DOCSLIB.ORG

16S Rrna Sequence Determination for Carnobacterium and Related

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
16S Rrna Sequence Determination for Carnobacterium and Related INTERNATIONALJOURNAL OF SYSTEMATICBACTERIOLOGY, July 1990, p. 224-230 Vol. 40, No. 3 0020-7713/90/030224-07$02.00/0 Copyright 0 1990, International Union of Microbiological Societies 16s rRNA Sequence Determination for Members of the Genus Carnobacterium and Related Lactic Acid Bacteria and Description of Vagococcus salmoninarum sp. nov. S. WALLBANKS,l A. J. MARTINEZ-MURCIA,l J. L. FRYER,2 B. A. PHILLIPS,l AND M. D. COLLINS1* Department of Microbiology, Agricultural and Food Research Council Institute of Food Research, Reading Laboratory, Shinfield, Reading, RG2 9AT, United Kingdom,' and Department of Microbiology, Oregon State University, Corvallis, Oregon 97331 -38M2 The phylogenetic interrelationships of members of the genus Carnobacterium and some atypical lactobacilli isolated from diseased salmonid fish were investigated by using reverse transcriptase sequencing of 16s rRNA. The four species Carnobacterium piscicola, Carnobacterium divergens, Carnobacterium gallinarum, and Carnobacterium mobile exhibited a high degree of sequence similarity with each other (ca. 96 to 98%) and formed a phylogenetically coherent group that was quite distinct from all other lactic acid bacteria. The sequence data clearly demonstrated that carnobacteria are phylogenetically closer to the genera Enterococcus and Vagococcus than to members of the genus Lactobacillus. The strains from fish were found to be phylogenetically related to the genus Vagococcus and represent a new species, Vagococcus salmoninarum. The type strain of Vagococcus salmoninarum is strain NCFB 2777. The genus Carnobacterium was proposed by Collins et al. in Oregon, and strain Rangen 128-81 was isolated from an (4) to accommodate the species Lactobacillus piscicola (17) adult rainbow trout (Oncorhynchus mykiss) at a trout hatch- and Lactobacillus divergens (18) and some so-called atypical ery near Buhl, Idaho. Cultures were checked for purity, lactobacilli isolated from poultry meat (24). Currently, four harvested by centrifugation, and washed in distilled water. species, Carnobacterium piscicola (type species), Carno- rRNA extraction and determination of rRNA sequence. bacterium divergens, Carnobacterium gallinarum, and Car- Total cellular rRNA was extracted from ca. 2 g (wet weight) nobacterium mobile are recognized in this genus (4). Al- of cells (6). Nucleotide sequences were determined by the though these four species form a phenotypically coherent dideoxynucleotide method, using avian myeloblastosis virus group (4, 9), the separateness of the genus Carnobacterium reverse transcriptase. Most of the sequences of the oligonu- (in particular its relationship to the genus Lactobacillus) cleotide primers and their 16s rRNA target sites have been remains unclear. Members of the genus Carnobacterium described previously by Lane et al. (20) and Embley et al. differ from Lactobacillus species by their inability to grow on acetate medium (4, 9) and by their synthesis of oleic acid (6); a DNA primer having the sequence 5'-TCACCCTCT (c18:1A9,10) instead of cis-vaccenic acid (c18:1A11,12), CAGGTCGGCTA was used for the region at ca. position 300 which is produced by lactobacilli (4). At present these are (complementary to positions 287 to 306; Escherichia coli). the only criteria which distinguish the two genera. The products of the sequencing reactions were separated on Sequencing of 16s rRNA by reverse transcriptase (20, 21) 55-cm wedge-shaped (0.2- to 0.6-mm) 6% (wthol) polyacryl- is currently the most rapid and powerful technique for amide denaturing (7 M urea) gels at 55°C by using an LKB elucidating the natural relationships of microorganisms (26). model Macrophor 2010 sequencing unit operated at 50 W per This method produces long stretches of sequence (ca. 95% of gel. the total sequence), which enables precise phylogenetic Analysis of rRNA sequence data. The sequences were relationships to be determined (26). In this study we deter- aligned, and the homology values determined by using the mined 16s rRNA primary structures for members of the Microgenie program (Beckman Instruments, Inc.) (22). Nu- genus Carnobacterium by using reverse transcription in an cleotide substitution rates (K,,, values) were calculated attempt to clarify the relationship of these organisms to the (19), and an unrooted phylogenetic tree or network was genus Lactobacillus and other lactic acid bacteria. In addi- produced by using the algorithm of Fitch and Margoliash (10) tion, the phylogenetic position of two representative strains contained in a program written by Felsenstein (8) (PHYLIP belonging to a group of atypical lactobacilli isolated from version 3.1) for IBM personal computers. salmonid fish was also determined. DNA studies. DNA was prepared by using a modification (7) of the method of Garvie (11).DNA base composition was MATERIALS AND METHODS estimated by thermal denaturation in standard saline citrate Cultures and cultivation. The test strains which we used as described by Garvie (ll), using DNA from E. coli K-12 are shown in Table 1. Strains of carnobacteria, enterococci, strain NCDO 1984 (51.5 mol% guanine plus cytosine) as the lactococci, leuconostocs, pediococci, and streptococci and standard. DNA-DNA hybridizations were performed by fish isolates OS1-68T (T = type strain) and Rangen 128-81 using the membrane filter technique described previously were grown in YGPB broth (12) at 30°C. Strains OS1-68T and (13). Rangen 128-81 were isolated by R.A. Holt, Oregon Depart- Fatty acid analyses. Fatty acids were extracted from dry ment of Fish and Wildlife; strain OS1-68T was isolated in cells by acid methanolysis, and purified methyl esters were 1968 from an adult rainbow trout at the Oak Spring Hatchery examined by capillary gas liquid chromatography as de- scribed prevtously (4). The positions of double bonds in * Corresponding author. unsaturated acids were determined by dimethyl disulfide 224 TABLE 1. Homology for a 1,340-nucleotide region of 16s rRNAs from carnobacteria and other strains % Homology with strain: Vagococcus Strain NCDO NCFB NCFB NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO NCDO s$mz'- 2763T 2766T 2765T 2762T 2674= 596T 2369T 2160 213T 1750T 2156 2118 523T 1832T 651 573T 643 2497 NCFB 217it Bacillus subtilis NCDO 1769T 90.1 90.4 90.2 90.5 91.2 91.1 91.4 89.1 87.9 87.0 85.2 86.2 86.4 89.3 88.0 85.9 86.3 89.7 89.9 Camobacterium divergens NCDO 2763= 97.0 96.0 97.5 94.3 94.6 94.2 88.9 87.7 89.3 87.4 88.5 87.5 91.6 89.7 88.9 89.2 93.4 94.1 Camobacterium gallinarum NCFB 2766= 95.7 98.7 93.9 94.1 94.4 89.2 87.8 89.0 87.7 88.3 87.0 91.3 90.2 88.0 88.5 92.3 93.2 Camobacterium mobile NCFB 2765= 96.3 93.6 93.7 92.6 88.8 87.7 89.2 87.6 88.1 86.3 91.2 88.7 87.5 87.5 93.4 93.7 Carnobacteriumpiscicola NCDO 2762T 94.3 94.7 94.7 89.9 89.0 89.9 88.4 88.1 86.7 91.8 89.9 88.9 89.3 93.4 93.8 Enterococcus cecorum NCDO 2674= 96.7 96.8 89.6 88.5 90.2 90.2 89.9 88.3 91.5 91.2 89.8 90.8 94.5 93.4 N Enterococcus durans NCDO 596= 98.3 90.4 88.4 89.5 89.5 89.5 88.1 92.1 91.3 90.7 90.8 94.6 94.5 Enterococcus avium NCDO 2369= 89.6 88.6 94.3 88.9 89.5 88.0 91.6 91.0 90.0 90.9 93.7 94.0 Lactobacillus okNCDO 2160 89.8 93.1 87.2 85.1 88.5 91.9 86.3 84.9 86.2 90.2 87.5 Lactobacillus delbrueckii NCDO 213= 89.0 86.8 85.7 87.5 89.5 86.0 84.4 84.2 88.0 87.4 Lactobacillusfermentum NCDO 1750T 87.8 85.8 87.6 92.0 87.4 86.0 87.0 89.9 87.0 Lactococcus garvieae NCDO 2156 95.0 85.9 87.9 92.3 89.9 90.9 87.3 87.8 Lactococcus lactis subsp. lacti3 NCDO 2118 84.6 89.6 91.9 91.4 91.7 87.5 88.4 Leuconostoc mesentemides NCDO 523= 88.3 87.9 86.3 86.7 87.7 86.3 Pedwcoccus damnosus NCDO 1832= 90.0 89.1 88.2 91.6 90.8 Streptococcusparaubek NCDO 651 94.5 96.5 89.3 88.9 Streptococcus thermophilus NCDO 573= 96.0 89.0 88.8 Streptococcus uberis NCDO 643 88.7 87.4 Vagococcus fluvialis NCDO 2497 96.3 226 WALLBANKS ET AL. INT.J. SYST. BACTERIOL. C.pi. C~G~AGA~CACCAGUGGC~GACUCU~~C~C~~~ C. ga. CGGW;AAAUGCGUAGAUAUGUGGAGGAACACCACUGGCGA C.di. CG~AGUCGCGAAGGCGA~~~~CGCWGGCUCGNAAGC~~~GGAU c.m. cGGUGAAAUGCGUAGWAUGUGGAGGAACACCAmK;GCGAA V.sa. CGGUGMWX~C~GA~CU~~~UGACA~~~ FIG. 1. Primary structures of 16s rRNAs from C. piscicola (C.pi.) NCDO 2762T, C. gaffinarum(C.ga.) NCFB 2766T, C. divergens (C.di.1 NCDO 2763T, C. mobile (C.mo.) NCFB 2765T, and V. salmoninarum (V.sa) NCFB 2777T as determined by using reverse transcriptase. The first nucleotide and last nucleotide in the sequences of C. piscicola, C. galfinarum, C. divergens, and V. salmoninarum are analogous to positions 1 and 1481 of the E. cofi 16s rRNA sequence (l), respectively, The sequence for determined C. mobile runs from position 107. The first nucleotide and last nucleotide in the long stretch (1,340 bases) used to calculate K,,, values correspond to positions 107 (G) and 1433 (A) in the E. cofi sequence, respectively. N, Undetermined nucleotide. Spaces in the sequences correspond to alignment gaps. derivitization and gas chromatography-mass spectrometry RESULTS AND DISCUSSION as described by Dunkelblum et al.
Load more

Recommended publications
  • The Israeli Journal of Aquaculture
    The Open Access Israeli Journal of Aquaculture – Bamidgeh As from January 2010 The Israeli Journal of Aquaculture - Bamidgeh (IJA) will be published exclusively as an on-line Open Access (OA) quarterly accessible by all AquacultureHub (http://www.aquaculturehub.org) members and registered individuals and institutions. Please visit our website (http://siamb.org.il) for free registration form, further information and instructions. This transformation from a subscription printed version to an on-line OA journal, aims at supporting the concept that scientific peer-reviewed publications should be made available to all, including those with limited resources. The OA IJA does not enforce author or subscription fees and will endeavor to obtain alternative sources of income to support this policy for as long as possible. Editor-in-Chief Published under auspices of Dan Mires The Society of Israeli Aquaculture and Marine Biotechnology (SIAMB) Editorial Board & University of Hawaiʻi at Mānoa Rina Chakrabarti Aqua Research Lab, Dept. of & Zoology, University of Delhi, India AquacultureHub Angelo Colorni National Center for Mariculture, http://www.aquaculturehub.org IOLR, Eilat, Israel Daniel Golani The Hebrew University of Jerusalem, Israel Hillel Gordin Kibbutz Yotveta, Arava, Israel ! Sheenan Harpaz Agricultural Research Organization, Beit Dagan, Israel Gideon Hulata Agricultural Research Organization Beit Dagan, Israel George Wm. Kissil National Center for Mariculture, IOLR, Eilat, Israel ! ! Ingrid Lupatsch Swansea University, Singleton Park,
    [Show full text]
  • CGM-18-001 Perseus Report Update Bacterial Taxonomy Final Errata
    report Update of the bacterial taxonomy in the classification lists of COGEM July 2018 COGEM Report CGM 2018-04 Patrick L.J. RÜDELSHEIM & Pascale VAN ROOIJ PERSEUS BVBA Ordering information COGEM report No CGM 2018-04 E-mail: [email protected] Phone: +31-30-274 2777 Postal address: Netherlands Commission on Genetic Modification (COGEM), P.O. Box 578, 3720 AN Bilthoven, The Netherlands Internet Download as pdf-file: http://www.cogem.net → publications → research reports When ordering this report (free of charge), please mention title and number. Advisory Committee The authors gratefully acknowledge the members of the Advisory Committee for the valuable discussions and patience. Chair: Prof. dr. J.P.M. van Putten (Chair of the Medical Veterinary subcommittee of COGEM, Utrecht University) Members: Prof. dr. J.E. Degener (Member of the Medical Veterinary subcommittee of COGEM, University Medical Centre Groningen) Prof. dr. ir. J.D. van Elsas (Member of the Agriculture subcommittee of COGEM, University of Groningen) Dr. Lisette van der Knaap (COGEM-secretariat) Astrid Schulting (COGEM-secretariat) Disclaimer This report was commissioned by COGEM. The contents of this publication are the sole responsibility of the authors and may in no way be taken to represent the views of COGEM. Dit rapport is samengesteld in opdracht van de COGEM. De meningen die in het rapport worden weergegeven, zijn die van de auteurs en weerspiegelen niet noodzakelijkerwijs de mening van de COGEM. 2 | 24 Foreword COGEM advises the Dutch government on classifications of bacteria, and publishes listings of pathogenic and non-pathogenic bacteria that are updated regularly. These lists of bacteria originate from 2011, when COGEM petitioned a research project to evaluate the classifications of bacteria in the former GMO regulation and to supplement this list with bacteria that have been classified by other governmental organizations.
    [Show full text]
  • Bacterial Fish Pathogens
    Bacterial Fish Pathogens Brian Austin • Dawn A. Austin Bacterial Fish Pathogens Disease of Farmed and Wild Fish Sixth Edition Brian Austin Dawn A. Austin Institute of Aquaculture School of Life Sciences University of Stirling Heriot-Watt University Stirling , UK Edinburgh , Scotland , UK ISBN 978-3-319-32673-3 ISBN 978-3-319-32674-0 (eBook) DOI 10.1007/978-3-319-32674-0 Library of Congress Control Number: 2016952087 4th edition: © Praxis Publishing Ltd, Chichester, UK, 2007 5th edition: © Springer Science+Business Media Dordrecht 2012 © Springer International Publishing Switzerland 2016 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifi cally the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfi lms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specifi c statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made.
    [Show full text]
  • Hydrolysis of Raw Fish Proteins Extracts by Carnobacterium Maltaromaticum Strains Isolated from Argentinean Freshwater Fish
    Journal Pre-proof Hydrolysis of raw fish proteins extracts by Carnobacterium maltaromaticum strains isolated from Argentinean freshwater fish Andrea Micaela Dallagnol (Conceptualization) (Methodology) (Investigation), Micaela Pescuma (Methodology) (Investigation), Natalia Gamarra Esp´ınola (Investigation), Mariela Vera (Investigation), Graciela Margarita Vignolo (Conceptualization) PII: S2215-017X(21)00005-9 DOI: https://doi.org/10.1016/j.btre.2021.e00589 Reference: BTRE 589 To appear in: Biotechnology Reports Received Date: 15 October 2019 Revised Date: 5 September 2020 Accepted Date: 31 December 2020 Please cite this article as: Dallagnol AM, Pescuma M, Esp´ınola NG, Vera M, Vignolo GM, Hydrolysis of raw fish proteins extracts by Carnobacterium maltaromaticum strains isolated from Argentinean freshwater fish, Biotechnology Reports (2021), doi: https://doi.org/10.1016/j.btre.2021.e00589 This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier. Hydrolysis of raw fish proteins extracts by Carnobacterium maltaromaticum strains isolated from Argentinean freshwater fish. Andrea Micaela Dallagnol*1,2, Micaela Pescuma3, Natalia Gamarra Espínola2, Mariela Vera2, Graciela Margarita Vignolo3 1Instituto de Materiales de Misiones (IMAM), Facultad de Ciencias Exactas, Químicas y Naturales (FCEQyN), CONICET, UNaM, (Felix de Azara 1552), Posadas, Argentina.
    [Show full text]
  • Does the Composition of the Gut Bacteriome Change During the Growth of Tuna?
    microorganisms Article Does the Composition of the Gut Bacteriome Change during the Growth of Tuna? Elsa Gadoin 1, Lucile Durand 1, Aurélie Guillou 1, Sandrine Crochemore 1 , Thierry Bouvier 1, Emmanuelle Roque d’Orbcastel 1 , Laurent Dagorn 1, Jean-Christophe Auguet 1, Antoinette Adingra 2, Christelle Desnues 3 and Yvan Bettarel 1,* 1 MARBEC, University Montpellier, CNRS, Ifremer, IRD, 34095 Montpellier, France; [email protected] (E.G.); [email protected] (L.D.); [email protected] (A.G.); [email protected] (S.C.); [email protected] (T.B.); [email protected] (E.R.d.); [email protected] (L.D.); [email protected] (J.-C.A.) 2 Centre de Recherches Océanologiques, Abidjan, Côte d’Ivoire; [email protected] 3 Mediterranean Insitute of Oceanodraphy (MIO), 13009 Marseille, France; [email protected] * Correspondence: [email protected] Abstract: In recent years, a growing number of studies sought to examine the composition and the determinants of the gut microflora in marine animals, including fish. For tropical tuna, which are among the most consumed fish worldwide, there is scarce information on their enteric bacterial communities and how they evolve during fish growth. In this study, we used metabarcoding of the 16S rDNA gene to (1) describe the diversity and composition of the gut bacteriome in the three most fished tuna species (skipjack, yellowfin and bigeye), and (2) to examine its intra-specific variability Citation: Gadoin, E.; Durand, L.; from juveniles to larger adults. Although there was a remarkable convergence of taxonomic richness Guillou, A.; Crochemore, S.; Bouvier, and bacterial composition between yellowfin and bigeyes tuna, the gut bacteriome of skipjack tuna T.; d’Orbcastel, E.R.; Dagorn, L.; was distinct from the other two species.
    [Show full text]
  • Taxonomy of Bacterial Fish Pathogens Brian Austin
    Austin Veterinary Research 2011, 42:20 http://www.veterinaryresearch.org/content/42/1/20 VETERINARY RESEARCH REVIEW Open Access Taxonomy of bacterial fish pathogens Brian Austin Abstract Bacterial taxonomy has progressed from reliance on highly artificial culture-dependent techniques involving the study of phenotype (including morphological, biochemical and physiological data) to the modern applications of molecular biology, most recently 16S rRNA gene sequencing, which gives an insight into evolutionary pathways (= phylogenetics). The latter is applicable to culture-independent approaches, and has led directly to the recognition of new uncultured bacterial groups, i.e. “Candidatus“, which have been associated as the cause of some fish diseases, including rainbow trout summer enteritic syndrome. One immediate benefit is that 16S rRNA gene sequencing has led to increased confidence in the accuracy of names allocated to bacterial pathogens. This is in marked contrast to the previous dominance of phenotyping, and identifications, which have been subsequently challenged in the light of 16S rRNA gene sequencing. To date, there has been some fluidity over the names of bacterial fish pathogens, with some, for example Vibrio anguillarum, being divided into two separate entities (V. anguillarum and V. ordalii). Others have been combined, for example V. carchariae, V. harveyi and V. trachuri as V. harveyi. Confusion may result with some organisms recognized by more than one name; V. anguillarum was reclassified as Beneckea and Listonella, with Vibrio and Listonella persisting in the scientific literature. Notwithstanding, modern methods have permitted real progress in the understanding of the taxonomic relationships of many bacterial fish pathogens. Table of contents 6. Taxonomic developments associated with specific 1.
    [Show full text]
  • First Isolation of Vagococcus Salmoninarum from Cultured Rainbow Trout (Oncorhynchus Mykiss, Walbaum) Broodstocks in Turkey
    Bull. Eur. Ass. Fish Pathol., 31(6) 2011, 235 First isolation of Vagococcus salmoninarum from cultured rainbow trout (Oncorhynchus mykiss, Walbaum) broodstocks in Turkey B. I. Didinen1*, A. Kubilay1, O. Diler1, S. Ekici1, E. E. Onuk2 and A. Findik3 1Suleyman Demirel University, Egirdir Fisheries Faculty, Egirdir, Isparta, Turkey; 2Ondokuz Mayıs University, Faculty of Veterinary Medicine, Department of Fish Diseases; 3Ondokuz Mayıs University, Faculty of Veterinary Medicine, Department of Microbiology, Samsun, Turkey Abstract In this study, we isolated Vagococcus salmoninarum for the first time from rainbow trout in Turkey. The disease outbreak occurred in post-spawning broodstocks at a water temperature of 12.6°C during March-April 2011. The cumulative mortality rate was approximately 55% within 2 months. Infected trout exhibited lethargy, a marked loss of equilibrium, anorexia, dark coloration, mono and bilateral exophthalmos, eyeball disruption, furuncles and erosive lesions on both sides of the body, hemorrhage in the abdomen, jaw, mouth, and anus, and prolapse of the anus. Necropsy findings included hyperemia, visceral hemorrhage, and fibrinous deposits in the heart (ventricle and atrium), liver, and spleen. Samples for bacteriological examinations were collected from the kidney, liver, spleen, and ovary by using sterile swabs; these samples were streaked onto trypticase soy agar plates, and incubated at 22°C for 48 h. Four bacterial isolates were obtained from sick fish. The Gram-positive V. salmoninarum isolates were identified by their morphological, physiological, and biochemical features. The identification was confirmed by PCR with the amplification of highly specific 16S rRNA gene for V. salmoninarum. Although the isolates were sensitive to erythromycin and doxycycline in vitro; antibiotic treatments were ineffective.
    [Show full text]
  • Carnobacterium Piscicola of Unusual Virulence
    DISEASES OF AQUATIC ORGANISMS Published November 18 Dis. aquat. Org. An epizootic in farmed, market-size rainbow trout in Spain caused by a strain of Carnobacterium piscicola of unusual virulence 'Departamento de Microbiologia y Parasitologia, Facultad de Biologia, Universidad de Santiago de Compostela, E-15706 Santiago de Cornpostela, Spain 'Institute de Investigaciones Marinas, CSIC, Eduardo Cabello 6, E-36208 Vigo, Spain ABSTRACT We report here the f~rstdescription In Spaln of a Carnobactenum straln causing important mortal~t~esin market-size rainbow trout Oncorhynchus mykiss Relevant cllnical signs In affected fish were a pronounced bilateral exophthalmia w~thper~ocular hemorrhages, accurnulat~onof ascitic flu~d. and hemorrhages in the liver, swimbladder muscle, and lntestlne Taxononuc studies conducted In companson with reference strains indicated that the present Isolate (PT-31)was Carnobactenuin p~sci- cola Agglutination assays demonstrated that this isolate was not serologically related to the reference stralns In addition, an analysis of the surface protelns revealed that different patterns occurred among the C piscicola isolates Although the ~mmunoblottingassays supported the antigenic heterogeneity within this specles all strains did share 2 major anhgenic proteins of 30 and 57 kDa Interestingly, this ~mmunoreactlve 57 kDa protein 1s also produced by Renibactenum salmon~narumand Coryne- bacterium aquat~cum Regardless of the challenge method (~njectionor water-borne) isolate PT-31 proved to be hlghly pathogen~cfor ralnbow trout
    [Show full text]
  • FISH DISEASES - Diseases Caused by Bacterial Pathogens in Inland Water - Hisatsugu Wakabayashi, Terutoyo Yoshida, Tetsuichi Nomura, Toshihiro Nakai, Tomokazu Takano
    Eolss Publishers Co. Ltd., UK Copyright © 2017 Eolss Publishers/ UNESCO Information on this title: www.eolss.net/eBooks ISBN- 978-1-78021-040-7 e-Book (Adobe Reader) ISBN- 978-1-78021-540-2 Print (Color Edition) The choice and the presentation of the facts contained in this publication and the opinions expressed therein are not necessarily those of UNESCO and do not commit the Organization. The designations employed and the presentation of material throughout this publication do not imply the expression of any opinion whatsoever on the part of UNESCO concerning the legal status of any country, territory, city, or area, or of its authorities, or the delimitation of its frontiers or boundaries. The information, ideas, and opinions presented in this publication are those of the Authors and do not represent those of UNESCO and Eolss Publishers. Whilst the information in this publication is believed to be true and accurate at the time of publication, neither UNESCO nor Eolss Publishers can accept any legal responsibility or liability to any person or entity with respect to any loss or damage arising from the information contained in this publication. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage or retrieval system, without prior permission in writing from Eolss Publishers or UNESCO. The above notice should not infringe on a 'fair use' of any copyrighted material as provided for in section 107 of the US Copyright Law, for the sake of making such material available in our efforts to advance understanding of environmental, political, human rights, economic, democracy, scientific, and social justice issues, etc.
    [Show full text]
  • New Insights on the Zeugodacus Cucurbitae (Coquillett) Bacteriome
    microorganisms Article New Insights on the Zeugodacus cucurbitae (Coquillett) Bacteriome Elias Asimakis 1 , Panagiota Stathopoulou 1 , Apostolis Sapounas 2, Kanjana Khaeso 1, Costas Batargias 2 , Mahfuza Khan 3 and George Tsiamis 1,* 1 Laboratory of Systems Microbiology and Applied Genomics, Department of Environmental Engineering, University of Patras, 2 Seferi St., 30100 Agrinio, Greece; [email protected] (E.A.); [email protected] (P.S.); [email protected] (K.K.) 2 Laboratory of Applied Genetics and Fish Breeding, Department of Animal Production, Fisheries and Aquaculture, University of Patras, Nea Ktiria, 30200 Messolonghi, Greece; [email protected] (A.S.); [email protected] (C.B.) 3 Institute of Food and Radiation Biology (IFRB), Atomic Energy Research Establishment (AERE), Ganak bari, Savar, Dhaka 1349, Bangladesh; [email protected] * Correspondence: [email protected]; Tel.: +30-264-107-4149 Abstract: Various factors, including the insect host, diet, and surrounding ecosystem can shape the structure of the bacterial communities of insects. We have employed next generation, high-throughput sequencing of the 16S rRNA to characterize the bacteriome of wild Zeugodacus (Bactrocera) cucurbitae (Coquillett) flies from three regions of Bangladesh. The tested populations developed distinct bacterial communities with differences in bacterial composition, suggesting that geography has an impact on the fly bacteriome. The dominant bacteria belonged to the families Enterobacteriaceae, Dysgomonadaceae and Orbaceae, with the genera Dysgonomonas, Orbus and Citrobacter showing the Citation: Asimakis, E.; Stathopoulou, highest relative abundance across populations. Network analysis indicated variable interactions P.; Sapounas, A.; Khaeso, K.; between operational taxonomic units (OTUs), with cases of mutual exclusion and copresence. Certain Batargias, C.; Khan, M.; Tsiamis, G.
    [Show full text]
  • Vagococcus Teuberi Sp. Nov., Isolated from the Malian Artisanal Sour Milk Fènè
    G Model SYAPM-25874; No. of Pages 8 ARTICLE IN PRESS Systematic and Applied Microbiology xxx (2017) xxx–xxx Contents lists available at ScienceDirect Systematic and Applied Microbiology journal homepage: www.elsevier.de/syapm Vagococcus teuberi sp. nov., isolated from the Malian artisanal sour milk fènè a a a a Stephan Wullschleger , Christoph Jans , Clelia Seifert , Sarah Baumgartner , a b a a,∗ Christophe Lacroix , Bassirou Bonfoh , Marc J.A. Stevens , Leo Meile a Laboratory of Food Biotechnology, Institute of Food Science and Nutrition, ETH Zurich, Schmelzbergstrasse 7, CH-8092 Zurich, Switzerland b Centre Suisse de Recherches Scientifiques en Côte d’Ivoire (CSRS), KM 17 route de Dabou, Adiopodoumé Yopougon, Abidjan — 01 B.P. 1303, Abidjan, Cote d’Ivoire a r t i c l e i n f o a b s t r a c t Article history: Ten bacterial isolates belonging to the genus Vagococcus were obtained from Malian sour milk fènè Received 27 July 2017 produced from spontaneously fermented cow milk. However, these isolates could not be assigned to Received in revised form 3 November 2017 a species upon initial comparative 16S rRNA gene sequence analysis and were therefore further charac- Accepted 7 November 2017 T terized. Rep-PCR fingerprinting of the isolates yielded four strain clusters represented by strains CG-21 T T (=DSM 21459 ), 24CA, CM21 and 9H. Sequence identity of the 16S rRNA gene of DSM 21459 to its clos- Keywords: T est relative species Vagococcus penaei was 97.9%. Among the four rep strain clusters, DSM 21459 and Vagococcus teuberi sp. nov. 24CA shared highest 16S rRNA gene sequence identity of 99.6% while CM21 and 9H shared 98.6–98.8% Lactic acid bacteria T T T with DSM 21459 and V.
    [Show full text]
  • Fish Diseases and Medicine
    CHAPTER 8 COELOMIC DISORDERS 174 CHRISTINE L. DENSMORE Copyrighted COELOMIC DISTENSION Differential diagnosis: As dropsy is more accurately defined as a clinical presentation of disease rather than Dropsy a disease entity, the differential diagnoses are numer- Overview: Dropsy is a commonly applied term for ous, including not only the potential etiologies that lead coelomic (i.e., abdominal) distention due to ascites, or to free coelomic fluid accumulation but also other vari- the effusion and collection of fluid freely throughout ous causes of coelomic distension: neoplasia, organo- the coelomic cavity. It is a nonspecific syndrome and megaly, gastrointestinal obstruction, egg-binding. a clinical presentation, as opposed to a defined dis- Diagnosis: Diagnostic imaging may be useful in ease. Dropsy, or ascites, is generallyMaterial a sign of another determining if coelomic distention is related to fluid ongoing disease process, oftentimes one that is multi- accumulation or some other cause. If free coelomic systemic and impacting coelomic organs and tissues. fluid is suspected or observed, coeliocentesis and Etiology: Dropsy may be caused by a variety of evaluation of the coelomic fluid through cytology potential etiological agents, both infectious and non- and microbial (i.e., bacterial, viral and fungal) cul- infectious. Generally, dropsy is associated with infec- ture may often be diagnostically useful. tious disease processes associated with viral, mycotic - Management/control: Treatment and control or bacterial infection. In particular,
    [Show full text]