston 1970). However, in the absence of behavioral observations and the high frequency of within-nest mating (Kukuk and Schwarz 1988, Kukuk and Sage 1994), it seems more likely that emergence of male dimorphism is related to sexual preference of females. These cases 42
illustrate how competition for access to reproductive opportunities may result in different selective pressures for males and females: males compete for sexually receptive females while females compete for adequate nesting sites (West-Eberhard 1983).
In this chapter, the the presence of males cohabitating within maternally attended nests of
Ceratina australensis (Perkins 1912) is reported. C. australensis is bivoltine and offspring are believed to disperse at the end of each brood period, mate, and males die before females diapause in winter aggregations (Michener 1962, Rehan et al. 2010). A small percentage of females do not disperse from their natal nests and form social pairs with a reproductive division of labor in which one female forages and reproduces, and one remains at the nest (Rehan et al. 2014). It is hypothesized that inclusive fitness gained by non-reproductives through nest defense against high parasitism has maintained the non-reproductive phenotype in C. australensis (Rehan et al.
2014). Relatedness estimates and fitness calculations for solitary and social phenotypes using demographic information across 4 years from a single population provided evidence that limited dispersal from natal nests leads to social nest formation but failed to provide evidence for inclusive fitness benefits for non-reproductive females (Rehan et al. 2014).
Here demographic information across three years and three populations was collected to re-test inclusive fitness theory in C. australensis and discovered males cohabiting within reproductively active nests, which had not been documented previously. The nest productivity of solitary and social nets are compared to nests containing males, which are referred to as bisex nests. It was predicted that males were benefitting nests by providing a guard in a similar way as non-reproductive females. However, given the rarity of male alloparental behavior within the
Hymenoptera (Bartz 1982), it was hypothesized that males were fathering offspring with 43
reproductively active females and gaining direct fitness benefits. If males were not fathering offspring but shared a high degree of relatedness to nest-mates, this may indicate a rare case of male altruism. These hypotheses were tested using eight polymorphic microsatellite loci
(Chapter 1) combined with three years of nest demographic information from three populations across the species’ range.
METHODS
Nest Collections and Assessments
Ceratina australensis nests were collected from three populations across Australia: near
Warwick, Queensland (QLD: 28.24S, 152.09E); Mildura, Victoria (VIC: 34.15S, 142.16E); and Adelaide, South Australia (SA: 34.94°S, 138.50°E) in January of 2015, 2016, and 2017.
Sticks were kept at -20° C refrigerated to sedate nest inhabitants prior to opening. Nests were then split lengthwise and opened. Reuse of nesting burrows from the first brood rearing period can be determined by darkened nest walls, stained with frass and/or uneaten pollen; new nests have clean walls without stains. recording the cell position and developmental stage of the brood.
Nests were then classified as Founding Nests (FN), Active Brood (AB), or Full Brood (FB) or
Mature Brood (MB) according to Rehan et al. (2010). FN nests contain a single female and no pollen. AB nests contain cells that are actively being provisioned, while FB nests are identifiable by the presence of a larva or pupa in the youngest brood cell. MB nests contain callow offspring which cohabitate with adult bees (Rehan et al. 2010). After assessment, adult bees and offspring were snap-frozen in liquid nitrogen and stored at -80°C. 44
Adults, callow offspring, and pupae were all sexed under a dissecting microscope. Male
C. australensis can be identified by examining the morphology of the ventral side of the last abdominal segment which terminates in the form of two distinct lobes (a ‘W’ shape), whereas female S6 terminates in a point. Wing wear as a measure of nicks and tears in the apical wing margin was scored from zero (no damage) to five (very worn) following (Rehan et al. 2009,
2010), and was used as a proxy for age and foraging effort (Cartar 1992).
Nest reproductive strategies at the AB or FB stage were classified based on the number of adults and their sex. Solitary nests contained only one adult female and social nests contained two to four females. Bisex nests contained one to three females and one male. The possibility that a solitary nest was a previously social nest that had been inherited by a non-reproductive female was investigated by comparing the wing wear of solitary females and the developmental stage of brood in the terminal brood cell. As C. australensis serially lay eggs from the back of the nest towards the front, advanced stage brood in the terminal brood cell infers that the female had completed foraging for her offspring. Therefore, if females in solitary, reused FB nests had a wing wear of zero and advanced stage brood was present in the terminal brood cell, they were conservatively inferred to be secondary females which had inherited social nests. Nests collected with developing brood but without an adult were considered orphaned.
Nest productivity was assessed by overall clutch size (CS), number of live brood (LB), survivorship, and per capita brood production (PCBP). Clutch size was assessed as the total number of cells containing developing brood within a nest, while live brood was the number of live offspring at the time of collection. Survivorship was the proportion of brood that was not parasitized or dead for any other reason (LB divided by CS). Both clutch size and live brood 45
were divided by the number of adult bees in each nest to calculate two measures of PCBP: CS
PCBP and LB PCBP.
The wing wear of males was compared to the wing wear of females and males taken from
FN and MB nests to estimate the flight effort of cohabitating males compared to males and females from the population at large. Male wing wear was also compared to reproductive and non-reproductive females
Genotyping and Relatedness Assessments
A total of 53 nests were genotyped at eight microsatellite loci developed specifically for
C. australensis (Chapter 1). This included 29 nests from SA, 14 nests from QLD, and 10 nests from VIC. Twenty-one solitary nests, 17 social nests, and 13 bisex nests were genotyped.
Pairwise relatedness coefficient (r) values were calculated in KinGroup (Konovalov et al. 2004) using the Queller-Goodknight estimation method (Queller and Goodnight 1989) and empirical allele frequencies across all populations. The Queller-Goodknight method produces relatedness values which range from negative one to positive one. A value of zero indicates the percent shared number of alleles between two randomly drawn individuals from the populations; thus negative values indicate that paired individuals share fewer alleles and positive values indicate that paired individuals share more alleles than a randomly drawn pair (Queller and Goodnight
1989). To accommodate the formula, female to male relatedness estimates were calculated by inputting haploid males as diploid. Estimated female to male r values were then divided in half to compensate for haplodiploid asymmetry (Trivers and Hare 1976). 46
Individuals for which more than four loci did not amplify were removed from this analysis. Eggs and larvae, which cannot be sexed based on morphology, were sexed based on genotype. Because males are haploid, individuals homozygous across all eight loci were considered male. However out of a total 124 adults and pupae visually confirmed as female, 13
(10.5%) were homozygous across all eight loci (all of which were from SA). Of the 32 larvae and eggs from SA, 11 were homozygous across all loci. Assuming a 10.5% female homozygosity rate, only about one of these 11 individuals is likely to be female. As such, I felt confident in classifying all fully homozygous brood as male.
Inspection of genotype profiles also revealed incidences of multiply mated females and the presence of unrelated individuals within nests. It was conservatively estimated that a female had mated with more than one male if a putative secondary paternal allele was reliably detected across at least two loci. If females consistently differed from a nestmate across at least two loci these individuals were classified as unrelated.
Statistical Analyses
Statistical tests were carried out in R v1.1.383 (R Core team 2017). To test the hypothesis that limited dispersal of first brood offspring leads to social nest formation (Rehan et al. 2010) the proportion of reused nests were compared between nesting strategy. To assess whether or not
AB nest live brood production could be incorporated into fitness calculations and increase sample size, the number of live brood in AB vs FB nests were compared. Chi-square tests were used to compare the proportion of nesting strategies detected by nest reuse patterns (new vs 47
reused) and between developmental stage (AB vs FB). Clutch size, number of live brood, survivorship, per capita brood production (PCBP), and wing wear scores were compared across reproductive strategies using non-parametric Kruskal-Wallis chi-squares followed by pairwise
Dunn’s rank sum tests using Bonferroni correction for multiple comparisons. Relatedness estimates for specific pairwise relationships were compared using ANOVAs and Welch’s two- tailed t-tests.
Fitness calculations
Fitness calculations were adapted from Rehan et al. (2014). The fitness of the reproductive female in any given nest type was estimated as the average number of live brood produced per reproductive strategy multiplied by the average relatedness of reproductive females to their brood, multiplied by the probability of her survival. The probability of female survival was calculated as 1 - the probability of nest abandonment (see results) for solitary females and 1
- probability of nest inheritance for nests containing at least 2 females.
푅푒푝푟표푑푢푐푡𝑖푣푒 = 퐿퐵 ∗ 푟(퐿퐵) ∗ 푝(푠푢푟푣𝑖푣푎푙)
Indirect fitness benefits for each non-reproductive female was calculated as their relatedness to brood, multiplied by the probability that the primary female survived, multiplied by the additional live brood produced in social compared to solitary nests (b). If non- reproductive females in social and bisex nests inherited an abandoned nest, they stood to gain direct fitness benefits. Direct fitness of non-reproductive females in social and bisex nests was equal to the probability that the primary female would not survive multiplied by the difference in 48
live brood between inherited and social nests (b.inherit), multiplied by the expected secondary female’s relatedness to her own offspring (r = 0.50). For non-reproductive females in MFNs the probability of nest inheritance was divided by two to account for equal potential for inheritance by either female.
푝(푁 퐼) 푁표푛 푅푒푝푟표푑푢푐푡𝑖푣푒 = 푏 ∗ 푟(퐿퐵) ∗ 푝(푠푢푟푣𝑖푣푎푙) + 푏. 𝑖푛ℎ푒푟𝑖푡 ∗ 푟(표푓푓푠푝푟𝑖푛푔) ∗ 푛 푛표푛 푟푒푝푟표푑푢푐푡푖푣푒푠
Indirect fitness benefits for males was calculated in the same was as for non-reproductive females, substituting the additional number of live brood produced in bisex nests compared to solitary nests (b.male) for b. Males cannot provision their own nest so they do not stand to benefit from female mortality. However, they do stand to gain direct fitness if they are the offspring’s father, in which case direct fitness is equal to the male's relatedness to his offspring multiplied the number of offspring sired.
푀푎푙푒 = 푏. 푚푎푙푒 ∗ 푟(퐿퐵) ∗ 푝(푠푢푟푣𝑖푣푎푙) + 푟(표푓푓푠푝푟𝑖푛푔) ∗ 푛 표푓푓푠푝푟𝑖푛푔
RESULTS
A total of 581 AB/FB nests were collected during the three consecutive field seasons, of which 525 (90%) were solitary, 39 (7%) social, and 17 (3%) bisex. Table 1 shows the percentage of AB/FB nests collected for each site and year that were social and bisex. All bisex nests except
1 were collected in 2016; 15 out of 17 of which were collected in SA and the remaining two of which were collected from QLD. 49
The proportion of reused nests varied significantly by reproductive strategy (i.e. social vs
2 solitary, X 2 = 23.2, p < 0.0001). The proportions of reused burrows occupied by bisex (9 out of
2 14; 64%) and social nests (22 out of 34; 65%) did not differ from each other (X 1=0.01,p =0.9).
By comparison, only 132 of 482 (27%) solitary nests were found in reused stems; a significantly
2 2 smaller proportion compared to bisex (X 1=7.4, p = 0.007) and social nests (X 1=14.3, p =
0.0002).
Wing wear assessment and brood production
Wing wear (WW) did not differ between AB and FB males (AB WW = 0.375 ± 0.18, n=
8; FB WW = 0 ± 0, n = 5; t = 2.1, d.f. = 7, p = 0.08). Wing wear between individuals across nest
2 types were significantly different (Kruskal-Wallis X 7 = 30.9, p < 0.0001). Males from FB bisex nests had significantly less WW (0.25 ± 0.12, n = 13) than FB social reproductives (3.9 ± 0.53, n
= 10; Z = -4.3, d.f. = 1, p = 0.0003) but did not significantly differ compared to FN/MB males
(1.8 ± 0.15, n = 159; Z = 2.8, d.f. = 1, p = 0.06), FN/MB females (1.4 ± 0.9, n=367; Z = 2.1, d.f.
= 1, p = 0.5, FB solitary females (1.5 ± 0.31, n = 24; Z = -2.4, d.f. = 1, p = 0.3), FB primary bisex females (2.3 ± 0.70, n = 12; Z = -2.2, d.f. = 1, p = 0.4), FB social non-reproductives (0.85 ± 0.41, n = 10; Z = -0.1, d.f. = 1, p = 1.0), and FB non-reproductive bisex females (0.13 ± 0.13, n = 8; Z
= 0.32, d.f. = 1, p = 0.1.0).
Six of 198 (3%) of reused FB nests containing one female were inferred to have been inherited by social secondary females. A total of 30 out of 514 (5.8%) solitary AB and FB nests were considered orphaned. There was a significant difference in the number of live brood 50
between AB nests (n = 360, 2.14 ± 0.11 s.e.) compared to FB nests (n = 209, 2.91 ± 0.14;
Welch’s t = -4.31, d.f. = 443.96, p < 0.0001).
The clutch sizes and live brood numbers produced by solitary females (n = 186), bisex reproductive females (n = 6), social reproductives (n = 11), and secondary inheritors of social
2 nest (n=6) did not differ significantly (Fig. 1; CS Kruskal-Wallis X 3 = 3.05, p = 0.38; LB
2 Kruskal-Wallis X 3 = 1.64, p = 0.65). However, survivorship was greater in solitary nests (mean
2 ± s.e. = 0.91 ± 0.02) compared to bisex nests (0.70 ± 0.10; Fig. 1; Kruskal-Wallis X 3 = 10.03, p
= 0.02; Z = -2.8, d.f. = 1, p = 0.01). All other survivorship comparisons were not significantly different. PCBP significantly differed by reproductive strategy (Fig. 2; CS PCBP Kruskal-Wallis
2 2 X 2 = 9.30, p = 0.01; LB PCBP Kruskal-Wallis X 2 = 13.9, p < 0.001). Solitary CS PCBP (3.20 ±
0.15) was greater than social CS PCBP (1.70 ± 0.39; Z = -2.8, d.f. = 1, p = 0.008), but did not differ from bisex nest CS PCBP (2.08 ± 0.55; Z = -1.4, d.f. = 1, p = 0.3). Solitary LB PCBP (2.88
± 0.15) was greater than social LB PCBP (1.38 ± 0.40; Z = -3.1, d.f. = 1, p = 0.003) and bisex
LB PCBP (1.33 ± 0.31; Z = -2.2, d.f. = 1, p = 0.045). Bisex and social nests did not differ by either CS PCBP (Z = 0.6, d.f. = 1, p = 0.8) or LB PCBP (Z = 0.13, d.f = 1, p = 1.0).
Relatedness Estimates
Of the 23 solitary female nests that were genotyped, two contained a single male offspring that differed from the resident female by at least one locus. The estimated r values between these individuals were 0.06 and -0.05 inferring that nests had been inherited by unrelated individuals. Evidence of two patrilines was detected in the brood genotype profiles of 51
five of the remaining 21 solitary nests (24%). Multiple mating was not detected in any other nest type. Average estimated relatedness among female offspring (sisters) was significantly greater in singly mated solitary nests (r = 0.77) compared to multiply mated solitary nests (r = 0.47; Table
2).
Of the 17 social nests, 5 contained 3-4 females. One nest containing 4 females contained
2 sisters (r = 0.69) alongside 2 unrelated females (r = 0.12; 95% CI: -0.28-0.52, n = 5). Similarly,
2 nests containing 2 females did not share alleles at one locus and had low relatedness estimates
(0.31 and 0.12), while an additional social pair differed at two loci (r = -0.52) suggesting that these three nests contain unrelated social pairs. In total, 4 social nests contained unrelated adult females. Interestingly, females in nests containing 3-4 females shared significantly higher r values (r= 0.83; d.f.=2, 33, F= 10.9, p=0.0002) compared to females in nests containing 2 females (r= 0.48; Tukey HSD=-0.35, p=0.0003) but did not differ from social females in bisex nests (r=0.81; Tukey HSD=0.02, p=0.95). Social females in bisex nests were significantly more related compared to social pairs (Tukey HSD= -0.3, p=0.002; Table 2). Female offspring (sisters) in social nests, regardless of the number of females, were related by 0.74 on average.
Adult females in bisex nests were related to resident males by 0.29. This value (0.29) was not significantly different from sister-brother pairs from solitary nests (r = 0.26) or social nests (r
= 0.34; Table 2). Males differed from female offspring by at least one locus in 4 bisex nests that contained female offspring. Male-female offspring were related by 0.19 (95% CI: 0.07-0.31, n=8). The only lone sister offspring pair collected and genotyped from any bisex nest was related by 0.66. 52
Fitness
The average number of live brood (LB) collected from AB nests was significantly lower than live brood from FB nests indicating that a reproductive mother’s survival to the end of the reproductive period should impact her fitness. The probability of solitary nest abandonment was taken as the average rate of female mortality estimated by orphanage rate (5.8 %) and the rate of usurpation by a drifting female in genotyped nests (8.7%). The probability of female survival was thus 1-probability of nest abandonment (0.93) for solitary females. The probability that social non-reproductive females would not inherit the nest was 0.97. The fitness of solitary females was 1.34 ± 0.07, social reproductives was 1.54 ± 0.39 and bisex reproductives was 1.25
± 0.28.
As there was no additional live brood produced in social or bisex nests, the indirect fitness of non-reproductive females was equal to zero. The potential benefit of inheriting an abandoned nest was equal to b.inherit = 3.67-2.87 = 0.8. The fitness of non-reproductive females was 0.05 ± 0.03.
Relatedness estimates for males and females suggest that males are brothers who have not dispersed (Table 2) and could therefore benefit from indirect fitness if they are helping to support more live offspring than females could produce without them. The low wing-wear scores of males further suggests that they are not often departing the nest which, for males, would likely imply mate searching flights. Males appear to be playing a similar behavioral role to non- reproductive females (i.e. potential nest guard) and their presence did not increase the number of live brood (Fig. 2). They would therefore receive no indirect fitness. There was no direct 53
evidence that males were mating with resident females. If males were waiting for the emergence of their nieces for mating opportunities (n offspring), the direct benefits of this strategy would not have been evident at the time of nest collection. Male inclusive fitness is therefore equal to zero.
The fitness of non-reproductive females was significantly lower compared to
2 reproductive females (Kruskal-Wallis X 3 =33.83, p<0.0001). Non-reproductive fitness (n = 12) was significantly lower compared to solitary fitness (n=186; Z = -5.6, d.f. = 1, p < 0.0001), social reproductive fitness (n = 11; Z = -4.8, d.f. = 1, p<0.0001), and bisex reproductive fitness (n = 6;
Z = 3.4, d.f. = 1, p = 0.002). The fitness of reproductive females between nest types were not significantly different (Bisex-Social: Z = -0.6, p = 1.0; Bisex-Solitary: Z = 0.09, p = 1.0; Social-
Solitary: Z = 1.1, p = 0.84).
DISCUSSION
The presence of cohabitating males within nests of a facultatively social bee was analyzed using microsatellite markers. Female-male r values fit the distribution of expected relatedness between haplodiploid siblings, while female-female r values were less clear. No evidence was found for inbreeding or inclusive fitness among males and limited fitness for non- reproductive females. Though male wing wear score values only differed significantly from social reproductive females, this is likely a product of low sample size as no bisex male had a score greater than 1 indicating minimal flight. Males were thus likely not flying outside of the nest very often or at all and would have therefore been reliant on foraging reproductives for food. 54
Decreased survivorship in bisex nests but not social nests indicates that males were either taking more food from foraging mothers or were not aiding in nest care to the extent of social non- reproductive females.
Social Nest Formation
The frequency of nest reuse was higher in social and bisex nesting strategies than in solitary nests. While around 2/3 of social and bisex nests were found in reused nests, around 1/3 of these nests were found in new nests. This indicates that social nest formation is not dependent on limited dispersal from natal nests exclusively, but perhaps also includes limited dispersal from natal nest aggregations. In line with this theory, we also detected a moderate instance of drifting:
6/53 (11%) of genotyped nests contained an alien female, including 4/17 (23.5%) of social nests.
Drifting between nests is common within social Hymenoptera (Schwarz 1987, Yanega 1990,
Soro et al. 2009, Ulrich et al. 2009, Leadbeater et al. 2011, Yagi and Hasegawa 2012) and offers potential benefits through competition avoidance with related nestmates or potential inheritance in new nests.
Relatedness coefficients between pairs of social females was lower than expected for full sisters of singly-mated females (Table 2; Trivers and Hare 1976). Evidence for multiple mating was detected in 24% of solitary nests (9.4% of all genotyped nests) which could account for the decreased relatedness between full sisters in those nests (Table 2). In the absence of behavioral observations, it is not possible to further confirm whether social pairs in this study were daughters of multiply-mated females, mother-daughter pairs, or both. Mother-daughter pairs 55
could form if first-brood female offspring did not disperse and remained within her natal nest.
This would also translate into increased relatedness between non-reproductives and offspring (r =
0.5) compared to full sister pairs where non-reproductives are related to offspring by 0.375
(Trivers and Hare 1976).
While this study did not allow for direct testing of the hypothesis that helping is selectively neutral, the absence of substantial inclusive fitness benefits for non-reproductives in this and a previous study (Rehan et al. 2014) suggests that helping behavior may instead be a product of natal philopatry and selection on maternal care behavior. This idea has been suggested for cooperatively breeding white browed scrub wrens in which the presence of a helper does not increase nest productivity (Magrath and Yezerinac 1997). The strong impetus to feed adult offspring has important fitness implications in terms of brood survival (Lewis and Richards
2017, Mikát et al. 2017, Shell and Rehan 2018). Guarding at the nest may thus be a byproduct of selection for maternal care (Wade 2001, Linksvayer and Wade 2005). As has been shown in
Xylocopa, the first bee to encounter a returning mother is fed first (Hogendoorn and Velthuis
1995) and thus remaining at the nest entrance should benefit guards even in the absence of high parasitism.
Bisex nesting
Bisex nests occurred predominately, but not exclusively, within SA in 2016 (Table 1). and one each in SA in 2015 and 2017. SA is characterized by a lack of genetic diversity and is likely a recently founded population (Dew et al. 2016); it is tempting to conclude that bisex nests 56
are the consequence of genetic and environmental factors affecting C. australensis at the end of its range. However, two nests were found in QLD in 2016; compared to SA, QLD is genetically diverse and is less likely to be subject to the deleterious effects of inbreeding.
Another unknown involves the normal degree of inbreeding among adult siblings within mature brood nests and hibernacula. Future studies should examine the sex ratio of brood in both reproductive periods of C. australensis to further explore the mating biology of this species. A population-wide sex-biased brood ratio occurring during either brood rearing period (Dew et al.
2018) could affect the potential number of mates available for females, consequently altering the cost-benefit ratios of mating with relatives and dispersing to establish new nests (Quiñones and
Pen 2017).
It is possible that males were waiting to mate with nieces or were delaying mate- searching flights until the end of the second brood period. However, it is peculiar that males were not forcefully removed from nests by females, as their presence does not benefit resident females
(Fig. 1). It is unknown what factors influence the timing of dispersal or for how long callow C. australensis remain within their natal nets, however forceful removal of males by females occurs within bees across the social spectrum (Gerling et al. 1981, Minckley and Buchmann 1990, dos
Santos 2018). Behavioral observations of aggressive and tolerant interactions throughout life cycle of C. australensis are needed to understand the mechanisms that underlie dispersal. That males remain within these nests until the end of the reproductive period suggests that selection for tolerance among nest mates is high, and that males are possibly exploiting maternal care instincts of their siblings. 57
GENERAL CONCLUSIONS
Cooperative behavior has evolved numerous times within the Hymenoptera (Rehan and
Toth 2015). The most complex form of cooperative behavior, eusocial behavior, involves 1) cooperative brood care, 2) overlapping generations, and 3) division of labor. Division of labor usually entails a sterile worker caste and such sterility is only fixed within the most derived clades (Wilson 1971). It is difficult to understand the origins of eusocial behavior via studies on the most derived clades because they lack the ability to revert to solitary behavior under different environmental conditions. Thus, species which exhibit both eusocial and solitary traits are ideal for testing hypotheses related to the factors underlying the origins of sterile, worker behavior.
Ceratina australensis is one such species and exhibits a low frequency of social nesting across years and populations (Rehan et al. 2010, Dew et al. 2018). In chapter 1 it was demonstrated that patterns of nuclear genetic diversity mirror patterns of mitochondrial haplotype diversity. These patterns are likely the result of limited female intra-population migration and probably male-biased dispersal. Male-biased dispersal is predicted for species whose females nest philopatrically (Lin and Michener 1972) and natal philopatry (limited dispersal) is the prevailing theory of social nest formation in C. australensis. South Australia
(SA) was the most genetically homogenous population and likely represents a range edge for C. australensis. In chapter 2 the relative fitness of different reproductive strategies was calculated and the mechanisms of social nest formation were analyzed. While nests containing males were found predominantly within SA bisex nests were also found within Queensland (QLD). 58
The role of cohabiting males within nests is still unclear. If males were acting to increase their own fitness directly by increased access to reproductive opportunity, it was not observed in this study. Bisex nests did not produce different numbers of live brood compared to other nest types, though they did have significantly fewer brood survive compared to solitary nests. If males were ‘acting’ altruistically, they were not very effective helpers. It is most likely that males were delaying dispersal for later reproductive opportunity, as occurs with the pied kingfisher (Reyer 1984). A lack of immediate reproductive opportunity could have provided the impetus for males to not disperse from their natal sites. This would be especially true if the first brood were male-biased.
Mutual tolerance is a prerequisite for social behavior (Lin and Michener 1972) and because there was no evidence that males had mated with reproductive females, this demonstrates that reproductive females tolerated the males. Mutual tolerance for nest mates is common within the Ceratinines (Michener 1990) as bees cohabitate before and during diapause.
Tolerance for male bees is likely to be selected against however as males take up resources that could go to the brood and do not appear to provide any benefit to developing offspring.
However, the fitness of reproductive females did not differ significantly by nest type indicating that the benefits of tolerance outweigh the costs from the perspective of the female reproductives.
The prevalence of maternal care behavior within Ceratina (Michener 1974) provides the possibility that helping in C. australensis may not necessarily be adaptive but may be a byproduct of strong selection on maternal care behavior. Males may then exploit this maternal care behavior in times when mating opportunities are low. Why males were not forcefully 59
removed by females remains unknown. Sex-specific pheromones have been identified in the mating behavior of many hymenopterans (Smith and Ayasse 1987, Derstine et al. 2017, Conrad et al. 2018) and the ability to recognize kin has been demonstrated in the North American
Ceratina calcarata (Rehan and Richards 2013). Given the moderate instance of drifting observed in chapter 2, it is possible that C. australensis either does not have the ability to discriminate amongst kin and non-kin or that drifting is due to recognition error. Males may be bypassing the recognition system of females in some way; perhaps bisex males appeared chemically to females as sisters, however any physiological differences between bisex males and males from the population at large were not noted in this study. More work focusing on 1) chemical cues and 2) aggression-tolerance interactions in C. australensis would help to inform our understanding of social nest formation and the factors that led to male limited dispersal.
The presence of multiple mating inferred the possibility that social pairs were mother- daughters or half-sisters. Because of what we know already about C. australensis nesting biology
(Rehan et al. 2014) and the high relatedness of females in bisex and multiple female nests, it is likely that related social pairs were half-sisters from the first brood period. This is interesting considering that social behavior is predicted to precede polygamous mating (Boomsma 2007,
2009), and does empirically when social behavior is analyzed within a phylogenetic context
(Hughes et al. 2008, Cornwallis et al. 2017). Reproductive division of labor between half-sisters is unlikely to be strongly selected for as the average relatedness between helpers and offspring would fall below 0.5. However, selection for reproductive division of labor between full sisters is also not likely to be strong as aunts are related to nieces by 0.375. The benefits of altruism in 60
these cases must be great enough to exceed the costs, without the amplifying effects of high relatedness.
The potential for nest inheritance was not great enough to explain social nesting. Females could have inherited the nest the following year (Yagi and Hasegawa 2012) and would represent a benefit if the costs of dispersal are high or if extreme environmental variation (parasite pressure) selects for low frequency of social nesting. This could be adaptive, not necessarily on a nest by nest basis, but may over time allow for the colonization of poor habitats. Cooperation has been shown to precede colonization of harsh environments in birds (Cornwallis et al. 2017). In chapter 1 evidence was provided for the range expansion of C. australensis via the introduction of non-native pithy stemmed plants (Michener 1962). As Ceratina are mostly polylectic foragers and exhibit apparent flexibility in nesting substrate (Michener 1990, Shell and Rehan 2017), the interplay between these factors and moderate levels of social plasticity (Sakagami and Maeta
1977, 1984, Maeta et al. 1997) are likely responsible for the cosmopolitan distribution of
Ceratina (Rehan et al. 2012).
61
References
ABS/ABARE/BRS. 2009. Socio-Economic Context for the Murray-Darling Basin - Descriptive Report,
ABS/ABARE/BRS Report to the Murray-Darling Basin Authority, Canberra, September.
Alcock, J. 2017. A long-term study of male territoriality in the tarantula hawk wasp (Hemipepsis ustulata;
Pompilidae) in Central Arizona. Southwest. Nat. 62: 109–112.
Alcock, J., E. M. Barrows, G. Gordh, L. J. Hubbard, L. Kirkendall, D. W. Pyle, T. L. Ponder, and F. G.
Zalom. 1978. The ecology and evolution of male reproductive behaviour in the bees and wasps. Zool. J. Linn.
Soc. 64: 293–326.
Ambrose, L., R. D. Cooper, T. L. Russell, T. R. Burkot, N. F. Lobo, F. H. Collins, J. Hii, and N. W. Beebe.
2014. Microsatellite and mitochondrial markers reveal strong gene flow barriers for Anopholes farauti in the
Solomon Arhipelago: implications for malaria vector control. Int. J. Parasitol. 44: 225–233.
Amsalem, E., C. M. Grozinger, M. Padilla, and A. Hefetz. 2015. The Physiological and Genomic Bases of
Bumble Bee Social Behaviour, 1st ed, Adv. In Insect Phys. Elsevier Ltd.
Arca, M., F. Mougel, T. Guillemaud, S. Dupas, Q. Rome, A. Perrard, F. Muller, A. Fossoud, C. Capdevielle-
Dulac, M. Torres-Leguizamon, X. X. Chen, J. L. Tan, C. Jung, C. Villemant, G. Arnold, and J. F.
Silvain. 2015. Reconstructing the invasion and the demographic history of the yellow-legged hornet, Vespa
velutina, in Europe. Biol. Invasions. 17: 2357–2371.
Asplen, M. K., J. B. Whitfield, J. G. De Boer, and G. E. Heimpel. 2009. Ancestral state reconstruction analysis of
hymenopteran sex determination mechanisms. J. Evol. Biol. 22: 1762–1769.
Baines, C. B., I. M. Ferzoco, and S. J. McCauley. 2017. Sex-biased dispersal is independent of sex ratio in a
semiaquatic insect. Behav. Ecol. Sociobiol. 71: 1–7.
Baird, R. W., and L. M. Dill. 1995. ecological and social determinants of group size in transient killer whales.
Behav. Ecol. 7: 408–416.
Bartz, S. H. 1982. On the evolution of male workers in the Hymenoptera. Behav. Ecol. Sociobiol. 11: 223–228.
Bateson, P. 1983. Optimal outbreeding, pp. 257–277. In Bateson, P. (ed.), Mate Choice. Cambridge University
Press, Cambridge, UK. 62
Boomsma, J. J. 2007. Kin selection versus sexual selection: why the ends do not meet. Curr. Biol. 17: 673–683.
Boomsma, J. J. 2009. Lifetime monogamy and the evolution of eusociality. Philos. Trans. R. Soc. B Biol. Sci. 364:
3191–3207.
Boomsma, J. J., B. Baer, and J. Heinze. 2005. The evolution of male traits in social insects. Annu. Rev. Entomol.
50: 395–420.
Brockmann, H. J. 1992. Male behavior, courtship, and nesting in Trypoxylon (Trypargilum) monteverdeae
(Hymenoptera: Sphecidae). J. Kansas Entomol. Soc. 65: 66–84.
Cahan, S. H., D. T. Blumstein, L. Sundstrom, J. Liebig, and A. Griffin. 2002. Social Trajectories and the
Evolution of Social Behavior. Oikos. 96: 206–216.
Cameron, S. A. 1985. Brood care by male bumble bees. Proc. Natl. Acad. Sci. U. S. A. 82: 6371–6373.
Cameron, S. A. 1986. Brood care by males of Polistes major ( Hymenoptera : Vespidae ). J. Kansas Entomol. Soc.
59: 183–185.
Cangialosi, K. R. 1990. Social spider defense against kleptoparasitism. Behav. Ecol. Sociobiol. 27: 49–54.
Carlsson, J., J. R. McDowell, P. Diaz-Jaimes, J. E. L. Carlsson, S. B. Boles, J. R. Gold, and J. E. Graves. 2004.
Microsatellite and mitochondrial DNA analyses of Atlantic bluefin tuna (Thunnus thynnus thynnus) population
structure in the Mediterranean Sea. Mol. Ecol. 13: 3345–3356.
Cartar, R. 1992. Morphological senescence and longevity: an experiment relating wing wear and life span in
foraging wild bumble bees. J. Anim. Ecol. 61: 225–231.
Chak, S. T. C., J. E. Duffy, K. M. Hultgren, and D. R. Rubenstein. 2017. Evolutionary transitions towards
eusociality in snapping shrimps. Nat. Ecol. Evol. 1: 1–7.
Cody, M. L., and T. W. D. Cody. 2004. Morphology and spatial distribution of alien sea-rockets (Cakile spp.) on
South Australian and Western Canadian beaches. Aust. J. Bot. 52: 175–183.
Conover, W. J., and R. L. Iman. 1979. On Multiple-Comparisons Procedures. Tech. Rep. LA-7677-MS. 1–14.
Conrad, T., R. J. Paxton, G. Assum, and M. Ayasse. 2018. Divergence in male sexual odor signal and genetics
across populations of the red mason bee, Osmia bicornis, in Europe. PLoS One. 13: e0193153.
Cornuet, J. M., and G. Luikart. 1996. Description and power analysis of two tests for detecting recent population
bottlenecks from allele frequency data. Genetics. 144: 2001–2014. 63
Cornwallis, C. K., C. A. Botero, D. R. Rubenstein, P. A. Downing, S. A. West, and A. S. Griffin. 2017.
Cooperation facilitates the colonization of harsh environments. Nat. Ecol. Evol. 1: 1–10.
Cortázar-Chinarro, M., E. Z. Lattenkamp, Y. Meyer-Lucht, E. Luquet, A. Laurila, and J. Höglund. 2017.
Drift, selection, or migration? Processes affecting genetic differentiation and variation along a latitudinal
gradient in an amphibian. BMC Evol. Biol. 17: 1–14.
Danforth, B. 2007. Bees. Curr. Biol. 17: 156–161.
Danforth, B. N. 2002. Evolution of sociality in a primitively eusocial lineage of bees. Proc. Natl. Acad. Sci. 99:
286–290.
Derstine, N. T., B. Ohler, S. I. Jimenez, P. Landolt, and G. Gries. 2017. Evidence for sex pheromones and
inbreeding avoidance in select North American yellowjacket species. Entomol. Exp. Appl. 164: 35–44.
Dew, R. M., S. M. Rehan, and M. P. Schwarz. 2016. Biogeography and demography of an Australian native bee
Ceratina australensis (Hymenoptera, Apidae) since the last glacial maximum. J. Hymenopt. Res. 49: 25–41.
Dew, R. M., W. A. Shell, and S. M. Rehan. 2018. Changes in maternal investment with climate moderate social
behaviour in a facultatively social bee. Behav. Ecol. Sociobiol. 72: 69–73.
Eckert, C. G., K. E. Samis, and S. C. Lougheed. 2008. Genetic variation across species’ geographical ranges: The
central-marginal hypothesis and beyond. Mol. Ecol. 17: 1170–1188.
Eickwort, G. C. 1986. First Steps into Eusociality : The Sweat Bee Dialictus lineatulus. Florida Entomol. 69: 742–
754.
Eickwort, G. C., and H. S. Ginsberg. 1980. Foraging and mating behavior in Apoidea. Annu. Rev. Entomol. 25:
421–446.
Engel, M. S. 2001. Monophyly and extensive extinction of advanced eusocial bees: insights from an unexpected
Eocene diversity. Proc. Natl. Acad. Sci. U. S. A. 98: 1661–1664.
Excoffier, L., G. Laval, and S. Schneider. 2005. Arlequin ( version 3 . 0 ): An integrated software package for
population genetics data analysis. 1: 47–50.
Friedel, A., R. J. Paxton, and A. Soro. 2017. Spatial patterns of relatedness within nesting aggregations of the
primitively eusocial sweat bee Lasioglossum malachurum. Insectes Soc. 64: 465–475.
Gerlach, G., A. Jueterbock, P. Kraemer, J. Deppermann, and P. Harmand. 2010. Calculations of population 64
differentiation based on G(ST) and D: forget G(ST) but not all of statistics! Mol. Ecol. 19: 3845–3852.
Gerling, D., P. D. Hurd Jr., and A. Hefetz. 1981. In-nest behavior of the carpenter bee, Xylocopa pubescens
Spinola (Hymenoptera: Anthophoridae). J. Kans. Entomol. Soc. 54: 209–218.
Gonzalez, V. H., A. Mejia, and C. Rasmussen. 2004. Ecology and Nesting Behavior of Bombus atratus Franklin
in Andean Highlands (Hymenoptera: Apidae). J. Hymenopt. Res. 13: 234–242.
Goropashnaya, A. V, V. B. Fedorov, B. Seifert, and P. Pamilo. 2007. Phylogeography and population structure in
the ant Formica exsecta ( Hymenoptera , Formicidae ) across Eurasia as reflected by mitochondrial DNA
variation and microsatellites. Ann. Zool. Fennici. 44: 462–474.
Goudet, J., N. Perrin, and P. Waser. 2002. Tests for sex-biased dispersal using bi-parentally inherited genetic
markers. Mol. Ecol. 11: 1103–1114.
Hamilton, W. 1964. The genetical evolution of social behaviour. I. J Theor. Biol. 7: 17–52.
Hamilton, W. D. 1972. Altruism and related phenomena, mainly in social insects. Annu. Rev. Ecol. Syst. 3: 193–
232.
Harpur, B. A., M. Sobhani, and A. Zayed. 2013. A review of the consequences of complementary sex
determination and diploid male production on mating failures in the Hymenoptera. Entomol. Exp. Appl. 146:
156–164.
Heinsohn, R., and S. Legge. 1999. The cost of helping. Trends Ecol. Evol. 14: 53–57.
Hines, H. M. 2008. Historical biogeography, divergence times, and diversification patterns of bumble bees
(Hymenoptera: Apidae: Bombus). Syst. Biol. 57: 58–75.
Hoffman, A. A., and M. W. Blows. 1994. Species Borders: Ecologial and Evolutionary Perspectives. Trends Ecol.
Evol. 9: 223–227.
Hogendoorn, K., and H. H. W. Velthuis. 1993. The sociality of Xylocopa pubescens: does a helper really help?
Behav. Ecol. Sociobiol. 32: 247–257.
Hogendoorn, K., and H. H. W. Velthuis. 1995. The role of young guards in Xylocopa pubescens. Insectes Soc. 42:
427–448.
Houston, T. F. 1970. Discovery of an apparent male soldier caste in a nest of a halictine bee (Hymenoptera:
Halictidae), with notes on the nest. Aust. J. Zool. 18: 345–351. 65
Hughes, W. O. H., J. Eilenberg, and J. J. Boomsma. 2002. Trade-offs in group living: transmission and disease
resistance in leaf-cutting ants. Proc. Biol. Sci. 269: 1811–1819.
Hughes, W., B. Oldroyd, M. Beekman, and F. Ratnieks. 2008. Ancestral monogramy shows kin selection is key
to the evolution of eusociality. Science (80-. ). 320: 1213–1217.
Hunt, J. H., and K. C. Noonan. 1979. Larval feeding by male Polistes fuscatus and Polistes metricus
(Hymenoptera: Vespidae). Insectes Soc. 26: 247–251.
Johnson, D. D. P., R. Kays, P. G. Blackwell, and D. W. Macdonald. 2002. Does the resource hypothesis explain
group living? Trends Ecol. Evol. 17: 563–570.
Johnstone, R. A., M. A. Cant, and J. Field. 2012. Sex-biased dispersal, haplodiploidy and the evolution of helping
in social insects. Proc. R. Soc. B Biol. Sci. 279: 787–793.
Jongepier, E., and S. Foitzik. 2015. Ant recognition cue diversity is higher in the presence of slavemaker ants.
Behav. Ecol. 00: arv153.
Jorde, L. B., M. Bamshad, and a R. Rogers. 1998. Using mitochondrial and nuclear DNA markers to reconstruct
human evolution. Bioessays. 20: 126–136.
Jost, L. 2008. GST and its relatives do not measure differentiation. Mol. Ecol. 17: 4015–4026.
Kapheim, K. M., S. P. Bernal, A. R. Smith, P. Nonacs, and W. T. Wcislo. 2011. Support for maternal
manipulation of developmental nutrition in a facultatively eusocial bee, Megalopta genalis (Halictidae).
Behav. Ecol. Sociobiol. 65: 1179–1190.
Kapheim, K. M., P. Nonacs, A. R. Smith, R. K. Wayne, and W. T. Wcislo. 2015. Kinship, parental manipulation
and evolutionary origins of eusociality. Proc. R. Soc. B Biol. Sci. 282: 20142886.
Kapheim, K. M., H. Pan, C. Li, S. L. Salzberg, D. Puiu, T. Magoc, H. M. Robertson, M. E. Hudson, and A.
Venkat. 2015. Genomic signatures of evolutionary transitions from solitary to group living. Science (80-. ).
348: 1139–1144.
Kidokoro, M., N. Azuma, and S. Higashi. 2006. Pre-hibernation mating by a solitary bee, Ceratina flavipes
(Hymenoptera: Apidae: Xylocopinae). J. Nat. Hist. 40: 2101–2110.
Kidokoro, M., T. Kikuchi, and M. Hirata. 2003. Prehibernal insemination and short dispersal of Ceratina flavipes
(Hymenoptera: Anthophidae) in northernmost Japan. Ecol. Res. 18: 99–102. 66
Kirby, K. S. 1965. Isolation and characterization of ribosomal ribonucleic acid. Biochem. J. 96: 266–269.
Kocher, S. D., and R. J. Paxton. 2014. Comparative methods offer powerful insights into social evolution in bees.
Apidologie. 45: 289–305.
Kocher, S. D., L. Pellissier, C. Veller, J. Purcell, M. A. Nowak, M. Chapuisat, and N. E. Pierce. 2014.
Transitions in social complexity along elevational gradients reveal a combined impact of season length and
development time on social evolution. Proc. R. Soc. B Biol. Sci. 281: 20140627.
Konovalov, D. A., C. Manning, and M. T. Henshaw. 2004. KINGROUP: A program for pedigree relationship
reconstruction and kin group assignments using genetic markers. Mol. Ecol. Notes. 4: 779–782.
Kopelman, N. M., J. Mayzel, M. Jakobsson, and N. A. Rosenberg. 2015. CLUMPAK : a program for identifying
clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 15: 1179–1191.
Kukuk, P. F., and P. C. Decelles. 1986. Behavioral Evidence for Population Structure in Lasioglossum ( Dialictus )
zephyrum Female Dispersion Patterns. Behav. Ecol. Sociobiol. 19: 233–239.
Kukuk, P. F., and G. K. Sage. 1994. Reproductivity and relatedness in a communal halictine bee Lasioglossum
(Chilalictus) hemichalceum. Insect Mol. Biol. 41: 443–455.
Kukuk, P. F., and M. Schwarz. 1988. Macrocephalic bees as functional reproductives and probable guards. Pan-
Pac. Entomol. 64: 131–137.
Leadbeater, E., J. M. Carruthers, J. P. Green, N. S. Rosser, and J. Field. 2011. Nest inheritance is the missing
source of direct fitness in a primitively eusocial insect. Science (80-. ). 333: 874–876.
Lewis, V., and M. H. Richards. 2017. Experimentally induced alloparental care in a solitary carpenter bee. Anim.
Behav. 123: 229–238.
Lin, N., and C. D. Michener. 1972. Evolution of Sociality in Insects. Q. Rev. Biol. 47: 131–159.
Lin, X., and L. C. Lavine. 2018. Endocrine regulation of a dispersal polymorphism in winged insects: a short
review. Curr. Opin. Insect Sci. 25: 20–24.
Linksvayer, T. A., and M. J. Wade. 2005. The evolutionary origin and elaboration of sociality in the aculeate
Hymenoptera: maternal effects, sib‐social effects, and heterochrony. Q. Rev. Biol. 80: 317–336.
Lock, C., and S. Cordingley. 2008. Vegetation Management Plan: Henley South & West Beach Dune Reserve, SA
Urban Forest Biodiversity Program. 67
López-Uribe, M. M., J. H. Cane, R. L. Minckley, and B. N. Danforth. 2016. Crop domestication facilitated rapid
geographical expansion of a specialist pollinator, the squash bee Peponapis pruinosa. Proc. R. Soc. B Biol.
Sci. 283: 20160443.
López-Uribe, M. M., S. J. Morreale, C. K. Santiago, and B. N. Danforth. 2015. Nest suitability, fine-scale
population structure and male-mediated dispersal of a solitary ground nesting bee in an urban landscape. PLoS
One. 10: 1–20.
López-Uribe, M. M., K. R. Zamudio, C. F. Cardoso, and B. N. Danforth. 2014. Climate, physiological tolerance
and sex-biased dispersal shape genetic structure of Neotropical orchid bees. Mol. Ecol. 23: 1874–1890.
Lucas, E. R., and J. Field. 2011. Active and effective nest defence by males in a social apoid wasp. Behav. Ecol.
Sociobiol. 65: 1499–1504.
Luikart, G., F. W. Allendorf, and W. B. Sherwin. 1998. Distortion of Allele Frequency Distributions Bottlenecks.
J. Hered. 238–247.
Luikart, P. S., and J. M. Cornuet. 1999. BOTTLENECK: a computer program for detecting recent reduction in
the effective population size using allele frequency data. J. Hered. 90: 502–503.
Maeta, Y., E. Asensio de la Sierra, and S. F. Sakagami. 1997. Compartative Studies on the in-nest behaviors of
small carpenter bees, the genus Ceratina (Hymenoptera, Anthophoridae, Xylocopinae) I. Ceratina (Ceratina)
cucurbitina, Part 2. Entomol. Soc. Japan. 65: 471–481.
Magrath, R. D., and S. M. Yezerinac. 1997. Facultative helping does not influence reproductive success or
survival in cooperatively breeding white-browed scrubwrens. J. Anim. Ecol. 66: 658–670.
Matthysen, E. 2012. Multicausality of dispersal: a review, pp. 3–18. In Clobert, J., Baguette, M., Benton, T.G.,
Bullock, J.M. (eds.), Dispersal Ecol. Evol. Oxford University Press, Oxford, UK.
Michener, C. D. 1962. The genus Ceratina in Australia, with notes on its nests (Hymenoptera : Apoidea). J. Kansas
Entomol. Soc. 35: 414–421.
Michener, C. D. 1974. The social behavior of the bees: a comparative study. Harvard University Press, Cambridge,
MA USA.
Michener, C. D. 1990. Castes in Xylocopine bees, pp. 123–146. In Engels, W. (ed.), Soc. Insects an Evol. Approach
to Castes Reprod. Springer-Verlag, New York. 68
Michener, C. D. 2007. The bees of the world, 2nd ed. The John Hopkins University Press, Baltimore, MD.
Michener, C. D., and M. Amir. 1977. The seasonal cycle and habitat of a tropical bumble bee. Pacific Insects. 17:
237–240.
Michener, C. D., and D. J. Brothers. 1974. Were workers of eusocial hymenoptera initially altruistic or oppressed?
Proc. Natl. Acad. Sci. 71: 671–674.
Mikát, M., C. Franchino, and S. M. Rehan. 2017. Sociodemographic variation in foraging behavior and the
adaptive significance of worker production in the facultatively social small carpenter bee, Ceratina calcarata.
Behav. Ecol. Sociobiol. 71: 135.
Minckley, R. L., and S. L. Buchmann. 1990. Territory site selection of male Xylocopa (Neoxylocopa) varipuncta
(Hymenoptera: Anthophoridae. J. Kansas Entomol. Soc. 63: 329–339.
Niitepõld, K., A. D. Smith, J. L. Osborne, D. R. Reynolds, L. Carreck, A. P. Martin, J. H. Marden, O.
Ovaskainen, I. Hanski, K. Niitep, A. D. Smith, J. L. Osborne, D. R. Reynolds, N. L. Carreck, A. P.
Martin, J. H. Marden, O. Ovaskainen, and I. Hanski. 2009. Flight Metabolic Rate and Pgi Genotype
Influence Butterfly Dispersal Rate in the Field. Ecology. 90: 2223–2232.
Nonacs, P. 2011. Kinship, greenbeards, and runaway social selection in the evolution of social insect cooperation.
Proc. Natl. Acad. Sci. U. S. A. 108 Suppl: 10808–10815.
Page, R. E., and R. A. Metcalf. 1982. Multiple Mating , Sperm Utilization , and Social Evolution. Am. Nat. 119:
263–281.
Paxton, R. J. 2005. Male mating behaviour and mating systems of bees: an overview. Apidologie. 36: 145–156.
Peakall, R., and P. E. Smouse. 2006. GENALEX 6: Genetic analysis in Excel. Population genetic software for
teaching and research. Mol. Ecol. Notes. 6: 288–295.
Peckham, D. J. 1977. Reduction of Miltogrammine cleptoparasitism by male Oxybelus subulatus (Hymenoptera:
Sphecidae). Ann. Entomol. Soc. Am. 70: 823–828.
Perkins, R. C. . 1912. Notes, with descriptions of new species, on aculeate Hymenoptera of the Australian region.
Ann. Mag. Nat. Hist. 8: 96–121.
Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure using multilocus genotype
data. Genetics. 155: 945–959. 69
Pritchard, J. K., X. Wen, and D. Falush. 2010. Documentation for structure software : Version 2 . 3.
(http://pritch.bsd.uchicago.edu/software/readme_structure2.pdf).
Pusey, A. E. 1987. Sex-biased dispersal and inbreeding avoidance in birds and mammals. Trends Ecol. Evol. 2:
295–299.
Queller, D. C., and K. F. Goodnight. 1989. Estimating relatedness using genetic markers. Evolution (N. Y). 43:
258–275.
Quiñones, A. E., and I. Pen. 2017. A unified model of Hymenopteran preadaptations that trigger the evolutionary
transition to eusociality. Nat. Commun. 8: 1–13.
R Core team. 2017. R: a language and environment for statistical computing. R Found. Stat. Comput. Vienna,
Austria. URL http//www.R-project.org/.
Rehan, S. M., R. Leys, and M. P. Schwarz. 2012. A mid-cretaceous origin of sociality in xylocopine bees with
only two origins of true worker castes indicates severe barriers to eusociality. PLoS One. 7: e34690.
Rehan, S. M., and M. H. Richards. 2010. Nesting biology and subsociality in Ceratina calcarata (Hymenoptera:
Apidae). Can. Entomol. 142: 65–74.
Rehan, S. M., and M. H. Richards. 2013. Reproductive aggression and nestmate recognition in a subsocial bee.
Anim. Behav. 85: 733–741.
Rehan, S. M., M. H. Richards, M. Adams, and M. P. Schwarz. 2014. The costs and benefits of sociality in a
facultatively social bee. Anim. Behav. 97: 77–85.
Rehan, S. M., M. H. Richards, and M. P. Schwarz. 2009. Evidence of social nesting in the Ceratina of Borneo
(Hymenoptera: Apidae). J. Kansas Entomol. Soc. 82: 194–209.
Rehan, S. M., M. H. Richards, and M. P. Schwarz. 2010. Social polymorphism in the Australian small carpenter
bee, Ceratina (Neoceratina) australensis. Insectes Soc. 57: 403–412.
Rehan, S. M., M. P. Schwarz, and M. H. Richards. 2011. Fitness consequences of ecological constraints and
implications for the evolution of sociality in an incipiently social bee. Biol. J. Linn. Soc. 103: 57–67.
Rehan, S. M., and A. L. Toth. 2015. Climbing the social ladder: The molecular evolution of sociality. Trends Ecol.
Evol. 30: 426–433.
Rehan, S., and M. Schwarz. 2015. A few steps forward and no steps back: Long-distance dispersal patterns in 70
small carpenter bees suggest major barriers to back-dispersal. J. Biogeogr. 42: 485–494.
Reyer, H.-U. 1984. Investment and relatedness: A cost/benefit analysis of breeding and helping in the pied
kingfisher (Ceryle rudis). Anim. Behav. 32: 1163–1178.
Richards, M. H., D. French, and R. J. Paxton. 2005. It’s good to be queen: Classically eusocial colony structure
and low worker fitness in an obligately social sweat bee. Mol. Ecol. 14: 4123–4133.
Ross, K. G., and J. M. Carpenter. 1991. Population genetic structure, relatedness, and breeding systems, pp. 451–
479. In Ross, K.G., Matthews, R.W. (eds.), Soc. Biol. Wasps. Cornell University Press.
Ross, K. G., and D. D. Shoemaker. 1997. Nuclear and mitochondrial genetic structure in two social forms of the
fire ant Solenopsis invicta: Insights into transitions to an alternate social organization. Heredity (Edinb). 78:
590–602.
Rousset, F. 2008. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and
Linux. Mol. Ecol. Resour. 8: 103–106.
Sakagami, S. F., and Y. Maeta. 1977. Some presumably presocial habits of Japanese Ceratina bees, with notes on
various social types in Hymenoptera. Insectes Soc. 24: 319–343.
Sakagami, S. F., and Y. Maeta. 1984. Multifemale nests and rudimentary castes in the normally solitary bee
Ceratina japonica (Hymenoptera: Xylocopinae). J. Kansas Entomol. Soc. 57: 639–656. dos Santos, C. F. 2018. Cooperation and antagonism over time : a conflict faced by males of Tetragonisca
angustula in nests. Insectes Soc. 1–7.
Schmid-Hempel, P., R. Schmid-Hempel, P. C. Brunner, O. D. Seeman, and G. R. Allen. 2007. Invasion success
of the bumblebee, Bombus terrestris, despite a drastic genetic bottleneck. Heredity (Edinb). 99: 414–422.
Schuelke, M. 2000. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 18: 233–
234.
Schwarz, M. P. 1987. Intra-colony relatedness and sociality in the allodapine bee Exoneura bicolor. Behav. Ecol.
21: 387–392.
Seger, J. 1983. Partial bivoltinism may cause SR biases that favour eusociality. Nature. 301: 59–62.
Selkoe, K. A., and R. J. Toonen. 2006. Microsatellites for ecologists: A practical guide to using and evaluating
microsatellite markers. Ecol. Lett. 9: 615–629. 71
Sen, R., and R. Gadagkar. 2006. Males of the social wasp Ropalidia marginata can feed larvae, given an
opportunity. Anim. Behav. 71: 345–350.
Shell, W. A., and S. M. Rehan. 2016. Development of multiple polymorphic microsatellite markers for Ceratina
calcarata (Hymenoptera: Apidae) using genome-wide analysis. J. Insect Sci. 16: 1–4.
Shell, W. A., and S. M. Rehan. 2017. Range Expansion of the Small Carpenter Bee Ceratina smaragdula across
the Hawaiian Archipelago with Potential Ecological Implications for Native Pollinator Systems. Pacific Sci.
71: 1–15.
Shell, W. A., and S. M. Rehan. 2018. The price of insurance: costs and benefits of worker production in a
facultatively social bee. Behav. Ecol. 29: 204–211.
Sivertsen, D., and L. Metcalfe. 1995. Natural vegetation of the southern wheat-belt (Forbes and Cargelligo 1: 250
000 map sheets). Cunninghamia. 4: 103–128.
Smith, A. R., W. T. Wcislo, and S. O’Donnell. 2008. Body size shapes caste expression, and cleptoparasitism
reduces body size in the facultatively eusocial bees Megalopta (Hymenoptera: Halictidae). J. Insect Behav. 21:
394–406.
Smith, B. H., and M. Ayasse. 1987. Kin-based male mating preferences in two species of halictine bee. Behav.
Ecol. Sociobiol. 20: 313–318.
Sokolowski, M. B. 2001. Drosophila: genetics meets behaviour. Nat. Rev. Genet. 2: 879–890.
Soro, A., M. Ayasse, M. U. Zobel, and R. J. Paxton. 2009. Complex sociogenetic organization and the origin of
unrelated workers in a eusocial sweat bee, Lasioglossum malachurum. Insectes Soc. 56: 55–63.
Soro, A., J. J. G. Quezada-Euan, P. Theodorou, R. F. A. Moritz, and R. J. Paxton. 2017. The population
genetics of two orchid bees suggests high dispersal, low diploid male production and only an effect of island
isolation in lowering genetic diversity. Conserv. Genet. 18: 607–619.
Spear, D. M., S. Silverman, and J. R. K. Forrest. 2016. Asteraceae Pollen Provisions Protect Osmia Mason Bees
(Hymenoptera: Megachilidae) from Brood Parasitism. Am. Nat. 187: 797–803.
Stevens, M. I., K. Hogendoorn, and M. P. Schwarz. 2007. Evolution of sociality by natural selection on variances
in reproductive fitness: evidence from a social bee. BMC Evol. Biol. 7: 153.
Subramoniam, T. 2017. Emergence of eusociality in aquatic environment: Synalpheid shrimps show the way! 72
Indian J. Geo-Marine Sci. 46: 1511–1518.
Taborsky, M. 1984. Broodcare helpers in the Cichlid fish Lamprologus brichardi:Their costs and benefits. Anim.
Behav. 32: 1236–1252.
Tamang, R., G. Chaubey, A. Nandan, P. Govindaraj, V. K. Singh, N. Rai, C. B. Mallick, V. Sharma, V. K.
Sharma, A. M. Shah, A. Lalremruata, A. G. Reddy, D. S. Rani, P. Doviah, N. Negi, Y. Hadid, V. Pande,
S. Vishnupriya, G. van Driem, D. M. Behar, T. Sharma, L. Singh, R. Villems, and K. Thangaraj. 2018.
Reconstructing the demographic history of the Himalayan and adjoining populations. Hum. Genet.
Taylor, P. D. 1992. Altruism in viscous populations - an inclusive fitness model. Evol. Ecol. 6: 352–356.
Tofts, C., and N. R. Franks. 1992. Doing the Right Thing : Ants , Honevbees and Naked Mole-rats. Tree. 7: 346–
349.
Trivers, R. L., and H. Hare. 1976. Haplodiploidy and the evolution of the social insects. Sci. (Washington, D.C.).
191: 249–263.
Tsutsui, N. D., and A. V Suarez. 2003. The Colony Structure and Population Biology of Invasive Ants. Conserv.
Biol. 17: 48–58.
Ulrich, Y., N. Perrin, and M. Chapuisat. 2009. Flexible social organization and high incidence of drifting in the
sweat bee, Halictus scabiosae. Mol. Ecol. 18: 1791–1800.
Wade, M. J. 2001. Maternal effect genes and the evolution of sociality in haplo-diploid organisms. Evolution (N.
Y). 55: 453–458.
Wcislo, W. T. 1996. Parasitism rates in relation to nest site in bees and wasps (Hymenoptera: Apoidea). J. Insect
Behav. 9: 643–656.
Wcislo, W. T., and J. H. Cane. 1996. Floral resource utilization by solitary bees (Hymenoptera:Apoidea) and
exploitation of their stored food by natural enemies. Annu. Rev. Entomol. 41: 257–286.
West-Eberhard, M. J. 1983. Sexual selection, social competition, and speciation. Q. Rev. Biol. 58: 155–183.
West-Eberhard, M. J. 1987. Flexible Strategy and Social Evolution. Anim. Soc. Theor. facts.
West, S. A., A. S. Griffin, and A. Gardner. 2007a. Evolutionary explanations for cooperation. Curr. Biol. 17: 661–
672.
West, S. A., A. S. Griffin, and A. Gardner. 2007b. Social semantics: Altruism, cooperation, mutualism, strong 73
reciprocity and group selection. J. Evol. Biol. 20: 415–432.
Wilson, D. S., G. B. Pollock, and L. A. Dugatkin. 1992. Can altruism evolve in purely viscous populations? Evol.
Ecol. 6: 331–341.
Wilson, E. O. 1971. The insect societies. Harvard University Press, Cambridge, USA.
Wilson, E. O. 1975. Sociobiology: the new synthesis. Harvard University Press, Cambridge, USA.
Yagi, N., and E. Hasegawa. 2012. A halictid bee with sympatric solitary and eusocial nests offers evidence for
Hamilton’s rule. Nat. Commun. 3: 1–7.
Yanega, D. 1990. Philopatry and nest founding in a primitively social bee, Halictus rubicundus. Behav. Ecol.
Sociobiol. 27: 37–42.
Yanega, D. 1992. Does Mating Determine Caste in Sweat Bees ? ( Hymenoptera : Halictidae ). J. Kansas Entomol.
Soc. 65: 231–237.
Zayed, A., and L. Packer. 2005. Complementary sex determination substantially increases extinction proneness of
haplodiploid populations. Proc. Natl. Acad. Sci. U. S. A. 102: 10742–6.
74
Tables and Figures
Chapter 1
75
Figure 1. Map of Australia indicating all known C. australensis collection sites (circles) and the
Murray-Darling River Basin (red outline). Red circles denote populations sampled for use in this study; blue circles denote other collection sites, recorded by the Atlas of Living Australia
(ala.org.au) and Michener (1962). 76
Figure 2. Microsatellite summary characteristics averaged across loci for each population.
Characteristics were compared using the Conover-Iman test for multiple comparisons. Na = number of alleles; Ae = number of effective alleles considering allele frequency; Ho = observed heterozygosity; He = expected heterozygosity. Asterisks denote comparisons between SA only as no significance was detected between QLD and VIC. *p<0.05 **p<0.01 ***p<0.001 77
78
Figure 3. STRUCTURE output of K = 3 clusters represented by three colors (blue = QLD, purple = VIC, Orange = SA) and frequency distribution, a) using a priori population information and b) with no a priori information . Individual bands represent individual genotypes while the proportion of color within each band is proportional to the likelihood of belonging to each cluster. 79
Figure 4. Allele distribution histograms for each population. Bottlenecks are detectable if the frequency of rare alleles (0-0.1) is less than the frequency of alleles occurring at a higher frequency (>0.1) 80
Table 1. Primer sequences and locus characteristics of C. australensis microsatellite loci. Ta =
primer specific annealing temperature (degrees Celsius).
Locus Primer Sequence GenBank Repeat Motif Allele Size Range Ta Caust11 F: CGAAATGGGCTTCTCCACCT MH061300 TAACC 238-288 55 R: CACACTCAGATGACTCCCGG Caust21 F: AAGAAGGAAGGAGGCAAGGC MH061301 GGAC 250-262 55 R: TCGTACCCTTCCTCTCTCCC Caust29 F: GACGGTCGGAGTACATCGTG MH061302 TATG 211-229 55 R: CCGTGTCGTGTAACGCCTAT Caust35 F: TGTAAACGAGCCAGCAGGAG MH061303 TATG 236-274 54 R: TAACGCGTTAGCTGTTCGGT Caust42 F: CGGAAATTATGTCCAGCGCG MH061304 CGTA 172-184 67 F: GAATCTCGTCTGACGGTGCA Caust43 F: CGAAAGGTGTGACTGGTCGA MH061305 ACGC 173-217 55 R: TACAGGTCTATTCGGCCGGA Caust44 F: TCGGAGCGATGTGAATCGAG MH061306 CAGG 230-254 55 R: CCGCCTCTTATCGACGGATC Caust50 F: CTCGACCACAGAGACATCGG MH061307 AGCA 201-213 54 R: CGCGTTTTCTTCTCCAACCG
81
Table 2. Summary characteristics of microsatellite markers averaged across loci. N = number of individuals; Na = number of alleles; Ae = number of effective alleles considering allele frequency;
Ho = observed heterozygosity; He = expected heterozygosity; HWE p = probability of deviation from Hardy Weinberg Equilibrium; Bonferroni alpha = level of significance after Bonferroni correction for multiple comparisons, significant deviations from HWE after correction are in bold. Chi-square test statistics are reported for each characteristic. d.f. = 2 for all comparisons.
Population Locus N Na Ae Ho He HWE p
Queensland Mean 14.63 3.75 2.31 0.58 0.54 0.28
SE 0.26 0.59 0.25 0.07 0.04
Victoria Mean 11.00 3.50 2.13 0.45 0.46 0.76
SE 0.00 0.57 0.28 0.08 0.08
South Australia Mean 30.75 2.38 1.32 0.19 0.21 0.62
SE 0.16 0.32 0.10 0.06 0.06 Chi-Square 3.75ns 9.93** 10.71** 9.93** ns=p>0.05 **=p<0.01
82
Table 3. Microsatellite loci descriptions across populations. N = number of individuals; Na = number of alleles; Ae = number of effective alleles considering allele frequency; Ho = observed heterozygosity; He = expected heterozygosity; HWE p = probability of deviation from Hardy
Weinberg Equilibrium; Bonferroni alpha = level of significance after Bonferroni correction for multiple comparisons. Values significant after Bonferroni correction are highlighted in bold.
Locus N Na Ae Ho He HWE p Bonferroni alpha Caust35 56 3.000 1.658 0.375 0.397 0.350 0.006 Caust50 57 4.000 1.261 0.158 0.207 0.099 0.007 Caust42 57 4.000 1.610 0.333 0.379 0.239 0.008 Caust43 56 10.000 2.715 0.518 0.632 0.001 0.010 Caust44 57 7.000 2.317 0.561 0.568 0.036 0.013 Caust11 55 4.000 1.517 0.164 0.341 0.000 0.017 Caust21 56 4.000 1.622 0.232 0.383 0.002 0.025 Caust29 57 5.000 1.709 0.404 0.415 0.422 0.050 Mean 56.375 5.125 1.801 0.343 0.415 <0.0001 - SE 0.263 0.811 0.168 0.054 0.047 - -
Table 4. Results of AMOVA comparing allelic frequencies among 57 non-related females from the three populations of C. australensis.
AMOVA Sum of Variance Percentage Source of variation d.f. squares components of variation Among populations 2 31.98 0.428 23.67 Among individuals within populations 54 75.74 0.021 1.18 Within individuals 57 77.5 1.36 75.15 Total 113 185.22 1.809
83
Table 5. Pairwise FST and Dest values among studied populations. FST values from a previous study using mitochondrial CO1 variation and from this study as well as Dest values for this study.
All FST values are significant at p<0.0001 and Dest values are significant at p = 0.003. n mtDNA
= (QLD: 30, VIC:42, SA: 19); n msat = (QLD:15, VIC:11, SA:31). FST values measure fixation while Dest values measure differentiation (Jost 2008). Microsatellite and mtDNA fixation are both greater between VIC and SA compared to QLD and VIC, however microsatellite fixation is greatest between QLD and SA while mtDNA fixation is greatest between VIC and SA.
Microsatellite differentiation is greatest between QLD and SA and lowest between VIC and SA.
The contrast between FST and Dest demonstrates that while VIC and SA are characterized by varying levels of heterozygosity, these two populations share a high proportion of similar alleles.
mtDNA FST MSAT FST MSAT Dest
QLD-SA 0.43 0.33 0.26
QLD-VIC 0.36 0.13 0.15
VIC-SA 0.59 0.18 0.10
84
Chapter 2
85
Fig. 1 Reproductive productivity of different nesting strategies observed by C. australensis.
There was no difference in average clutch size or average live brood by nesting strategy at p<0.05. Solitary nests had a significantly greater proportion of offspring alive, not parasitized or visibly dead, at the time of collection compared to bisex nests. No other pair-wise comparison was significant. Sample size for each strategy are: Solitary 186; Bisex rep. 6; Social rep. 11;
Secondary 6. Error bars represent standard error. **p<0.01 86
Fig. 2. Average PCBP, which controls for the number of adults within each nest, differed between nesting strategies. Bisex nests did not significantly differ from either solitary or social nests when using clutch size but had significantly less number of live brood produced per individual. Error bars represent standard error. *p<0.05, **p<0.01 87
Fig. 3. Average fitness of each reproductive strategy. Reproductive strategies were each significantly greater than non-reproductive strategies but did not differ from each other. Male fitness was equal to zero and is not shown. NR= non- reproductive. Asterisks denote differences compared to reproductive strategies. Error bars represent standard error. ***p<0.005
88
Table 1 Social nesting composition of active brood and full brood (AB/FB) nests collected in
QLD, VIC, and SA of C. australensis from 2015-2017. The percentages of social and bisex nests are calculated from the total number of AB/FB nests collected within each site and year.
Bisex nests were predominately found within SA in 2016.
Number of Number of Percentage Number of Percentage Site Year AB/FB Nests Social Nests Social Bisex Nests Bisex 2015 55 2 3.6 0 0.0 QLD 2016 86 3 3.5 2 2.3 2017 50 5 10.0 0 0.0 2015 154 4 2.6 1 0.6 SA 2016 147 17 11.6 13 8.8 2017 26 1 3.8 1 3.8 2015 19 0 0.0 0 0.0 VIC 2016 29 3 10.3 0 0.0 2017 15 4 26.7 0 0.0 Total 581 39 6.7 17 2.9 89
Table 2 Relatedness coefficient estimates calculated for relationships across C. australensis range. Mono solitary = singly mated solitary nests; Multi solitary = multiply mated solitary nests;
Social 2 females = social nests with clear primary and secondary females; Social 3-4 females = social nests containing 3-4 related females; Social related females = all social nests except those containing unrelated adult females; Solitary combined = all solitary nests. Sisters-brothers/males- females comparison represent the average pair-wise relatedness between brothers and sisters in social and solitary nests, and between adult males and females in bisex nests. Significant p values are highlighted in bold. *the one pairwise comparison between sisters in bisex nests was not used to calculate the t statistic. Superscripts denote differences between groups 90