USOO8697361 B2
(12) United States Patent (10) Patent No.: US 8,697,361 B2 Johnson (45) Date of Patent: Apr. 15, 2014
(54) SEROTONIN TRANSPORTER GENE AND 2008/0228824 A1 9/2008 Kenedy et al. TREATMENT OF ALCOHOLISM 2009,0269773 A1 10, 2009 Fant1 et al. 2010.0041689 A1 2/2010 Johnson et al. 2010/0076006 A1 3/2010 Johnson et al. (75) Inventor: Rashok A. Johnson, Charlottesville, VA 2010/0093.762 A1 4, 2010 Wu 2011/0065628 A1 3/2011 Johnson et al. 2011/02643.74 A1 10, 2011 Johnson et al. (73) Assignee: University of Virginia Patent 2012/0115149 A1 5/2012 Johnson Foundation, Charlottesville, VA (US) 2012/0302592 A1 11/2012 Johnson et al. (*) Notice: Subject to any disclaimer, the term of this FOREIGN PATENT DOCUMENTS patent is extended or adjusted under 35 EP O945133 A1 9, 1999
HK 1151091 1, 2012 (21) Appl. No.: 12/919,905 JP 2010537990. A 12/2010 NO WO-2009026381 A3 2, 2009 (22) PCT Filed: Feb. 27, 2009 RU 2O75978 C1 3, 1997 WO WO-0050639 A2 8, 2000 WO WO-2007OO9691 A2 1, 2007 (86). PCT No.: PCT/US2O09/03542O WO WO-2007039 123 A2 4? 2007 S371 (c)(1), WO WO-2007O95580 A2 8, 2007 (2), (4) Date: Jan. 11, 2011 WO WO-2008077092 A2 6, 2008 s e ----9 WO WO-2008095.086 A2 8, 2008 WO WO-2008095.086 A3 8, 2008 (87) PCT Pub. No.: WO2009/108837 WO WO-2009026381 A3 2/2009 WO WO-20090293O8 A1 3, 2009 PCT Pub. Date: Sep. 3, 2009 WO WO-2009 108837 A2 9, 2009 WO WO-2009 108837 A3 9, 2009 (65) Prior Publication Data WO WO-2010 126603 A1 11 2010 WO WO-2012O03462 A1 1, 2012 US 2011 FO112159 A1 May 12, 2011 WO WO-2012O03462 A4 1, 2012 Related U.S. Application Data OTHER PUBLICATIONS (60) Provisional application No. 61/032,263, filed on Feb. Martin, Jet al. Molecular Psychiatry 2007 vol. 12 pp. 421-422.* 28, 2008, provisional application No. 61/05 9,301, Kenna, George Drug Discovery Today: Therapeutic Strategies 2005 filed on Jun. 6, 2008, provisional application No. vol. 2 No. 1 pp.71-78.* 61/146,440, filed on Jan. 22, 2009. Herman, Aryeh et al. Alcohol and Alcoholism 2003 vol. 38 No. 5 pp. 446-449. (51) Int. Cl. Liu, Ying et al. J Hum Genet 2005 vol. 50 pp. 62-68.* CI2O I/68 (2006.01) “U.S. Appl. No. 13/569.465, Restriction Requirement mailed Dec. CI2P 19/34 (2006.01) 21, 2012', 10 pgs. C7H 2L/02 (2006.01) “U.S. Appl. No. 13/589,603, Restriction Requirement mailed Dec. 7. (52) U.S. Cl. 2012”, 8 pgs. USPC ...... 435/6.11: 435/91.1536/23.1 (Continued) (58) Field of Classification Search None See application file for complete search history. Primary Examiner — Amanda Haney (74) Attorney, Agent, or Firm — Schwegman, Lundberg & (56) References Cited Woessner, P.A.
U.S. PATENT DOCUMENTS (57) ABSTRACT 2. 3. f s But al The gene responsible for encoding SERT has a functional 63 23,356 B2 11/2001 NEE, polymorphism at the 5'-regulatory promoter region, which 7,033,771 B2 4/2006 Brooks results in two forms, long (L) and short (S). The LL-genotype 2001/0023254 A1 9/2001 McElroy is hypothesized to play a key role in the early onset of alcohol 2002fO091320 A1 7/2002 Crutchfield et al. use. The present invention discloses the differences in treat 398-92 A. 258. Pl ment and diagnosis based on the L or short genotypes as well 2003/0153590 A1 8/2003 Kurkela et al. as on a single nucleotidepolymorphism of the SERT gene, the 2004O1671 64 A1 8, 2004 Pozuelo 3' UTRSNPrs 1042173. The present invention demonstrates 2005.008989.0 A1 4, 2005 Cubicciotti the efficacy of using the drug ondansetron and similar drugs 2005.0245461 A1 11, 2005 Ehrich et al. 2006/0286,594 A1 12/2006 Mundo et al. for treatment based on variations in the polymorphisms of the 2007/OO72899 A1 3/2007 Johnson et al. SERT gene as well as methods for diagnosing Susceptibility 2007/0088100 A1 4/2007 Ahmed et al. to abuse of alcohol and other addiction-related diseases and 2007/0167423 A1 7/2007 Bergauer et al. disorders. 2007/027597O A1 11, 2007 Weber 2007,029.2880 A1 12/2007 Philibert et al. 2008.0004291 A1 1/2008 Singh 24 Claims, 4 Drawing Sheets US 8,697,361 B2 Page 2
(56) References Cited “International Application Serial No. PCT/US2008/073738, Written Opinion mailed Nov. 12, 2008”, 5 pgs. OTHER PUBLICATIONS “International Application Serial No. PCT/US2009 1035420, Inter “International Application Serial No. PCT/US2012/054090, Invita national Preliminary Report on Patentability mailed Sep. 10, 2010”. tion to Pay Additional Fees mailed Nov. 15, 2012, 2 pgs. 21 pgs. “International Application Serial No. PCT/US2010/001273, Interna “Japanese Application Serial No. 2009-543177. Office Action mailed tional Preliminary Report on Patentability mailed Jan. 4, 2011”. 16 Dec. 10, 2012, 5 pgs. pg.S. “Mexican Application Serial No. MX/a/2009/006672, Office Action “International Application Serial No. PCT/US2011/023481, Interna mailed Dec. 17, 2012, 3 pgs. tional Preliminary Report on Patentability mailed Jul. 27, 2011”. 10 “U.S. Appl. No. 12/250,095, Response filed Feb. 29, 2012 to Final pg.S. Office mailed Sep. 1, 2011”, 13 pgs. “International Application Serial No. PCT/US2011/023481, Interna “U.S. Appl. No. 12/520,095, Response filed Jan. 17, 2012 to Final tional Search Report mailed Jul. 27, 2011”, 3 pgs. Office Action mailed Sep. 1, 2011”, 13 pgs. “International Application Serial No. PCT/US2011/042823, Interna “U.S. Appl. No. 12/520,095, Advisory Action mailed Mar. 7, 2012”. tional Search Report mailed Dec. 6, 2011”. 4pgs. 4pgs. “International Application Serial No. PCT/US2011/042823, Written “U.S. Appl. No. 12/520,095, Final Office Action mailed Sep. 1, Opinion mailed Dec. 6, 2011”, 5 pgs. 2011’, 25 pgs. “Israeli Application Serial No. 207822. Non Final Office Action “U.S. Appl. No. 12/520,095, Non Final Office Action mailed Feb. 18, dated Aug. 25, 2011”, 3 pgs. 2011’, 25 pgs. “Japanese Application Serial No. 2009-543177. Amendment filed “U.S. Appl. No. 12/520,095, Response filed Jun. 20, 2011 to Non Dec. 1, 2011’, 2 pgs. Final Office Action mailed Feb. 18, 2011”, 14pgs. “Japanese Application Serial No. 2010-522982, Amendment filed “U.S. Appl. No. 12/525,230, Response Filed Jan. 17, 2012 to Restric May 10, 2011”, 8 pgs. tion Requirement mailed Nov. 17, 2011”.9 pgs. “Japanese Application Serial No. 2010-548.893, Amendment filed Feb. 21, 2012”, 61 pgs. “U.S. Appl. No. 12/525,320, Non Final Office Action mailed Feb. 8, “Mexican Application Serial No. MX/a/2009/006672, Office Action 2012, 25 pgs. mailed Apr. 12, 2012, 3 pgs. “U.S. Appl. No. 12/525.320, Restriction Requirement mailed Nov. “Mexico Application Serial No. MX/a/2009/006672, Office Action 17, 2011”, 10 pgs mailed Sep. 6, 2011’, 2 pgs. “U.S. Appl. No. 12/674,348, Non Final Office Action mailed Dec. 13, “Mexico Application Serial No. MX/a/2009/006672, Response filed 2011”, 16 pgs. Jan. 31, 2012 to Office mailed Sep. 6, 2011”, 3 pgs. “U.S. Appl. No. 12/674,348, Response filed May 14, 2012 to Non “NCBI Reference Cluster Report 17614942, Retrieved Nov. 28, Final Office Action mailed Dec. 13, 2011”, 13 pgs. 2011. Online. Retrieved from the Internet:
(56) References Cited Concept Study”. Alcoholism: Clinical and Experimental Research vol. 28, Issue 8, (Aug. 2004), 1137-1144. OTHER PUBLICATIONS Johnson, Bankole A, 'Serotonergic agents and alcoholism treatment: rebirth of the subtype concept—an hypothesis'. Alcohol Clin Exp Caumo, Andrea, et al., “Insulin sensitivity from meal tolerance tests Res., 24(10), (Oct. 2000), 1597-601. in normal subjects: A Minimal Model Index”, Journal of Clinical Johnson, Bankole A. et al., “Topiramate for Treating Alcohol Depen Endocrinology & Metabolism 85, (2000), 4396-4402 dence: A Randomized Controlled Trial”, JAMA, 298(14), (Oct. 10, Clausen, Jesper O. “Insulin Sensitivity index. Acute Insulin 2007), 1641-51. Response, and Glucose Effectiveness in a Population-based Sample Kjems, L. L., et al., “Quantification of beta-cell function during of 380 Young Healthy Caucasians”, Journal of Clinical investigation IVGTT in Type II and non-diabetic subjects: assessment of insulin 98, (1996), 1195-1209. secretion by mathematical methods', Diabetologia 44. (2001), 1339 Cortot, A., et al., “Gastric emptying and gastrointestinal absorption of 1348. alcohol ingested with a meal”. Dig Dis Sci., 31(4), (Apr. 1986), Liefnmann, R, "Endocrine Imbalance in Rheumatoid Arthritis and 343-8. Rheumatoid Spondylitis: Hyperglycemia Unresponsiveness, Insulin Dalla, Man C, et al., “Measurement of selective effect of insulin on Resistance, Increased Gluconeogenesis and Mesenchymal Tissue glucose disposal from labeled glucose oral test minimal model'. Am Degeneration'. Acta Medica Scandinavica, 136(3), (1950), 226-232. J Physiol Endocrinol Metab. 289(5), (2005), E909-14. Liu, Y., et al., “Association of habitual Smoking and drinking with Dalla, Man C, et al., “Minimal Model Estimation of Glucose Absorp single nucleotide polymorphism (SNP) in 40 candidate genes: data tion and Insulin Sensitivity from Oral Test: Validation with a Tracer from random population-based Japanese samples'. J Hum Genet. Method”. Am. J. Physiol. Endocrinol. Metab. 287, (2004), E637-643. 50(2), (2005), 62-8. Dalla Man, C., et al., “The oral glucose minimal model: estimation of Mannelli, P. et al., “Polymorphism in the serotonin transporter gene insulin sensitivity from a meal test”. IEEE Biomed Eng., 49(5), (May and response to treatment in African American cocaine and alcohol 2002), 419-29. abusing individuals'. Addict Biol., 10(3), (Sep. 2005), 261-8. Defronzo, R.A., “Glucose clamp technique: a method for quantifying Matsumoto, H., et al., “Pharmacokinetics of ethanol: a review of the insulin secretion and resistance'. Am J Physiol. 237(3), (1979), methodology. Addiction Biology, 7(1), (2002), 5-14. E214-23. Mumenthaler, M. S. et al., “Ethanol pharmacokinetics in white Elahi, D, “In praise of the hyperglycemic clamp: A method for women: nonlinear model fitting versus Zero-order elimination analy assessment of beta-cell sensitivity and insulin resistance', Diabetes ses”. Alcohol Clin Exp Res., 24(9), (Sep. 2000), 1353-62. Care 19, (1996), 278-286. Ni, T C, et al., “Reassessment of glucose effectiveness and insulin Enoch, M. A. et al., “Genetics of Alcoholism. Using Intermediate sensitivity from minimal model analysis: a theoretical evaluation of Phenotypes”, Alcohol Clin Exp Res., 27(2), (Feb. 2003), 169-76. the single-compartment glucose distribution assumption”. Diabetes, Enoch, M-A, et al., “Functional genetic variants that increase synap 46(11), (1997), 1813-21. tic serotonin and 5-HT3 receptor sensitivity predict alcohol and drug Ni, Xingqun, et al., 'Serotonin genes and gene-gene interactions in dependence”. Molecular Psychiatry, (2010), 10 pgs. borderline personality disorder in a matched case-control study”. Flier, Jeffrey S. "Chapter 140—Syndromes of Insulin Resistance'. Progress in Neuro-Psychopharmacology and Biological Psychiatry, Principles and practice of endocrinology and metabolism, editor, vol. 33, (Nov. 12, 2008), 128-133. Kenneth L. Becker; Published Philadelphia: J.B. Lippincott Co., Norberg, A. et al., “Role of variability in explaining ethanol (1995), 1249-1259. pharmacokinetics: research and forensic applications’. Clin. Fraser, AG, et al., “Inter-individual and intra-individual variability of Pharmacokinet. 42(1), (2003), 1-31. ethanol concentration-time profiles: comparison of ethanol ingestion Norberg, A., et al., “Within- and between-subject variations in before or after an evening meal', Br JClin Pharmacol. 40(4), (1995), pharmacokinetic parameters of ethanol by analysis of breath, venous 387-392. blood and urine', Br J Clin Pharmacol. 49(5), (2000), 399-408. Gu, Bo, et al., “Association between a polymorphism of the HTR3A Oneta, C M. “First pass metabolism of ethanol is strikingly influ gene and therapeutic response to risperidone treatment in drug-naive enced by the speed ofgastric emptying'. Gut,43(5), (1998), 612-619. Chinese Schizophrenia patients'. Pharmacogenetics and Genomics, Pettinati, Helen, et al., “Recent advances in the treatment of alcohol vol. 88(8), (2008), 721-727. ism”. Clinical Neuroscience Research, 5(2-4), (Nov. 2005), 151-159. Hartman, B. J. "Hypnotherapeutic approaches to the treatment of Reaven, G. M. “Pathophysiology of insulin resistance in human dis alchoholism”, J Natl Med Assoc. 68(2), (Mar. 1976), 101-3, 147. ease”, Physiol Rev. 75(3), (1995), 473-86. Ji. Xiaofei, et al., “An Association between serotonin receptor 3B Samochowiec, J., et al., “Family-based and case-control study of Gene (HTR3B) and Treatment-Resistant Schizophrenia (TRS) in a DRD2, DAT, 5HTT, COMT genes polymorphisms in alcohol depen Japanese Population', Nagoya J MedSci, vol. 70, (2008), 11-17. dence'. Neurosci Lett., 410(1), (Dec. 13, 2006), 1-5. Johnson, B. A. “Effects of GR 68755 on d-amphetarnine-induced Seneviratne, C, et al., “Characterization of a functional changes in mood, cognitive performance, appetite, food preference, polymorphism in the 3' UTR of SLC6A4 and its association with and caloric and macronutrient intake in humans'. Behav, Pharmacol., drinking intensity”, vol. 33, No. 2., (Feb. 1, 2009), 332-339. 7(3), (May 1996), 216-227. Silverstone, PH, et al., “Ondansetron, a 5-HT3 receptor antagonist, Johnson, B. A. et al., “Pharmacogenetic approach at the serotonin partially attenuates the effects of amphetamine: a pilot study in transporter gene as a method of reducing the severity of alcohol healthy volunteers'. Int Clin Psychopharmacol. 7(1), (1992), 37-43. drinking”. Am J Psychiatry, 168(3), (Mar. 2011), 265-75. Souza, RP. et al., “Influence of serotonin3A and 3B receptor genes on Johnson, Bankole A, et al., “Age of onset as a discriminator between clozapine treatment response in Schizophrenia'. Pharmacognetics alcoholic Subtypes in a treatment-seeking outpatient population'. and Genomics, vol. 20(4), (Apr. 2010), 274-276. Am J Addict., 9(1), (Winter, 2000), 17-27. Steil, Garry M. et al., “Evaluation of insulin sensitivity and beta-cell Johnson, Bankole A. et al., “Development of novel function indexes obtained from minimal model analysis of a meal pharmacotherapies for the treatment of alcohol dependence: focus on tolerance test”. Diabetes, 53(5), (2004), 1201-7. antiepileptics”. Alcohol Clin Exp Res., 28(2), (Feb. 2004), 295-301. Toffolo, G. et al., “Beta-cell function during insulin-modified intra Johnson, Bankole A. et al., “Improvement of physical health and venous glucose tolerance test Successfully assessed by the C-peptide quality of life of alcohol-dependent individuals with topiramate treat minimal model”, Metabolism, 48(9), (1999), 1162-1166. ment: US multisite randomized controlled trial', Arch Intern Med., Toffolo, G. et al., “Estimation of beta-cell sensitivity from intrave 168(11), (Jun. 9, 2008), 1188-99. nous glucose tolerance test C-peptide data. Knowledge of the kinetics Johnson, Bankole A, et al., “Neuropharmacological treatments for avoids errors in modeling the secretion”. Diabetes, 44(7), (1995), alcoholism: Scientific basis and clinical findings'. Psychopharmacol 845-854. ogy (Berl), 149(4), (May 2000), 327-44. Toffolo, Gianna, et al., “Quantitative indexes of B-cell function dur Johnson, Bankole, “Progress in the Development of Topiramate for ing graded up&down glucose infusion from C-peptide minimal mod Treating Alcohol Dependence: From a Hypothesis to a Proof-of els”, Am J Physiol Endocrinol Metab., 280(1), (2001), E2-E 10. US 8,697,361 B2 Page 4
(56) References Cited Johnson, B., “An Overview of the Development of Medications Including Novel Anticonvulsants for the Treatment of Alcohol OTHER PUBLICATIONS Dependence”. Expert Opinion, Pharmacother: 5(9), (2004), 1943 1955. Umulis, DM, et al., “A physiologically based model for ethanol and Johnson, B. A., et al., "Can serotonin transporter genotype predict acetaldehyde metabolism in human beings'. Alcohol, 35(1), (2005), serotonergic function, chronicity, and severity of drinking?'. 3-12. Progress In Neuro-Psychopharmacology & Biological Psychiatry, Ward, RJ, et al., “Women and alcohol susceptibility: could differ 32, (2008), 209-216. ences in alcohol metabolism predispose women to alcohol-related Johnson, B. A. et al., “Understanding nd Treating Alcohol Depen diseases?'. Arch Womens Ment Health. 6(4), (2003), 231-8. dence”, Alcohol Clin Exp Res. vol. 30(3), (2006), 567-584. Welch, S, et al., “Minimal model analysis of intravenous glucose Johnson, Bankole A., et al., "Combining Ondansetron and tolerance test-derived insulin sensitivity in diabetic subjects”. J. Clin Naltrexone Effectively Treats Biologically Predisposed Alcoholics: Endocrinol Metab., 71(6), (1990), 1508-1518. From Hypotheses to Preliminary Clinical Evidece'. Alcoholism: Willms, B, et al., “Gastric emptying, glucose responses, and insulin Clinical and Experimental Research, 24(5), (May 2000), 737-742. Secretion after a liquid test meal: effects of exogenous glucagon-like Johnson, Bankole A., et al., “Ondansetron for Reduction of Drinking peptide-1 (GLP-1)-(7-36) amide in type 2 (noninsulin-dependent) Among Biologically Predisposed Alcoholic Patients: A Randomized diabetic patients”. J. Clin Endocrinol Metab., 81 (1), (1996), 327-32. Controlled Trial”, JAMA, vol. 284, No. 8, (Aug. 2000),963-971. Wise, Roy A. et al., “A Psychomotor stimulant theory of addiction'. Kaysen, D., et al., “Domestic Violence and Alcohol Use: Trauma Psychological Review 94, (1987), 469-492. related Symptoms and Motives for Drinking”. Addict Behav., vol. Wolff, Manfred E. “”. Burgers Medicinal Chemistry, 5th ed. Part 1. 32(6), (2007), 1272-1283. John Wiley & Sons, (1995),975-977. Kenna, G. A., et al., “Pharmacotherapy, pharmacogenomics, and the “U.S. Appl. No. 12/520,095, Preliminary Amendment filed Jun. 19, future of alcohol dependence treatment, part 1'. Am. J. Health-Syst. 2009”, 11 pgs. Pharm., 61. (Nov. 1, 2004), 2272-2279. “U.S. Appl. No. 12/520,095, Restriction Requirement mailed Aug. 5, Kenna, G. A., et al., “Pharmacotherapy, pharmacogenomics, and the 2010”, 8 pgs. future of alcohol dependence treatment, part 2'. Am. J. Health-Syst. “U.S. Appl. No. 12/525.320, Preliminary Amendment filed Jul. 31. Pharm., 61. (Nov. 15, 2004), 2380-2390. 2009, 9 pgs. Kenna, G. A., “Pharmacotheray of Alcohol Dependence: Targeting a “U.S. Appl. No. 12/675,486, Preliminary Amendment filed Feb. 26, Complex Disorder'. Drug Discovery Today: Therapeutic Strategies, 2010”, 16 pgs. 2(1), (2005), 71-78. “Costa Rican Application Serial No. 10938, Response To Opposition Konishi, T., et al., “ADH1B*1, ADH1C*2, DRD2 (-141C Ins), and Filed filed May 12, 2010”, 16 pgs. 5-HTTLPR are associated with alcoholism in Mexican American “European Application Serial No. 078695.01.2, Communication men living in Los Angeles'. Alcohol Clin Exp Res., vol. 28(8), dated Aug. 11, 2009, 2 pgs. (2004), 1145-52. “European Application Serial No. 078695.01.2, Office Action mailed Kranzler, H. R. et al., “Effects of Ondansetron in Early- Versus May 31, 2010”. 1 pg. Late-onset Alcoholics: A Prospective, Open-Label Study”. Alcohol “European Application Serial No. 078695.01.2, Response filed Aug. ism: Clinical and Experimental Research, 27(7), (Jul. 2003), 1150 31, 2009 to Communication dated Aug. 11, 2009, 5 pgs. 1155. “European Application Serial No. 078695.01.2, Supplemental Euro Mannelli, P. et al., “Polymorphism in the serotonin transporter gene pean Search Report mailed Feb. 25, 2010”, 15 pgs. and moderators of prolactin response to meta “International Application Serial No. PCT/US07/88100. Interna chlorophenylpiperazine in African-American cocaine abusers and tional Search Report mailed May 16, 2008”, 1 pg. controls”. Psychiatry Research, 144. (2006), 99-108. “International Application Serial No. PCT/US07/88100, Written Moak. D. H. "Assessing the efficacy of medical treatments for alco Opinion mailed May 16, 2008”, 11 pgs. hol use disorders”. Expert Opin Pharmacother, 5(10), (Oct. 2004), “International Application Serial No. PCT/US08/52628. Interna 2O75-89. tional Search Report mailed Aug. 19, 2008”, 3 pgs. Moner, S. E., "Acupuncture and Addiction Treatment”, Journal of “International Application Serial No. PCT/US08/52628, Written Addictive Diseases, 15(3), (1996), 79-100. Opinion mailed Aug. 19, 2008”, 5 pgs. Reist, C., et al., “Serotonin Transporter Promoter Polymorphism Is “International Application Serial No. PCT/US09/35420, Interna Associated With Attenuated Prolactin Response to Fenfluramine”. tional Search Report mailed Oct. 5, 2009, 5 pgs. American Journal of Medicla Genetics (Neuropsychiatric Genetics), “International Application Serial No. PCT/US09/35420, Written 105, (2001), 363-368. Opinion mailed Oct. 5, 2009, 20 pgs. Stoltenberg, S.F., et al., “Serotonergic Agents and Alcoholism Treat ment: A Simulation'. Alcoholism: Clinical and Experimental “International Application Serial No. PCT/US2008/064232, Interna Research, 27(12), (Dec. 2003), 1853-1859. tional Search Report mailed Aug. 15, 2008”, 1 pg. Swift, R. “Topiramate for the Treatment of Alcohol Dependence: “International Application Serial No. PCT/US2008/064232, Written Initiating Abstinence'. The Lancet, vol. 361, (May 2003), 1666 Opinion mailed Aug. 15, 2008”, 8 pgs. 1667. Anton, R. F., et al., “Structured Psychosocial Interventions Focused Szilagyi, A., et al., “Combined effect of promoter polymorphisms in on Adherence Combined with Naltrexone Make Drinking Relapse the dopamine D4 receptor and the serotonin transporter genes in Less Likely'. Annals of Internal Medicine, 134(5), (2001), 388-389. heroin dependence'. Neuropsychopharmacol Hung., vol. 7(1), Castro, L. A. et al., “The pharmacologic treatment of the alcohol Retrieved on Sep. 23, 2009). Retrieved from the internet:
(56) References Cited Dick, D, et al., “Association analyses of the serotonin transporter gene with lifetime depression and alcohol dependence in the Col OTHER PUBLICATIONS laborative Study on the Genetics of Alcoholism (COGA) sample'. Psychiatric Genetics, vol. 17, No. 1, (Feb. 2007), 35-38. “Chinese Application Serial No. 200780051498.2, Response filed Feinn, R. et al., “Meta-analysis of the association of a functional Oct. 10, 2012 to Office Action mailed Jul. 30, 2012. With English serotonin transporter promoter polymorphism with alcohol depen Claims, 6 pgs. dence', American Journal of Medical Genetics. Part B, Neuropsychiatric Genetics, vol. 133B, No. 1, (Feb. 5, 2005), 79-84. “Eurasian Application Serial No. 201000 1389, Office Action mailed Kenna, G., “A within-group design of nontreatment seeking 5-HT Sep. 19, 2012”. With English Translation, 2 pgs. TLPR genotyped alcohol-dependent Subjects receiving ondansetron “European Application Serial Appl. No. 09714591.6, Response filed and sertraline”. Alcoholism, Clinical and Experimental Research vol. Sep. 21, 2012 to Office Action mailed Jun. 28, 2012”, 14pgs. 33, No. 2, (Feb. 2009), 315-323. “European Application Serial No. 10717322.1, Office Action mailed Mannelli, et al., “Polymorphism in the serotonin transporter gene and Aug. 29, 2012, 5 pgs. response to treatment in African American cocaine and alcohol “Mexican Application Serial No. MX/a/2009/006672, Response abusing individuals'. Addiction Biology, vol. 10, No. 3. (Sep. 2005), filed Aug. 15, 2012 to Non Final Office Action dated Apr. 16, 2012”. 261-268. With English Claims, 4. Philibert, RA, et al., “The relationship of 5HTT (SLC6A4) methyla Grant, S A. et al., “Blood Alcohol Concentration and Psychomotor tion and genotype on mRNA expression and liability to major depres Effects', British Journal of Anesthesia, 85(3), (2000), 401–406. sion and alcohol dependence in SUbjects from the Iowa Adoption “U.S. Appl. No. 12/520,095, Response filed Dec. 6, 2010 to Restric Studies'. American Journal of Medical Genetics. Part B, tion Requirement mailed Aug. 5, 2010, 14pgs. Neuropsychiatric Genetics, vol. 147B, No. 5, (Jul. 5, 2008), 543-549. “International Application Serial No. PCT/US2010/001273, Search Seneviratne, C, et al., “Characterization of a functional Report mailed Aug. 24, 2010”. 10 pgs. polymorphism in the 3' UTR of SLC6A4 and its association with “International Application Serial No. PCT/US2010/001273, Written drinking intensity'. Alcoholism, Clinical and Experimental Opinion mailed Aug. 24, 2010”, 13 pgs. Research, vol. 33, No. 2, (Feb. 2009), 332-339. Dawes, M. et al., “Drinking histories in alcohol-use-disordered Sookoian, S, et al., “Contribution of the functional 5-HTTLPR vari youth: preliminary findings on relationships to platelet serotonin ant of the SLC6A4 gene to obesity risk in male adults', Obesity, vol. transporter expression with genotypes of the serotonin transporter'. 16, No. 2, (Feb. 2008), 488-491. Journal of Studies on Alcohol and Drugs vol. 70, No. 6, (Nov. 2009), 899-907. * cited by examiner U.S. Patent Apr. 15, 2014 Sheet 1 of 4 US 8,697,361 B2
5'-HTTLPR
rS25531
rS6354
rS6355
rS28914832
rS1042173
5'-HTTLPR
rS25531
rS6354
rS6355
rS28914832
rS1042173
5'-HTTLPR
rS25531
rS6354
rS6355
rS28914832
rS1042173 U.S. Patent Apr. 15, 2014 Sheet 2 of 4 US 8,697,361 B2
CD 9 CD H N C/D Ne
CD O D w O C CD CD H H
an n ...... V (p 06 Sed) Kep 6upup/Syup JOON
CDCN
an - , , , , , , , , , V 06 Sed) Kep 6upu.jp/S).uup JOON U.S. Patent Apr. 15, 2014 Sheet 3 of 4 US 8,697,361 B2
CD 3 CD
Q o
8
an H an g 9 3 8 (HOdVO O), UOI)eel ul) CY) UOISSeldxe Ue)Old LLH-g CD co O X
CN d X
s X
an - is , , , , CN V V O O (HOdVS O). UO)eel u) uOSSeldxe WNuLLH-G U.S. Patent Apr. 15, 2014 Sheet 4 of 4 US 8,697,361 B2
1400
1200
1000
800 - 7
600 -
Z 44 400 Z W
200 - 1 3.
LL S-Carrier 5-HTTLPR genotype
FIG. 4 Bmax vs. Genotype US 8,697,361 B2 1. 2 SEROTONIN TRANSPORTER GENE AND of 5-HT reuptake depends on the density of 5-HTTs on TREATMENT OF ALCOHOLISM presynaptic surface. The selective 5-HT reuptake inhibitors that act directly on 5-HTTs have been shown to reduce alco CROSS REFERENCE TO RELATED hol consumption in rats (Gill and Amit, 1989). However, in APPLICATIONS humans SSRIs have been effective at reducing heavy drinking only among some Subtypes of alcoholics, more specifically in This application is a U.S. National Stage Filing under 35 type A alcoholics but not in type Balcoholics (Dundon et al., U.S.C. S371 from International Application Serial No. PCT/ 2004; Pettinati et al., 2000) who are considered to be more US2009/035420, filed on Feb. 27, 2009, and published in biologically predisposed to develop alcohol dependence. English as WO 2009/108837 A2 on Sep. 3, 2009, which is 10 Therefore, it is reasonable to propose that allelic variations entitled to priority pursuant to 35 U.S.C. S 119(e) to U.S. which alter expression levels of SLC6A4 gene can be provisional patent application Nos. 61/032,263, filed on Feb. expected to have an important effect on drinking intensity. 28, 2008, 61/059,301, filed on Jun. 6, 2008, and 61/146,440, The human 5-HTT is encoded by a single gene (SLC6A4) filed on Jan. 22, 2009. The entire disclosures of the afore 15 mapped on chromosome 17q11.1-q12 (Ramamoorthy et al., mentioned PCT application and provisional patent applica 1993). The SLC6A4 gene spans ~35 kb and has 14 exons. The tions are incorporated herein by reference. protein encoded by this gene, the 5-HTT, is a trans-membrane STATEMENT REGARDING FEDERALLY protein containing 630 amino acids (Heils et al., 1996). The SPONSORED RESEARCH ORDEVELOPMENT expression level of SLC6A4 is regulated by at least three mechanisms: transcription regulatory elements in the pro This invention was made with government Support under moter (Ramamoorthy et al., 1993), differential splicing (Bra Grant Nos. U10 AA011776-10, 1 NO1 AA001016-000, 7 RO1 dley and Blakely, 1997), and the use of different 3' polyade AAO 10522-12, 5 RO1 AA012964-06, 5 K23 AA000329-06, 3 nylation sites (Battersby et al., 1999). Furthermore, several R01 DAO12844 and 5 R01 DAO 13783 awarded by the other polymorphisms that change amino acid sequence National Institutes of Health. The government has certain 25 (Thr4Ala, Gly56Ala, Glu215Lys, Lys605ASn and rights in the invention. Pro612Ser) of 5-HTT have been shown to affect 5-HTuptake function in cell cultures (Prasad et al., 2003). FIELD OF INVENTION Although the long (L) and short (S) polymorphism at 5-HTT linked polymorphic region (5-HTTLPR) of SLC6A4 This invention relates generally to the field of diagnosing 30 has been extensively studied in the literature, the results are the susceptibility to addiction-related diseases and disorders inconclusive. For example, in a meta-analysis of 17 studies, and impulse control disorders, particularly alcohol-related Feinn et al. (2005) showed that Sallele was significantly diseases and disorders, as well as monitoring and treating the associated with alcohol dependence in Subjects with co-oc SaC. curring serotonergic abnormalities while several other studies 35 reported an association of alcohol dependence with the L BACKGROUND allele (Kweonet al., 2005, Hu et al., 2005). On the other hand, numerous studies including the report by our group reveal a Vulnerability to alcohol dependence is heritable, with a differential association between chronic problem-drinking rate ranging from 0.52 to 0.64 (Kendler, 2001). Despite this and the density and function of serotonin transporters in alco high heritability rate, only one marker allele (alcohol-me 40 holic subjects carrying L and S variants of SLC6A4 (Little et tabolizing aldehyde dehydrogenase genes) has been identi al., 1998, Javors et al., 2005, Johnson et al., 2008). Located in fied consistently to be associated with alcoholism (Kranzler the gene's transcriptional control region, 5-HTTLPR con et al., 2002). Of the various neurotransmitter systems through tains 16 tandem repeats of a 20 to 23 bp (G+C)-rich sequence which alcohol mediates its effects, the serotonergic system between by -1376 and bp-1027. Two common forms of this has been shown to play an important role in alcohol prefer 45 transcriptional control region have been found: a long 528bp ence and consumption (Johnson, 2004). Synaptic serotoner allele (L) with 16 repeats and a short 484 bp allele (S) with a gic neurotransmission is terminated when serotonin (5-HT) is deletion of transported back into pre-synaptic neurons by 5-HT trans 44 bp extending from bp -1255 to bp -1212. porters (5-HTTs) (Talvenheimo and Rudnick, 1980). There Serotonin (5-HT) function has been implicated in the regu fore, a major part of the functional capacity of the serotoner 50 lation of mood, impulsivity, and alcohol use that includes gic system is regulated by the 5-HTT. Heavy episodic variation in the age of onset of drinking and onset of alcohol drinking is associated with numerous psychiatric and general use disorders. The 5-HT System, originating in the raphe medical conditions causing a major public health burden nuclei and projecting to cortex, hippocampus, and Subcortical (Cargiulo, 2007). Several studies have reported a dose-re brain regions, is thought to influence drinking behavior sponse relationship between the extent of heavy drinking and 55 directly in alcohol-use-disordered individuals by modulating the risk of alcohol related morbidity and mortality among the reinforcing effects of alcohol and/or indirectly by pro heavy drinkers (Makela and Mustonen, 2007: Gastfriend et cesses regulating impulsivity and affect. Findings from ani al., 2007). Consequently, reduction of heavy drinking is used mal studies have shown that pharmacological enhancement as an indicator of treatment response in clinical trials aimed at of 5-HTactivity inhibits alcohol intake. Human studies have treating alcohol dependence. 60 shown that low 5-HT turnover is associated with impulsivity. Of the various neurotransmitter systems through which as well as alcohol-seeking behavior and alcoholism. Lower alcohol mediates its effects, the serotonergic system has been central 5-HT turnover (e.g., 5-hydroxy indole acetic acid in shown to play an important role in alcohol preference and cerebrospinal fluid) has been reported in early-onset alcohol consumption (Johnson, 2004). Synaptic serotonergic neu dependent (EOA) adults compared to late-onset alcohol rotransmission is terminated when serotonin (5-HT) is trans 65 dependent adults (LOA) and the lowest central 5-HT turnover ported back into pre-synaptic neurons by 5-HT transporters occurs in EOA adults when both parents have alcohol depen (5-HTTs) (Talvenheimo and Rudnick, 1980) and the degree dence. Together, these findings Support the hypothesis that US 8,697,361 B2 3 4 5-HT availability and function regulate drinking-related Reduced 5-HT neurotransmission has been reported in behaviors and drinking history. those with an increased propensity for drinking and in alco Scientific frustration has been promulgated by failures to holics who exhibit antisocial behaviors (i.e., EOA) (LeMar demonstrate clinical efficacy for selective serotonin reuptake quand etal 1994a: LeMarquand etal 1994b). These results are inhibitors (SSRIs) in treating alcoholism. Animal studies consistent with: 1) the demonstration of increased 5-HT show consistently that SSRIs reduce alcohol consumption in uptake into presynaptic serotonergic neurons in the brain, in various models and across species (for a review, see Johnson lymphocytes, and in platelets of alcoholics and their descen and Ait-Daoud 2000). SSRIs augment central serotonergic dants (Boismare et al 1987; Ernouf et al 1993; Faraj et al function and, by tonic inhibition, decrease mesocorticolimbic 1997) and 2) SPECT studies in nonhuman primates that had dopamine (DA) release. DA activation mediates alcohols 10 undergone early environmental stress, showing that increased rewarding effects; hence, its diminution should be associated binding of serotonin transporters is associated with greater with decreased abuse liability. Moreover, in humans, there is aggressiveness and reduced sensitivity to ethanol intoxication solid evidence that individuals with the highest biological (Heinz et al 1998). It would, therefore, be tempting to specu predisposition to alcoholism, typically by having an early late that this hypo-Serotonergic state could render individuals disease onset, family history, or both, have reduced seroton 15 more vulnerable to experimentation with alcohol early in life. ergic function (Buydens-Branchey et al. 1989: Fils-Aime etal Although acute alcohol intake may initially produce some 1996; LeMarquand et al 1994a: LeMarquand et al 1994b; temporary relief by increasing brain 5-HT levels, the residual Swann et al 1999). It was, therefore, tempting to predict that effect is to reduce serotonin function, thereby setting up a alcoholics would benefit from SSRI treatment, and that those vicious cycle (for a review see LeMarquand et al. (LeMar with an early onset and/or family history would benefit the quand etal 1994a: LeMarquand etal 1994b)). Chronic exces most because the SSRI would presumably ameliorate the sive drinking does not result in Sustained increases in 5-HT existing disequilibrium in serotonergic function. neurotransmission (Branchey et al 1981; Ledig et al 1982; Despite the encouraging results of earlier studies, more Pohorecky et al 1978). Reduced SERT density in the raphe rigorous, well controlled, state-of-the-art trials have gener nuclei is associated with an early alcoholism onset in violent ally failed to find a therapeutic effect for SSRIs in treating 25 offenders (Tihonen et al 1997) and with the combination of alcoholism (Gorelick and Paredes 1992: Kranzleretal 1996). having the LL variant of 5-HTTLPR and chronic drinking in In humans, functional control of the serotonergic system both postmortem brains (Little et al 1998) and living indi also seems to be regulated by genetic differences in SERT viduals (Heinz et al 2000). The study of Heinz and colleagues expression (Meltzer and Arora 1988). The SERT possesses (Heinz et al 2000) showed that individuals with the LL form the only known functional polymorphism regulating the sero 30 of 5-HTTLPR are more vulnerable to chronic alcohol-in tonin system (Heils et al 1997; Heils et al 1996; Lesch et al duced reductions in SERT density, but their study requires 1997). Basically, the polymorphism of the SERT5' regulatory validation in an adequately powered prospective study that promoter region (5-HTTLPR) on chromosome 17p12 con contains an equal number of individuals with the LL and sists of two types (Heils et al 1997: Heils etal 1996; Leschet SS/SL variants of 5-HTTLPR. This would enable confirma all 1997). The long (LL) variant, compared with the short (SS) 35 tion of the differential phenotypic expression of these allelic or heterozygous (SL) form, is associated with three times forms. Although it may, at first, seem paradoxical (i.e., for greater 5-HTuptake from platelets (Greenberg etal 1999) and those with the LL variant of 5-HTTLPR to have both reduced in lymphoblasts (Lesch et al 1996). Hence, individuals with SERT density and decreased serotonergic function), it is the LL variant of 5-HTTLPR can be expected to have notable that the SERTs in the raphe are associated with the increased SERT number and function and reduced levels of 40 regulation of cell firing rates. intrasynaptic 5-HT. There is a long felt need in the art for compositions and Recent scientific evidence would support the hypothesis of methods useful for diagnosing, treating, and monitoring alco LL variant of 5-HTTLPR predominance among EOA (Ish hol disorders and susceptibility to alcohol disorders. The iguro et al 1999; Schuckit et al 1999). Turker et al. (1998) present invention satisfies these needs. Suggested that high ethanol tolerance may be associated with 45 the SS/SL form of 5-HTTLPR, but their rather informal SUMMARY OF THE INVENTION criteria and the use of controls from a blood bank with uncer tain alcohol histories may make their conclusions difficult to The present invention discloses several methods and substantiate. Furthermore, a study by Sander et al. (1998) did assays useful for determining whether a subject has a predis not find a significant relationship (p=0.09) between SS/SL 50 position to developing an addictive disease or disorder, deter genotype and alcoholics with dissocial personality disorder. mining whether a Subject will be responsive to particular Finally, there are conflicting data on the relationship between treatments, and compositions and methods useful for treating the SS/SL form of 5'-HTTLPR and alcoholism in general a Subject in need of treatment. For example, the present inven (Edenberg et al. 1998: Hammoumi et al. 1999; Jorm et al. tion encompasses compositions and methods, and combina 1998; Sander et al. 1997); however, these studies contain no 55 tions thereof, useful for predicting subjects susceptible to subtyping information. Moreover, it is difficult to compare increased intensity of drinking and useful for predicting use these epidemiologic genotyping studies because of differing ful treatments. diagnostic criteria between the studies and different popula The present invention encompasses compositions and tion frequencies across ethnic groups for the allelic forms. methods useful for treating subjects who abuse alcohol based Perhaps most importantly, none of these studies have taken 60 on identification of genetic markers indicative of a subject into account that it may be the interaction between these being predisposed to severe drinking or being more Suscep Subtypes and alcohol consumption which is critical. That is, tible to alcoholism and problem drinking The assays center on even though these allelic forms of the SERT may not deter the serotonin System, particularly the serotonin transporter mine Vulnerability to alcoholism per se, the interaction gene SLC6A4, its expression, and various polymorphisms of between the allelic forms and alcohol consumption may 65 that gene. In one aspect, the marker is based on measurement determine treatment response, particularly to a selective sero of nucleotide polymorphisms. In one aspect, the polymor tonergic agent. phism is a single nucleotide polymorphism (SNP). The inven US 8,697,361 B2 5 6 tion further provides for the use of combinations of assays to of one or more of the assays in a Subject, treatments can be help further predict a predisposition to developing an addic designed specifically for that Subject. tive disease or disorder and to help predict treatments based The present invention encompasses an approach that com on the results of the assays. In one aspect, at least one drug bines drugs for the treatment or prevention of addictive dis which regulates part of the serotonin system is administered orders such as alcohol dependence. Because the reinforcing to the Subject. In another aspect, combination therapy can be effects of most abused drugs are also mediated by CMDA used by administering additional drugs. neurons, the present invention provides combination therapy Subjects comprising the Gallele of SNP polymorphism with drugs such as topiramate, ondansetron, and naltrexone rs 1042173 of the serotonin transporter gene SLC6A4 were as efficacious treatments for addictive disorders including found herein to be associated with significantly lower drink 10 (but not limited to) alcohol, eating, cocaine, methamphet ing intensity compared to subjects homozygous for the T amine, marihuana, tobacco abuse and addiction, and other allele. This was true for whites but not Hispanics. Addition addictive behaviors, including, but not limited to, gambling ally, the present application discloses that cells transfected and sex. Based on the unexpected discoveries described with the Gallele of SNP polymorphism rs1042173 of the herein, one of ordinary skill in the art will now appreciate that serotonin transporter gene SLC6A4 had significantly higher 15 the compounds of the invention useful for combination drug levels of both the mRNA and the serotonin transporter protein therapy can in some instances be used singly instead of as part compared with cells transfected with the Tallele. Even of a combination. Additionally, based on the present applica among alcohol-dependent Gallele carriers for rs1042173. tion, one of ordinary skill in the art will also appreciate that there was less intensity of drinking of compared with alcohol the compounds of the invention useful for combination drug dependent subject who were homozygous for the Tallele. The therapy can in Some instances be used in any combination. present application further discloses that alcohol-dependent In one embodiment, the present invention provides com subjects with the TT genotype respond better to ondansetron positions and methods for treating or preventing an alcohol treatment than similar subjects with the TG/GG genotype. related disease or disorder comprising administering to a Therefore, the present invention provides compositions and subject a therapeutically effective amount of at least two methods useful for predicting a predisposition to an addictive 25 anti-alcohol agents or compounds, and optionally other thera disease or disorder and the severity of that disorder, as well a peutic agents. Preferably, at least three anti-alcohol agents or compositions and methods useful for predicting Suitable compounds are used in the combination therapy. The present treatments and treatment regimens for those Subjects. The invention further encompasses the adjunctive use of psycho present invention provides that for those homozygous for T. Social management techniques. In one aspect, the drug com treatment may be customized to increase expression of the 30 bination therapy is more effective alone than when combined SLC6A4 gene or its protein, or their levels or activity, and that with psychosocial management techniques. In another treatments further include compositions and methods useful aspect, the drug combination therapy combined with psycho for decreasing serotonin levels or activity. Social management techniques is more effective than drug The present application discloses that youths with the LL combination therapy alone. In one aspect, the present inven genotype of the functional polymorphism for the 5'-regula 35 tion provides methods for treating or preventing an alcohol tory promoter region of the SERT gene (5-HTTLPR) had related disease or disorder in a subject comprising adminis higher levels of SERT, as measured by H-paroxetine binding tering an effective amount of at least two compounds, or and had a significantly earlier age of onset of drinking The preferably at least three compounds, or analogs, homologs, present invention therefore encompasses a method of predict derivatives, modifications, and pharmaceutically acceptable ing Subjects with a predisposition to early onset of drinking as 40 salts thereof, selected from the group consisting of seroton well as methods of treating these subjects, including treat ergic agents, serotonin antagonists, selective serotonin re ments to reduce expression of SERT and it activity. uptake inhibitors, serotonin receptor antagonists, opioid The present application further discloses that the “interac antagonists, dopaminergic agents, dopamine release inhibi tion of treatment (with ondansetron) and genotype (LSVS. tors, dopamine antagonists, norepinephrine antagonists, LS/SS) is highly significant and that there is a significant 45 GABA agonists, GABA inhibitors, GABA receptor antago effect of age of onset of drinking The application discloses a nists, GABA channel antagonists, glutamate agonists, significantly higher paroxetine binding (density of SERT) in glutamate antagonists, glutamine agonists, glutamine antago LL-genotype vs. 5-carriers (SS or SL genotypes). The present nists, anti-convulsant agents, NMDA-blocking agents, cal further application discloses that the LL group had a signifi cium channel antagonists, carbonic anhydrase inhibitors, cantly earlier age of onset of drinking and alonger duration of 50 neurokinins, Small molecules, peptides, vitamins, co-factors, drinking These promising data provide the first evidence that anti-orexin agents, regulators of cannabinoid receptor-1, and alcoholics with the LL genotype, compared with their LS/SS Corticosteroid Releasing Factor antagonists. In one aspect, counterparts, experience significantly greater reduction in the the neurokinin is NPY. The present invention further encom severity of drinking following ondansetron treatment. passes administering other Small molecules and peptides. In one embodiment, the present invention provides for 55 In one embodiment, the alcohol-related disease or disorder treating alcoholics, as well as Subjects with other addictive being treated includes, but is not limited to, early-onset alco diseases and disorders, with at least one drug. In one aspect, holic, late-onset alcoholic, alcohol-induced psychotic disor the Subject has the genotype LL. In one aspect, the at least one der with delusions, alcohol abuse, excessive drinking, heavy drug is ondansetron. In one aspect, the treatment reduces drinking, problem drinking, alcohol intoxication, alcohol DDD. The present invention further encompasses the use of 60 withdrawal, alcohol intoxication delirium, alcohol with multiple drugs and combinations of drugs for treating Sub drawal delirium, alcohol-induced persisting dementia, alco jects described herein. hol-induced persisting amnestic disorder, alcohol depen Furthermore, the present invention provides for the use of dence, alcohol-induced psychotic disorder with combinations of assays to betterpredict or diagnose a suscep hallucinations, alcohol-induced mood disorder, alcohol-in tibility to developing an addictive disease or disorder as well 65 duced or associated bipolar disorder, alcohol-induced or as methods of predicting a personalized treatment based on associated posttraumatic stress disorder, alcohol-induced the use of one or more predictive assays. Based on the results anxiety disorder, alcohol-induced sexual dysfunction, alco US 8,697,361 B2 7 8 hol-induced sleep disorder, alcohol-induced or associated and craving. Both subjective and objective measures can be gambling disorder, alcohol-induced or associated sexual dis used to analyze the effectiveness of treatment. For example, a order, alcohol-related disorder not otherwise specified, alco Subject can self-report according to guidelines and proce hol intoxication, and alcohol withdrawal. In one aspect, the dures established for such reporting. The procedures can be alcohol-related disease or disorder is early onset alcoholic. In performed at various times before, during, and after treat another aspect, the alcohol-related disease or disorder is late ment. Additionally, assays are available for measuring alco onset alcoholic. hol consumption. These assays include breath alcohol meter In one embodiment, the present invention provides com readings, measuring serum CDT and GGT levels, and mea positions and methods for reducing the frequency of alcohol suring 5-HTOL urine levels. consumption compared with the frequency of alcohol con 10 The present invention further provides adjunctive therapies sumption before the treatment. One of ordinary skill in the art to be used in conjunction with the combination drug thera will appreciate that the frequency can be compared with prior pies. The present invention further provides adjunctive consumption by the Subject or with consumption by a control therapy or treatment wherein the subject is also submitted to Subject not receiving the treatment. In one aspect, the type of a psychosocial management program. Psychosocial manage alcohol consumption is heavy drinking In another aspect, it is 15 ment programs are known in the art and include, but are not excessive drinking limited to, Brief Behavioral Compliance Enhancement Treat In one embodiment, the present invention provides com ment, Cognitive Behavioral Coping Skills Therapy, Motiva positions and methods for reducing the quantity of alcohol tional Enhancement Therapy, Twelve-Step Facilitation consumed in a Subject compared with the amount of alcohol Therapy (Alcoholics Anonymous), Combined Behavioral consumed before the treatment or compared with the alcohol Intervention, Medical Management, psychoanalysis, psycho consumption by a control Subject not receiving the treatment. dynamic treatment, and Biopsychosocial, Report, Empathy, One of ordinary skill in the art will appreciate that in some Needs, Advice, Direct Advice and Assessment. The present instances a subject being treated for and addictive disorder is invention further encompasses the use of additional adjunct not necessarily dependent. Such subjects include, for therapies and treatment, including hypnosis and acupuncture. example, Subjects who abuse alcohol, drink heavily, drink 25 The present invention further provides for advice to be excessively, are problem drinkers, or are heavy drug users. provided to Subjects in conjunction with drug combination The present invention provides compositions and methods for therapy. Advice constitutes a set of instructions pertaining to treating or preventing these behaviors in non-dependent Sub the potential consequences of excessive drinking, a calendar jects. or other method for monitoring drinking, and instructions or In one embodiment of the invention, the present invention 30 Suggestions about how to reduce or stop drinking Any of these provides compositions and methods for improving the physi strategies either alone or in any combination, and no matter cal or psychological sequelae associated with alcohol con how brief or lengthy, can constitute advice. The advice can be Sumption compared with a control Subject not receiving the provided in a format such as written, electronic, or interper treatment. Sonal. In one embodiment, the drug combination therapy is In one embodiment, the present invention provides com 35 more effective at treatment or prevention than merely admin positions and methods for increasing the abstinence rate of a istering a placebo and providing advice, administering no Subject compared with a control Subject not receiving the drugs and providing advice, or not administering drugs or treatment. providing advice. In one aspect, the combination drug therapy In one embodiment, the present invention provides com is more effective at treatment or prevention than drug therapy positions and methods for reducing the average level of alco 40 used in combination with a psychosocial management pro hol consumption in a subject compared with the level of gram. alcohol consumption before the treatment or compared with In one embodiment, at least one of the compounds being the level of alcohol consumption by a control subject not administered is administered at least once a day. In one receiving the treatment. aspect, it is administered at least twice a day. In another In one embodiment, the present invention provides com 45 embodiment, it is administered at least once a week. In yet positions and methods for reducing alcohol consumption and another embodiment, it is administered at least once a month. for increasing abstinence compared with the alcohol con In one embodiment, at least one of the compounds is a sumption by the subject before treatment or with a control serotonin receptor antagonist. In one aspect, the serotonin Subject not receiving the treatment. receptor is the serotonin-3 receptor. In one aspect, the com In one embodiment, the present invention provides com 50 pound is ondansetron. positions and methods for treating a subject with a predispo Various aspects and embodiments of the invention are sition to early-onset alcoholism. described in further detail below. In one embodiment, the present invention provides com positions and methods for treating a subject with a predispo BRIEF DESCRIPTION OF THE DRAWINGS sition to late-onset alcoholism. 55 One of ordinary skill in the art will appreciate that there are FIG. 1. Haploview generated LD plots for the five SNPs multiple parameters or characteristics of alcohol consump examined in this study and 5-HTTLPR alleles of SLC6A4 tion which may characterize a subject afflicted with an alco gene. The pooled sample consists of Subjects of Caucasian hol-related disease or disorder. It will also be appreciated that and Hispanic origin. Number in each box represents D'values combination therapies may be effective in treating more than 60 for each SNP pair. one parameter, and that there are multiple ways to analyze the FIG. 2. Amounts of drinking in 165 Caucasian male and effectiveness of treatment. The parameters analyzed when female alcoholics. (A) Amounts of drinking as a function of measuring alcohol consumption or frequency of alcohol con TT, TG and GG genotypes of rs1042173 (N of subjects in Sumption include, but are not limited to, heavy drinking days, each group is: 47 TT, 77 TG, and 41 GG). Mean drinks per number of heavy drinking days, average drinking days, num 65 drinking day (SEM) for the TT, TG and GG subjects were ber of drinks per day, days of abstinence, number of individu 11.17+0.98 vs. 8.05+0.47 and 9.58+0.67, respectively als not drinking heavily or abstinent over a given time period, (F-5.63; p=0.004).(B) Drinks per drinking day variance as a US 8,697,361 B2 10 function of the TT and G carriers (N of subjects in each LOA late-onset alcoholic(s) genotype is: 47 TT 118 G carriers). Mean drinks per drinking MET Motivational Enhancement Therapy day (SEM) for the Thomozygotes and G carriers were miRNA microRNA 11.17+0.98 vs. 8.58+0.39 respectively (t=2.97; p=0.003). MM Medical Management FIG. 3. (A) Serotonin transporter (5-HTT) mRNA expres NAc nucleus accumbens sion levels in HeLa cell cultures quantified by quantitative Naltrexone—au opioid receptor antagonist real-time PCR assay. The data shown here are meant-SEM of incRNA non-coding RNA four replicates for 5-HTT mRNA expressed by the T and G NMDA N-methyl-D-aspartate alleles in three separate experiments (Exp.) conducted on NOS—not otherwise specified separate times. GAPDH-glyceraldehyde-3-phosphate dehy 10 Ondansetron (ZofranR)—a serotonin receptor antagonist drogenase. (B) Average differences in optical densities of P alcohol-preferring rats bands seen on immunoblots for serotonin transporter S—short (5-HTT) protein expression in HeLa cell cultures for the T SERT serotonin transporter (also referred to as 5-HTT) and Gallele specific expression in three cell cultures (G: SLC6A4 human 5-HT transporter gene. 1.23+0.07: T: 0.28+0.05; N=4). 15 SNP single nucleotide polymorphism FIG. 4 is a graphic representation of platelet paroxetine SSRI selective serotonin re-uptake inhibitor binding (Brmax) for LL and S-carrier genotypes (5-HTTLPR Topiramate (TopamaX(R)—an anticonvulsant genotype). The ordinate indicates platelet binding (Brmax) TSF Twelve-Step Facilitation Therapy (e.g., Alcoholics and the abscissa indicates the genotype. Anonymous) V maximum serotonin uptake Velocity DETAILED DESCRIPTION VTA—Ventral tegmental area Abbreviations, Generic Names, and Acronyms DEFINITIONS
5-HT serotonin 25 In describing and claiming the invention, the following 5-HT, a subtype of serotonin receptor, the serotonin-3 terminology will be used in accordance with the definitions receptor set forth below. Unless defined otherwise, all technical and 5-HTOL 5-hydroxytryptophol Scientific terms used herein have the same meaning as com 5-HTT serotonin transporter (also referred to as SERT, monly understood by one of ordinary skill in the art to which 5HTT, HTT, and OCD1) 30 this invention belongs. Although any methods and materials 5-HTTLPR serotonin transporter-linked polymorphic similar or equivalent to those described herein can be used in region the practice or testing of the present invention, the preferred ADE—alcohol deprivation effect methods and materials are described herein. As used herein, ADI-adolescence diagnostic interview each of the following terms has the meaning associated with ASPD—antisocial personality disorder 35 it in this section. Specific and preferred values listed below for AUD-alcohol use disorder radicals, Substituents, and ranges are for illustration only; BBCET Brief Behavioral Compliance Enhancement Treat they do not exclude other defined values or other values ment within defined ranges for the radicals and Substituents. BED binge eating disorder As used herein, the articles “a” and “an refer to one or to b.i.d.-twice a day 40 more than one, i.e., to at least one, of the grammatical object B. maximum specific paroxetine binding density of the article. By way of example, “an element’ means one BRENDA Biopsychosocial, Report, Empathy, Needs, element or more than one element. Direct advice, and Assessment The term “about, as used herein, means approximately, in CBI-combined behavioral intervention the region of roughly, or around. When the term “about is CBT Cognitive Behavioral Coping Skills Therapy, also 45 used in conjunction with a numerical range, it modifies that referred to as cognitive behavioral therapy range by extending the boundaries above and below the CDT carbohydrate-deficient transferrin numerical values set forth. In general, the term “about is ChIPS children's interview for psychiatric syndrome used herein to modify a numerical value above and below the CMDA cortico-mesolimbic dopamine stated value by a variance of 20%. DA—dopamine 50 Addictive disorders' include, but are not limited to, eating DDD drinks/drinking day disorders, obesity-related disorders, impulse control disor DSM Diagnostic and Statistical Manual of Mental Disor ders, alcohol-related disorders, nicotine-related disorders, ders amphetamine-related disorders, methamphetamine-related EOA early-onset alcoholic(s) disorders, cannabis-related disorders, cocaine-related disor G2651T a site within a putative polyadenylation signal for 55 ders, gambling, sexual disorders, hallucinogen use disorders, a commonly used 3' polyadenylation site of the SLC6A4 inhalant-related disorders, benzodiazepine abuse or depen gene; also has reference identification number rs1042173 at dence related disorders, and opioid-related disorders. the GenBank website of the National Center for Biotechnol One of ordinary skill in the art will appreciate that addictive ogy Information disorders such as those related to alcohol or drugs, does mean GABA Y-amino-butyric acid (also referred to as Y-amino 60 that a subject is dependent unless specifically defined as such. butyric acid and Y-aminobutyric acid) The term “additional therapeutically active compound', in GGT Y-glutamyl transferase the context of the present invention, refers to the use or ICD impulse control disorder administration of a compound for an additional therapeutic IP intraperitoneal use other than just the particular disorder being treated. Such K. affinity constant 65 a compound, for example, could include one being used to K—equilibrium constant treat an unrelated disease or disorder, or a disease or disorder L—long which may not be responsive to the primary treatment for the US 8,697,361 B2 11 12 addictive disease or disorder being treated. Disease and dis twenty standard L-amino acids commonly found in naturally orders being treated by the additional therapeutically active occurring peptides. "Nonstandard amino acid residue” means agent include, for example, hypertension and diabetes. any amino acid, other than the standard amino acids, regard As used herein, the term “aerosol refers to suspension in less of whether it is prepared synthetically or derived from a the air. In particular, aerosol refers to the particlization or natural source. As used herein, “synthetic amino acid also atomization of a formulation of the invention and its suspen encompasses chemically modified amino acids, including but sion in the air. not limited to salts, amino acid derivatives (such as amides), As used herein, the term “affected cell refers to a cell of a and Substitutions. Amino acids contained within the peptides subject afflicted with a disease or disorder, which affected cell of the present invention, and particularly at the carboxy- or has an altered phenotype compared with a subject not 10 amino-terminus, can be modified by methylation, amidation, afflicted with a disease, condition, or disorder. acetylation or Substitution with other chemical groups which Cells or tissue are “affected by a disease or disorder if the can change the peptide's circulating half-life without cells or tissue have an altered phenotype relative to the same adversely affecting their activity. Additionally, a disulfide cells or tissue in a Subject not afflicted with a disease, condi linkage may be present or absent in the peptides of the inven tion, or disorder. 15 As used herein, an "agonist’ is a composition of matter tion. that, when administered to a mammal such as a human, The term “amino acid is used interchangeably with enhances or extends a biological activity of interest. Such “amino acid residue.” and may refer to a free amino acid and effect may be direct or indirect. to an amino acid residue of a peptide. It will be apparent from The term “alcohol abuser', as used herein, refers to a the context in which the term is used whetherit refers to a free subject who meets DSM IV criteria for alcohol abuse (i.e., amino acid or a residue of a peptide. “repeated use despite recurrent adverse consequences') but is Amino acids have the following general structure: not dependent on alcohol. "Alcohol-related disorders' as used herein refers to dis eases and disorder related to alcohol consumption and 25 H include, but are not limited to, alcohol-induced psychotic R-C-COOH disorder, with delusions; alcohol abuse; excessive drinking; heavy drinking; problem drinking; alcohol intoxication; alco hol withdrawal; alcohol intoxication delirium; alcohol with drawal delirium; alcohol-induced persisting dementia; alco 30 Amino acids may be classified into seven groups on the hol-induced persisting amnestic disorder, alcohol basis of the side chain R: (1) aliphatic side chains; (2) side dependence: alcohol-induced psychotic disorder, with hallu chains containing a hydroxylic (OH) group; (3) side chains cinations; alcohol-induced mood disorder; alcohol-induced or associated bipolar disorder; alcohol-induced or associated containing Sulfur atoms; (4) side chains containing an acidic post traumatic stress disorder, alcohol-induced anxiety dis 35 or amide group; (5) side chains containing a basic group; (6) order, alcohol-induced sexual dysfunction; alcohol-induced side chains containing an aromatic ring; and (7) proline, an sleep disorder; and alcohol-related disorder not otherwise imino acid in which the side chain is fused to the amino group. specified (NOS). As used herein, the term “conservative amino acid Substi As used herein, “amino acids are represented by the full tution' is defined herein as exchanges within one of the fol name thereof, by the three letter code corresponding thereto, 40 lowing five groups: or by the one-letter code corresponding thereto, as indicated I. Small aliphatic, nonpolar or slightly polar residues: in the following table: Ala, Ser. Thr, Pro, Gly: II. Polar, negatively charged residues and their amides: Asp, ASn, Glu, Gln; 45 III. Polar, positively charged residues: FullName Three-Letter Code One-Letter Code His, Arg, Lys; Aspartic Acid Asp D IV. Large, aliphatic, nonpolar residues: Glutamic Acid Glu E Met Leu, Ile, Val, Cys Lysine Lys K V. Large, aromatic residues: Arginine Arg R 50 Phe, Tyr, Trp Histidine His H Tyrosine Tyr Y The nomenclature used to describe the peptide compounds Cysteine Cys C of the present invention follows the conventional practice Asparagine ASn N wherein the amino group is presented to the left and the Glutamine Gln Q carboxy group to the right of each amino acid residue. In the Serine Ser S Threonine Thr T 55 formulae representing selected specific embodiments of the Glycine Gly G present invention, the amino- and carboxy-terminal groups, Alanine Ala A. although not specifically shown, will be understood to be in Valine Wall V Leucine Leu L the form they would assume at physiologic pH values, unless Isoleucine Ile I otherwise specified. Methionine Met M 60 The term “basic' or “positively charged amino acid, as Proline Pro P used herein, refers to amino acids in which the R groups have Phenylalanine Phe F a net positive charge at pH 7.0, and include, but are not limited Tryptophan Trp W to, the standard amino acids lysine, arginine, and histidine. As used herein, an “analog of a chemical compound is a The expression "amino acid as used herein is meant to 65 compound that, by way of example, resembles another in include both natural and synthetic amino acids, and both D structure but is not necessarily an isomer (e.g., 5-fluorouracil and L amino acids. "Standard amino acid means any of the is an analog of thymine). US 8,697,361 B2 13 14 An “antagonist' is a composition of matter that when pound, when administered in combination with another com administered to a mammal such as a human, inhibits or pound(s), may be different from when that compound is impedes a biological activity attributable to the level or pres administered alone. The term “more effective” means that the ence of an endogenous compound in the mammal. Such effect selected effect is alleviated to a greater extent by one treat may be direct or indirect. ment relative to the second treatment to which it is being As used herein, the term “anti-alcohol agent” refers to any compared. active drug, formulation, or method that exhibits activity to The term "elixir, as used herein, refers in general to a clear, treat or prevent one or more symptom(s) of alcohol addiction, Sweetened, alcohol-containing, usually hydroalcoholic liquid alcohol abuse, alcohol intoxication, and/or alcohol with containing flavoring Substances and sometimes active drawal, including drugs, formulations and methods that sig 10 nificantly reduce, limit, or prevent alcohol consumption in medicinal agents. mammalian Subjects. “Ethnic and Racial Categories' are defined herein accord The term “appetite Suppression', as used herein, is a reduc ing to NIH guidelines (1997 OMB Directive 15). tion, a decrease or, in cases of excessive food consumption, an Ethnic Categories: amelioration in appetite. This suppression reduces the desire 15 Hispanic or Latino: A person of Cuban, Mexican, Puerto or craving for food. Appetite Suppression can result in weight Rican, South or Central American, or other Spanish culture or loss or weight control as desired. origin, regardless of race. The term "Spanish origin” can also The term “average drinking, as used herein, refers to the be used in addition to “Hispanic or Latino.” mean number of drinks consumed during a one week period. Not Hispanic or Latino The term “average drinking is used interchangeably herein Racial Categories: with the term “average level of drinking.” American Indian or Alaska Native: A person having origins A “biomarker' is a specific biochemical in the body which in any of the original peoples of North, Central, or South has a particular molecular feature that makes it useful for America, and who maintains tribal affiliations or community measuring the progress of disease or the effects of treatment, attachment. or for measuring a process of interest. 25 Asian: A person having origins in any of the original A “compound as used herein, refers to any type of Sub peoples of the Far East, Southeast Asia, or the Indian subcon stance or agent that is commonly considered a drug, or a tinent including, for example, Cambodia, China, India, Japan, candidate for use as a drug, as well as combinations and Korea, Malaysia, Pakistan, the Philippine Islands, Thailand, mixtures of the above. and Vietnam. (Note: Individuals from the Philippine Islands A “control Subject is a subject having the same character 30 have been recorded as Pacific Islanders in previous data col istics as a test Subject, Such as a similar type of dependence, lection strategies.) etc. The control subject may, for example, be examined at Black or African American: A person having origins in any precisely or nearly the same time the test Subject is being of the black racial groups of Africa. Terms such as “Haitian' treated or examined. The control Subject may also, for or “Negro' can be used in addition to “Black or African example, be examined at a time distant from the time at which 35 American.” the test Subject is examined, and the results of the examination Native Hawaiian or Other Pacific Islander: A person having of the control subject may be recorded so that the recorded origins in any of the original peoples of Hawaii, Guam, results may be compared with results obtained by examina Samoa, or other Pacific Islands. tion of a test Subject. White: A person having origins in any of the original A “test” subject is a subject being treated. 40 peoples of Europe, the Middle East, or North Africa. As used herein, a "derivative' of a compound refers to a The term “excessive drinker, as used herein, refers to men chemical compound that may be produced from another com who drink more than 21 alcohol units per week and women pound of similar structure in one or more steps, as in replace who consume more than 14 alcohol units per week. One ment of H by an alkyl, acyl, or amino group. standard drink is 0.5 oz of absolute alcohol, equivalent to 10 As used herein, the term "diagnosis' refers to detecting a 45 oz of beer, 4 oz of wine, or 1 oz of 100-proof liquor. These risk or propensity to an addictive related disease disorder. In individuals are not dependent on alcohol but may or may not any method of diagnosis exist false positives and false nega meet DSM IV criteria for alcohol abuse. tives. Any one method of diagnosis does not provide 100% As used herein, a “functional molecule is a molecule in a accuracy. form in which it exhibits a property or activity by which it is A “disease' is a state of health of a subject wherein the 50 characterized. A functional enzyme, for example, is one that Subject cannot maintain homeostasis, and wherein if the dis exhibits the characteristic catalytic activity by which the ease is not ameliorated then the Subject's health continues to enzyme is characterized. deteriorate. In contrast, a “disorder in a subject is a state of The term “heavy drinker,” as used herein, refers to men health in which the Subject is able to maintain homeostasis, who drink more than 14 alcohol units per week and women but in which the subject's state of health is less favorable than 55 who consume more than 7 alcohol units per week. One stan it would be in the absence of the disorder. However, the dard drink is 0.5 oz of absolute alcohol, equivalent to 10 oz of definitions of “disease' and “disorder” as described above are beer, 4 oz of wine, or 1 oz of 100-proof liquor. These indi not meant to Supersede the definitions or common usage viduals are not dependent on alcohol but may or may not meet related to specific addictive diseases or disorders. DSM IV criteria for alcohol abuse. A disease, condition, or disorder is “alleviated” if the sever 60 The term “heavy drinking', as used with respect to the ity of a symptom of the disease or disorder, the frequency with alcohol-dependent population of Example 1, refers to drink which Such a symptom is experienced by a patient, or both, ing at least 21 standard drinks/week for women and at least 30 are reduced. drinks/week for men during the 90 days prior to enrollment in As used herein, an “effective amount’ means an amount the study and is more fully described therein. Sufficient to produce a selected effect, Such as alleviating 65 A "heavy drinking day, as used herein, refers to the con symptoms of a disease or disorder. In the context of admin Sumption by a man or woman of more than about five or four istering two or more compounds, the amount of each com standard drinks per drinking day, respectively. US 8,697,361 B2 15 16 The term “heavy drug use.” as used herein, refers to the use when the ligand functions in a binding reaction which is of any drug of abuse, including, but not limited to, cocaine, determinative of the presence of the compound in a sample of methamphetamine, other stimulants, phencyclidine, other heterogeneous compounds. hallucinogens, marijuana, sedatives, tranquilizers, hypnotics, A “receptor is a compound or molecule that specifically opiates at intervals or in quantities greater than the norm. The binds to a ligand. intervals of use include intervals such as at least once a month, As used herein, the term “linkage” refers to a connection at least once a week, and at least once a day. "Heavy drug use between two groups. The connection can be either covalent or is defined as testing “positive' for the use of that drug on at non-covalent, including but not limited to ionic bonds, hydro least 2 occasions in any given week with at least 2 days gen bonding, and hydrophobic/hydrophilic interactions. between testing occasions. 10 As used herein, the term “inhaler” refers both to devices for As used herein, the term “linker” refers to a molecule that nasal and pulmonary administration of a drug, e.g., in solu joins two other molecules either covalently or noncovalently, tion, powder and the like. For example, the term “inhaler” is e.g., through ionic or hydrogen bonds or van der Waals inter intended to encompass a propellant driven inhaler, such as is actions. used to administer antihistamine for acute asthma attacks, and 15 The term “measuring the level of expression' or “deter plastic spray bottles, such as are used to administer decon mining the level of expression' as used herein refers to any gestants. measure or assay which can be used to correlate the results of The term “inhibit, as used herein, refers to the ability of a the assay with the level of expression of a gene or protein of compound or any agent to reduce or impede a described interest. Such assays include measuring the level of mRNA, function, level, activity, synthesis, release, binding, etc., protein levels, etc. and can be performed by assays Such as based on the context in which the term “inhibit is used. northern and western blot analyses, binding assays, immuno Preferably, inhibition is by at least 10%, more preferably by at blots, etc. The level of expression can include rates of expres least 25%, even more preferably by at least 50%, and most sion and can be measured in terms of the actual amount of an preferably, the function is inhibited by at least 75%. The term mRNA or protein present. “inhibit is used interchangeably with “reduce” and “block.” 25 The term “nasal administration' in all its grammatical The term “inhibit a complex,” as used herein, refers to forms refers to administration of at least one compound of the inhibiting the formation of a complex or interaction of two or invention through the nasal mucous membrane to the blood more proteins, as well as inhibiting the function or activity of stream for systemic delivery of at least one compound of the the complex. The term also encompasses disrupting a formed invention. The advantages of nasal administration for deliv complex. However, the term does not imply that each and 30 ery are that it does not require injection using a syringe and every one of these functions must be inhibited at the same needle, it avoids necrosis that can accompany intramuscular time. administration of drugs, and trans-mucosal administration of The term “inhibit a protein, as used herein, refers to any a drug is highly amenable to self administration. method or technique which inhibits protein synthesis, levels, As used herein, the term “nucleic acid encompasses RNA activity, or function, as well as methods of inhibiting the 35 as well as single and double-stranded DNA and cDNA. Fur induction or stimulation of synthesis, levels, activity, or func thermore, the terms, “nucleic acid, “DNA “RNA and tion of the protein of interest. The term also refers to any similar terms also include nucleic acid analogs, i.e. analogs metabolic or regulatory pathway which can regulate the Syn having other than a phosphodiester backbone. For example, thesis, levels, activity, or function of the protein of interest. the so-called "peptide nucleic acids.” which are known in the The term includes binding with other molecules and complex 40 art and have peptide bonds instead of phosphodiester bonds in formation. Therefore, the term “protein inhibitor refers to the backbone, are considered within the scope of the present any agent or compound, the application of which results in the invention. By “nucleic acid' is also meant any nucleic acid, inhibition of protein function or protein pathway function. whether composed of deoxyribonucleosides or ribonucleo However, the term does not imply that each and every one of sides, and whether composed of phosphodiester linkages or these functions must be inhibited at the same time. 45 modified linkages Such as phosphotriester, phosphoramidate, As used herein, an “instructional material” includes a pub siloxane, carbonate, carboxymethylester, acetamidate, car lication, a recording, a diagram, or any other medium of bamate, thioether, bridged phosphoramidate, bridged meth expression which can be used to communicate the usefulness ylene phosphonate, bridged phosphoramidate, bridged phos of a compound of the invention in the kit for effecting alle phoramidate, bridged methylene phosphonate, viation of the various diseases or disorders recited herein. 50 phosphorothioate, methylphosphonate, phosphorodithioate, Optionally, or alternately, the instructional material may bridged phosphorothioate or Sulfone linkages, and combina describe one or more methods of alleviating the diseases or tions of such linkages. The term nucleic acid also specifically disorders in a subject. The instructional material of the kit of includes nucleic acids composed of bases other than the five the invention may, for example, be affixed to a container biologically occurring bases (adenine, guanine, thymine, which contains the identified compound invention or be 55 cytosine and uracil). Conventional notation is used herein to shipped together with a container which contains the identi describe polynucleotide sequences: the left-hand end of a fied compound. Alternatively, the instructional material may single-stranded polynucleotide sequence is the 5'-end; the be shipped separately from the container with the intention left-hand direction of a double-stranded polynucleotide that the instructional material and the compound be used sequence is referred to as the 5'-direction. The direction of 5' cooperatively by the recipient. 60 to 3' addition of nucleotides to nascent RNA transcripts is “Intensity of drinking refers to the number of drinks, referred to as the transcription direction. The DNA strand which can be equated with values such as drinkS/day, drinkS/ having the same sequence as an mRNA is referred to as the drinking day, etc. Therefore, greater intensity of drinking “coding strand': sequences on the DNA strand which are means more drinkS/day, or drinkS/drinking day, etc. located 5' to a reference point on the DNA are referred to as As used herein, a “ligand’ is a compound that specifically 65 "upstream sequences'; Sequences on the DNA strand which binds to a target compound or molecule. A ligand 'specifi are 3' to a reference point on the DNA are referred to as cally binds to” or “is specifically reactive with a compound "downstream sequences US 8,697,361 B2 17 18 Unless otherwise specified, a “nucleotide sequence encod As used herein, the term “pharmaceutically acceptable car ing an amino acid sequence' includes all nucleotide rier includes any of the standard pharmaceutical carriers, sequences that are degenerate versions of each other and that Such as a phosphate buffered saline Solution, water, emulsions encode the same amino acid sequence. Nucleotide sequences Such as an oil/water or water/oil emulsion, and various types that encode proteins and RNA may include introns. of wetting agents. The term also encompasses any of the “Obesity' is commonly referred to as a condition of agents approved by a regulatory agency of the US Federal increased body weight due to excessive fat. Drugs to treat government or listed in the US Pharmacopeia for use in obesity are generally divided into three groups: (1) those that animals, including humans. decrease food intake. Such as drugs that interfere with As used herein, the term “physiologically acceptable' ester monoamine receptors. Such as noradrenergic receptors, sero 10 or salt means an ester or salt form of the active ingredient tonin receptors, dopamine receptors, and histamine receptors; which is compatible with any other ingredients of the phar (2) those that increase metabolism; and (3) those that increase maceutical composition, and which is not deleterious to the thermogenesis or decrease fat absorption by inhibiting pan subject to which the composition is to be administered. creatic lipase (Bray, 2000, Nutrition, 16:953-960 and Leon 15 A "predisposition' to an addictive disease or disorder hardt et al., 1999, Eur. J. Nutr., 38:1-13). Obesity has been refers to situations a Subject has an increased chance of abus defined interms of body mass index (BMI). BMI is calculated ing a Substance Such as alcohol or a drug or becoming as weight (kg)/(height (m), according to the guidelines of addicted to alcohol or a drug or other addictive diseases or the U.S. Centers for Disease Control and Prevention (CDC), disorders. and the World Health Organization (WHO). Physical status: The term “prevent, as used herein, means to stop some The use and interpretation of anthropometry. Geneva, Swit thing from happening, or taking advance measures against zerland: World Health Organization 1995. WHO Technical Something possible or probable from happening. In the con Report Series), for adults over 20 years old, BMI falls into one text of medicine, “prevention' generally refers to action taken of these categories: below 18.5 is considered underweight, to decrease the chance of getting a disease or condition. 18.5-24.9 is considered normal, 25.0-29.9 is considered over 25 The term “problem drinker, as used herein, encompasses weight, and 30.0 and above is considered obese. individuals who drink excessively and who report that their The term "oligonucleotide' typically refers to short poly alcohol consumption is causing them problems. Such prob nucleotides, generally no greater than about 50 nucleotides. It lems include, for example, driving while intoxicated, prob will be understood that when a nucleotide sequence is repre lems at work caused by excessive drinking, and relationship sented by a DNA sequence (i.e., A.T., G, C), this also includes 30 problems caused by excessive drinking by the Subject. an RNA sequence (i.e., A, U, G, C) in which “U” replaces “T” As used herein, “protecting group with respect to a termi The term "peptide” typically refers to short polypeptides. nal amino group refers to a terminal amino group of a peptide, “Polypeptide' refers to a polymer composed of amino acid which terminal amino group is coupled with any of various residues, related naturally occurring structural variants, and amino-terminal protecting groups traditionally employed in synthetic non-naturally occurring analogs thereof linked via 35 peptide synthesis. Such protecting groups include, for peptide bonds, related naturally occurring structural variants, example, acyl protecting groups such as formyl, acetyl, ben and synthetic non-naturally occurring analogs thereof. Syn Zoyl, trifluoroacetyl. Succinyl, and methoxysuccinyl; aro thetic polypeptides can be synthesized, for example, using an matic urethane protecting groups such as benzyloxycarbonyl: automated polypeptide synthesizer. and aliphatic urethane protecting groups, for example, tert The term “protein' typically refers to large polypeptides. 40 butoxycarbonyl or adamantyloxycarbonyl. See Gross and A “recombinant polypeptide' is one which is produced Mienhofer, eds. The Peptides, vol. 3, pp. 3-88 (Academic upon expression of a recombinant polynucleotide. Press, New York, 1981) for suitable protecting groups. A peptide encompasses a sequence of two or more amino As used herein, “protecting group with respect to a termi acids wherein the amino acids are naturally occurring or nal carboxy group refers to a terminal carboxyl group of a synthetic (non-naturally occurring) amino acids. Peptide 45 peptide, which terminal carboxyl group is coupled with any mimetics include peptides having one or more of the follow of various carboxyl-terminal protecting groups. Such protect ing modifications: ing groups include, for example, tert-butyl, benzyl, or other 1. peptides wherein one or more of the peptidyl —C(O) acceptable groups linked to the terminal carboxyl group NR—linkages (bonds) have been replaced by a non-peptidyl through an ester or ether bond. linkage Such as a —CH2-carbamate linkage 50 The term "psychosocial management program, as used (—CH2OC(O)NR ), a phosphonate linkage, a —CH2-sul herein, relates to the use of various types of counseling and fonamide (—CH2—S(O)2NR—) linkage, a urea ( NHC management techniques used to Supplement the combination (O)NH-) linkage, a -CH2-secondary amine linkage, or pharmacotherapy treatment of addictive and alcohol-related with an alkylated peptidyl linkage ( C(O)NR—) wherein R diseases and disorders. is C1-C4 alkyl: 55 As used herein, the term “purified and like terms relate to 2. peptides wherein the N-terminus is derivatized to a an enrichment of a molecule or compound relative to other —NRR1 group, to a NRC(O)R group, to a NRC(O)OR components normally associated with the molecule or com group, to a NRS(O)2R group, to a NHC(O)NHR group pound in a native environment. The term “purified” does not where Rand R1 are hydrogen or C1-C4 alkyl with the proviso necessarily indicate that complete purity of the particular that R and R1 are not both hydrogen; 60 molecule has been achieved during the process. A "highly 3. peptides wherein the C terminus is derivatized to —C(O) purified’ compound as used herein refers to a compound that R2 where R2 is selected from the group consisting of C1-C4 is greater than 90% pure. alkoxy, and —NR3R4 where R3 and R4 are independently “Reduce see “inhibit. selected from the group consisting of hydrogen and C1-C4 The term “reduction in drinking, as used herein, refers to alkyl. 65 a decrease in drinking according to one or more of the mea The term “per application” as used herein refers to admin Surements of drinking Such as heavy drinking, number of istration of a drug or compound to a Subject. drinkS/day, number of drinkS/drinking day, etc. US 8,697,361 B2 19 20 The term “regulate” refers to either stimulating or inhibit decreasing the risk of developing pathology associated with ing a function or activity of interest. the disease. “Treating is used interchangeably with “treat A “sample, as used herein, refers to a biological sample ment herein. from a subject, including, but not limited to, normal tissue A “therapeutic' treatment is a treatment administered to a samples, diseased tissue samples, biopsies, blood, saliva, Subject who exhibits signs of pathology for the purpose of feces, semen, tears, and urine. A sample can also be any other diminishing or eliminating those signs. Source of material obtained from a Subject which contains A “therapeutically effective amount of a compound is that cells, tissues, or fluid of interest as interpreted in the context amount of compound which is sufficient to provide a benefi of the claim and the type of assay to be performed using that cial effect to the subject to which the compound is adminis sample. 10 tered. By “small interfering RNAs (siRNAs) is meant, interalia, an isolated dsRNA molecule comprising both a sense and an Chemical Definitions anti-sense strand. In one aspect, it is greater than 10 nucle otides in length. siRNA also refers to a single transcript that 15 As used herein, the term “halogen' or “halo' includes has both the sense and complementary antisense sequences bromo, chloro, fluoro, and iodo. from the target gene, e.g., a hairpin. siRNA further includes The term “haloalkyl as used herein refers to an alkyl any form of dsRNA (proteolytically cleaved products of radical bearing at least one halogen Substituent, for example, larger dsRNA, partially purified RNA, essentially pure RNA, chloromethyl, fluoroethyl or trifluoromethyl and the like. synthetic RNA, recombinantly produced RNA) as well as The term "C-C alkyl” wherein n is an integer, as used altered RNA that differs from naturally occurring RNA by the herein, represents a branched or linear alkyl group having addition, deletion, Substitution, and/or alteration of one or from one to the specified number of carbon atoms. Typically, more nucleotides. C-C alkyl groups include, but are not limited to, methyl, By the term “specifically binds, as used herein, is meanta ethyl, n-propyl, iso-propyl, butyl, iso-butyl, sec-butyl, tert molecule which recognizes and binds a specific molecule, but 25 butyl, pentyl, hexyl, and the like. does not substantially recognize or bind other molecules in a The term "C-C, alkenyl' wherein n is an integer, as used sample, or it means binding between two or more molecules herein, represents an olefinically unsaturated branched or as in part of a cellular regulatory process, where said mol linear group having from two to the specified number of ecules do not substantially recognize or bind other molecules carbonatoms and at least one double bond. Examples of Such in a sample. 30 groups include, but are not limited to, 1-propenyl, 2-propenyl, The term “standard, as used herein, refers to something 1,3-butadienyl, 1-butenyl, hexenyl, pentenyl, and the like. used for comparison. For example, it can be a known standard The term "C-C alkynyl' wherein n is an integer refers to agent or compound which is administered or added and used an unsaturated branched or linear group having from two to for comparing results when adding a test compound, or it can the specified number of carbon atoms and at least one triple be a standard parameter or function which is measured to 35 bond. Examples of such groups include, but are not limited to, obtain a control value when measuring an effect of an agent or 1-propynyl, 2-propynyl, 1-butynyl, 2-butynyl, 1-pentynyl, compound on a parameter or function. Standard can also refer and the like. to an “internal standard’. Such as an agent or compound The term "C-C cycloalkyl wherein n=8, represents which is added at known amounts to a sample and is useful in cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohep determining such things as purification or recovery rates 40 tyl, and cyclooctyl. when a sample is processed or subjected to purification or As used herein, the term “optionally substituted” refers to extraction procedures before a marker of interest is measured. from Zero to four substituents, wherein the substituents are Internal standards are often a purified marker of interest each independently selected. Each of the independently which has been labeled, such as with a radioactive isotope, selected substituents may be the same or different than other allowing it to be distinguished from an endogenous marker. 45 Substituents. The term “one standard drink, as used herein, is 0.5 oz of As used herein the term “aryl refers to an optionally absolute alcohol, equivalent to 10 oz of beer, 4 oz of wine, or Substituted mono- or bicyclic carbocyclic ring system having 1 oz of 100-proof liquor. one or two aromatic rings including, but not limited to, phe A “subject of diagnosis or treatment is a mammal, includ nyl, benzyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl, ing a human. 50 and the like. “Optionally substituted aryl' includes aryl com The term “subject comprises a predisposition to the early pounds having from Zero to four Substituents, and 'substi onset of alcoholism,” as used herein, refers to a subject who tuted aryl' includes aryl compounds having one or more has, or is characterized by, a predisposition to the early onset substituents. The term (Cs-Cs alkyl)aryl refers to any aryl of alcoholism. group which is attached to the parent moiety via the alkyl The term “symptom, as used herein, refers to any morbid 55 group. phenomenon or departure from the normal in structure, func The term "heterocyclic group' refers to an optionally sub tion, or sensation, experienced by the patient and indicative of stituted mono- or bicyclic carbocyclic ring system containing disease. In contrast, a sign is objective evidence of disease. from one to three heteroatoms wherein the heteroatoms are For example, a bloody nose is a sign. It is evident to the selected from the group consisting of oxygen, Sulfur, and patient, doctor, nurse and other observers. 60 nitrogen. As used herein the term "heteroaryl refers to an As used herein, the term “treating may include prophy optionally substituted mono- or bicyclic carbocyclic ring sys laxis of the specific disease, disorder, or condition, or allevia tem having one or two aromatic rings containing from one to tion of the symptoms associated with a specific disease, dis three heteroatoms and includes, but is not limited to, furyl, order or condition and/or preventing or eliminating said thienyl, pyridyl and the like. symptoms. A "prophylactic' treatment is a treatment admin 65 The term “bicyclic' represents either an unsaturated or istered to a subject who does not exhibit signs of a disease or saturated stable 7- to 12-membered bridged or fused bicyclic exhibits only early signs of the disease for the purpose of carbon ring. The bicyclic ring may be attached at any carbon US 8,697,361 B2 21 22 atom which affords a stable structure. The term includes, but phisms can result in differences in serotonergic function and is not limited to, naphthyl, dicyclohexyl, dicyclohexenyl, and regulation. Since alcohol consumption affects serotonergic the like. function, this gene-gene interaction (5-HTTLPR and The compounds of the present invention contain one or rs 1042173) may lead to a serotonergic dysregulation that more asymmetric centers in the molecule. In accordance with either provokes, aggravates, or maintains further drinking the present invention a structure that does not designate the behavior and alcoholism. These states of serotonergic dys Stereochemistry is to be understood as embracing all the regulation or alterations in function can be stabilized orame various optical isomers, as well as racemic mixtures thereof. liorated in excessive drinking or alcoholic populations by the The compounds of the present invention may exist in tau compositions and methods of the present invention Such as 10 administration of serotonergic medications including the tomeric forms and the invention includes both mixtures and serotonin-3 (5-HT-3) antagonist, ondansetron. separate individual tautomers. For example the following In one embodiment, 5-HT3 receptor antagonists (includ Structure: ingondansetron) can improve the drinking outcomes of those with certain polymorphisms of 5-HTTLPR and/or 15 rs 1042173, either alone or combined. Because abused drugs are predicted to work through similar mechanisms, the present invention therefore encompasses the use of 5-HT3 antagonists (including ondansetron) to ameliorate or stabilize these serotonergic States and produce atherapeutic effect that is understood to represent a mixture of the structures: improves clinical outcome for these disorders and diseases. The addictive diseases and disorders encompassed by the present compositions and methods include, but are not lim N% NH YS ited to, alcohol-related diseases and disorders, obesity-related and diseases and disorders, eating disorders, impulse control dis 25 orders, nicotine-related disorders, amphetamine-related dis orders, methamphetamine-related disorders, cannabis-re The term “pharmaceutically-acceptable salt” refers to salts lated disorders, cocaine-related disorders, hallucinogen use which retain the biological effectiveness and properties of the disorders, inhalant-related disorders, benzodiazepine abuse compounds of the present invention and which are not bio or dependence related disorders, opioid-related disorders, logically or otherwise undesirable. In many cases, the com 30 gambling, and computer or electronic addictions. pounds of the present invention are capable of forming acid Because the serotonin system has intimate connections and and/or base salts by virtue of the presence of amino and/or is modulated in the brain by other neurotransmitters, particu carboxyl groups or groups similar thereto. larly dopamine, GABA, glutamate, opioids, and cannabinoid, the present invention encompasses the use of medications and Embodiments 35 drugs that affect the structure and function of these other neurotransmitters when combined with any serotonergic The number of serotonin transporter protein molecules in agent (including ondansetron). In one aspect, the combina cells is affected by the amount of mature (secondary) seroto tion is efficacious for individuals with polymorphisms at the nin transporter mRNA molecules expressed in that cell. The 5-HTTLPR and rs1042173 described herein or anywhere expression levels of mRNA are controlled by the 5'-HTTLPR 40 else in the serotonergic system. In another aspect, the present and 3'-UTR of the SLC6A4 gene via two different mecha invention provides compositions, compounds and methods nisms. The 5-HTTLPR region controls the transcription rate that are associated with these co-modulating neurotransmit of SLC6A4 (Heils et al., (1996) J. Neurochem. 66:2621 ters (i.e., dopamine, GABA, glutamate, opioids, and cannab 2624), while rs1042173 SNP in the 3'-UTR of SLC6A4 inoid), including, but not limited to, topiramate, baclofen, affects mature mRNA levels via post-transcriptional mecha 45 gabapentin, naltrexone, nalmefene, and rimonabant in nisms (Battersby et al., (1999), J. Neurochem. 72: 1384-1388: combination with any serotonergic agent (including but not Beaudoing et al., (2000), Genome Res 10:1001-1010; Chenet limited to ondansetron, selective serotonin re-uptake block al., (2006), Nat. Genet. 38:1452-145). ers, and other agonists orantagonists of other serotonin recep The 5-HTTLPR is found to harbor several binding sites for tors or moieties) can produce a therapeutic effect to improve different transcription factor molecules necessary for the 50 the clinical outcomes for individuals who use, abuse, misuse, regulation of transcription initiation (Hu et al., (2005), Alco or are dependent on alcohol. Because abused drugs are pre hol Clin. Exp. Res. 29:8-16). Therefore, the number of dicted to work through similar mechanisms, the present nascent (primary) mRNA copies transcribed by the SLC6A4 invention further provides combinations of these co-modu gene and the Subsequent mature mRNA copies is affected by lating drugs with any other serotonergic agent to be used to 5'-HTTLPR polymorphisms. The rs1042173 allelic differ 55 treat individuals with any Substance use, abuse, misuse, ences are reported to be regulated by MicroRNA (miRNA) dependence, or habit-forming behavior with polymorphisms binding to at/near the rs1042173 site (for examples, miR-15a at 5-HTTLPR and rs1042173, or anywhere else in the sero and miR-16 binding), degrading primary mRNA molecules tonergic or co-modulating neurotransmitter systems (i.e., and differential polyadenylation and resulting in altered dopamine, GABA, glutamate, opioids, and cannabinoid), mature mRNA levels. Therefore, the combined effects of 60 either alone or in combination. 5'-HTTLPR and rs1042173 polymorphisms may modulate The present invention encompasses compositions and each other's individual effects on determining the overall methods for treatment or prevention where 5'-HTTLPR poly availability of mature mRNA for translation into serotonin morphisms are associated with Vulnerability or can Sustain, transporter protein molecules. provoke, or govern alcohol consumption. 5'-HTTLPR poly Without wishing to be bound by any particularly, it is 65 morphisms or related miRNA, mRNA, protein expression, hypothesized herein that, considering these factors, the com levels, or states of function, or other biochemical products or bined genetic effect of 5'-HTTLPR and rs1042173 polymor chemical associations may themselves serve as a biomarker US 8,697,361 B2 23 24 for alcohol consumption. Such a biomarker (i.e., blood test) aid in recovery from Substance use, misuse, abuse, or depen can be used to provide a means or a test to determine whether, dence or any habit-forming behavior. and how much, alcohol has been consumed by an individual. The present invention encompasses providing any 5-HT3 5'-HTTLPR polymorphisms or related miRNA, mRNA, pro antagonist (including ondansetron), at any dose or dosage tein expression, levels, or states of function, or other bio form, to individuals with rs1042173 and 5'-HTTLPR poly chemical products or chemical associations may themselves morphisms combined can ameliorate, improve, treat, or aid in serve as a biomarker for alcohol use, misuse, or dependence. recovery from alcohol use, abuse, or dependence. Such a biomarker (i.e., blood test) can be used to provide a The present invention encompasses providing any agent or means or a test to determine, evaluate, or Support a diagnosis drug that has an effect on the serotonin system, at any dose or 10 dosage form, either directly or indirectly to individuals with of alcohol use, misuse, or dependence. rs 1042173 and 5-HTTLPR polymorphisms can ameliorate, The present invention encompasses compositions and improve, treat, or aid in recovery from Substance use, abuse, methods for treatment or prevention where rs1042173 poly or dependence or habit-forming behavior. morphisms are associated with Vulnerability or can Sustain, The present invention encompasses providing any agent or provoke, or govern alcohol consumption. rs1042173 poly 15 drug or chemical entity that has an effect, at any dose or morphisms or related miRNA, mRNA, protein expression, dosage form, either directly or indirectly to modulate, regu levels, or states of function, or other biochemical products or late, or alter the structural, functional, molecular, or bio chemical associations may themselves serve as a biomarker chemical effects of rs1042173 and 5'-HTTLPR polymor for alcohol consumption. Such a biomarker (i.e., blood test) phisms, either alone or combined, can ameliorate, improve, can be used to provide a means or a test to determine whether, treat, or aid in recovery from alcohol use, abuse, or depen and how much, alcohol has been consumed by an individual. dence. rs 1042173 polymorphisms or related miRNA, mRNA, pro The present invention encompasses providing any agent or tein expression, levels, or states of function, or other bio drug or chemical entity that has an effect, at any dose or chemical products or chemical associations may themselves dosage form, either directly or indirectly to modulate, regu serve as a biomarker for alcohol use, misuse, or dependence. 25 late, or alter the structural, functional, molecular, or bio Such a biomarker (i.e., blood test) can be used to provide a chemical effects of rs1042173 and 5'-HTTLPR polymor means or a test to determine, evaluate, or Support a diagnosis phisms, either alone or combined, can ameliorate, improve, of alcohol use, misuse, or dependence. treat, or aid in recovery from Substance use, abuse, or depen The present invention encompasses compositions and dence or habit-forming behavior. methods for treatment or prevention where the combination 30 5'-HTTLPR and rs1042173 polymorphisms, either alone of 5-HTTLPR and rs1042173 polymorphisms is associated or in combination, or combined with any other polymor with vulnerability or can sustain, provoke, or govern alcohol phisms within the serotonin system, or their related miRNA, consumption. The combination of 5-HTTLPR and mRNA, nckNA, or protein expression, levels, or states of rs 1042173 polymorphisms or related miRNA, mRNA, or function or other biochemical products or chemical associa protein expression, levels, or states of function, or other bio 35 tions, may themselves serve as a biomarker for alcohol con chemical products or chemical associations, may itself serve sumption. In one aspect, the use of 5-HTTLPR and as a biomarker for alcohol consumption. Such a biomarker rs 1042173 as biomarkers can provide a means or a test to can be used to provide a means or a test to determine whether, determine whether, and how much, alcohol has been con and how much, alcohol has been consumed by an individual. Sumed by an individual. The combination of 5'-HTTLPR and rs1042173 polymor 40 5'-HTTLPR and rs1042173 polymorphisms, either alone phisms or related miRNA, mRNA, or protein expression, or in combination, or combined with any other polymor levels, or states of function, or other biochemical products or phisms within the serotonin system, or their related miRNA, chemical associations, may itself serve as a biomarker for mRNA, ncRNA, or protein expressions, levels, or states of alcohol use, abuse, or dependence. Such a biomarker can be function or other biochemical products or chemical associa used to determine, evaluate, or Support a diagnosis of alcohol 45 tions, may themselves serve as a biomarker for alcohol use, use, misuse, or dependence. misuse, or dependence. In one aspect, the use of 5-HTTLPR The present invention further provides for the use of any and rs1042173 as biomarkers can provide a means or a test to 5-HT3 antagonist (including ondansetron) at any dose or determine, evaluate, or Support a diagnosis of alcohol use, dosage form to individuals with 5'-HTTLPR polymorphisms misuse, abuse, or dependence. can ameliorate, improve, treat, or aid in recovery from alcohol 50 5'-HTTLPR and rs1042173 polymorphisms, either alone use, abuse, or dependence, or Substance use, abuse, or depen or in combination, or combined with any other polymor dence. phisms within the serotonin system, or their related miRNA, The present invention encompasses providing any agent or mRNA, ncRNA, or protein expressions, levels, or states of drug that has an effect on the serotonin system, at any dose or function or other biochemical products or chemical associa dosage form, either directly or indirectly to individuals with 55 tions, may themselves serve as a biomarker for Substance use 5'-HTTLPR polymorphisms can ameliorate, improve, treat, or a habit-forming behavior. In one aspect, the use of 5'-HT or aid in recovery from alcohol use, abuse, or dependence. TLPR and rs1042173 as biomarkers can provide a means or a The present invention encompasses providing any 5-HT-3 test to determine whether, and how much, Substance has been antagonist (including ondansetron), at any dose or any dosage consumed, or a habit-forming behavior has been performed, form, to individuals with rs1042173 polymorphisms can 60 by an individual. ameliorate, improve, treat or aid in recovery from alcohol use, 5'-HTTLPR and rs1042173 polymorphisms, either alone abuse, or dependence, or Substance use, abuse, or depen or in combination, or combined with any other polymor dence. phisms within the serotonin system, or their related miRNA, The present invention encompasses providing any agent or mRNA, ncRNA, or protein expressions, levels, or states of drug that has an effect on the serotonin system, at any dose or 65 function or other biochemical products or chemical associa dosage form, either directly or indirectly to individuals with tions, may themselves serve as a biomarker for Substance use, rs 1042173 polymorphisms can ameliorate, improve, treat, or abuse, misuse, dependence, or any habit-forming behavior. In US 8,697,361 B2 25 26 one aspect, the use of 5-HTTLPR and rs1042173 as biomar viduals who will respond to any treatment (i.e., pharmaco kers can provide a means or a test to determine whether, and logical, behavioral, genetic, biochemical, or any other com how much, a Substance has been consumed, or a habit-form binations). ing behavior has been performed, by an individual. The present invention further encompasses a method In one aspect, providing any agent or drug or chemical whereby genetic screening is used to identify any polymor entity, at any dose or dosage form, either directly or indirectly phisms within the serotonin system or their related miRNA, to modulate, regulate, or alter the structural, functional, mRNA, ncRNA, or protein expressions, levels, or states of molecular, or biochemical effects of the serotonin System can function, or other biochemical products or chemical associa be used to predict the response of a treatment effect toward tions, in order to identify individuals who use, abuse, misuse, 10 or are dependent on any Substance or have a habit-forming any genetic polymorphism, either alone or combined, to ame behavior, may be a basis for identifying adverse events or side liorate, improve, treat, or aid in recovery from alcohol use, effects or optimizing any treatment (i.e., pharmacological, abuse, or dependence, Substance use, abuse, or dependence, behavioral, genetic, biochemical, or any other combinations) or any habit-forming behavior. at any dose, dosage form, or treatment regimen. Such a test In another aspect, providing any 5-HT3 antagonist (in 15 can be anticipated to determine individuals who will not cluding ondansetron), at any dose or dosage form, either respond to a treatment or individuals who will need additional directly or indirectly to modulate, regulate, or alter the struc measures to optimize the Success of any treatment (i.e., phar tural, functional, molecular, or biochemical effects of any macological, behavioral, genetic, biochemical, or any other polymorphism, either alone or combined, within the seroto combinations). nin system can ameliorate, improve, treat, or aid in recovery The present invention further encompasses a method from alcohol use, abuse, or dependence or Substance use, whereby genetic screening is used to identify any polymor abuse, or dependence phisms within the serotonin system or their related miRNA, The present invention further encompasses a method mRNA, nckNA, or protein expression, levels, or states of whereby genetic screening is used to identify polymorphisms function, or other biochemical products or chemical associa within the serotonin system or their related miRNA, mRNA, 25 tions, in order to identify individuals who use, abuse, misuse, incRNA, or protein expression, levels, or states of function, or or are dependent on alcohol or any other Substance or have a other biochemical products or chemical associations, may habit-forming behavior (including but not limited to obesity, serve as a biomarker for alcohol consumption. Such a biom gambling, or computer or electronic addictions), may be a arker (including a blood test) can be used to provide a means basis for identifying adverse events or side effects or optimiz or a test to determine whether, and how much, alcohol has 30 ing treatment with any 5-HT3 antagonist (including been consumed by an individual. ondansetron) at any dose or dosage form. Such a test can be The present invention further encompasses a method anticipated to determine individuals who will respond to whereby genetic screening is used to identify polymorphisms treatment with any 5-HT-3 antagonist (including within the serotonin system or their related miRNA, mRNA, ondansetron). incRNA, or protein expression, levels, or states of function, or 35 The present invention further encompasses a method other biochemical products or chemical associations, may whereby genetic screening is used to identify 5-HTTLPR and serve as a biomarker to determine, evaluate, or Support the rs 1042173 polymorphisms or their related miRNA, mRNA, diagnosis of alcohol use, misuse, abuse, or dependence. or protein expressions, levels, or states of function, or other The present invention further encompasses a method biochemical products or chemical associations, either alone whereby genetic screening is used to identify polymorphisms 40 or in any combination, in order to identify individuals who within the serotonin system or their related miRNA, mRNA, use, abuse, misuse, or are dependent on alcohol or any other incRNA, or protein expression, levels, or states of function, or Substance or have a habit-forming behavior, may be a basis other biochemical products or chemical associations, may for identifying adverse events or side effects or optimizing serve as a biomarker for the consumption of any Substance, or treatment with any 5-HT-3 antagonist (including any Substance with abuse- or dependence-forming capability. 45 ondansetron) at any dose or dosage form. Such a test (includ Such a biomarker (including a blood test) can be used to ing a blood test) can be anticipated to determine individuals provide a means oratest to determine whether, and how much who will not respond to treatment with a 5-HT3 antagonist of any Substance (including addictive Substances) has been (including ondansetron) or individuals who will need addi consumed, or a habit-forming behavior has been performed, tional measures to optimize the Success of treatment with any by an individual. 50 5-HT3 antagonist (including ondansetron). The present invention further encompasses a method The present invention further encompasses a method whereby genetic screening is used to identify polymorphisms whereby genetic screening is used to identify 5-HTTLPR and within the serotonin system or their related miRNA, mRNA, rs 1042173 polymorphisms or their related miRNA, mRNA, incRNA, or protein expression, levels, or states of function, or or protein expressions, levels, or states of function, or other other biochemical products or chemical associations, may 55 biochemical products or chemical associations, either alone serve as a biomarker to determine, evaluate, or Support the or in any combination, in order to identify individuals who diagnosis of Substance use, misuse, abuse, or dependence or use, abuse, misuse, or are dependent on alcohol or any other any habit-forming behavior. Substance or have a habit-forming behavior (including but not The present invention further encompasses a method limited to obesity, gambling, or computer or electronic addic whereby genetic screening is used to identify polymorphisms 60 tions), may be a basis for identifying those who will respond within the serotonin system or their related miRNA, mRNA, to treatment with any 5-HT3 antagonist (including incRNA, or protein expression, levels, or states of function, or ondansetron) at any dose or dosage form. Such a test (includ other biochemical products or chemical associations, in order ing a blood test) can be anticipated to determine individuals to identify individuals who use, abuse, misuse, or are depen who will respond to treatment with a 5-HT3 antagonist (in dent on alcohol or any other Substance or habit-forming 65 cluding ondansetron). Such diseased individuals can be iden behavior, may be a basis for identifying treatment. Such a test tified by means of the genetic screening and then provided (including a blood test) can be anticipated to determine indi with ondansetron. US 8,697,361 B2 27 28 The present invention further encompasses a method ondansetron) plus any of these co-modulating agents or whereby genetic screening is used to identify 5-HTTLPR and drugs. Individuals with alcohol use, abuse, or dependence rs 1042173 polymorphisms or their related miRNA, mRNA, who have these polymorphisms identified by this genetic or protein expressions, levels, or states of function, or other screening can than be provided with ondansetron plus the co biochemical products or chemical associations, either alone modulating medication or drug, with the prediction that these or in any combination, in order to identify individuals who combinations will be expected to be efficacious. use, abuse, misuse, or are dependent on alcohol, may be a The present invention further encompasses a method basis for identifying those who will respond to treatment with whereby genetic screening is used to identify 5-HTTLPR and any 5-HT3 antagonist (including ondansetron) at any dose or rs 1042173 polymorphisms, or any other polymorphisms in dosage form. Such a test (including a blood test) can be 10 co-modulating neurotransmitter systems (i.e., dopamine, anticipated to determine individuals with an alcohol use, GABA, glutamate, opioids, and cannabinoids) or their related abuse, or dependence disorder who will respond to treatment miRNA, mRNA, ncRNA, or protein expressions, levels, or with a 5-HT-3 antagonist (including ondansetron). Such indi states of function, or other biochemical products or chemical viduals can be identified by means of the genetic screening associations, either alone or in any combination, in order to and then provided with ondansetron. 15 identify individuals who use, abuse, misuse, or are dependent The present invention further encompasses a method on alcohol, may be a basis for identifying those who will be whereby genetic screening is used to identify any polymor susceptible to adverse events or not respond to treatment with phisms within the serotonin system or their related miRNA, any 5-HT-3 antagonist (including ondansetron) in combina mRNA, ncRNA, or protein expressions, levels, or states of tion with any drug that affects these co-modulating systems function, or other biochemical products or chemical associa (including but not limited to topiramate, baclofen, gabapen tions, either alone or in any combination, in order to identify tin, naltrexone, nalmefene, and rimonabant) at any dose or individuals who use, abuse, misuse, or are dependent on dosage form. Such a test (including a blood test) can be alcohol or any other substance or have a habit-forming behav anticipated to determine individuals who will not respond to ior (including but not limited to obesity, gambling, or com treatment with a 5-HT3 antagonist (including ondansetron) puter or electronic addictions), may be a basis for identifying 25 plus any of these co-modulating agents or drugs, or who will individuals who will respond to treatment with any seroton need additional measures to optimize treatment to these com ergic agent, compound, or drug at any dose or dosage form. pounds. Individuals with Substance use, abuse, dependence or Such a test (including a blood test) can be anticipated to any habit-forming behavior who have these polymorphisms determine individuals who will respond to treatment for any identified by this genetic screening can either be screened out addictive behavior with any serotonergic agent, compound, 30 of being provided the combined treatment or be given addi or drug. tional measures to optimize their treatment. The present invention further encompasses a method The present invention further encompasses a method whereby genetic screening is used to identify 5-HTTLPR and whereby genetic screening is used to identify 5-HTTLPR and rs 1042173 polymorphisms or their related miRNA, mRNA, rs 1042173 polymorphisms, or any other polymorphisms in or protein expressions, levels, or states of function, or other 35 co-modulating neurotransmitter systems (i.e., dopamine, biochemical products or chemical associations, either alone GABA, glutamate, opioids, and cannabinoids) or their related or in any combination, in order to identify individuals who miRNA, mRNA, ncRNA, or protein expressions, levels, or use, abuse, misuse, or are dependent on alcohol or any other states of function, or other biochemical products or chemical Substance or have a habit-forming behavior (including but not associations, either alone or in any combination, is used to limited to obesity, gambling, or computer or electronic addic 40 produce a biomarker (including a blood test) to determine, tions), may be a basis for identifying those Susceptible to ascertain, or evaluate consumption level or diagnosis of alco adverse events or side effects or optimizing treatment with hol use, abuse, misuse, or dependence. any serotonergic agent, compound, or drug at any dose or The present invention further encompasses a method dosage form. Such a test (including a blood test) can be whereby genetic screening is used to identify 5-HTTLPR and anticipated to determine individuals who will not respond to 45 rs 1042173 polymorphisms, or any other polymorphisms in treatment with a serotonergic agent, compound, or drug, or co-modulating neurotransmitter systems (i.e., dopamine, individuals who will need additional measures to optimize the GABA, glutamate, opioids, and cannabinoids) or their related Success of treatment with any serotonergic agent, compound, miRNA, mRNA, ncRNA, or protein expressions, levels, or or drug. states of function, or other biochemical products or chemical The present invention further encompasses a method 50 associations, either alone or in any combination, is used to whereby genetic screening is used to identify 5-HTTLPR and produce a biomarker (including a blood test) to determine, rs 1042173 polymorphisms, or any other polymorphisms in ascertain, or evaluate consumption level or diagnosis of Sub co-modulating neurotransmitter systems (i.e., dopamine, stance use, abuse, misuse, or dependence or habit-forming GABA, glutamate, opioids, and cannabinoids) or their related behavior. miRNA, mRNA, ncRNA, or protein expressions, levels, or 55 The present invention further encompasses a method states of function, or other biochemical products or chemical whereby genetic screening is used to identify 5-HTTLPR and associations, either alone or in any combination, in order to rs 1042173 polymorphisms, or any other polymorphisms in identify individuals who use, abuse, misuse, or are dependent co-modulating neurotransmitter systems (i.e., dopamine, on alcohol, may be a basis for identifying those who will GABA, glutamate, opioids, and cannabinoids) or their related respond to treatment with any 5-HT3 antagonist (including 60 miRNA, mRNA, ncRNA, or protein expressions, levels, or ondansetron) in combination with any drug that affects these states of function, or other biochemical products or chemical co-modulating systems (including but not limited to topira associations, either alone or in any combination, in order to mate, baclofen, gabapentin, naltrexone, nalmefene, and identify individuals with Substance use, abuse, misuse, or rimonabant) at any dose or dosage form. Such a test (includ dependence or any habit-forming behavior, may be a basis for ing a blood test) can be anticipated to determine individuals 65 identifying those who will respond to treatment with any with an alcohol use, abuse, or dependence disorder who will 5-HT3 antagonist (including ondansetron) in combination respond to treatment with a 5-HT-3 antagonist (including with any drug that affects these co-modulating systems (in US 8,697,361 B2 29 30 cluding but not limited to topiramate, baclofen, gabapentin, erally sufficient, but will vary depending on Such things as the maltrexone, nalmefene, and rimonabant) at any dose or dosage disorder being treated, the length of treatment, the age, sex, form. Such a test (including a blood test) can be anticipated to weight, and/or health of the Subject, etc. The drugs can be determine individuals with Substance use, misuse, abuse, or administered in formulations that contain all drugs being dependence or any habit-forming disorder who will respond used, or the drugs can be administered separately. In some to treatment with a 5-HT3 antagonist (including cases, it is anticipated that multiple doses/times of adminis ondansetron) plus any of these co-modulating agents or tration will be required or useful. The present invention fur drugs. Individuals with Substance use, abuse, or dependence ther provides for varying the length of time of treatment. or any habit-forming behavior who have these polymor Topiramate is disclosed herein as a drug useful in combi phisms identified by this genetic screening can than be pro 10 nation drug therapy. In one embodiment, topiramate is pro vided with ondansetron plus the co modulating medication or vided at a dosage ranging from about 15 mg/day to about drug, with the prediction that these combinations will be 2500 mg/day. In one aspect, topiramate is administered at a expected to be efficacious. dosage ranging from about 25 mg/day to about 1000 mg/day. The present invention further encompasses a method In yet another aspect, topiramate is administered at a dosage whereby genetic screening is used to identify 5-HTTLPR and 15 ranging from about 50 mg/day to about 500 mg/day. In one rs 1042173 polymorphisms, or any other polymorphisms in aspect, topiramate is administered at a dosage of about 400 co-modulating neurotransmitter systems (i.e., dopamine, mg/day. In another aspect, topiramate is administered at a GABA, glutamate, opioids, and cannabinoids) or their related dosage of 400 mg/day. In a further aspect, topiramate is miRNA, mRNA, ncRNA, or protein expressions, levels, or administered at a dosage of about 300 mg/day. In yet a further states of function, or other biochemical products or chemical aspect, topiramate is administered at a dosage of about 275 associations, either alone or in any combination, in order to mg/day. In one aspect, topiramate is administered at a dose of identify individuals with Substance use, abuse, misuse, or about 1 mg/day. In one aspect, up to about 300 mg/day is dependence or any habit-forming behavior, may be a basis for administered. identifying those who will be susceptible to adverse events or In one embodiment, topiramate is provided at a dose of side effects or who will not respond to treatment with any 25 about 1 mg/kg. In one aspect, topiramate is provided at a dose 5-HT3 antagonist (including ondansetron) in combination of about 10 mg/kg. In one aspect, topiramate is provided at a with any drug that affects these co-modulating systems (in dose of about 100 mg/kg. In one embodiment, topiramate is cluding but not limited to topiramate, baclofen, gabapentin, administered at a dosage ranging from about 0.1 mg/kg/day to maltrexone, nalmefene, and rimonabant) at any dose or dosage about 100 mg/kg/day. form. Such a test (including a blood test) can be anticipated to 30 Topiramate (CHNOS: IUPAC name: 2,3:4.5-Bis-O- determine individuals with Substance use, misuse, abuse, or (1-methylethylidene)-beta-D-fructopyranose Sulfamate; dependence or any habit-forming disorder who will not CAS Registry No. 97240-79-4) has the following structure: respond to treatment with a 5-HT-3 antagonist (including ondansetron) plus any of these co-modulating agents or drugs, or who will require additional measures to optimize 35 treatment. Individuals with Substance use, abuse, depen \" dence, or any habit-forming behavior who have these poly O o/ N morphisms identified by this genetic screening can either be O O screened out of being provided the combined treatment or be HC CH given additional measures to optimize their treatment. 40 The present invention encompasses the use of ondansetron O O as well as other drugs. In one aspect, combinations of drugs are used. The present invention encompasses the use of com binations of drugs or compounds to treat addictive and com An important aspect of psychotropic drugs is to produce pulsive diseases and disorders, particular alcohol-related dis 45 weight gain. These increases in weight gain can induce a eases and disorders. The present invention further range of metabolic problems including abnormal Sugar, fat, encompasses the use of adjunctive treatments and therapy and carbohydrate metabolism. Because topiramate can cause Such as psychosocial management regimes, hypnosis, and weight loss and improve endocrine function, it is proposed acupuncture. herein that topiramate may be used to ameliorate weight gain In one embodiment, the present invention provides com 50 caused by other psychotropic drugs with which it is combined positions and methods for treating alcohol-related diseases as well as alcohol and any other abused drugs. and disorders using pharmaceutical compositions comprising An important adverse event of topiramate is cognitive effective amounts of ondansetron, topiramate and/or naltrex impairment. In the general population, this is reported by OC. 2.4% of individuals who take topiramate (Johnson & Johnson The dosage of the active compound(s) being administered 55 Pharmaceutical Research & Development. Investigators will depend on the condition being treated, the particular Brochure: Topiramate (RWJ-17021-000), 10th ed.: Decem compound, and other clinical factors such as age, sex, weight, ber 2005). In the substance abuse field, the occurrence rate of and health of the subject being treated, the route of adminis cognitive impairment is about 18.7% (Johnson B A, Ait tration of the compound(s), and the type of composition being Daoud N. Bowden C L et al. Oral topiramate for treatment of administered (tablet, gel cap, capsule, Solution, Suspension, 60 alcohol dependence: a randomized controlled trial. Lancet inhaler, aerosol, elixir, lozenge, injection, patch, ointment, 2003, 361: 1677-1685). Topiramate-associated cognitive cream, etc.). It is to be understood that the present invention effects are due to its anti-glutaminergic properties. It is, there has application for both human and veterinary use. fore, not obvious that ondansetron, a serotonin-3 receptor For example, in one embodiment relating to oral adminis antagonist, will alleviate these complaints of cognitive tration to humans, a dosage of between approximately 0.1 and 65 impairment. Ondansetron appears to have cholinergic effects, 300 mg/kg/day, or between approximately 0.5 and 50 mg/kg/ perhaps though interactions with the GABA system, that day, or between approximately 1 and 10 mg/kg/day, is gen seem to ameliorate topiramate-associated cognitive impair US 8,697,361 B2 31 32
ment. Hence, it is to be expected that the rate of cognitive impairment reported by this triple combination would be less than that for topiramate on its own. Ondansetron is disclosed hereinas a drug useful alone oras part of combination drug therapy. Ondansetron is a 5-HT receptor antagonist and has functionally opposite effects to SSRIs and blocks serotonin agonism at the 5-HT receptor. The dosage and treatment regimen for administering ondansetron when it is being used as one compound of a combination therapy can be varied based on the other drug or 10 drugs with which it is being administered, or based on other criteria Such as the age, sex, health, and weight of the Subject. The present invention therefore provides for the use of Naltrexone also has important adverse events—nausea and ondansetron at varying doses Such as about 0.01 ug/kg, about 15 Vomiting that reduce compliance to it. Indeed, about 15% 0.1 ug/kg, about 1.0 ug/kg, about 5.0 ug/kg, about 10.0 g/kg, of individuals in alcohol trials are unable to tolerate a naltr about 0.1 mg/kg, about 1.0 mg/kg, about 5.0 mg/kg, and about exone dose of 50 mg/day. This has led to the development of 10.0 mg/kg. In another embodiment, ondansetron is admin depot formulations that release naltrexone slowly to reduce istered at a dosage ranging from about 0.01 ug/kg to about the incidence of nausea and vomiting. Nevertheless, these 100 ug/kg per application. In one aspect, ondansetron is depot formulation(s) appear to have similar compliance rates administered at a dosage ranging from about 0.1 ug/kg to to the oral form of the medication. Importantly, ondansetron about 10.0 ug/kg per application. In yet another aspect, reduces nausea and decreases Vomiting by slowing gut motill ondansetron is administered at a dosage ranging from about ity. Therefore, a combination that adds ondansetron to naltr 1.0 g/kg to about 5.0 g/kg per application. In a further exone will diminish the nausea and Vomiting caused by nal aspect, ondansetron is administered at a dosage of about 4.0 25 trexone. This is an important therapeutic advance because ug/kg per application. In another aspect, ondansetron is many more people will be able to tolerate the treatment due to administered at a dosage of about 3.0 g/kg per application. In increased compliance, and higher doses than the typically one aspect, ondansetron is administered at a dose of about 4 administered naltrexone dose of 50 mg/day can be given to ug/kg twice daily (about 0.25 to 0.6 mg twice daily for body improve the therapeutic response. weights between about 50 kg and 150 kg). 30 In one embodiment, the alcohol-related disease or disorder Ondansetron (CHNO; CAS Registry No. 996.14-02-5; being treated includes, but is not limited to, early-onset alco IUPAC name: 9-methyl-3-(2-methyl-1H-imidazol-1-yl)me holic, late-onset alcoholic, alcohol-induced psychotic disor thyl-1,2,3,9-tetrahydrocarbazol-4-One) has the following der with delusions, alcohol abuse, excessive drinking, heavy Structure: drinking, problem drinking, alcohol intoxication, alcohol 35 withdrawal, alcohol intoxication delirium, alcohol with drawal delirium, alcohol-induced persisting dementia, alco hol-induced persisting amnestic disorder, alcohol depen dence, alcohol-induced psychotic disorder with hallucinations, alcohol-induced mood disorder, alcohol-in 40 duced or associated bipolar disorder, alcohol-induced or associated posttraumatic stress disorder, alcohol-induced anxiety disorder, alcohol-induced sexual dysfunction, alco hol-induced sleep disorder, alcohol-induced or associated gambling disorder, alcohol-induced or associated sexual dis 45 order, alcohol-related disorder not otherwise specified, alco The present invention further provides for the use of other hol intoxication, and alcohol withdrawal. In one aspect, the drugs such as naltrexone as part of the drug combination alcohol-related disease or disorder is early onset alcoholic. In therapy disclosed herein. In one embodiment, naltrexone is another aspect, the alcohol-related disease or disorder is late administered at a dose of about 10 mg/day. In one aspect, onset alcoholic. maltrexone is administered at a dosage at a dosage of about 50 50 In one embodiment, the present invention provides com mg/day. In one aspect, naltrexone is administered at a dosage positions and methods for reducing the frequency of alcohol of about 100 mg/day. In one aspect, naltrexone is adminis consumption compared with the frequency of alcohol con tered at a dosage ranging from about 1 mg to about 300 mg per sumption before the treatment. One of ordinary skill in the art application. In another aspect, naltrexone is administered at a will appreciate that the frequency can be compared with prior dosage ranging from about 10 mg to about 50 mg per appli 55 consumption by the Subject or with consumption by a control cation. In a further aspect of the invention, naltrexone is Subject not receiving the treatment. In one aspect, the type of administered at a dosage of about 25 mg per application. In alcohol consumption is heavy drinking In another aspect, it is one embodiment, naltrexone is administered at least once a excessive drinking month. In a further embodiment, naltrexone is administered In one embodiment, the present invention provides com once a month. In one embodiment, naltrexone is administered 60 positions and methods for reducing the quantity of alcohol at least once a week. In another embodiment, naltrexone is consumed in a Subject compared with the amount of alcohol administered at least once a day. In a further embodiment, consumed before the treatment or compared with the alcohol maltrexone is administered at least twice a day. In one aspect, consumption by a control Subject not receiving the treatment. maltrexone is administered twice a day. One of ordinary skill in the art will appreciate that in some Naltrexone (CHNO; 17-(Cyclopropylmethyl)-4,5a 65 instances a Subject being treated for and addictive disorder is epoxy-3, 14-dihydroxymorphinan-6-one hydrochloride: not necessarily dependent. Such subjects include, for CAS Registry No. 16590-41-3) has the following structure: example, Subjects who abuse alcohol, drink heavily, drink US 8,697,361 B2 33 34 excessively, are problem drinkers, or are heavy drug users. together by a chemical linkage, such as a covalent bond, so The present invention provides compositions and methods for that the at least two different compounds form separate parts treating or preventing these behaviors in non-dependent Sub of the same molecule. In one aspect, the chemical linkage is jects. selected such that after entry into the body, the linkage is In one embodiment of the invention, the present invention broken, such as by enzymatic action, acid hydrolysis, base provides compositions and methods for improving the physi hydrolysis, or the like, and the two separate compounds are cal or psychological sequelae associated with alcohol con then formed. Sumption compared with a control Subject not receiving the Data from previous structure-activity relationship (SAR) treatment. studies within the art may be used as a guide to determine In one embodiment, the present invention provides com 10 which compounds to use and the optimal position or positions positions and methods for increasing the abstinence rate of a on the molecules to attach the tether such that potency and Subject compared with a control Subject not receiving the selectivity of the compounds will remain high. The tether or treatment. linker moiety is chosen from among those of demonstrated In one embodiment, the present invention provides com utility for linking bioactive molecules together. Disclosed positions and methods for reducing the average level of alco 15 herein are representative compounds that can be attached hol consumption in a subject compared with the level of together in different combinations to form heterobivalent alcohol consumption before the treatment or compared with therapeutic molecules. the level of alcohol consumption by a control subject not Examples of linkers reported in the scientific literature receiving the treatment. include methylene (CH), linkers (Hussey et al., J. Am. In one embodiment, the present invention provides com Chem. Soc., 2003, 125:3692-3693; Tamiz et al., J. Med. positions and methods for reducing alcohol consumption and Chem..., 2001, 44:1615-1622), oligo ethyleneoxy for increasing abstinence compared with the alcohol con O(—CHCHO ), units used to link maltrexamine to other sumption by the subject before treatment or with a control opioids, glycine oligomers of the formula —NH Subject not receiving the treatment. (COCH-NH), COCHCHCO (NHCHCO)NH- used In one embodiment, the present invention provides com 25 to link opioid antagonists and agonists together ((a) Portogh positions and methods for treating a subject with a predispo ese et al., Life Sci., 1982,31:1283-1286. (b) Portoghese et al., sition to early-onset alcoholism. J. Med. Chem., 1986, 29:1855-1861), hydrophilic diamines In one embodiment, the present invention provides com used to link opioid peptides together (Stepinski et al., Inter positions and methods for treating a subject with a predispo nat. J. of Peptide & Protein Res., 1991, 38:588-92), rigid sition to late-onset alcoholism. 30 double stranded DNA spacers (Paaret al., J. Immunol., 2002, One of ordinary skill in the art will appreciate that there are 169:856-864) and the biodegradable linker poly(L-lactic multiple parameters or characteristics of alcohol consump acid) (Klok et al., Macromolecules, 2002, 35:746-759). The tion which may characterize a subject afflicted with an alco attachment of the tether to a compound can result in the hol-related disease or disorder. It will also be appreciated that compound achieving a favorable binding orientation. The combination therapies may be effective in treating more than 35 linker itselfmay or may not be biodegradable. The linker may one parameter, and that there are multiple ways to analyze the take the form of a prodrug and be tunable for optimal release effectiveness of treatment. The parameters analyzed when kinetics of the linked drugs. The linker may be either confor measuring alcohol consumption or frequency of alcohol con mationally flexible throughout its entire length or else a seg Sumption include, but are not limited to, heavy drinking days, ment of the tether may be designed to be conformationally number of heavy drinking days, average drinking days, num 40 restricted (Portoghese et al., J. Med. Chem., 1986, 29:1650 ber of drinks per day, days of abstinence, number of individu 1653). als not drinking heavily or abstinent over a given time period, With respect to alcohol-related disorders, including but not and craving. Both subjective and objective measures can be limited to alcohol abuse and alcohol dependence, at least two used to analyze the effectiveness of treatment. For example, a compounds selected from the group consisting of topiramate, Subject can self-report according to guidelines and proce 45 ondansetron, and naltrexone, and analogs, derivatives, and dures established for such reporting. The procedures can be modifications thereof, and pharmaceutically acceptable salts performed at various times before, during, and after treat thereof, can be used to decrease ethanol consumption associ ment. Additionally, assays are available for measuring alco ated with Such alcohol-related disorders. In one aspect, topi hol consumption. These assays include breath alcohol meter ramate and ondansetron are used. Accordingly, the present readings, measuring serum CDT and GGT levels, and mea 50 invention provides a method for treating or preventing alco suring 5-HTOL urine levels. hol-related disorders based on ethanol consumption, com In some embodiments, a first compound and a second prising administering to a subject in need of such treatment or compound are administered nearly simultaneously. In other prevention an effective amount of at least two compounds embodiments, a first compound is administered prior to the selected from the group consisting of topiramate, second compound. In yet other embodiments, the first com 55 ondansetron, and naltrexone, and analogs, derivatives, and pound is administered Subsequent to the second compound. If modifications thereof or a pharmaceutically acceptable salt three or more compounds are administered, one of ordinary thereof. In a further aspect, the combination pharmaco skill in the art will appreciate that the three or more com therapy treatment is used in conjunction with behavioral pounds can be administered simultaneously or in varying modification or therapy. order. 60 Additional types of compounds can be administered to In certain embodiments disclosed herein, an individual is treat further the addiction-related diseases and disorders or to given a pharmaceutical composition comprising a combina treat other diseases and disorders. The additional types of tion of two or more compounds to treat or prevent an addic compounds include, but are not limited to, adrenergics, tion-related disease or disorder or impulse control-related adrenocortical steroids, adrenocortical Suppressants, aldos disease or disorder. In some of these embodiments, each 65 terone antagonists, amino acids, analeptics, analgesics, compound is a separate chemical entity. However, in other anorectic compounds, anorexics, anti-anxiety agents, antide embodiments, the at least two compounds can be joined pressants, antihypertensives, anti-inflammatories, antinause US 8,697,361 B2 35 36 ants, antineutropenics, antiobsessional agents, antiparkinso nylpropanolamine Polistirex: Prenalterol Hydrochloride; nians, antipsychotics, appetite Suppressants, blood glucose Propylhexedrine; Pseudoephedrine Hydrochloride; Tetrahy regulators, carbonic anhydrase inhibitors, cardiotonics, car drozoline Hydrochloride; Tramazoline Hydrochloride: diovascular agents, choleretics, cholinergics, cholinergic Xylometazoline Hydrochloride. agonists, cholinesterase deactivators, cognition adjuvants, Adrenocortical steroid: Ciprocinonide; Desoxycorticos cognition enhancers, hormones, memory adjuvants, mental terone Acetate; Desoxycorticosterone Pivalate; Dexametha performance enhancers, mood regulators, neuroleptics, neu sone Acetate: Fludrocortisone Acetate: Flumoxonide; Hydro roprotectives, psychotropics, relaxants, sedative-hypnotics, cortisone Hemisuccinate; Methylprednisolone stimulants, thyroid hormones, thyroid inhibitors, thyromi Hemisuccinate; Naflocort; Procinonide; Timobesone metics, cerebral ischemia agents, vasoconstrictors, and 10 Acetate; Tipredane. vasodilators. Adrenocortical Suppressant: Aminoglutethimide; Trilos In one embodiment, the present invention provides meth tane. ods and compositions useful for decreasing mesocorticolim Alcohol deterrent: Disulfiram. bic dopamine activity. Aldosterone antagonist: Canrenoate Potassium, Can In one embodiment, the present invention provides meth 15 renone; Dicirenone; Mexrenoate Potassium; Prorenoate ods and compositions useful for regulating mesocorticolim Potassium; Spironolactone. bic dopamine activity. Amino acid: Alanine; Aspartic Acid; Cysteine Hydrochlo In one embodiment, the present invention provides meth ride, Cystine; Histidine; Isoleucine; Leucine; Lysine; Lysine ods and compositions useful for inhibiting glutamate func Acetate; Lysine Hydrochloride; Methionine; Phenylalanine: tion. Proline; Serine; Threonine; Tryptophan; Tyrosine; Valine. In one embodiment, the present invention provides meth Analeptic: Modafinil. ods and compositions useful for facilitating Y-amino-butyric Analgesic: Acetaminophen; Alfentanil Hydrochloride; acid activity. Aminobenzoate Potassium; Aminobenzoate Sodium; Ani In one embodiment, the present invention provides meth doxime; Anileridine: Anileridine Hydrochloride; Anilopam ods and compositions useful for regulating Y-amino-butyric 25 Hydrochloride; Anirolac, Antipyrine; Aspirin; Benoxapro acid activity. fen; Benzydamine Hydrochloride; Biciifadine Hydrochlo The present invention provides for multiple methods for ride; Brifentanil Hydrochloride; Bromadoline Maleate; Bro delivering the compounds of the invention. The compounds mfenac Sodium: Buprenorphine Hydrochloride; Butacetin: may be provided, for example, as pharmaceutical composi Butixirate; Butorphanol; Butorphanol Tartrate; Carbam tions in multiple formats as well, including, but not limited to, 30 azepine; Carbaspirin Calcium; Carbiphene Hydrochloride: tablets, capsules, pills, lozenges, syrups, ointments, creams, Carfentanil Citrate: Ciprefadol Succinate; Ciramadol; Cira elixirs, suppositories, Suspensions, inhalants, injections (in madol Hydrochloride; Clonixeril: Clonixin: Codeine: cluding depot preparations), and liquids. Codeine Phosphate: Codeine Sulfate; Conorphone Hydro The present invention further encompasses biologically chloride: Cyclazocine; Dexoxadrol Hydrochloride; Dex active analogs, homologs, derivatives, and modifications of 35 pemedolac; Dezocine; Diflunisal; Dihydrocodeine Bitartrate; the compounds of the invention. Methods for the preparation Dimefadane; Dipyrone; Doxpicomine Hydrochloride; Drin of Such compounds are known in the art. In one aspect, the idene: Enadoline Hydrochloride: Epirizole; Ergotamine Tar compounds are topiramate, naltrexone, and ondansetron. trate; Ethoxazene Hydrochloride; Etofenamate; Eugenol; The compositions and methods described herein for treat Fenoprofen; Fenoprofen Calcium; Fentanyl Citrate; Floc ing or preventing alcohol-related diseases and disorders are 40 tafenine: Flufenisal; Flunixin: Flumixin Meglumine: Flupir also useful for treating or preventing other addiction-related tine Maleate; FluproduaZone: Fluradoline Hydrochloride; diseases and disorders and impulse control disorders. In one Flurbiprofen; Hydromorphone Hydrochloride; Ibufenac: aspect, the compositions and methods elicit an indirect effect Indoprofen; Ketazocine; Ketorfanol: Ketorolac on CMDA neurons. Such effects may be elicited, for Tromethamine: Letimide Hydrochloride; Levomethadyl example, by regulating serotonergic, opiate, glutamate, or 45 Acetate; Levomethadyl Acetate Hydrochloride; Levonantra y-amino-butyric acid receptors. In one aspect, the addictive dol Hydrochloride; Levorphanol Tartrate; Lofemizole diseases and disorders include eating disorders, impulse con Hydrochloride; Lofentanil Oxalate: Lorcinadol; Lomoxi trol disorders, nicotine-related disorders, methamphetamine cam: Magnesium Salicylate; Mefenamic Acid; Menabitan related disorders amphetamine-related disorders, cannabis Hydrochloride; Meperidine Hydrochloride; Meptazinol related disorders, cocaine-related disorders, hallucinogen use 50 Hydrochloride; Methadone Hydrochloride; Methadyl disorders, inhalant-related disorders, benzodiazepine abuse Acetate; Methopholine; Methotrimeprazine; Metkephamid or dependence related disorders, and opioid-related disor Acetate; Mimbane Hydrochloride; Mirfentanil Hydrochlo ders. ride; MolinaZone: Morphine Sulfate; Moxazocine; Nabitan A list of types of drugs, and specific drugs within catego Hydrochloride; Nalbuphine Hydrochloride; Nalmexone ries which are encompassed within the invention is provided 55 Hydrochloride: Namoxyrate; Nantradol Hydrochloride: below. Naproxen; Naproxen Sodium; Naproxol; Nefopam Hydro Adrenergic: Adrenalone; Amidephrine Mesylate; Apra chloride; Nexeridine Hydrochloride; Noracymethadol clonidine Hydrochloride: Brimonidine Tartrate; Dapiprazole Hydrochloride; Ocfentanil Hydrochloride; Octazamide: Hydrochloride; Deterenol Hydrochloride; Dipivefrin; Olvanil; Oxetorone Fumarate; Oxycodone; Oxycodone Dopamine Hydrochloride: Ephedrine Sulfate: Epinephrine; 60 Hydrochloride: Oxycodone Terephthalate: Oxymorphone Epinephrine Bitartrate: Epinephryl Borate; Esproduin Hydrochloride; Pemedolac, Pentamorphone; Pentazocine; Hydrochloride; Etafedrine Hydrochloride; Hydroxyamphet Pentazocine Hydrochloride; Pentazocine Lactate; amine Hydrobromide: Levonordefrin; Mephentermine Sul Phenazopyridine Hydrochloride; Phenyramidol Hydrochlo fate; Metaraminol Bitaritrate; Metizoline Hydrochloride: ride; Picenadol Hydrochloride; Pinadoline; Pirfenidone; Naphazoline Hydrochloride; Norepinephrine Bitartrate; Oxi 65 Piroxicam Olamine; Pravadoline Maleate; Prodilidine dopamine: Oxymetazoline Hydrochloride; Phenylephrine Hydrochloride; Profadol Hydrochloride; Propirarn Fuma Hydrochloride; Phenylpropanolamine Hydrochloride; Phe rate; Propoxyphene Hydrochloride; Propoxyphene Napsy US 8,697,361 B2 37 38 late: Proxazole; Proxazole Citrate; Proxorphan Tartrate; Pyr Trebenzomine Hydrochloride; Trimipramine; Trimipramine roliphene Hydrochloride; Remifentanil Hydrochloride; Maleate; Venlafaxine Hydrochloride; Viloxazine Hydrochlo Salcolex: Salethamide Maleate; Salicylamide; Salicylate ride; Zimeldine Hydrochloride; Zometapine. Meglumine; Salsalate: Sodium Salicylate: Spiradoline Mesy Antihypertensive: AflyZosin Hydrochloride: Alipamide: late; Sufentanil; Sufentanil Citrate; Talmetacin; Talniflumate; Althiazide; Amiquinsin Hydrochloride; Amlodipine Besy Talosalate: Tazadolene Succinate; Tebufelone; Tetrydamine: late: Amlodipine Maleate; Anaritide Acetate; Atiprosin Male Tifurac Sodium; Tilidine Hydrochloride; Tiopinac; Tonazo ate; Belfosdil; Bemitradine; Bendacalol Mesylate; Bendrof cine Mesylate: Tramadol Hydrochloride; Trefentanil Hydro lumethiazide; Benzthiazide. Betaxolol Hydrochloride: chloride; Trolamine: Veradoline Hydrochloride; Verilopam Bethanidine Sulfate; Bevantolol Hydrochloride; Biclodil Hydrochloride; Volazocine: Xorphanol Mesylate: Xylazine 10 Hydrochloride; Bisoprolol; Bisoprolol Fumarate; Bucindolol Hydrochloride; Zenazocine Mesylate: Zomepirac Sodium; Hydrochloride; Bupicomide: Buthiazide: Candoxatril; Can Zucapsaicin. doxatrilat; Captopril; Carvedilol; Ceronapril; Chlorothiazide Anorectic compounds including dexfenfluramine. Sodium: Cicletanine: Cilazapril; Clonidine; Clonidine Anorexic: Aminorex: Amphecloral; Chlorphentermine Hydrochloride; Clopamide: Cyclopenthiazide: Cyclothiaz Hydrochloride; Clominorex; Clortennine Hydrochloride: 15 ide: Darodipine; Debrisoquin Sulfate; Delapril Hydrochlo Diethylpropion Hydrochloride: Fenfluramine Hydrochlo ride; Diapamide; Diazoxide; Dilevalol Hydrochloride; Dilt ride; Fenisorex: Fludorex: Fluminorex; Levamfetamine Suc iazem Malate; Ditekiren: Doxazosin Mesylate: Ecadotril; cinate; Mazindol; Mefenorex Hydrochloride; Phenmetrazine Enalapril Maleate; Enalaprilat; Enalkiren: Endralazine Hydrochloride; Phentermine; Sibutramine Hydrochloride. Mesylate: Epithiazide: Eprosartan; Eprosartan Mesylate: Anti-anxiety agent: Adatanserin Hydrochloride; Alpidem; Fenoldopam Mesylate: Flavodilol Maleate; Flordipine; Binospirone Mesylate: Bretazenil; Glemanserin; Ipsapirone Flosequinan; Fosinopril Sodium; Fosinoprilat; Guanabenz; Hydrochloride; Mirisetron Maleate; Ocinaplon; Ondansetron Guanabenz, Acetate; Guanacline Sulfate; Guanadrel Sulfate; Hydrochloride; Panadiplon; Pancopride; Pazinaclone: Guancydine; Guanethidine Monosulfate; Guanethidine Sul Serazapine Hydrochloride; Tandospirone Citrate; fate; Guanfacine Hydrochloride; Guanisoquin Sulfate; Gua Zalospirone Hydrochloride. 25 noclor Sulfate; Guanoctine Hydrochloride; Guanoxabenz; Anti-cannabis agent: Rimonabant and other useful drugs, Guanoxan Sulfate; Guanoxyfen Sulfate; Hydralazine Hydro including drugs regulating the cannabinoid receptors. chloride; Hydralazine Polistirex; Hydroflumethiazide; Inda Antidepressant: Adatanserin Hydrochloride; Adinazolam; crinone; Indapamide; Indolaprif Hydrochloride; Indoramin; Adinazolam Mesylate; Alaproclate; Aletamine Hydrochlo Indoramin Hydrochloride; Indorenate Hydrochloride: Laci ride; Amedalin Hydrochloride; Amitriptyline Hydrochloride; 30 dipine; Leniquinsin; Levcromakalim; Lisinopril; Lofexidine Amoxapine: Aptazapine Maleate; AZaloxan Fumarate; Hydrochloride; Losartan Potassium; Losulazine Hydrochlo Azepindole: Azipramine Hydrochloride; Bipenarinol Hydro ride; Mebutamate; Mecamylamine Hydrochloride: Medrox chloride; Bupropion Hydrochloride; Butacetin; Butriptyline alol; Medroxalol Hydrochloride; Methalthiazide; Methy Hydrochloride; Caroxazone; Cartazolate: Ciclazindol; clothiazide; Methyldopa; Methyldopate Hydrochloride: Cidoxepin Hydrochloride: Cilobamine Mesylate; Clodazon 35 Metipranolol; Metolazone: Metoprolol Fumarate; Meto Hydrochloride; Clomipramine Hydrochloride; Cotinine prolol Succinate; Metyrosine; Minoxidil; Monatepil Male Fumarate; Cyclindole: Cypenamine Hydrochloride; Cyproli ate; Muzolimine; Nebivolol; Nitrendipine: Ofornine; Par dol Hydrochloride: Cyproximide; Daledalin Tosylate: gyline Hydrochloride; Pazoxide: Pelanserin Hydrochloride: Dapoxetine Hydrochloride; Dazadrol Maleate; Dazepinil Perindopril Erbumine; Phenoxybenzamine Hydrochloride: Hydrochloride; Desipramine Hydrochloride; Dexamisole; 40 Pinacidil: Pivopril; Polythiazide; Prazosin Hydrochloride: Deximafen; Dibenzepin Hydrochloride; Dioxadrol Hydro Primidolol; Prizidilol Hydrochloride: Quinapril Hydrochlo chloride; Dothiepin Hydrochloride; Doxepin Hydrochloride: ride; Quinaprilat; Quinazosin Hydrochloride: Quinelorane Duloxetine Hydrochloride; Eclanamine Maleate; Encyprate; Hydrochloride: Quinpirole Hydrochloride: Quinuclium Bro Etoperidone Hydrochloride; Fantridone Hydrochloride: Feh mide: Ramipril; Rauwolfia Serpentina; Reserpine; Saprisar metozole Hydrochloride: Fenmetramide: Fezolamine Fuma 45 tan Potassium; Saralasin Acetate: Sodium Nitroprusside; Sul rate; Fluotracen Hydrochloride: Fluoxetine: Fluoxetine finalol Hydrochloride: Tasosartan; Teludipine Hydrochloride: Fluparoxan Hydrochloride; Gamfexine: Hydrochloride; Temocapril Hydrochloride; Terazosin Guanoxyfen Sulfate: Imafen Hydrochloride: Imiloxan Hydrochloride; Terlakiren; Tiamenidine; Tiamenidine Hydrochloride: Imipramine Hydrochloride; Indeloxazine Hydrochloride; Ticrynafen; Tinabinol; TiodaZosin; Tipen Hydrochloride; Intriptyline Hydrochloride; Iprindole: Iso 50 tosin Hydrochloride; Trichlormethiazide; Trimazosin Hydro carboxazid; Ketipramine Fumarate; Lofepramine Hydro chloride; Trimethaphan Camsylate; Trimoxamine Hydro chloride; Lortalamine: Maprotiline: Maprotiline Hydrochlo chloride; Tripamide; Xipamide; Zankiren Hydrochloride: ride; Melitracen Hydrochloride; Milacemide Hydrochloride; Zofenoprilat Arginine. Minaprine Hydrochloride; Mirtazapine: Moclobemide: Anti-inflammatory: Alclofenac; Alclometasone Dipropi Modaline Sulfate; Napactadine Hydrochloride; Napamezole 55 onate; Algestone Acetonide; Alpha Amylase; Amcinafal; Hydrochloride: Nefazodone Hydrochloride; Nisoxetine: Amcinafide: Amfenac Sodium; Amiprilose Hydrochloride; Nitrafudam Hydrochloride; Nomifensine Maleate; Nortrip Anakinra, Anirolac, AnitraZafen; Apazone; BalsalaZide tyline Hydrochloride; Octriptyline Phosphate; Opipramol Disodium; Bendazac, Benoxaprofen; Benzydamine Hydro Hydrochloride: Oxaprotiline Hydrochloride: Oxypertine: chloride; Bromelains; Broperamole; Budesonide; Carprofen; Paroxetine; Phenelzine Sulfate: Pirandamine Hydrochloride: 60 Cicloprofen; Cintazone; Cliprofen; Clobetasol Propionate: Pizotyline: Pridefine Hydrochloride; Prolintane Hydrochlo Clobetasone Butyrate; Clopirac; Cloticasone Propionate: ride; Protriptyline Hydrochloride; Quipazine Maleate; Roli Cormethasone Acetate; Cortodoxone; Deflazacort; Des cyprine; Seproxetine Hydrochloride: Sertraline Hydrochlo onide; DeSoximetasone; Dexamethasone Dipropionate; ride; Sibutramine Hydrochloride; Sulpiride: Suritozole; Diclofenac Potassium; Diclofenac Sodium; Diflorasone Tametraline Hydrochloride; Tampramine Fumarate; Tan 65 Diacetate; Diflumidone Sodium; Diflunisal; Difluprednate: damine Hydrochloride; Thiazesim Hydrochloride; Thozali Diftalone; Dimethyl Sulfoxide; Drocinonide; Endrysone: none; Tomoxetine Hydrochloride; Trazodone Hydrochloride; Enlimomab: Enolicam Sodium; Epirizole; Etodolac.; Etofe US 8,697,361 B2 39 40 namate; Felbinac; Fenamole: Fenbufen, Fenclofenac; Fen perone; Piperacetazine; Pipotiazine Palniitate; Piquindone clorac; Fendosal: Fenpipalone: Fentiazac.; Flazalone: Fluaza Hydrochloride; Prochlorperazine Edisylate: Prochlorpera cort; Flufenamic Acid, Flumizole; Flunisolide Acetate; zine Maleate; Promazine Hydrochloride; Remoxipride: Flunixin: Flunixin Meglumine: Fluocortin Butyl; Fluo Remoxipride Hydrochloride; Rimcazole Hydrochloride: rometholone Acetate; FluguaZone: Flurbiprofen; Fluretofen; Seperidol Hydrochloride: Sertindole: Setoperone; Spiper Fluticasone Propionate; Furaprofen; Furobufen; Halcinon one: Thioridazine: Thioridazine Hydrochloride; Thiothixene; ide; Halobetasol Propionate; Halopredone Acetate; Ibufenac: Thiothixene Hydrochloride; Tioperidone Hydrochloride: Ibuprofen; Ibuprofen Aluminum; Ibuprofen Piconol: Tiospirone Hydrochloride; Trifluoperazine Hydrochloride: Ilonidap; Indomethacin; Indomethacin Sodium; Indoprofen; Trifluperidol; Triflupromazine; Triflupromazine Hydrochlo Indoxole; Intrazole; Isoflupredone Acetate; Isoxepac; Isoxi 10 ride; Ziprasidone Hydrochloride. cam; Ketoprofen; Lofemizole Hydrochloride; Lornoxicam; Appetite suppressant: Dexfenfluramine Hydrochloride; Loteprednol Etabonate; Meclofenamate Sodium; Meclofe Phendimetrazine Tartrate; Phentermine Hydrochloride. namic Acid; Meclorisone Dibutyrate; Mefenamic Acid; Blood glucose regulators: Human insulin; Glucagon; Mesalamine: MeseclaZone; Methylprednisolone Suleptan Tolazamide; Tolbutamide; Chloropropamide: Acetohexam ate; Momiflumate; Nabumetone; Naproxen; Naproxen 15 ide and Glipizide. Sodium; Naproxol; Nimazone; Olsalazine Sodium; Orgot Carbonic anhydrase inhibitor: Acetazolamide: Acetazola ein; Orpanoxin: Oxaprozin: Oxyphenbutazone; Paranyline mide Sodium, Dichlorphenamide: Dorzolamide Hydrochlo Hydrochloride; Pentosan Polysulfate Sodium; Phenbutazone ride; Methazolamide: Sezolarmide Hydrochloride. Sodium Glycerate; Pirfenidone: Piroxicam; Piroxicam Cin Cardiac depressant: Acecainide Hydrochloride: Acetyl namate; Piroxicam Olamine; Pirprofen; Prednazate: Prife choline Chloride; Actisomide; Adenosine; Amiodarone; lone: Prodolic Acid; ProquaZone: Proxazole; Proxazole Cit Aprindine: Aprindine Hydrochloride; Artilide Fumarate; rate; Rimexolone; Romazarit; Salcolex; Salnacedin; Azimilide Dihydrochloride; Bidisomide; Bucainide Maleate; Salsalate: Sanguinarium Chloride; Seclazone: Sermetacin; Bucromarone; Butoprozine Hydrochloride: Capobenate Sudoxicam; Sulindac: Suprofen; Talmetacin; Talniflumate; Sodium; Capobenic Acid; Cifenline; Cifenline Succinate; Talosalate: Tebufelone; Tenidap: Tenidap Sodium; Tenoxi 25 Clofilium Phosphate; Disobutamide; Disopyramide: Disopy cam; Tesicam, Tesimide; Tetrydamine; Tiopinac; Tixocortol ramide Phosphate; Dofetilide; Drobuline; Edifolone Acetate; Pivalate: Tolimetin; Tolimetin Sodium; Triclonide; Triflumi Emilium Tosylate: Encainide Hydrochloride; Flecainide date; Zidometacin: Zomepirac Sodium. Acetate; Ibutilide Fumarate; Indecainide Hydrochloride; Ipa Antinauseant: Buclizine Hydrochloride; Cyclizine Lac Zilide Fumarate; Lorajmine Hydrochloride; Lorcainide tate; Naboctate Hydrochloride. 30 Hydrochloride; Meobentine Sulfate; Mexiletine Hydrochlo Antineutropenic: Filgrastim; Lenograstim; Molgra ride; Modecainide; Moricizine; Oxiramide: Pirmenol Hydro mostim; Regramostim; Sargramostim. chloride; Pirolazamide; Pranolium Chloride; Procainamide Antiobsessional agent: Fluvoxamine Maleate. Hydrochloride; Propafenone Hydrochloride; Pyrinoline: Antiparkinsonian: Benztropine Mesylate; Biperiden; Quindonium Bromide: Quinidine Gluconate; Quinidine Sul Biperiden Hydrochloride; Biperiden Lactate; Carmantadine: 35 fate; Recainam Hydrochloride; Recainam Tosylate: Risotil Ciladopa Hydrochloride; Dopamantine; Ethopropazine ide Hydrochloride; Ropitoin Hydrochloride: Sematilide Hydrochloride: Lazabemide; Levodopa; Lometraline Hydro Hydrochloride; Suricainide Maleate: Tocainide; Tocainide chloride; Mofegiline Hydrochloride: Naxagolide Hydrochlo Hydrochloride; Transcainide. ride; Pareptide Sulfate; Procyclidine Hydrochloride; Quine Cardiotonic: Actodigin; Amrinone; Bemoradan; Butopam torane Hydrochloride; Ropinirole Hydrochloride: Selegiline 40 ine; Carbazeran; Carsatirin Succinate; Deslanoside; Digitalis; Hydrochloride; Tolcapone; Trihexyphenidyl Hydrochloride. Digitoxin; Digoxin; Dobutamine; Dobutamine Hydrochlo Antiperistaltic: Difenoximide Hydrochloride; Difenoxin; ride; Dobutamine Lactobionate; Dobutamine Tartrate; Enoxi Diphenoxylate Hydrochloride; Fluperamide: Lidamidine mone: ImaZodan Hydrochloride; Indolidan; Isomazole Hydrochloride; Loperamide Hydrochloride: Malethamer; Hydrochloride; Levdobutamine Lactobionate; Lixazinone Nufenoxole; Paregoric. 45 Sulfate; Medorinone; Milrinone; Pelrinone Hydrochloride: Antipsychotic: Acetophenazine Maleate; Alentemol Pimobendan; Piroximone; Prinoxodan; Proscillaridin; Hydrobromide: Alpertine; Azaperone: Batelapine Maleate; Quazinone; Tazolol Hydrochloride: Vesnarinone. Benperidol; BenZindopyrine Hydrochloride; Brofbxine; Bro Cardiovascular agent: Dopexamine; Dopexamine Hydro mperidol; Bromperidol Decanoate: Butaclamol Hydrochlo chloride. ride; Butaperazine; Butaperazine Maleate; Carphenazine 50 Choleretic: Dehydrocholic Acid: Fencibutirol; Hymec Maleate; Carvotroline Hydrochloride; Chlorpromazine: romone; Piprozolin; Sincalide; Tocamphyl. Chlorpromazine Hydrochloride; Chlorprothixene; Cin Cholinergic: Aceclidine. Bethanechol Chloride; Carba perene; Cintriamide: Clomacran Phosphate: Clopenthixol; chol; Demecarium Bromide; Dexpanthenol; Echothiophate Clopimozide; Clopipazan Mesylate; Cloroperone Hydro Iodide: Isoflurophate; Methacholine Chloride; Neostigmine chloride; Clothiapine; Clothixamide Maleate; Clozapine; 55 Bromide; Neostigmine Methylsulfate; Physostigmine; Phys Cyclophenazine Hydrochloride; Droperidol; Etazolate ostigmine Salicylate: Physostigmine Sulfate; Pilocarpine; Hydrochloride: Fenimide: Flucindole: Flumezapine; Pilocarpine Hydrochloride; Pilocarpine Nitrate; Pyridostig Fluphenazine Decanoate: Fluphenazine Enanthate: mine Bromide. Fluphenazine Hydrochloride: Fluspiperone: Fluspirilene: Cholinergic agonist: Xanomeline; Xanomeline Tartrate. Flutroline; Gevotroline Hydrochloride; Halopemide: Halo 60 Cholinesterase Deactivator: Obidoxime Chloride; Prali peridol; Haloperidol Decanoate; Iloperidone: Imidoline doxime Chloride; Pralidoxime Iodide; Pralidoxime Mesy Hydrochloride; Lenperone; Mazapertine Succinate: late. Mesoridazine; Mesoridazine Besylate; Metiapine; Milenper Coccidiostat: Arprinocid; Narasin; Semduramicin; Sem one; Milipertine: Molindone Hydrochloride; Naranol Hydro duramicin Sodium. chloride: Neflumozide Hydrochloride; Ocaperidone; Olanza 65 Cognition adjuvant: Ergoloid Mesylates; Piracetam; pine; Oxiperomide; Penfluridol; Pentiapine Maleate; Pramiracetam Hydrochloride; Pramiracetam Sulfate; Tacrine Perphenazine: Pimozide; Pinoxepin Hydrochloride; Pipam Hydrochloride. US 8,697,361 B2 41 42 Cognition enhancer: Besipirdine Hydrochloride: Linopir Ceruletide; Ceruletide Diethylamine: Cisapride; Dazopride dine: Sibopirdine. Fumarate; Dextroamphetamine; Dextroamphetamine Sul Dopamine receptor agonist: cabergoline (Dostinex) fate; Difluanine Hydrochloride; Dimefline Hydrochloride: Hormone: Diethylstilbestrol; Progesterone; 17-hydroxy Doxapram Hydrochloride; Etryptamine Acetate; Ethamivan: progesterone; Medroxyprogesterone; Norgestrel; Nor Fenethylline Hydrochloride: Flubanilate Hydrochloride: ethynodrel; Estradiol; Megestrol (Megace); Norethindrone: Flurothyl; Histamine Phosphate: Indriline Hydrochloride: Levonorgestrel; Ethyndiol: Ethinyl estradiol; Mestranol: Mefexamide; Methamphetamine Hydrochlo ride; Meth Estrone; Equilin; 17-alpha-dihydroequilin; equilenin; 17-al ylphenidate Hydrochloride; Pemoline: Pyrovalerone Hydro pha-dihydroequilenin; 17-alpha-estradiol; 17-beta-estradiol; chloride; Xamoterol: Xamoterol Fumarate. Synergist: Proad Leuprolide (lupron); Glucagon; Testolactone; Clomiphene; 10 ifen Hydrochloride. Han memopausal gonadotropins; Human chorionic gonadot Thyroid hormone: Levothyroxine Sodium; Liothyronine ropin: Urofollitropin; Bromocriptine; Gonadorelin; Luteiniz Sodium; Liotrix. ing hormone releasing hormone and analogs; Gonadotropins; Thyroid inhibitor: Methimazole; Propyithiouracil. Danazol; Testosterone; Dehydroepiandrosterone; Andros Thyromimetic: Thyromedan Hydrochloride. tenedione; Dihydroestosterone: Relaxin: Oxytocin; Vaso 15 Cerebral ischemia agents: Dextrorphan Hydrochloride. pressin; Folliculostatin: Follicle regulatory protein; Gona Vasoconstrictor: Angiotensin Amide: Felypressin; Methy doctrinins; Oocyte maturation inhibitor; Insulin growth sergide; Methysergide Maleate. factor, Follicle Stimulating Hormone; Luteinizing hormone; Vasodilator: Alprostadil; AZaclorzine Hydrochloride; Tamoxifen.: Corticorelin Ovine Triftutate; Cosyntropin: Bamethan Sulfate; Bepridil Hydrochloride; Buterizine: Metogest; Pituitary, Posterior; Seractide Acetate; Somalapor; Cetiedil Citrate; Chromonar Hydrochloride; Clonitrate; Dil Somatrem: Somatropin; Somenopor: Somidobove. tiazem Hydrochloride; Dipyridamole; Droprenilamine; Memory adjuvant: Dimoxamine Hydrochloride: Ribami Erythrity1 Tetranitrate; Felodipine: Flunarizine Hydrochlo nol. ride; Fostedil; Hexobendine; Inositol Niacinate; Iproxamine Mental performance enhancer: Aniracetam. Hydrochloride; Isosorbide Dinitrate; Isosorbide Mononi Mood regulator: Fengabine. 25 trate; Isoxsuprine Hydrochloride; Lidoflazine; Mefenidil; Neuroleptic: Duoperone Fumarate; Risperidone. Mefenidil Fumarate; Mibefradil Dihydrochloride; Miofla Neuroprotective: Dizocilpine Maleate. zine Hydrochloride; Mixidine; Nafronyl Oxalate: Nicar Psychotropic: Minaprine. dipine Hydrochloride; Nicergoline; Nicorandil; Nicotinyl Relaxant: Adiphenine Hydrochloride; Alcuronium Chlo Alcohol; Nifedipine; Nimodipine; Nisoldipine; Oxfenicine; ride; Aminophylline: Azumolene Sodium; Baclofen; Ben 30 Oxprenolol Hydrochloride; Pentaerythritol Tetranitrate; Pen Zoctamine Hydrochloride: Carisoprodol; Chlorphenesin Car toxifylline: Pentrinitrol; Perhexiline Maleate; Pindolol; Pir bamate; ChlorZoxazone; Cinflumide: Cinnamedrine: sidomine: Prenylamine: Propatyl Nitrate: Suloctidil; Clodanolene; Cyclobenzaprine Hydrochloride; Dantrolene: Terodiline Hydrochloride; Tipropidil Hydrochloride; Tolazo Dantrolene Sodium; Fenalanide; Fenyripol Hydrochloride: line Hydrochloride; Xanthinol Niacinate. Fetoxylate Hydrochloride: Flavoxate Hydrochloride; Fle 35 Assays and methods for testing compounds of the inven tazepam; Flumetramide:-Flurazepam Hydrochloride; tion are described herein or are known in the art. For example, Hexafluorenium Bromide: Isomylamine Hydrochloride; Lor see Lippa et al., U.S. Pat. Pub. No. 2006/0173-64, published bamate; Mebeverine Hydrochloride; Mesuprine Hydrochlo Aug. 3, 2006. ride; Metaxalone; Methocarbamol; Methixene Hydrochlo The invention further encompasses treating and preventing ride; Nafomine Malate; NeleZaprine Maleate; Papaverine 40 obesity, i.e., for affecting weight loss and preventing weight Hydrochloride; Pipoxolan Hydrochloride; Quinctolate: Rito gain. Obesity is a disorder characterized by the accumulation drine: Ritodrine Hydrochloride; Rolodine: Theophylline of excess fat in the body. Obesity has been recognized as one Sodium Glycinate; Thiphenamil Hydrochloride; Xilobam. of the leading causes of disease and is emerging as a global Sedative-hypnotic: Allobarbital; Alonimid; Alprazolam: problem. Increased instances of complications such as hyper Amobarbital Sodium; Bentazepam; Brotizolam: Butabar 45 tension, non-insulin-dependent diabetes mellitus, arterioscle bital; Butabarbital Sodium: Butalbital; Capuride; Carboclo rosis, dyslipidemia, certain forms of cancer, sleep apnea, and ral; Chloral Betaine; Chloral Hydrate; Chlordiazepoxide osteoarthritis have been related to increased instances of obe Hydrochloride; Cloperidone Hydrochloride; Clorethate: sity in the general population. In one aspect, the invention Cyprazepam; Dexclamol Hydrochloride; Diazepam; Dichlo encompasses administering to a subject in need thereof a ral phenazone; Estazolam: Ethchlorvynol; Etomidate: 50 combination therapy to induce weight loss. For example, Fenobam; Flunitrazepam; Fosazepam; Glutethimide: subjects having a BMI of greater than about 25 (25.0-29.9 is Halazepam, Lorimetazepam, Mecloqualone; Meprobamate; considered overweight) are identified for treatment. In one Methaqualone; Midaflur; Paraldehyde; Pentobarbital; Pento aspect, the individuals have a BMI of greater than 30 (30 and barbital Sodium; Perlapine; Prazepam; Quazepam; above is considered obese). In another aspect, a Subject may Reclazepam; Roletamide: Secobarbital; Secobarbital 55 be targeted for treatment to prevent weight gain. In one Sodium; Suproclone; Thalidomide: Tracazolate: Trepipam embodiment, an individual is instructed to take at least one Maleate; Triazolam; Tricetamide; Triclofos Sodium; Trime compound of the invention at least once daily and at least a tozine: Uldazepam; Zaleplon; Zolazepam Hydrochloride; second compound of the invention at least once daily. The Zolpidem Tartrate. compound may be in the form of for example, a tablet, a Serotonin antagonist: Altanserin Tartrate; Amesergide; 60 lozenge, a liquid, etc. In one aspect, a third compound is also Ketanserin; Ritanserin. taken daily. In one embodiment, compounds may be taken Serotonin inhibitor: Cinanserin Hydrochloride: Fenclo more than once daily. In another embodiment, compounds are nine; Fonazine Mesylate; Xylamidine Tosylate. taken less than once daily. The dosages can be determined Serotonin receptor antagonist: Tropanserin Hydrochlo based on what is known in the art or what is determined to be ride. 65 best for a Subject of that age, sex, health, weight, etc. Com Stimulant: Amfonelic Acid; Amphetamine Sulfate; Ampy pounds useful for treating obesity according to the methods of zine Sulfate; Arbutamine Hydrochloride; Azabon; Caffeine: the invention, include, but are not limited to, topiramate, US 8,697,361 B2 43 44 maltrexone, and ondansetron. See Weber (U.S. Pat. Pub. No. Baltimore, Md.: Lippincott Williams & Wilkins; 2003, 282 20070275970) and McElroy (U.S. Pat. No. 6,323,236) for 301). Brief interventions (Edwards et al., J. Stud. Alcohol. additional information and techniques for administering 1977, 38:1004-1031) such as BBCET, have been shown to drugs useful for treating obesity, addictive disorders, and benefit treatment of alcohol dependence. BBCET was mod impulse control disorders, and for determining dosage eled on the clinical management condition in the National schemes. Institute of Mental Health collaborative depression trial, Pharmaceutically-acceptable base addition salts can be which was used as an adjunct to the medication condition for prepared from inorganic and organic bases. Salts derived that study (Fawcett et al. Psychopharmacol Bull. 1987, from inorganic bases, include by way of example only, 23:309-324). BBCET has been used successfully as the psy Sodium, potassium, lithium, ammonium, calcium and mag 10 chosocial treatment platform in the single-site and multi-site nesium salts. Salts derived from organic bases include, but are efficacy trials of topiramate for treating alcohol dependence not limited to, salts of primary, secondary and tertiary amines, (Johnson et al., Lancet. 2003, 361: 1677-1685; Johnson et al., Such as alkylamines, dialkyl amines, trialkyl amines, Substi JAMA, 2007, 298:1641-1651). It is delivered by trained cli tuted alkyl amines, di(Substituted alkyl)amines, tri(Substi nicians, including nurse practitioners and other non-special tuted alkyl)amines, alkenyl amines, dialkenyl amines, trialk 15 ists. Uniformity and consistency of BBCET delivery are enyl amines, Substituted alkenyl amines, di(Substituted ensured by ongoing training and Supervision. BBCET is alkenyl)amines, tri(Substituted alkenyl)amines, cycloalkyl copyrighted material (Johnson et al., Brief Behavioral Com amines, di(cycloalkyl)amines, tri(cycloalkyl)amines, Substi pliance Enhancement Treatment (BBCET) manual. In: tuted cycloalkyl amines, disubstituted cycloalkyl amines, Johnson BA, Ruiz P. Galanter M, eds. Handbook of clinical trisubstituted cycloalkylamines, cycloalkenyl amines, di(cy alcoholism treatment. Baltimore, Md.: Lippincott Williams cloalkenyl) amines, tri(cycloalkenyl) amines, Substituted & Wilkins: 2003, 282-301). cycloalkenyl amines, disubstituted cycloalkenyl amines, The present invention further encompasses the use of psy trisubstituted cycloalkenyl amines, aryl amines, diary1 chosocial management regimens other than BBCET, includ amines, triaryl amines, heteroaryl amines, diheteroaryl ing, but not limited to, Cognitive Behavioral Coping Skills amines, triheteroarylamines, heterocyclic amines, dihetero 25 Therapy (CBT) (Project MATCH Research Group. Matching cyclic amines, triheterocyclic amines, mixed di- and tri Alcoholism Treatments to Client Heterogeneity: Project amines where at least two of the substituents on the amine are MATCH posttreatment drinking outcomes. J Stud Alcohol. different and are selected from the group consisting of alkyl, 1997:58:7-29), Motivational Enhancement Therapy (MET) Substituted alkyl, alkenyl, Substituted alkenyl, cycloalkyl, (Project MATCH Research Group. Matching Alcoholism Substituted cycloalkyl, cycloalkenyl, Substituted cycloalk 30 Treatments to Client Heterogeneity: Project MATCH post enyl, aryl, heteroaryl, heterocyclic, and the like. Also treatment drinking outcomes. J. Stud. Alcohol. 1997, 58:7- included are amines where the two or three substituents, 29), Twelve-Step Facilitation Therapy (TSF) (Project together with the amino nitrogen, form a heterocyclic or MATCH Research Group. Matching Alcoholism Treatments heteroaryl group. Examples of Suitable amines include, by to Client Heterogeneity: Project MATCH posttreatment way of example only, isopropylamine, trimethyl amine, 35 drinking outcomes. J. Stud. Alcohol. 1997, 58:7-29), Com diethyl amine, tri(iso-propyl) amine, tri(n-propyl) amine, bined Behavioral Intervention (CBI), (Anton et al., JAMA, ethanolamine, 2-dimethylaminoethanol, tromethamine, 2006, 295:2003-2017) Medical Management (MM) (Anton lysine, arginine, histidine, caffeine, procaine, hydrabamine, et al., JAMA, 2006, 295:2003-2017), or the Biopsychosocial, choline, betaine, ethylenediamine, glucosamine, N-alkylglu Report, Empathy, Needs, Direct advice, and Assessment camines, theobromine, purines, piperazine, piperidine, mor 40 (BRENDA) model (Garbutt et al., JAMA, 2005, 293:1617 pholine, N-ethylpiperidine, and the like. It should also be 1625). The present invention further encompasses the use of understood that other carboxylic acid derivatives would be alternative interventions such as hypnosis or acupuncture to useful in the practice of this invention, for example, carboxy assist in treating an addictive disease or disorder. lic acid amides, including carboxamides, lower alkyl car The psychosocial management programs can be used boxamides, dialkyl carboxamides, and the like. 45 before, during, and after treating the subject with the combi Pharmaceutically acceptable acid addition salts may be nation drug therapy of the invention. prepared frominorganic and organic acids. Salts derived from One of ordinary skill in the art will recognize that psycho inorganic acids include hydrochloric acid, hydrobromic acid, Social management procedures, as well as alternative inter Sulfuric acid, nitric acid, phosphoric acid, and the like. Salts ventions such as hypnosis oracupuncture, can also be used in derived from organic acids include acetic acid, propionic 50 conjunction with combination drug therapy to treat addictive acid, glycolic acid, pyruvic acid, oxalic acid, malic acid, and impulse-related disorders other than alcohol-related dis malonic acid. Succinic acid, maleic acid, fumaric acid, tartaric eases and disorders. acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, The present invention further encompasses the use of com methanesulfonic acid, ethanesulfonic acid, p-toluene-Sul bination pharmacotherapy and behavioral (psychosocial) fonic acid, salicylic acid, and the like. 55 intervention ortraining to treat other addictive and/or impulse Psychosocial Intervention and Management control disorders. The drug combination treatments of the present invention For example, binge eating disorder (BED) is characterized can be further Supplemented by providing to Subjects a form by discrete periods of binge eating during which large of psychosocial intervention and/or management, such as amounts of food are consumed in a discrete period of time and Brief Behavioral Compliance Enhancement Treatment 60 a sense of control over eating is absent. Persons with bulimia (BBCET). BBCET, a standardized, manual-guided, brief nervosa have been reported to have electroencephalographic (i.e., delivered in about 15 minutes), psychosocial adherence abnormalities and to display reduced binge eating in response enhancement procedure, emphasizes that medication compli to the anti-epileptic drug phenytoin. In addition, in controlled ance is crucial to changing participants’ drinking behavior trials in patients with epilepsy, topiramate was associated (Johnson et al., Brief Behavioral Compliance Enhancement 65 with Suppression of appetite and weight loss unrelated to Treatment (BBCET) manual. In: Johnson B. A. Ruiz P. Gal binge eating. Ondansetron has been shown to reduce binge anter M, eds. Handbook of clinical alcoholism treatment. eating. US 8,697,361 B2 45 46 BED is a subset of a larger classification of mental disor inhalant-related disorders, and opioid-related disorders, all of ders broadly defined as Impulse Control Disorders (ICDs) which are further subclassified as listed below. characterized by harmful behaviors performed in response to Eating disorders include, but are not limited to, Bulimia irresistible impulses. It has been suggested that ICDs may be Nervosa, Nonpurging Type; Bulimia Nervosa, Purging Type: related to obsessive-compulsive disorder or similarly, maybe and Eating Disorder not otherwise specified (NOS). forms of obsessive-compulsive disorders. It has also been Impulse control disorders include, but are not limited to, hypothesized that ICDs may be related to mood disorder or Intermittent Explosive Disorder, Kleptomania, Pyromania, may be forms of affective spectrum disorder, a hypothesized Pathological Gambling, Trichotillomania, and Impulse Con family of disorders sharing at least one common physiologic trol Disorder not otherwise specified (NOS). abnormality with major depression. In the Diagnostic and 10 Nicotine-related disorders include, but are not limited to, Nicotine Dependence, Nicotine Withdrawal, and Nicotine Statistical Manual of Mental Disorders (DSM-IV), the essen Related Disorder not otherwise specified (NOS). tial feature of an ICD is the failure to resistan impulse, drive, Amphetamine-related disorders include, but are not lim or temptation to performan act that is harmful to the person or ited to, Amphetamine Dependence, Amphetamine Abuse, to others. For most ICDs, the individual feels an increasing 15 Amphetamine Intoxication, Amphetamine Withdrawal, sense of tension or arousal before committing the act, and Amphetamine Intoxication Delirium, Amphetamine-Induced then experiences pleasure, gratification, or release at the time Psychotic Disorder with delusions, Amphetamine-Induced of committing the act. After the act is performed, there may or Psychotic Disorders with hallucinations, Amphetamine-In may not be regret or guilt. ICDs are listed in a residual duced Mood Disorder, Amphetamine-Induced Anxiety Dis category, the ICDs Not Elsewhere Classified, which includes order, Amphetamine-Induced Sexual Dysfunction, Amphet intermittent explosive disorder (IED), kleptomania, patho amine-Induced Sleep Disorder, Amphetamine Related logical gambling, pyromania, trichotillomania, and ICDs not Disorder not otherwise specified (NOS), Amphetamine otherwise specified (NOS). Examples of ICDs NOS are com Intoxication, and Amphetamine Withdrawal. pulsive buying or shopping, repetitive self-mutilation, non Cannabis-related disorders include, but are not limited to, paraphilic sexual addictions, severe nail biting, compulsive 25 Cannabis Dependence; Cannabis Abuse; Cannabis Intoxica skin picking, personality disorders with impulsive features, tion; Cannabis Intoxication Delirium; Cannabis-Induced attention deficit/hyperactivity disorder, eating disorders char Psychotic Disorder, with delusions; Cannabis-Induced Psy acterized by binge eating, and Substance use disorders. chotic Disorder with hallucinations; Cannabis-Induced Anxi Many drugs can cause physical and/or psychological ety Disorder; Cannabis-Related Disorder not otherwise addiction. Those most well known drugs include opiates, 30 specified (NOS); and Cannabis Intoxication. Such as heroin, opium and morphine; sympathomimetics, Cocaine-related disorders include, but are not limited to, including cocaine and amphetamines; sedative-hypnotics, Cocaine Dependence, Cocaine Abuse, Cocaine Intoxication, including alcohol, benzodiazepines, and barbiturates; and Cocaine Withdrawal, Cocaine Intoxication Delirium, nicotine, which has effects similar to opioids and sympatho Cocaine-Induced Psychotic Disorder with delusions, mimetics. Drug addiction is characterized by a craving or 35 Cocaine-Induced Psychotic Disorders with hallucinations, compulsion for taking the drug and an inability to limit its Cocaine-Induced Mood Disorder, Cocaine-Induced Anxiety intake. Additionally, drug dependence is associated with drug Disorder, Cocaine-Induced Sexual Dysfunction, Cocaine-In tolerance, the loss of effect of the drug following repeated duced Sleep Disorder, Cocaine-Related Disorder not other administration, and withdrawal, the appearance of physical wise specified (NOS), Cocaine Intoxication, and Cocaine and behavioral symptoms when the drug is not consumed. 40 Withdrawal. Sensitization occurs if repeated administration of a drug leads Hallucinogen-use disorders include, but are not limited to, to an increased response to each dose. Tolerance, sensitiza Hallucinogen Dependence, Hallucinogen Abuse, Hallucino tion, and withdrawal are phenomena evidencing a change in gen Intoxication, Hallucinogen Withdrawal, Hallucinogen the central nervous system resulting from continued use of the Intoxication Delirium, Hallucinogen-Induced Psychotic Dis drug. This change motivates the addicted individual to con 45 order with delusions, Hallucinogen-Induced Psychotic Dis tinue consuming the drug despite serious Social, legal, physi order with hallucinations, Hallucinogen-Induced Mood Dis cal, and/or professional consequences. order, Hallucinogen-Induced Anxiety Disorder, Attention-deficit disorders include, but are not limited to, Hallucinogen-Induced Sexual Dysfunction, Hallucinogen Attention-Deficit/Hyperactivity Disorder, Predominately Induced Sleep Disorder, Hallucinogen Related Disorder not Inattentive Type: Attention-Deficit/Hyperactivity Disorder, 50 otherwise specified (NOS), Hallucinogen Intoxication, and Predominately Hyperactivity-Impulsive Type: Attention Hallucinogen Persisting Perception Disorder (Flashbacks). Deficit/Hyperactivity Disorder, Combined Type: Attention Inhalant-related disorders include, but are not limited to, Deficit/Hyperactivity Disorder not otherwise specified Inhalant Dependence; Inhalant Abuse; Inhalant Intoxication; (NOS); Conduct Disorder: Oppositional Defiant Disorder; Inhalant Intoxication Delirium; Inhalant-Induced Psychotic and Disruptive Behavior Disorder not otherwise specified 55 Disorder, with delusions; Inhalant-Induced Psychotic Disor (NOS). der with hallucinations; Inhalant-Induced Anxiety Disorder; Depressive disorders include, but are not limited to, Major Inhalant-Related Disorder not otherwise specified (NOS); Depressive Disorder, Recurrent; Dysthymic Disorder; and Inhalant Intoxication. Depressive Disorder not otherwise specified (NOS); and Opioid-related disorders include, but are not limited to, Major Depressive Disorder. Single Episode. 60 Opioid Dependence, Opioid Abuse, Opioid Intoxication, Parkinson's disease includes, but is not limited to, neuro Opioid Intoxication Delirium, Opioid-Induced Psychotic leptic-induced parkinsonism. Disorder, with delusions, Opioid-Induced Psychotic Disorder Addictive disorders include, but are not limited to, eating with hallucinations, Opioid-Induced Anxiety Disorder, disorders, impulse control disorders, alcohol-related disor Opioid-Related Disorder not otherwise specified (NOS), ders, nicotine-related disorders, amphetamine-related disor 65 Opioid Intoxication, and Opioid Withdrawal. ders, cannabis-related disorders, cocaine-related disorders, Tic disorders include, but are not limited to, Tourette's gambling, sexual disorders, hallucinogen use disorders, Disorder, Chronic Motor or Vocal Tic Disorder, Transient Tic US 8,697,361 B2 47 48 Disorder, Tic Disorder not otherwise specified (NOS), Stut Some situations, they may be easier to administer than the tering, Autistic Disorder, and Somatization Disorder. parent drug. They may, for instance, be bioavailable by oral The present invention further encompasses the treatment of administration whereas the parent is not. The prodrug may at least two addictive diseases or disorders or impulse control also have improved solubility in pharmaceutical composi disorders simultaneously. For example, the present invention 5 tions over the parent drug, or may demonstrate increased provides for the simultaneous treatment of alcohol related palatability or be easier to formulate. An example, without disorders and weight control (see Examples). limitation, of a prodrug would be a compound of the present The present invention also encompasses the use of the invention which is administered as an ester (the “prodrug) to compounds and combination therapies of the invention in facilitate transmittal across a cell membrane where water circumstances where mandatory treatment may be appli 10 solubility is detrimental to mobility but which then is meta cable. For example, a court may require that a subject be bolically hydrolyzed to the carboxylic acid, the active entity, treated or take part in a treatment program using compounds once inside the cell where water-solubility is beneficial. A or combination therapies of the invention as part of a man further example of a prodrug might be a short peptide dated therapy related to alcohol abuse, excessive drinking, (polyaminoacid) bonded to an acid group where the peptide is drug use, etc. More particularly, the invention encompasses 15 metabolized to provide the active moiety. forensic uses where a court would require a Subject who has The invention encompasses the preparation and use of been convicted of driving under the influence to be subjected pharmaceutical compositions comprising a compound useful to the methods of the invention as part of a condition of bail, for treatment of the diseases disclosed herein as an active probation, treatment, etc. ingredient. Such a pharmaceutical composition may consist The invention also encompasses the use of pharmaceutical of the active ingredient alone, in a form Suitable for adminis compositions comprising compounds of the invention to tration to a subject, or the pharmaceutical composition may practice the methods of the invention, the compositions com comprise the active ingredient and one or more pharmaceu prising at least one appropriate compound and a pharmaceu tically acceptable carriers, one or more additional ingredi tically-acceptable carrier. ents, or some combination of these. The active ingredient may Other methods useful for the practice of the invention can 25 be present in the pharmaceutical composition in the form of a be found, for example, in U.S. Pat. Pub. No. 2006/0173064 physiologically acceptable ester or salt, such as in combina (Lippa et al.), U.S. Pat. No. 6,323,236 (McElroy), U.S. Pat. tion with a physiologically acceptable cation or anion, as is Pub. No. 2007/0275970, PCT application PCT/US/2008/ well known in the art. 052628 (Johnson et al.) filed Jan. 31, 2008, and PCT appli The formulations of the pharmaceutical compositions cation PCT/US/2007/0881.00 (Johnson and Tiouririne), filed 30 described herein may be prepared by any method known or Dec. 19, 2007. hereafter developed in the art of pharmacology. In general, In one embodiment, a composition of the invention may such preparatory methods include the step of bringing the comprise one compound of the invention. In another embodi active ingredient into association with a carrier or one or more ment, a composition of the invention may comprise more than other accessory ingredients, and then, if necessary or desir one compound of the invention. In one embodiment, addi 35 able, shaping or packaging the product into a desired single tional drugs or compounds useful for treating other disorders or multi-dose unit. may be part of the composition. In one embodiment, a com Although the descriptions of pharmaceutical compositions position comprising only one compound of the invention may provided herein are principally directed to pharmaceutical be administered at the same time as another composition compositions which are Suitable for ethical administration to comprising at least one other compound of the invention. In 40 humans, it will be understood by the skilled artisan that such one embodiment, the different compositions may be admin compositions are generally suitable for administration to ani istered at different times from one another. When a compo mals of all sorts. Modification of pharmaceutical composi sition of the invention comprises only one compound of the tions Suitable for administration to humans in order to render invention, an additional composition comprising at least one the compositions suitable for administration to various ani additional compound must also be used. 45 mals is well understood, and the ordinarily skilled veterinary The pharmaceutical compositions useful for practicing the pharmacologist can design and perform such modification invention may be, for example, administered to deliver a dose with merely ordinary, if any, experimentation. Subjects to of between 1 ng/kg/day and 100 mg/kg/day. which administration of the pharmaceutical compositions of Pharmaceutical compositions that are useful in the meth the invention is contemplated include, but are not limited to, ods of the invention may be administered, for example, sys 50 humans and other primates, mammals including commer temically in oral Solid formulations, or as ophthalmic, Sup cially relevant mammals such as cattle, pigs, horses, sheep, pository, aerosol, topical or other similar formulations. In cats, and dogs, and birds including commercially relevant addition to the appropriate compounds, such pharmaceutical birds such as chickens, ducks, geese, and turkeys. compositions may contain pharmaceutically-acceptable car One type of administration encompassed by the methods of riers and other ingredients known to enhance and facilitate 55 the invention is parenteral administration, which includes, but drug administration. Other possible formulations, such as is not limited to, administration of a pharmaceutical compo nanoparticles, liposomes, resealed erythrocytes, and immu sition by injection of the composition, by application of the nologically based systems may also be used to administer an composition through a Surgical incision, by application of the appropriate compound, or an analog, modification, or deriva composition through a tissue-penetrating non-Surgical tive thereof according to the methods of the invention. 60 wound, and the like. In particular, parenteral administration is Compounds which are identified using any of the methods contemplated to include, but is not limited to, Subcutaneous, described herein may be formulated and administered to a intraperitoneal, intramuscular, and intrasternal injection, and subject for treatment of the diseases disclosed herein. One of kidney dialytic infusion techniques ordinary skill in the art will recognize that these methods will Pharmaceutical compositions that are useful in the meth be useful for other diseases, disorders, and conditions as well. 65 ods of the invention may be prepared, packaged, or sold in A "prodrug” refers to an agent that is converted into the formulations suitable for oral, rectal, vaginal, parenteral, parent drug in vivo. Prodrugs are often useful because, in topical, pulmonary, intranasal, inhalation, buccal, oph US 8,697,361 B2 49 50 thalmic, intrathecal or another route of administration. Other and hydroxypropyl methylcellulose. Known lubricating contemplated formulations include projected nanoparticles, agents include, but are not limited to, magnesium Stearate, liposomal preparations, resealed erythrocytes containing the Stearic acid, silica, and talc. active ingredient, and immunologically-based formulations. Tablets may be non-coated or may be coated using known A pharmaceutical composition of the invention may be methods to achieve delayed disintegration in the gastrointes prepared, packaged, or Soldinbulk, as a single unit dose, or as tinal tract of a Subject, thereby providing Sustained release a plurality of single unit doses. As used herein, a “unit dose” and absorption of the active ingredient. By way of example, a is a discrete amount of the pharmaceutical composition com material Such as glyceryl monostearate or glyceryl distearate prising a predetermined amount of the active ingredient. The may be used to coat tablets. Further by way of example, amount of the active ingredient is generally equal to the 10 tablets may be coated using methods described in U.S. Pat. dosage of the active ingredient which would be administered Nos. 4,256,108; 4,160,452; and 4,265,874 to form osmoti to a subject, or a convenient fraction of such a dosage such as, cally-controlled release tablets. Tablets may further comprise for example, one-half or one-third of Such a dosage. a Sweetening agent, a flavoring agent, a coloring agent, a The relative amounts of the active ingredient, the pharma preservative, or some combination of these in order to provide ceutically acceptable carrier, and any additional ingredients 15 pharmaceutically elegant and palatable preparation. in a pharmaceutical composition of the invention will vary, Hard capsules comprising the active ingredient may be depending upon the identity, size, and condition of the Subject made using a physiologically degradable composition, Such treated and further depending upon the route by which the as gelatin. Such hard capsules comprise the active ingredient, composition is to be administered. By way of example, the and may further comprise additional ingredients including, composition may comprise between 0.1% and 100% (w/w) for example, an inert Solid diluent such as calcium carbonate, active ingredient. calcium phosphate, or kaolin. In addition to the active ingredient, a pharmaceutical com Soft gelatin capsules comprising the active ingredient may position of the invention may further comprise one or more be made using a physiologically degradable composition, additional pharmaceutically active agents. Particularly con 25 Such as gelatin. Such soft capsules comprise the active ingre templated additional agents include anti-emetics and Scaven dient, which may be mixed with water oran oil medium such gers Such as cyanide and cyanate Scavengers. as peanut oil, liquid paraffin, or olive oil. Controlled- or Sustained-release formulations of a pharma Lactulose can also be used as a freely erodible filler and is ceutical composition of the invention may be made using useful when the compounds of the invention are prepared in conventional technology. 30 capsule form. A formulation of a pharmaceutical composition of the Liquid formulations of a pharmaceutical composition of invention Suitable for oral administration may be prepared, the invention which are suitable for oral administration may packaged, or sold in the form of a discrete Solid dose unit be prepared, packaged, and sold either in liquid form or in the including, but not limited to, a tablet, a hard or soft capsule, a 35 form of a dry product intended for reconstitution with water cachet, a troche, or a lozenge, each containing a predeter or another suitable vehicle prior to use. mined amount of the active ingredient. Other formulations Liquid Suspensions may be prepared using conventional suitable for oral administration include, but are not limited to, methods to achieve Suspension of the active ingredient in an a powdered or granular formulation, an aqueous or oily Sus aqueous or oily vehicle. Aqueous vehicles include, for pension, an aqueous or oily solution, or an emulsion. 40 example, water and isotonic saline. Oily vehicles include, for As used herein, an "oily liquid is one which comprises a example, almond oil, oily esters, ethyl alcohol, vegetable oils carbon-containing liquid molecule and which exhibits a less Such as arachis, olive, Sesame, or coconut oil, fractionated polar character than water. Vegetable oils, and mineral oils such as liquid paraffin. Liquid A tablet comprising the active ingredient may, for example, Suspensions may further comprise one or more additional be made by compressing or molding the active ingredient, 45 ingredients including, but not limited to, Suspending agents, optionally with one or more additional ingredients. Com dispersing or wetting agents, emulsifying agents, demul pressed tablets may be prepared by compressing, in a Suitable cents, preservatives, buffers, salts, flavorings, coloring device, the active ingredient in a free-flowing form such as a agents, and Sweetening agents. Oily Suspensions may further powder or granular preparation, optionally mixed with one or comprise a thickening agent. Known Suspending agents more of a binder, a lubricant, an excipient, a surface active 50 include, but are not limited to, Sorbitol syrup, hydrogenated agent, and a dispersing agent. Molded tablets may be made by edible fats, Sodium alginate, polyvinylpyrrolidone, gum molding, in a Suitable device, a mixture of the active ingredi tragacanth, gum acacia, and cellulose derivatives such as ent, a pharmaceutically acceptable carrier, and at least Suffi Sodium carboxymethylcellulose, methylcellulose, and cient liquid to moisten the mixture. Pharmaceutically accept hydroxypropylmethylcellulose. Known dispersing or wetting able excipients used in the manufacture of tablets include, but 55 agents include, but are not limited to, naturally occurring are not limited to, inert diluents, granulating and disintegrat phosphatides such as lecithin, condensation products of an ing agents, binding agents, and lubricating agents. Known alkylene oxide with a fatty acid, with a long chain aliphatic dispersing agents include, but are not limited to, potato starch alcohol, with a partial ester derived from a fatty acid and a and Sodium starch glycollate. Known Surface active agents hexitol, or with a partial ester derived from a fatty acid and a include, but are not limited to, Sodium lauryl Sulphate. Known 60 hexitol anhydride (e.g., polyoxyethylene Stearate, heptadeca diluents include, but are not limited to, calcium carbonate, ethyleneoxycetanol, polyoxyethylene Sorbitol monooleate, Sodium carbonate, lactose, microcrystalline cellulose, cal and polyoxyethylene Sorbitan monooleate, respectively). cium phosphate, calcium hydrogen phosphate, and sodium Known emulsifying agents include, but are not limited to, phosphate. Known granulating and disintegrating agents lecithin and acacia. Known preservatives include, but are not include, but are not limited to, corn starch and alginic acid. 65 limited to, methyl, ethyl, or n-propyl parahydroxybenzoates, Known binding agents include, but are not limited to, gelatin, ascorbic acid, and Sorbic acid. Known Sweetening agents acacia, pre-gelatinized maize starch, polyvinylpyrrolidone, include, for example, glycerol, propylene glycol, Sorbitol, US 8,697,361 B2 51 52 Sucrose, and saccharin. Known thickening agents for oily As is well known in the art, enema preparations may be Suspensions include, for example, beeswax, hard paraffin, administered using, and may be packaged within, a delivery and cetyl alcohol. device adapted to the rectal anatomy of the Subject. Enema In one aspect, a preparation in the form of a syrup or elixir preparations may further comprise various additional ingre or for administration in the form of drops may comprise dients including, but not limited to, antioxidants and preser active ingredients together with a Sweetener, which is prefer vatives. ably calorie-free, and which may further include methylpa A pharmaceutical composition of the invention may be raben or propylparaben as antiseptics, a flavoring and a Suit prepared, packaged, or sold in a formulation Suitable for able color. vaginal administration. Such a composition may be in the Liquid Solutions of the active ingredient in aqueous or oily 10 form of for example, a Suppository, an impregnated or coated Solvents may be prepared in Substantially the same manner as vaginally-insertable material Such as a tampon, a douche liquid Suspensions, the primary difference being that the preparation, or gel or cream or a solution for vaginal irriga active ingredient is dissolved, rather than Suspended in the tion. Solvent. Liquid solutions of the pharmaceutical composition Methods for impregnating or coating a material with a of the invention may comprise each of the components 15 chemical composition are known in the art, and include, but described with regard to liquid Suspensions, it being under are not limited to methods of depositing orbinding a chemical stood that Suspending agents will not necessarily aid disso composition onto a Surface, methods of incorporating a lution of the active ingredient in the solvent. Aqueous sol chemical composition into the structure of a material during vents include, for example, water and isotonic saline. Oily the synthesis of the material (i.e. Such as with a physiologi Solvents include, for example, almond oil, oily esters, ethyl cally degradable material), and methods of absorbing an alcohol, vegetable oils such as arachis, olive, Sesame, or coco aqueous or oily solution or Suspension into an absorbent nut oil, fractionated vegetable oils, and mineral oils such as material, with or without Subsequent drying. liquid paraffin. Douche preparations or solutions for vaginal irrigation Powdered and granular formulations of a pharmaceutical may be made by combining the active ingredient with a preparation of the invention may be prepared using known 25 pharmaceutically acceptable liquid carrier. As is well known methods. Such formulations may be administered directly to in the art, douche preparations may be administered using, a subject, used, for example, to form tablets, to fill capsules, and may be packaged within, a delivery device adapted to the or to prepare an aqueous or oily Suspension or Solution by vaginal anatomy of the Subject. Douche preparations may addition of an aqueous or oily vehicle thereto. Each of these further comprise various additional ingredients including, but formulations may further comprise one or more of a dispers 30 not limited to, antioxidants, antibiotics, antifungal agents, ing or wetting agent, a suspending agent, and a preservative. and preservatives. Additional excipients, such as fillers and sweetening, flavor As used herein, "parenteral administration” of a pharma ing, or coloring agents, may also be included in these formu ceutical composition includes any route of administration lations. characterized by physical breaching of a tissue of a subject A pharmaceutical composition of the invention may also 35 and administration of the pharmaceutical composition be prepared, packaged, or sold in the form of oil in water through the breach in the tissue. Parenteral administration emulsion or a water-in-oil emulsion. The oily phase may be a thus includes, but is not limited to, administration of a phar Vegetable oil such as olive or arachis oil, a mineral oil such as maceutical composition by injection of the composition, by liquid paraffin, or a combination of these. Such compositions application of the composition through a Surgical incision, by may further comprise one or more emulsifying agents includ 40 application of the composition through a tissue-penetrating ing naturally occurring gums such as gum acacia or gum non-Surgical wound, and the like. In particular, parenteral tragacanth, naturally occurring phosphatides such as Soybean administration is contemplated to include, but is not limited or lecithin phosphatide, esters or partial esters derived from to. Subcutaneous, intraperitoneal, intramuscular, and combinations of fatty acids and hexitol anhydrides such as intrasternal injection, and kidney dialytic infusion tech Sorbitan monooleate, and condensation products of Such par 45 niques. tial esters with ethylene oxide such as polyoxyethylene sor Formulations of a pharmaceutical composition Suitable for bitan monooleate. These emulsions may also contain addi parenteral administration comprise the active ingredient tional ingredients including, for example, Sweetening or combined with a pharmaceutically acceptable carrier, Such as flavoring agents. sterile water or sterile isotonic saline. Such formulations may A pharmaceutical composition of the invention may be 50 be prepared, packaged, or sold in a form suitable for bolus prepared, packaged, or sold in a formulation Suitable for administration or for continuous administration. Injectable rectal administration. Such a composition may be in the form formulations may be prepared, packaged, or sold in unit dos of for example, a Suppository, a retention enema preparation, age form, such as in ampules or in multi-dose containers and a solution for rectal or colonic irrigation. containing a preservative. Formulations for parenteral admin Suppository formulations may be made by combining the 55 istration include, but are not limited to, Suspensions, solu active ingredient with a non irritating pharmaceutically tions, emulsions in oily or aqueous vehicles, pastes, and acceptable excipient which is solidat ordinary room tempera implantable Sustained-release or biodegradable formulations. ture (i.e. about 20°C.) and which is liquid at the rectal tem Such formulations may further comprise one or more addi perature of the subject (i.e. about 37°C. in a healthy human). tional ingredients including, but not limited to, Suspending, Suitable pharmaceutically acceptable excipients include, but 60 stabilizing, or dispersing agents. In one embodiment of a are not limited to, cocoa butter, polyethylene glycols, and formulation for parenteral administration, the active ingredi various glycerides. Suppository formulations may further ent is provided in dry (i.e., powder or granular) form for comprise various additional ingredients including, but not reconstitution with a suitable vehicle (e.g., Sterile pyrogen limited to, antioxidants and preservatives. free water) prior to parenteral administration of the reconsti Retention enema preparations or Solutions for rectal or 65 tuted composition. colonic irrigation may be made by combining the active The pharmaceutical compositions may be prepared, pack ingredient with a pharmaceutically acceptable liquid carrier. aged, or sold in the form of a sterile injectable aqueous or oily US 8,697,361 B2 53 54 Suspension or solution. This Suspension or solution may be be administered using any nebulization or atomization formulated according to the known art, and may comprise, in device. Such formulations may further comprise one or more addition to the active ingredient, additional ingredients such additional ingredients including, but not limited to, a flavor as the dispersing agents, wetting agents, or Suspending agents ing agent such as saccharin Sodium, a Volatile oil, a buffering described herein. Such sterile injectable formulations may be agent, a surface active agent, or a preservative such as meth prepared using a non-toxic parenterally acceptable diluent or ylhydroxybenzoate. The droplets provided by this route of solvent, such as water or 1,3-butane diol, for example. Other administration preferably have an average diameter in the acceptable diluents and solvents include, but are not limited range from about 0.1 to about 200 nanometers. to, Ringer's solution, isotonic sodium chloride solution, and The formulations described herein as being useful for pull fixed oils such as synthetic mono- or di-glycerides. Other 10 parentally-administrable formulations which are useful monary delivery are also useful for intranasal delivery of a include those which comprise the active ingredient in micro pharmaceutical composition of the invention. crystalline form, in a liposomal preparation, or as a compo Another formulation suitable for intranasal administration nent of a biodegradable polymer systems. Compositions for is a coarse powder comprising the active ingredient and hav Sustained release or implantation may comprise pharmaceu 15 ing an average particle from about 0.2 to about 500 microme tically acceptable polymeric or hydrophobic materials such ters. Such a formulation is administered in the manner in as an emulsion, an ion exchange resin, a sparingly soluble which Snuff is taken, i.e., by rapid inhalation through the nasal polymer, or a sparingly soluble salt. passage from a container of the powder held close to the Formulations suitable for topical administration include, aS. but are not limited to, liquid or semi-liquid preparations such Formulations suitable for nasal administration may, for as liniments, lotions, oil in water or water in oil emulsions example, comprise from about as little as about 0.1% (w/w) Such as creams, ointments or pastes, and solutions or Suspen and as much as about 100% (w/w) of the active ingredient, sions. Topically-administrable formulations may, for and may further comprise one or more of the additional ingre example, comprise from about 1% to about 10% (w/w) active dients described herein. ingredient, although the concentration of the active ingredient 25 A pharmaceutical composition of the invention may be may be as high as the solubility limit of the active ingredient prepared, packaged, or sold in a formulation Suitable for in the solvent. Formulations for topical administration may buccal administration. Such formulations may, for example, further comprise one or more of the additional ingredients be in the form of tablets or lozenges made using conventional described herein. methods, and may, for example, comprise about 0.1% to A pharmaceutical composition of the invention may be 30 about 20% (w/w) active ingredient, the balance comprising prepared, packaged, or sold in a formulation Suitable for an orally dissolvable or degradable composition and, option pulmonary administration via the buccal cavity. Such a for ally, one or more of the additional ingredients described mulation may comprise dry particles which comprise the herein. Alternately, formulations suitable for buccal admin active ingredient and which have a diameter in the range from istration may comprise a powder or an aerosolized or atom about 0.5 to about 7 nanometers, and preferably from about 1 35 ized solution or Suspension comprising the active ingredient. to about 6 nanometers. Such compositions are conveniently in Such powdered, aerosolized, or atomized formulations, when the form of dry powders for administration using a device dispersed, preferably have an average particle or droplet size comprising a dry powder reservoir to which a stream of pro in the range from about 0.1 to about 200 nanometers, and may pellant may be directed to disperse the powder or using a further comprise one or more of the additional ingredients self-propelling solvent/powder-dispensing container Such as 40 described herein. a device comprising the active ingredient dissolved or Sus A pharmaceutical composition of the invention may be pended in a low-boiling propellant in a sealed container. prepared, packaged, or sold in a formulation Suitable for Preferably, such powders comprise particles wherein at least ophthalmic administration. Such formulations may, for 98% of the particles by weight have a diameter greater than example, be in the form of eye drops including, for example, 0.5 nanometers and at least 95% of the particles by number 45 a 0.1% to 1.0% (w/w) solution or suspension of the active have a diameter less than 7 nanometers. More preferably, at ingredient in an aqueous or oily liquid carrier. Such drops least 95% of the particles by weight have a diameter greater may further comprise buffering agents, salts, or one or more than 1 nanometer and at least 90% of the particles by number other of the additional ingredients described herein. Other have a diameter less than 6 nanometers. Dry powder compo opthalmically-administrable formulations which are useful sitions preferably include a solid fine powder diluent such as 50 include those which comprise the active ingredient in micro Sugar and are conveniently provided in a unit dose form. crystalline form or in a liposomal preparation. Low boiling propellants generally include liquid propel A pharmaceutical composition of the invention may be lants having a boiling point of below 65° F. at atmospheric prepared, packaged, or sold in a formulation Suitable for pressure. Generally, the propellant may constitute about 50% intramucosal administration. The present invention provides to about 99.9% (w/w) of the composition, and the active 55 for intramucosal administration of compounds to allow pas ingredient may constitute about 0.1% to about 20% (w/w) of sage or absorption of the compounds across mucosa. Such the composition. The propellant may further comprise addi type of administration is useful for absorption orally (gingi tional ingredients such as a liquid non-ionic or Solid anionic val, Sublingual, buccal, etc.), rectally, vaginally, pulmonary, Surfactant or a solid diluent (preferably having a particle size nasally, etc. of the same order as particles comprising the active ingredi 60 In some aspects, Sublingual administration has an advan ent). tage for active ingredients which in some cases, when given Pharmaceutical compositions of the invention formulated orally, are subject to a Substantial first pass metabolism and for pulmonary delivery may also provide the active ingredient enzymatic degradation through the liver, resulting in rapid in the form of droplets of a solution or suspension. Such metabolization and a loss of therapeutic activity related to the formulations may be prepared, packaged, or sold as aqueous 65 activity of the liver enzymes that convert the molecule into or dilute alcoholic Solutions or Suspensions, optionally ster inactive metabolites, or the activity of which is decreased ille, comprising the active ingredient, and may conveniently because of this bioconversion. US 8,697,361 B2 55 56 In some cases, a Sublingual route of administration is weight compounds can be used alone or in combination with capable of producing a rapid onset of action due to the con one another or with other active or inactive components of the siderable permeability and vascularization of the buccal intranasal formulation. mucosa. Moreover, Sublingual administration can also allow When a controlled-release pharmaceutical preparation of the administration of active ingredients which are not nor the present invention further contains a hydrophilic base, mally absorbed at the level of the stomach mucosa or diges many options are available for inclusion. Hydrophilic poly tive mucosa after oral administration, or alternatively which merS Such as a polyethylene glycol and polyvinyl pyrroli are partially or completely degraded in acidic medium after done, Sugar alcohols such as D-Sorbitol and Xylitol, Saccha ingestion of for example, a tablet. rides such as Sucrose, maltose, lactulose, D-fructose, dextran, Sublingual tablet preparation techniques known from the 10 and glucose, Surfactants such as polyoxyethylene-hydroge prior art are usually prepared by direct compression of a nated castor oil, polyoxyethylene polyoxypropylene glycol, mixture of powders comprising the active ingredient and and polyoxyethylene Sorbitan higher fatty acid esters, salts excipients for compression, Such as diluents, binders, disin Such as sodium chloride and magnesium chloride, organic tegrating agents and adjuvants. In an alternative method of acids such as citric acid and tartaric acid, amino acids such as preparation, the active ingredient and the compression excipi 15 glycine, beta-alanine, and lysine hydrochloride, and ami ents can be dry- or wet-granulated beforehand. In one aspect, nosaccharides such as meglumine are given as examples of the active ingredient is distributed throughout the mass of the the hydrophilic base. Polyethylene glycol, Sucrose, and poly tablet. WO 00/16750 describes a tablet for sublingual use that vinyl pyrrolidone are preferred and polyethylene glycol are disintegrates rapidly and comprises an ordered mixture in further preferred. One or a combination of two or more hydro which the active ingredient is in the form of microparticles philic bases can be used in the present invention. which adhere to the surface of water-soluble particles that are The present invention contemplates pulmonary, nasal, or Substantially greater in size, constituting a Support for the oral administration through an inhaler. In one embodiment, active microparticles, the composition also comprising a delivery from an inhaler can be a metered dose. mucoadhesive agent. WO 00/57858 describes a tablet for 25 An inhaler is a device for patient self-administration of at Sublingual use, comprising an active ingredient combined least one compound of the invention comprising a spray with an effervescent system intended to promote absorption, inhaler (e.g., a nasal, oral, or pulmonary spray inhaler) con and also a pH-modifier. taining anaerosol spray formulation of at least one compound The compounds of the invention can be prepared in a of the invention and a pharmaceutically acceptable dispers formulation or pharmaceutical composition appropriate for 30 ant. In one aspect, the device is metered to disperse an amount administration that allows or enhances absorption across of the aerosol formulation by forming a spray that contains a mucosa. Mucosal absorption enhancers include, but are not dose of at least one compound of the invention effective to limited to, a bile salt, fatty acid, Surfactant, or alcohol. In treat a disease or disorder encompassed by the invention. The specific embodiments, the permeation enhancer can be dispersant may be a surfactant, such as, but not limited to, Sodium cholate, sodium dodecyl Sulphate, sodium deoxycho 35 polyoxyethylene fatty acid esters, polyoxyethylene fatty acid late, taurodeoxycholate, Sodium glycocholate, dimethylsul alcohols, and polyoxyethylene Sorbitan fatty acid esters. foxide or ethanol. In a further embodiment, a compound of Phospholipid-based surfactants also may be used. the invention can be formulated with a mucosal penetration In other embodiments, the aerosol formulation is provided enhancer to facilitate delivery of the compound. The formu 40 as a dry powder aerosol formulation in which a compound of lation can also be prepared with pH optimized for solubility, the invention is present as a finely divided powder. The dry drug stability, and absorption through mucosa Such as nasal powder formulation can further comprise a bulking agent, mucosa, oral mucosa, Vaginal mucosa, respiratory, and intes Such as, but not limited to, lactose, Sorbitol, Sucrose, and tinal mucosa. mannitol. To further enhance mucosal delivery of pharmaceutical 45 In another specific embodiment, the aerosol formulation is agents within the invention, formulations comprising the a liquid aerosol formulation further comprising a pharmaceu active agent may also contain a hydrophilic low molecular tically acceptable diluent, such as, but not limited to, sterile weight compound as a base or excipient. Such hydrophilic water, saline, buffered saline and dextrose solution. low molecular weight compounds provide a passage medium In further embodiments, the aerosol formulation further through which a water-soluble active agent, Such as a physi 50 comprises at least one additional compound of the invention ologically active peptide or protein, may diffuse through the in a concentration Such that the metered amount of the aerosol base to the body surface where the active agent is absorbed. formulation dispersed by the device contains a dose of the The hydrophilic low molecular weight compound optionally additional compound in a metered amount that is effective to absorbs moisture from the mucosa or the administration ameliorate the symptoms of disease or disorder disclosed atmosphere and dissolves the water-soluble active peptide. 55 herein when used incombination with at least a first or second The molecular weight of the hydrophilic low molecular compound of the invention. weight compound is generally not more than 10000 and pref Thus, the invention provides a self administration method erably not more than 3000. Exemplary hydrophilic low for outpatient treatment of an addiction related disease or molecular weight compounds include polyol compounds, disorder such as an alcohol-related disease or disorder. Such Such as oligo-, di- and monosaccharides such as Sucrose, 60 administration may be used in a hospital, in a medical office, mannitol, lactose, L-arabinose, D-erythrose, D-ribose, D-xy or outside a hospital or medical office by non-medical per lose, D-mannose, D-galactose, lactulose, cellobiose, genti Sonnel for self administration. biose, glycerin, and polyethylene glycol. Other examples of Compounds of the invention will be prepared in a formu hydrophilic low molecular weight compounds useful as car lation or pharmaceutical composition appropriate for nasal riers within the invention include N-methylpyrrolidone, and 65 administration. In a further embodiment, the compounds of alcohols (e.g., oligovinyl alcohol, ethanol, ethylene glycol, the invention can be formulated with a mucosal penetration propylene glycol, etc.). These hydrophilic low molecular enhancer to facilitate delivery of the drug. The formulation US 8,697,361 B2 57 58 can also be prepared with pH optimized for solubility, drug Typically, dosages of the compounds of the invention stability, absorption through nasal mucosa, and other consid which may be administered to an animal, preferably a human, erations. range in amount from about 1.0 ug to about 100 g per kilo Capsules, blisters, and cartridges for use in an inhaler or gram of body weight of the animal. The precise dosage insufflator may be formulated to contain a powder mix of the administered will vary depending upon any number of fac pharmaceutical compositions provided herein; a Suitable tors, including but not limited to, the type of animal and type powder base. Such as lactose or starch; and a performance of disease state being treated, the age of the animal and the modifier, such as 1-leucine, mannitol, or magnesium Stearate. route of administration. Preferably, the dosage of the com The lactose may be anhydrous or in the form of the monohy pound will vary from about 1 mg to about 10 g per kilogram drate. Other Suitable excipients include dextran, glucose, 10 of body weight of the animal. More preferably, the dosage maltose, Sorbitol. Xylitol, fructose, Sucrose, and trehalose. will vary from about 10 mg to about 1 g per kilogram of body The pharmaceutical compositions provided herein for weight of the animal. inhaled/intranasal administration may further comprise a The compounds may be administered to a Subject as fre suitable flavor, such as menthol and levomenthol, or Sweet quently as several times daily, or it may be administered less eners, such as saccharin or saccharin Sodium. 15 frequently, such as once a day, once a week, once every two For administration by inhalation, the compounds for use weeks, once a month, or even less frequently, Such as once according to the methods of the invention are conveniently every several months or even once a year or less. The fre delivered in the form of an aerosol spray presentation from quency of the dose will be readily apparent to the skilled pressurized packs or a nebulizer, with the use of a suitable artisan and will depend upon any number of factors, such as, propellant, e.g., dichlorodifluoromethane, trichlorofluo- 20 but not limited to, the type and severity of the disease being romethane, dichlorotetrafluoroethane, carbon dioxide or treated, the type and age of the animal, etc. other Suitable gas. In the case of a pressurized aerosol, the The invention also includes a kit comprising the com dosage unit may be determined by providing a valve to deliver pounds of the invention and an instructional material that a metered amount. Capsules and cartridges of e.g., gelatin for describes administration of the compounds. In another use in an inhaler or insufflator may be formulated containing 25 embodiment, this kit comprises a (preferably sterile) solvent a powder mix of the drugs and a suitable powder base such as Suitable for dissolving or Suspending the composition of the lactose or starch. invention prior to administering the compound to the mam As used herein, “additional ingredients' include, but are mal. not limited to, one or more of the following: excipients; As used herein, an “instructional material” includes a pub Surface active agents; dispersing agents; inert diluents; granu- 30 lication, a recording, a diagram, or any other medium of lating and disintegrating agents, binding agents, lubricating expression that can be used to communicate the usefulness of agents: Sweetening agents; flavoring agents; coloring agents: the compounds of the invention in the kit for effecting alle preservatives; physiologically degradable compositions such viation of the various diseases or disorders recited herein. as gelatin; aqueous vehicles and solvents; oily vehicles and Optionally, or alternately, the instructional material may Solvents; Suspending agents; dispersing or wetting agents; 35 describe one or more methods of alleviating the diseases or emulsifying agents, demulcents; buffers; salts; thickening disorders. The instructional material of the kit of the invention agents; fillers; emulsifying agents; antioxidants; antibiotics; may, for example, be affixed to a container that contains a antifungal agents; stabilizing agents; and pharmaceutically compound of the invention or be shipped together with a acceptable polymeric or hydrophobic materials. Other “addi- container that contains the compounds. Alternatively, the tional ingredients' which may be included in the pharmaceu- 40 instructional material may be shipped separately from the tical compositions of the invention are known in the art and container with the intention that the instructional material and described, for example in Genaro, ed., 1985, Remington's the compound be used cooperatively by the recipient. Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., Relevant nucleic acid and amino sequences encompassed which is incorporated herein by reference. by the present invention include, but are not limited to:
SEQ ID NO: 1-Human serotonin transporter (SLC6A4), nucleic acid sequence (GenBank Accession No. NM_001045-2775 bp mRNA) - acagc.ca.gc.gc.cgc.cgggtgcct cagggcgc.gaggc.ca.gc.ccgc.ctgcc.ca.gc.ccggga Ccagcctic ccc.gc.gcagoctggCaggit ct cotggaggcaaggcgaccttgcttgc cct ct Cttgcagaataacaaggggcttagccacaggagttgctggcaagtggaaagaagaacaaa tgagt caatc.ccgacgtgtcaatcc.cgacgatagagagct cqgaggtgatccacaaatcC aag cacccagagat caattgggat.ccttggcagatgga catcagtgt catttact aacca gCaggatggagacgacgcc ctitgaattict Cagaa.gcagct at cagcgtgttgaagatggag aagattgtcaggaaaacggagttct acagaaggttgttcc cacccCaggggacaaagtgg agt ccgggcaaat atccalatggg tact cagoagttcCaagtic ctggtgcgggagatgaca cacggc actictatcc.cagogaccaccaccaccct agtggctgagctt catcaaggggaac gggagacctggggcaagaaggtggattitcCttct ct cagtgattggctatgctgtggacc tgggcaatgtctggcgctt CCCctacatatgttaccagaatggagggggggcatt cotcC tcc cct acac catcatggc catttittgggggaatcc.cgct ctitttacatggagct cqcac tgggacagtaccaccgaaatggatgcatttcaatatggaggaaaatctgc.ccgattitt Ca aagggattggittatgc catctgcatcattgcc titttacattgct tcc tact acaacacca t catggcctggg.cgctatact acccatct cotcc tt cacggaccagotgcc cttggacca gctgcaagaact cotggaacactggcaactgcacca attact tct cogaggacaa catca cctggaccct coattic cacgt.ccc.ctgctgaagaattittacacgc.gc.cacgt.cctgcaga tccaccggtcta aggggotcc aggacctggggggcatcagctggcagctggcc ct ctgca t catgctgat citt cactgttatc tact tcago atctggaaaggcgtcaagacct ctdgca aggtggtgtgggtgacago Cacct tcc ctitat at catcCtttctgtc.ctgctggtgaggg gtgccaccct Coctggagcctggaggggtgttct Cttct acttgaaaccca attggcaga aacticctggaga caggggtgtggatagatgcagcc.gct Cagatct tcttct ct cttggtc
US 8,697,361 B2 61 62 Other methods and techniques useful for the practice of the atric diagnoses other than alcohol or nicotine dependence; invention that are not described are known in the art, for significant alcohol withdrawal symptoms based on the example, see International application no. PCT/US2008/ revised clinical institute withdrawal assessment for alcohol O64232. scale (Sullivan et al., 1989) score >15; clinically significant Without further description, it is believed that one of ordi physical abnormalities based on physical examination, elec nary skill in the art can, using the preceding description and trocardiogram recording, hematological assessment, bio the following illustrative examples, make and utilize the com chemistry including serum bilirubin concentration, and uri pounds of the present invention and practice the claimed nalysis; pregnant or lactating state; treatment for alcohol methods. The following working examples, therefore, spe dependence s30 days prior to enrollment, and mandated cifically point out embodiments of the present invention, and 10 incarceration or employment loss for not receiving alcohol are not to be construed as limiting in any way the remainder of treatment. the disclosure. Drinking Measurements Self-reported drinking (measured in standard drinks) in the EXAMPLES 90 days prior to study enrollment was quantified using the 15 timeline follow-back method. One standard drink was Example 1 defined as 0.35 Lofbeer, 0.15 L ofwine, or 0.04 L of 80-proof liquor. The intensity of drinking was assessed by measure Correlation of a Functional Polymorphism in the ment of the mean drinks per drinking day and mean drinks per 3'UTR of the Serotonin Transporter Gene SLC6A4 day. Drinks per drinking day was defined as the total number and its Association with Drinking Activity of drinks divided by the number of drinking days within the 90 days; drinks per day was defined as the total number of It was determined whether allelic variation at a single drinks divided by 90 days. nucleotide polymorphism (SNP) within a putative polyade DNA Extraction and Genotyping nylation signal for a commonly used 3' polyadenylation site Ten milliliters of blood was drawn from each subject at G2651T SNP (National Center for Biotechnology Informa 25 baseline to obtain white blood cells for the determination of tion reference ID #rs1042173) of SLC6A4, the serotonin 5-HTT genotypes. DNA was extracted using a Gentra Pure transporter gene, is associated with differences in the severity gene(R) kit (QIAGEN Inc., Valencia, Calif.). SNPs for asso of drinking among treatment-seeking alcoholics. To deter ciation analyses were selected using the National Center for mine the functional significance of the G2651T/rs 1042173 Biotechnology Information (NCBI) dbSNP database (http:// SNP, we examined whether allelic variation at this site was 30 www.ncbi.nlm.nih.gov/SNP?) based on their functional associated with quantifiable changes in mRNA expression potential and minor allele frequency (MAF)-0.05. The aver level and 5-HTT protein expression. The human serotonin age SNP density is ~7 kb. Detailed information on SNP transporter gene (SLC6A4) is found at position 17q11.1-q12 locations, chromosomal positions, allelic variants, MAF, and of chromosome 17. G2651T/rs 1042173 is in exon 15 position primer/probe sequences is summarized in Table 1. Four of the 25,549,137. Additionally, the 5-HTTLPR is in the promoter 35 five SNPs (rs6354, rs6355, rs28914832, and rs1042173) were at chromosome position ~25,588,500. The sequence of the genotyped with TaqMan(R) SNP genotyping assays (Applied 5'-flanking region of the gene corresponds to GenBank Biosystems, Foster City, Calif.). Polymerase chain reaction Accession No. X76753 (see Heils et al., J. Neurochem. (PCR) conditions were 50° C. for 2 min,95° C. for 10 min, 30 66:2621, 1996). cycles of 95°C. for 25s, and 60° C. for 1 min. Alleles of each Materials and Methods 40 SNP were determined with an ABI PRISM(R) 790OHT instru Subjects ment (Applied Biosystems) and analyzed using sequence A total of two hundred seventy-five alcohol-dependent detection system (SDS) software. subjects (78.5% male) aged between 18 and 66 years were The DNA samples from the 77 subjects that were not used in this study, in which 198 of them were included in our included in our previous study were genotyped for 5'-HT previous study (Johnson et al., 2008). All subjects were con 45 TLPR L/S alleles as described previously (Johnson et al., sidered to be alcohol-dependent (see below for details) and 2008). enrolled as part of a pharmacotherapy trial for the treatment of Assays for SNP rs25531 were carried out as described by alcohol dependence at both the University of Texas Health Wendland etal (2006). Each assay had a total assay volume of Science Center at San Antonio and at University of Virginia. 20 ul, and the PCR conditions were 15 minat 95°C., 35 cycles Participants were recruited by newspaper or radio advertise 50 of 94° C. for 30s, 65.5° C. for 90s, and 72° C. for 60s, with ments, and written informed consent—approved by review a final extension step of 10 min at 72°C. Afterwards, 10ul of boards of all participating institutes, was obtained from all PCR product was double-digested with HpaII and BccI (5 U participants. each: New England Biolabs, Ipswich, Mass.) in a 20-ul reac Alcohol dependence was diagnosed using the Structured tion assay containing NEBuffer 1 and bovine serum albumin Clinical Interview for Diagnostic and Statistical Manual of 55 at 37°C. for 5 h. Finally, 10ul of remaining PCR product and Mental Disorders, 4th edition (American Psychiatric Asso 20 ul of restriction enzyme assay Solution were electrophore ciation, 1994) Axis I Disorders, by a trained psychologist. All sed with 3.5% UltraPureTMagarose gel (InvitrogenTM, Carls subjects had a score of >8 on the Alcohol Use Disorders bad, Calif.) for 1.5-2 h at 100 V in Tris/Borate/ethylenedi Identification Test (AUDIT) (Baboret al., 1992) that screened aminetetraacetic acid buffer and visualized by ethidium for individuals with alcohol use and related problems: 60 bromide staining (Sigma-Aldrich, St Louis, Mo.). The uncut reported heavy drinking which was defined as drinking of 221 PCR product in the lanes loaded with restriction enzyme standard drinks/week for women and >30 standard drinks/ digested PCR products were detected as the 'A' allele of week for men during the 90 days prior to enrollment. Absence rs25531, and the cut product at 402 bp were detected as the of other Substance use was confirmed by negative urine toxi “G” allele of rS25531. cological Screen for narcotics, amphetamines, or sedative 65 Association Analyses with Drinking Intensity hypnotics at enrollment. The Subjects who met the following Associations of individual SNPs with the intensity of criteria were excluded from the study: current axis I psychi drinking (i.e., drinks per drinking day and drinks per day) US 8,697,361 B2 63 64 were analyzed using the analysis of variance test in SAS overnight at 25 mA. The membranes were blocked for 1 h at version 9.1 (SAS Institute Inc., Cary, N.C.). Three genetic room temperature with 2% non-fat dry milk diluted in Tris models (additive, dominant, and recessive) were tested using buffered saline with Tween R. 20 (TBST) buffer and washed gender and age as covariates. Pair-wise linkage disequilib three times for 10 min each in TBST buffer; then they were rium (LD) among all 6 polymorphisms was assessed using the incubated overnight with primary antibody (1:200) at 4°C. Haploview program (Barrett et al., 2005). All associations rabbit polyclonal immunoglobulin G (IgG) corresponding to found to be significant were corrected for multiple testing the C-terminus of a sodium-dependent 5-HTT of human ori according to Bonferroni correction by dividing the signifi gin (200 ug/ml stock solution) (Santa Cruz, Biotechnology, cance level by the number of polymorphisms studied. Inc., Santa Cruz, Calif.). Membranes then were washed three Cloning, Cell Culture, and Transfection 10 times for 10 min each in TBST buffer and incubated with Allelic expression differences of the SNP (rs1042173) that secondary antibodies (1:5,000) anti-rabbit IgG (goat), horse showed a significant association with drinking intensity were radish peroxidase labeled (PerkinElmer) for 1.5 h at room studied using an in vitro system. The human 5-HTT contain temperature. The hybridized membranes were washed with ing the Gallele of rs1042173 in pRluescript II KS (-) was a TBST buffer four times for 10 min each, and the immunore generous gift from Prof. Randy D. Blakely (Vanderbilt Uni 15 activity of the proteins was detected using Western Light versity School of Medicine, Nashville, Tenn.). This 5-HTT ning R. Chemiluminescence Reagent Plus (PerkinElmer) and cDNA/Bluescript construct contained the coding region as exposure to X-ray film. Tubulin protein was used as an inter well as both 5’- and 3'-untranslated regions of the gene with a nal control to control for discrepancies in the loading of total length of 2508 bp. The human 5-HTT construct was proteins in each lane. A monoclonal antibody (mouse mono digested with HindIII/Xbaland subcloned into pcDNA3.1 (-) clonal antibody to C-tubulin) was used as the primary anti (InvitrogenTM) pre-digested with HindIII/Xbal as described body (1:2,000), and an anti-mouse IgG was used as the sec by Qian et al (Qian et al., 1997). To produce plasmid with the ondary antibody in western blotting for tubulin. Tallele of rs1042173, a DNA plasmid carrying the Gallele Densitometric and Statistical Analysis was mutated using the GeneTailorTM site-directed mutagen Western blotting films were scanned on a UMAX scanner esis system (InvitrogenTM). Both constructs were DNA 25 (Techville, Inc., Dallas, Tex.) using Adobe Photoshop (v. 6.0: sequence verified. Adobe Systems Inc., San Jose, Calif.), and the optical densi HeLa cells were cultured in complete medium Dulbecco's ties of the G and Talleles and tubulin were measured using modified Eagle's medium (HyClone, Logan, Utah), 10% NIH Image software (v. 1.61). The optical densities of bands GIBCOR fetal bovine serum (InvitrogenTM), 100 U/ml peni of the G and Talleles and of tubulin were quantified using cillin, and 100 g/ml Streptomycin (Mediatech, Inc., Manas 30 densitometry. The background (the area surrounding each sas, Va.) in 6-well plates and maintained in a humidified band) optical density values were quantified the same way as incubator at 37° C. and 5% CO2. After the cells reached for the proteinbands, and the values were subtracted from the approximately 80% confluence, they were transfected with measured optical density values for the protein bands. The one of the two alleles (4 ug of plasmids per well) in 6-well ratios of the optical density values of the G and Talleles to the culture plates using LipofectamineTM 2000 (InvitrogenTM) 35 optical density values of tubulin in the corresponding samples according to the manufacturer's guidelines. RNA and pro were calculated to normalize the expression of the G and T teins were extracted from HeLa cells 24 h after transfection. alleles of the 5-HTT. Student's t-test was used to analyze RNA Isolation, Reverse Transcription, and Quantitative protein data to determine the significance of expression dif Real-Time Polymerase Chain Reaction (qRT-PCR) ferences between the G and Talleles. Total RNA was extracted from HeLa cells with TRIZOLOR 40 Results reagent (InvitrogenTM). Potential DNA contaminations were Genotyping and LD Analysis removed by treating the RNA samples with RNase-free DNA samples from 275 alcohol-dependent subjects were DNase I at 37° C. for 30 min. Each RNA sample was reverse genotyped in this study. Of these subjects, 165 were Cauca transcribed in vitro using SuperScript(R) II RT (InvitrogenTM) sians (43 females and 122 males) and 110 were Hispanics (16 to obtain cDNA. These cDNA samples were transcribed with 45 females and 94 males). Genotypic distributions of all 5 SNPs TaqMan(R) Gene Expression Assays (Applied Biosystems) and 5-HTTLPR L/Salleles, conformed to the Hardy-Wein specific for 5-HTT mRNA, and the resulting 5-HTT mRNA berg equilibrium (Table 1). Further, the LD analyses using was quantified by the ABIPRISM(R) 7900HT sequence detec Haploview revealed no haplotype blocks among the 5 SNPs tion system. TaqMan(R) primer/probe sets for glyceraldehyde and the 5'-HTTLPRL/S polymorphism according to the cri 3-phosphate dehydrogenase (G3PDH) were used as an inter 50 teria of Gabrieletal. (2002), in Caucasian, Hispanic orpooled nal control to normalize the expression of 5-HTT. For each populations, respectively (FIG. 1). qRT-PCR experiment, four samples with the Gallele, four Associations with Self-Reported Drinking Measures samples with the T allele, and four controls with the To exclude potential variations caused by ethnic differ pcDNA3.1 (-) vector only were used in cell cultures from ences on drinking intensity, Subgroups of Subjects based on transfections carried out on different days. 55 ethnicity were analyzed separately for all polymorphisms Western Blotting Analysis studied here. Among the polymorphisms analyzed individu Radioimmunoprecipitation assay buffer Tris-HCl (pH ally using SAS (version 9.1) program for associations with 7.4), 1% NP-40, 150 mMNaCl, 0.25% Na-deoxycholate, and drinking intensity, only SNP rs1042173 in the 3' UTR of 1 mM EDTA was added to HeLa cells after washing the cells SLC6A4 showed a significant association with intensity of once with ice-cold phosphate-buffered saline. The protein 60 drinking Table 2 shows demographic and drinking param concentration of the cell lysates was determined using the eters of the cohort analyzed for rs1042173 association stud Bio-Radassay (Bio-Rad Laboratories, Hercules, Calif.). Fif ies. No significant association was detected for other genetic teen micrograms of samples were loaded onto 10% sodium polymorphisms with intensity of drinking in Caucasian, His dodecyl sulfate-polyacrylamide gels (30% acrylamide) in panic or pooled populations (data not shown). Tris-glycine buffer containing sodium dodecyl sulfate. The 65 Among Caucasian Subjects, mean drinks per drinking day separated proteins were then electrophoretically transferred differed significantly among TT, TG, and GG genotypes to nitrocellulose membranes (PerkinElmer, Waltham, Mass.) (F-5.625; p=0.004). Using Tukey's post-hoc multiple com US 8,697,361 B2 65 66 parison test, the differences between TG heterozygotes and Discussion TT homozygotes were statistically significant (d=4.721: The data provide evidence that rs1042173, a SNP in the 3' p=0.002); however, the differences between TG heterozy UTR of the SLC6A4 gene, is associated with intensity of gotes and GG homozygotes were not (d=2.175; p=0.20). drinking among Caucasians dependent on alcohol. Using a site-directed mutagenesis approach, it was shown that When TT and TG were combined and compared with GG rs 1042173 is a functional polymorphism that resulted in a using Student's t-test, the means did not differ significantly difference in 5-HTT expression levels in HeLa cell cultures, (t=0.32; p=0.75). The combined means of TG and GG (FIG. with Gallele associated with higher 5-HTT mRNA and pro 2A) were significantly lower than the mean of TT (t=2.97; tein expression levels than the T allele. Of multiple p=0.003). This suggests a dominant effect of the Gallele over approaches used to determine whether a polymorphism is a the Tallele. The difference between the means of drinks per 10 function one, a direct comparison of expression level between drinking day in G-carriers and TT genotypic group was 2.59+ two alleles through an in vitro expression system as used in 0.87 (95% CI 0.879 to 4.297). this study represents one of the most convenient molecular Estrogen has been shown to modulate the synthesis, techniques in the field. Alcohol-dependent individuals who were G-allele carriers release, and metabolism of 5-HT (Bethea et al., 2002; Frack 15 for rs1042173 showed less intensity of drinking compared iewicz et al., 2000: Pivac et al., 2004). Thus, to examine the with those who were homozygous for the Tallele. Impor impact of gender on these associations, we repeated the tantly, the average intensity of drinking for both of these analyses on male Subjects only. In Caucasian males, the mean allelic groups exceeded the threshold for heavy drinking (i.e., difference of standard drinks per drinking day between G-car 25 and >4 standard drinkS/day for men and women, respec riers and TT genotypic group, was 2.89+1.07 (95% CI-0.771 tively), and all were dependent on alcohol. At the time of to 5.009), which was similar to the mean difference in com entry, Subjects in both allelic groups were not statistically bined Caucasian male and female subjects. Therefore, we did significantly different in average chronological age and dura not find a significant effect of gender on the associations tion of alcohol dependency. It is, therefore, reasonable to between rs1042173 genotypes and drinks per drinking day. propose that alcohol-dependent individuals with the TT geno However, among Hispanic Subjects, we did not detect a 25 type might constitute a Subtype of more intense drinkers significant effect of rs1042173 genotypes on both measures among heavy-drinking alcoholics of European descent. This is the first study to investigate the function of the of drinking intensity, drinks per drinking day (F=0.935; rs 1042173 SNP in an alcohol-dependent population. The p=0.397) and drinks per day (F=0.299; p=0.74). rs 1042173 polymorphism is not only located at a putative Considering that 5-HTTLPR L/S polymorphism has polyadenylation signal site in the 3' UTR of the 5-HTT gene implicated as functional in many reported Studies, we exam 30 but also near a potential binding site for microRNA miRNA ined potential interactive effect of 5-HTTLPR L/S and 135 according to a bioinformatics prediction with PicTar rs 1042173 alleles on drinking intensity by using a newly program (Chen et al., 2006). It has been hypothesized that a developed algorithm for detecting gene-gene interaction, variant at this location may change expression levels by called generalized multifactor dimensionality reduction affecting the stability of mRNA (Battersby et al., 1999; Beau (GMDR) method (Lou et al. 2007). Our GMDR analyses 35 doing et al., 2000; Chen et al., 2006). Our findings have been revealed no significant interaction between these two func further supported by two recent reports. The first study tional SNPs (P=0.623). reported by Vallender et al. (2008) revealed that a functional 5-HTT mRNA Expression in Cells Transfected with Plas haplotype containing Tallele of rs1042173 was associated mid Carrying Either T or G Alleles with higher mRNA expression in HEK293 cells compared to To study whether the Tand Galleles of rs1042173 leads to 40 the haplotype consisting of Gallele. Another study reported differential expression levels of 5-HTTs, we transfected plas by Limetal. (2006) showed that G-allele had increased allelic mids carrying the T and Galleles of rs1042173 into HeLa expression imbalance (AEI) in Epstein-Barr virus trans cells and quantified mRNA levels by using the qRT-PCR formed lymphoblast cells while human pons tissue showed a assay. Results were analyzed for allelic differences using the decreased AEI for G-allele. Although the expression levels AACt method described by Winer et al (1999). FIG. 3A 45 associated with each allele of rs1042173 are inconsistent depicts the mean 5-HTT mRNA expression levels for the T among these studies (likely due to different reporter genes and Galleles from three independent transfection experi and/or cell lines used among them), they all reveal that ments. The G allele yielded significantly higher mRNA rs 1042173 is a functional one. expression level compared with the Tallele. In the three The finding of no association between rs1042173 genotype independent experiments, the G allele-transfected HeLa 50 and intensity of drinking in Hispanics, which differed from cells, compared with their Tallele-transfected counterparts, that of an association among Caucasians, while the allelic always produced a >50% higher 5-HTT mRNA level, an frequencies for T and Galleles in Caucasians and Hispanics effect that was significant statistically (p<0.0001). were not significantly different, does suggest the possibility 5-HTT Protein Expression in the T and G Alleles of the of differential regulation of gene expression by ethnic group. rS1042173 SNP 55 Due to the relatively small sample size of the cohort, such a To determine if the allele-associated RNA difference can premise needs to be treated as preliminary and confirmed by be translated into protein, we measured allele-specific differ larger studies. ences in 5-HTT protein levels between the two alleles. After The data show that the association between the intensity of normalization with tubulin for the loading difference, we drinking and the genotype remained significant in the same found that the 5-HTT protein level with G allele 60 manner even if we varied the drinking period prior to enroll (0.137+0.006) is significantly higher than that of Tallele ment within a range of 14 to 90 days (data not shown). The (0.104+0.002) (t=5.53; p=0.005: See FIG.3B). These results consistency of these results strengthened our findings. were reproduced in western blotting experiments from sev The findings suggest the possibility that two different sub eral independent replications. Notably, the expression of both groups of treatment-seeking alcoholics with allelic differ mRNA and 5-HTT proteins was in the same direction the G 65 ences at the 3' UTR SNPrs 1042173 can differ in their inten allele being associated with higher mRNA and protein sity of drinking, an effect that might be associated with expression levels than the Tallele. underlying differences in expression of 5-HTT. US 8,697,361 B2 67 68 TABLE 1. Biolodical Information of the 5 SNPs Examined in the Study p-values for the deviation Primers and probe MAF from HWE' sequences/context
NCBI Physical Chromosome Call- His Call- His sequence ID of ABI primers and coSNP ID position position Alleles CEU casian panic' casian panic probes 5-HTTLPR Promoter - 25, 588, 5OO L O 451 O. 43 O O. 814 O. 624 Forward: (long) TCC TCCGCTTTGGCGCCTC TTCC (SEO ID NO : 13) Rewerse: TGGGGGTTGCAGGGGAGAT CCTG (SEO ID NO: 14)
rs25531 Promoter 25, 588, 4.72 S O 1 OO O. O65 O. Of 9 O. 999 1. OOO Forward: (short) TCC TCCGCTTTGGCGCCTC A/G TTCC (SEO ID NO: 15) Rewerse: TGGGGGTTGCAGGGGAGAT CCTG (SEO ID NO: 16) The two alleles were determined using restriction enzymes Hpa11 and bc c1
rs6354 Exon 2 25, 574, O24 T/G O 295 O.2O2 O. 158 O 319 1. OOO C 1841706 10 (5' UTR)
rS6355 Exon 3 25, 572,936 C/G O. O25 O. O22 O. O2 6 1. OOO 1. OOO C 11414113 20 (Ala/Gly)
rs28914 832 Exon 1 O 25, 562, 5 OO A/C O. OO8 O. OO3 O. OO9 1. OOO 1. OOO Custom Taqman (R) SNP (Lieu/Ile) Genotyping Assay Forward: GCAGAAGCGATAGCCAACATG (SEO ID NO : 17) Rewerse: CAAGCCCAGCGTGATTAA CATC (SEQ ID NO: 18) Probe: CTTTCTTTGccC/ATCATCT (SEQ ID NO: 19)
rs1O 42173 Exon 15 25,549,137 G/T O. 433 O. 419 O. 455 O. 138 1. OOO C 7473190 10 (3' UTR)
MAF, minor allele frequency; HWE, Hardy-Weinberg equilibrium; ABI, Applied BioSystems (Foster City, CA). European sample from HapMap project. Data from this study.
TABLE 2 Demographics and Drinking Parameters in the Cohort Analyzed for TS1042173 Caucasian Hispanic
TT TG GG p-value TT TG GG p-value
Number of 47 77 41 26 56 28 Subjects Gender (% male) 82.97 64.93 80.49 88.46 85.71 82.14 Age (years) 41.6 166 42.36 - 1.23 40.98 - 1.52 0.62 37.08 - 2.01 40.05 - 1.22 38.82 - 1.76 O.33 Age of onset of 29.74 1.72 30.61 - 1.25 28.37 - 1.87 O.69 26.44 - 1.67 26.82 1.23 26.36 1.87 O.91 problem drinking Baseline drinks 11170.98, 8.05 - O.47 9.58 0.67 0.0043 9.99 O.71 1066 0.67 9.76 O.S8 0.65 per drinking day Baseline drinks 8.99 O.96 6.48 044 7.72 0.58 0.02 8.23 O.7S 7.52 0.59 7.92 OSS O.74 per day Years of lifetime 11.86+ 1.32 11.75 - 1.04 12.6 t 1.4 0.56 10.63 1.68 13.23 - 1.2 12.64 - 151 O.35 drinking Values are means + SEM. Significant p-values after correction for multiple testing are given in bold. “Years of lifetime drinking” was calculated by subtracting the age at which the subject began experiencing symptoms of alcohol dependence from their age at study enrollment, The adjusted p-value at the 0.05 significance level is 0.010. US 8,697,361 B2 69 70 Bibliography for Example 1 Vallender et al. (2008) Functional variation in the 3' untranslated region of the serotonin transporter in human and American Psychiatric Association (1994) Diagnostic and rhesus macaque. Genes, Brain Behav. 2008 August; 7(6): statistical manual of mental disorders, 4th ed. American Psy 690-7 chiatric Association, Washington, D.C. Wendland et al. (2006) Simultaneous genotyping of four Babor T. F., dela Fuente J. R., Saunders.J., Grant M. (1992) functional loci of human SLC6A4, with a reappraisal of AUDIT: The alcohol use disorders identification test, World 5-HTTLPR and rs25531. Mol Psych. 11:224-226. health organization, Geneva, Switzerland. Winer et al. (1999) Anal Biochem 270:41-49. Barrett et al., Bioinformatics, 2005, 21:263-265. Wrase et al. (2006) Cogn Affect Behav Neurosci 6:53-61. Battersby et a., J Neurochem, 1999, 72: 1384-1388. 10 Beaudoing et al., (2000), Genome Res 10:1001-1010. Example 2 Bethea et al. (2002), Front Neuroendocrinol 23:41-100. Drinking Histories in Alcohol-Use-Disordered Bradley et al. (1997), J Neurochem 69:1356-1367. Youth: Relationship of Platelet Serotonin Transporter Cargiulo T. (2007) Am J Health Syst Pharm 64(5 Suppl 15 Expression with Genotypes of the Serotonin 3):55-11. Transporter Chen et al. (2006) Hum Genet 120:1-21. Chen et al. (2006) Nature Genetics 38: 1452-1456 Functional control of the serotonin system is hypothesized Dundon et al. (2004) Alcohol Clin Exp Res 28(7):1065-73. to be regulated in part by differences in SERT (5-HTT) Feinn et al., (2005), Am J Med Genet B Neuropsychiatr expression 15. The gene responsible for encoding SERT Genet 133B(1):79-84. expression has a functional polymorphism at the 5'-regula Frackiewicz et al., (2000), Ann Pharmacother 34:80-88. tory promoter region 16, 17. The polymorphism contains an Gastfriend et al., (2007), J Subst Abuse Treat 33(1):71-80. insertion/deletion mutation with the long (L) variant having Goldman et al. (2005) Nature Reviews/Genetics 6:521 44 base pairs that are absent in the short (S) variant. In normal 532. 25 controls, the LL genotype, compared to S-carriers (i.e., SS Gill K, Amit Z. (1989) Recent Dev Alcohol 7:225-48. and SL genotypes), has greater 5-HT uptake in human plate Heils et al. (1996) J Neurochem 66:2621-2624. lets 18, lymphoblasts 19, and greater numbers (e.g., Hu et al. (2005) Alcohol Clin Exp Res 29(1): 8-16. reflecting either greater expression or less turnover) of SERT Hu et al. (2006) Am J Hum Genet 78(5):815-26. in human raphe nuclei 20. Assuming that individuals with 30 the LL genotype have greater SERT expression rates, these Johnson et al. (2004) Alcohol Clin Exp Res 28(2):295-301. individuals would be hypothesized to have greater 5-HT Javors etal. (2005) Prog Neuropsychopharmacol Biol Psy uptake, lower intra-synaptic 5-HT levels, and, therefore, chiatry 29(1): 7-13. reduced intra-synaptic 5HT neurotransmission in vivo and in Johnson et al. (2008) Can serotonin transporter genotype vitro 16, 19. predict serotonergic function, chronicity, and severity of 35 Differential expression of the serotonin transporter, in drinking? Prog Neuropsychopharmacol Biol Psychiatry interaction with chronic alcohol use, may play an important 32(1):209-16. role in the etiology and pathogenesis of alcoholism 15, 21. Kweon Y S. Lee H K, Lee CT, Lee KU, Pae C.U. (2005) especially for early-onset alcoholism. For example, adoles Association of the serotonin transporter gene polymorphism cents with the LL genotype may have specific Vulnerabilities with Korean male alcoholics. Journal of Psychiatric Research 40 that increase the risk of developing alcoholism 1, 22. Family 39:371-376. risk and population studies provide Support for this hypoth LeMarquand et al. (1994) Biol Psychiatry 36:326-337. esis. In a sample of men at risk for alcohol dependence, the LL Lim et al. (2006) Allelic expression of serotonin trans genotype was more prevalent among those who developed porter (SERT) mRNA inhumanpons: lack of correlation with alcohol dependence 23. Ernouf and colleagues 24 have the polymorphism SERTLPR. Mol Psychiatry 11(7): 649 45 shown that platelet serotonin (5-HT) uptake was higher in 662. alcohol dependent parents and their children, compared to Little et al. (1998) Am J Psychiatry 155:207-213. age-matched controls. Rausch and colleagues 25 showed Lou et al. (2007) Am J Hum Genet 80(6):1125-1137. that adult males with alcohol-dependent fathers had higher Makela P. Mustonen H. (2007) Alcohol Alcohol 42(6):610 mean Vmax for platelet 5-HT uptake, compared to FH-con 50 trols. In a Japanese sample, alcoholics with the L allele (e.g., LL and LS genotypes) had a significantly earlier onset of Mynett-Johnson et al. (2000) Am J Med Genet 96(6):845 alcohol dependence, compared those with the SS genotype 26. In a Korean male sample, the frequency of the L-allele Ozaki et al. (2003) Mol Psychiatry 8(11):933-6. was significantly higher in alcohol dependent individuals Pivac et al. (2004) Life Sci 76:521-531. 55 compared to controls 27. However, in European and Mexi Prasad et al. (2005) Human serotonin transporter variants can-American samples, the SS genotype, not the LL geno display altered sensitivity to protein kinase G and p38 mito type, has been associated with an antisocial-type of alcohol gen-activated protein kinase. PNAS 102(32): 11545-11550. ism 28, 29. So the genetic risk is clearly not as simple as a Qian et al. (1997) Protein kinase C activation regulates single allelic variant increasing risk for alcohol dependence. human serotonin transporters in HEK-293 cells via altered 60 Our group has reported previously that 5-HT uptake into cell surface expression. J Neurosci 17:45-57. platelets was greater among EOA males, compared to LOA Ramamoorthy et al. (1993) Antidepressant- and cocaine males and healthy controls 30. Although in adult normal sensitive human serotonin transporter: molecular cloning, samples, platelet 5-HT uptake is greater among L-carriers expression, and chromosomal localization. Proc Natl Acad compared to individuals with the SS genotype 18, we Sci USA 90:2542-2546. 65 recently found that among adults with chronic alcohol depen Sullivan et al. (1989) BrJAddict 84:1353-1357. dence, both 5-HTuptake and 3H-paroxetine binding to SERT Talvenheimo et al. (1980). J Biol Chem 255:8606-8611. were reduced among L-carriers (e.g., LL and LS) compared US 8,697,361 B2 71 72 to SS homozygotes 31, and these reductions in platelet General Design and Procedures— 5-HT function were related to years of drinking. Together, the The experimental design was a cross-sectional retrospec above findings from family risk and population studies Sup tive study. After initial screening, eligible participants gave port the hypothesis that chronic alcohol use may be “toxic' to blood for assay of platelet 5HT function and genotyping. SERT and diminish SERT activity expressed in individuals Fifty milliliters of blood was drawn from each participant to who are L-carriers 15, 20, 22. obtain platelets for the measurement of 5-HT uptake into The aims were to determine whether SERT genotype (LL intact platelets and paroxetine binding to platelet membranes. vs. S-carriers) differentiated Early Onset adolescents with Additionally, a 10 ml sample of blood was drawn for the AUD with respect to their drinking patterns or their seroton determination of SERT genotype. 10 Platelet Suspension and Platelet Membrane Preparation— ergic activity measured by SERT density and function in Fifty ml blood was drawn into 60 ml polypropylene platelets. Relationships of platelet SERT measures to current syringes containing 10 ml of Acid-Citrate-Dextrose (ACD) and lifetime drinking also were examined. It was hypoth buffer. The blood was then centrifuged at 150 g at 23°C. for esized that platelet measures of SERT binding and function 20 min in a Beckman TJ-6 centrifuge to obtain platelet-rich would be related to SERT genotype, in part due to the rela 15 plasma (PRP). Platelet count in PRP was determined with a tively short histories of alcohol use. Specifically it was pre Coulter counter model S-plus VI and adjusted to 3x108 plate dicted that adolescents with AUD would show higher SERT lets/ml with the addition of platelet buffer (137 mM KC1, 1 function and SERT density in the LL genotype compared to mM MgCl, 5.5 mM glucose, 5 mM HEPES, pH 7.4) to the S-genotypes (LS, SS). It was also tested whether history prepare adjusted PRP for the serotonin uptake experiments of drinking, current amount of drinking, or both, determine only. Three ml of adjusted PRP was used for plateletserotonin how SERT genotype alters SERT function in adolescents with uptake experiments, which were performed on the day of the alcohol use disorder. blood draw. To prepare platelet membranes for paroxetine Materials and Methods binding experiments, the remainder of the PRP was used. One Participants— ml of prostaglandin 12 solution (300 ng/ml) per ml of PRP Participants were youths aged 18-20 with a currentalcohol 25 was added to prevent loss of platelets during centrifugation, use disorder who were not seeking treatment. Participants and then the sample was centrifuged at 550 g. The resulting were diagnosed with alcohol abuse or alcohol dependence, platelet pellet was resuspended in platelet buffer and then using criteria from the Diagnostic and Statistical Manual of centrifuged at 35,000 g. The platelet membrane pellet was Mental Disorders, 4th edition (DSM-IV: American Psychiat resuspended in 1 ml of platelet buffer and then stored at 80°C. ric Association, 1994). All volunteers were in good physical 30 until the day of the assay to measure paroxetine binding. health (determined by a complete physical examination, elec Serotonin Uptake into Intact Platelets— trocardiogram (EKG) within normal limits, and laboratory Platelet 5-HT uptake experiments were performed in 21 screening tests within acceptable parameters); were consum participants. The adjusted PRP suspension was used to deter ing at least 3 Standard Drinks/Drinking Day; had breath mine platelet 5-HT uptake. Assay tubes were prepared in alcohol level of Zero at screen; and were literate in English. 35 duplicate and contained H5-HT at six different concentra Exclusionary criteria included current or lifetime Axis I tions (62.5 nM to 2000 nM), and 100 uM pargyline with or DSM-IV Substance Use Disorder other than to alcohol or without 50 uM fluoxetine. These tubes were incubated at 37° cannabis use disorder. Illicit substance use in the past 30 days C. for 5 min; then the reaction was started by the addition of other than marijuanause was exclusionary. Psychiatric exclu 100ul of adjusted PRP that contained 107 platelets. The assay sionary criteria included current major depressive disorder, 40 tubes were incubated at 37° C. for an additional 5 min; then bipolar disorder, post-traumatic stress disorder, psychosis, or the reaction was quenched by rapid filtering through What attention deficit hyperactivity (ADHD) that was medicated man GF/B filters using a Brandel Cell Harvester. The filters within the previous 30 days. Medical exclusionary criteria were washed three times with 5 ml of ice-cold washbuffer (50 included elevated liver enzymes greater than 4 times the nor mM Tris-HCl, 150 mM. NaCl, and 20 mMethylene diamine mal range, and/or elevated bilirubin (>110% per limits of 45 tetra-acetic acid (EDTA)). Filters were placed in scintillation normal); serious medical co-morbidity requiring medical vials containing 5 ml of Beckman Ready Protein-i- scintilla intervention or close Supervision; clinically significant alco tion counting fluid and immediately counted. Specific uptake hol withdrawal; treatment for alcohol abuse or dependence was calculated by Subtracting total uptake from nonspecific within the last 30 days; or, if female, pregnant. All partici uptake (fluoxetine tubes). Maximum 5-HT uptake rate pants gave written informed consent. The study was approved 50 (Vmax) in platelets was expressed as fmol 5-HT/min-107 by the University of Texas Health Science Center Institutional platelets, and the equilibrium constant (Kim) as nM. Km and Review Board. Vmax were calculated using the one-site hyperbolic function Diagnostic Measures— in Prism 4 software by Graph PadTM. Trained therapists used the Children's Interview for Psy Paroxetine Binding to Platelet Membranes— chiatric Syndromes (ChIPS), which adheres strictly to DSM 55 Platelet membranes were used to determine platelet parox IV criteria for psychiatric disorders and has been shown to be etine binding. Assay tubes were prepared in duplicate con accurate and provide valid diagnoses of psychiatric disorders taining incubation buffer (50 mM Tris-HCl, 5 mM KCl and in adolescents and young adults to 20 years of age 32. 120 mM. NaCl) and |H| paroxetine at 6 different concentra Current and lifetime Substance use disorders were diagnosed tions (0 to 2 nM) with and without 150 mM fluoxetine. The in a structured clinical interview using the Adolescent Diag 60 actual concentration of paroxetine in each tube was deter nostic Interview (ADI) 33, 34. The principal investigator mined using a 40 ml aliquot taken from each tube prior to the clarified discrepancies and established reliability of inter addition of platelet membranes. The experiment was started views, using the Best Estimate Diagnostic Procedure 35,36). by the addition of 80 mg of platelet membrane protein then and monitored for consistency of participants self-report the assay tubes were incubated for 1 hr at 23°C. The reaction throughout the study. Recent reported drinking and lifetime 65 was quenched by addition of ice-cold wash buffer (50 mM drinking were determined by patient interview using time Tris HCl, 150 mM NaCl, 20 mM EDTA) and rapid filtering line follow back procedures 37. through Whatman GF/B filters treated with 0.3% polyethyl US 8,697,361 B2 73 74 enimine using a Brandel Cell Harvester. Filters were washed Bmax and Kd than did S-carriers, indicating greater amounts 3 times with ice-cold wash buffer, dried over-night, placed in of SERT with lower affinity for paroxetine binding. There scintillation vials containing 5 ml of Beckman Ready Pro were no genotype group differences in the platelet functional tein-- Scintillation counting fluid and counted in a Beckman measures of 5HT uptake. LS-6500 liquid scintillation counter. Disintegrations per 5 Discussion— minute (DPM) from the 40 ml aliquots were converted into The main finding was that SERT genotype predicted dif nM of paroxetine to obtain the actual concentrations in each ferences in age of onset and duration of drinking, as well as tube. Total and non-specific binding of paroxetine was plotted the platelet binding profile of SERT among adolescent sub against each actual concentration. Specific binding was cal jects with an alcohol use disorder. Specifically, adolescents culated by Subtracting non-specific binding from total bind 10 ing. Kd and Bmax of paroxetine binding were calculated with the LL genotype began drinking at a younger age and using Prism4 software (Graphpad). Paroxetine binding showed greater 3H-paroxetine binding at lower affinity than (Bmax) was expressed as fmol/mg of platelet membrane pro did S-carriers. tein and Kd as nM. Protein concentrations were measured Even though both groups of participants had an onset of using the BioRad method and a SPECTRAmax PLUS384 15 alcohol use disorder during adolescence and were of the same Micro-plate spectrophotometer. current age (i.e., mean=18.7 yrs), participants with an LL Genotyping— genotype had significantly earlier age of onset of drinking The blood sample for the determination of SERT genotype (i.e., 13.5 vs. 15.2 years of age) compared to the S-carriers. was drawn at enrollment. White blood cells were separated This finding is consistent with a hypothesis described by from plasma and re-suspended, and DNA was isolated using Johnson 22 predicting that the LL genotype would be asso PUREGENE, Gentra systems according to the manufactur ciated with an earlier age of onset of problem drinking. Also er's protocol. The 5'-HTTLPR 44 bp promoter region repeat consistent with the Johnson hypothesis, the LL-group also polymorphism was amplified by polymerase chain reaction had higher levels of behavioral vulnerability (i.e., trait impul (PCR) from ~50 ng of DNA using two primers: 5'-CGTTGC sivity) than did the S-carriers 1, 15, 22. This latter finding is CGC TCT GAA TGC CAG-3 (SEQ ID NO:11) AND 25 interesting in light of the literature Suggesting LL-genotypes 5'-GGA TTC TGG TGC CAC CTA GAC GCC-3' (SEQ ID may have lower 5-HT in the synaptic cleft and lower central NO:12) and in a 25-ul final volume consisting of 0.5 U of Tfl turnover of 5-HT associated with higher levels of impulsivity DNA polymerase (Epicentre), 1x PCR buffer, 1.5 ml MgCl, 1, 15, 22. Interestingly, there were no significant group 200uMdNTPs, 1x enhancer, and 0.6 uMofeach primer. The differences in the current levels of drinking, which contrasts PCR conditions were as follows: 94° for 30s; 70° C. for 30s, 30 with reports in college students, showing that S-carriers had and 72° C. for 30s); a final extension of 72° C. for 7 min and terminal hold at 4°C. Separation by gel electrophoresis using heavier patterns of binge drinking 38. 4% MetaPhor agarose (Cambrex, Rockland, Me.) allowed Results from previous studies in adult populations have visualization by ethidium bromide/UV detection of the two generally shown that the SS genotype is associated with anti variants (long (L) and short (S): fragment sizes 464 bp and 35 Social types of alcoholism in European and Mexican-Ameri 420 bp, respectively) of the promoter region of the SCL4A can populations 28, while among Asian populations, LL gene (-1415 to -951) 16. genotype has been associated with alcoholism risk 26, 29. Statistical Analyses— The present study population of adolescents included Cauca Means and standard deviations for outcome variables of sian, “white'. Hispanic, biracial or mixed, and American platelet variables (Km and Vmax of 5HT uptake into intact 40 Indian ancestry participants. The results suggest that the LL platelets, and Kd and Bmax of paroxetine binding on platelet genotype may be associated with a greater impulsivity, plasma membranes) were examined. Non-normal distribu thereby increasing risk to begin encountering problem drink tions of outcome variables were transformed. Planned analy ing at an earlier (adolescent) age. Given the association of the ses included Pearson correlations to examine the relation SS-genotype with anxiety and stress-related disorders 15, ships the platelet variables. T-tests were used to determine 45 39, an alternative hypothesis is that by the time that Cauca whether there were group differences in the LL genotypes vs. sian adolescents mature into college-age young adults, other S-carrier genotypes, in psychiatric disorders, current, and environmental factors such as stress, interact with S-carrier lifetime drinking, for the dependent variables for platelet 5HT genotypes, to produce anxiety or affective distress resulting in function (Bmax Kd. Vmax, and KM). greater patterns of drinking and alcoholism risk. Results— 50 Previous studies in adults have shown that compared to The distribution of genotypes was the following: LL., n=8, S-carriers, the LL-genotype is associated with increased cen LS, n=9, SS, n=4. Since S-carriers (LS and SS) were the predominant genotypes in the sample, LS and SS were pooled tral SERT binding 20 and increased 5-HT uptake (but not for the analyses of group differences (e.g., LL vs. S-carriers). binding) in the platelets of healthy subjects 18. However, There were no statistically significant differences in age or 55 this finding appears not to be the case in adult alcoholics. It is ethnicity between the LL and S-carriers (see Table 1). How known that adult alcoholics having an L-allele actually have ever, the LL group had a significantly earlier age of onset and reduced 3H-paroxetine binding and 5-HT uptake into plate longer duration of alcohol use, but did not have significant lets compared to the SS-homozygotes—and hypothesized differences in quantitative measures of recent drinking. The that this effect is related to years of problem drinking 31. LL group also had significantly higher inattention and motor 60 The current findings Suggest that adolescent problem drinkers components of trait impulsivity, and a trend towards signifi who have the LL genotype initially have normal patterns of cant differences in total BIS-11 trait impulsivity. All partici increased SERT binding, but that S-carriers do not have nor pants had a current Alcohol Use Disorder based on DSM-IV mal SERT binding. Therefore, it is reasonable to speculate criteria. There were no significant differences between geno that with continued heavy drinking, adolescents who have type groups in other the DSM-IV psychiatric groups. 65 earlier onset of drinking and longer duration of drinking have Table 2 and FIG. 4 present the results of the platelet studies. an earlier onset of down regulation of SERT than is seen in Participants having the LL genotype had significantly higher adult alcoholics. US 8,697,361 B2 75 76 EXAMPLE 2, TABLE 1 EXAMPLE 2, TABLE 2 Group differences in measures of 5HT uptake and Demographics, Drinking History, and Current Psychiatric paroxetine binding Disorders Genotype Genotype LL (n = 8 LSSS (n = 13 LL LSFSS (n = 8) (n = 13) Variable Mean (SD) Mean (SD) P value 10 Paroxetine Variable Mean (SD) Mean (SD) P value Binding
Age (yrs) 18.9 O6 18.5 O.S O.20 B. (fmol/mg 802.O 2542 SO4.3 1998 O.O2 Trait Impulsivity protein) K (nM) 0.7 O.S 0.4 3 O.O3 (BIS-11) Bmax.Kd 1293.2 SO8.6 1861.4 1318.0 O.18 15 5HT Uptake Non-planning 26.O 4.7 24.4 6.9 0.57 nattention 2O.S 3.4 16.5 3.8 O.O3 Vmax 1816 1284 2001 113.5 O46 Motor 27.8 3.2 23.9 3.2 O.O2 (fmol/min-107 platelets) K (IM) 445.9 4093 323.2 1364 O.40 Total 74.3 7.4 64.9 11.3 O.OS Vmax/Kn O.6 0.4 0.7 0.4 O.S3 Lifetime Drinking Note: Age of Onset of 13.5 1.2 15.2 1.9 O.O3 Data were transformed to the natural log scale fort-test analyses, Alcohol Use (yrs) Duration of 5.4 O.9 3.3 1.8 <0.018 Conclusion— Alcohol Use (yrs) 25 The present findings provide partial Support for the hypoth Recent Drinking esis that among currently drinking adolescents with an alco hol use disorder, those having an LL-genotype display greater DD 3.0 1.7 3.9 5.3 O.98 impulsivity, began drinking at an earlier age, and have DDD 9.9 5.7 7.8 7.8 0.27 increased H-paroxetine binding to platelet SERT. These PDA 67.6 16.1 52.7 25.7 O16 30 findings expand our current understanding of the 5'-promoter of the SERT gene in regulating the SERT in adolescents with (Percent (Percent of of LL LSSS AUD. This study provides preliminary findings that further Number Participants) Number Participants) demonstrate that platelet and genetic measures of SERT func tion may be useful measures to track the complex interplay of Gender 0.97 35 biological and environmental factors in the etiology of Vul nerability and risk of either alcoholism onset or toxicity. Male 5 62.5 8 61.5 Female 3 37.5 5 38.5 Example 2 Bibliography Ethnicity O.38 40 1. Johnson, B. A. and N. Ait-Daoud, Psychopharmacology, Caucasian 2 2SO 3 23.1 2000. 149: p. 327-344. Hispanic 3 37.5 9 69.2 2. LeMarquand et al., Biological Psychiatry, 1994. 36: p. Biracial or Mixed 3 37.5 O O.O 326-337. American Indian O O.O 1 7.7 3. LeMarquand et al., American Journal of Psychiatry, 1999. ADHD 3 37.5 3 2SO O48 45 156: p. 1771-1779. ODD 1 12.5 3 2SO 0.55 4. Stoltenberg, S.F., Alcoholism: Clin. Exp. Res., 2003. 27: p. CD 6 75.0 9 75.0 O.92 1853-1859. Mood Disorders 2 2SO 3 23.0 O.85 Anxiety Disorders O O.O 4 44.0 O.81 5. Linnoila et al., Life Sciences, 1983. 33: p. 2609-2614. Alcohol Use 8 1OOO 13 1OOO -- 6. Fils-Aime, M. L., et al., Archives of General Psychiatry, 50 Disorder 1996. 53(3): p. 211-216. Alcohol 8 1OOO 10 83.3 O.14 7. Cloninger, C., Science, 1987. 236: p. 410-416. Dependence 8. Virkkunen et al., Archives of General Psychiatry, 1987. 44: Alcohol Abuse O O.O 3 16.7 :::::: p. 241-247. Cannabis 1 12.5 6 SO.O O.11 9. Virkkunen et al., Archives of General Psychiatry, 1996.53: 55 p. 523-529. Dependence 10. Swann et al., Psychopharmacology, 1999. 143: p. 380 384. *Duration of alcohol use remains significant after including Barrett Impulsivity Scale (BIS) total as covariate, 11. Grunbaum, J. A., et al., Morb. Mort. Wkly Rpt., Surveil. DD: Average Drinks per Day in past 90 days; Sum. 2002. 51(4): p. 1-62. DDD: Average Drinks per Drinking Day in past 90 days; 60 12. McBride, et al., Critical Reviews in Neurobiology, 1998. PDA: Percent Days Abstinent in past 90 days; 12: p. 339-369. (+) All participants met criteria for a current Alcohol Use Disorder; 13 Virkkunen, et al., Journal of Psychiatry and Neuroscience, (**) Three participants met DSM-IV-TR criteria for Alcohol Abuse. 1995. 20: p. 271-275. Attention Deficit Hyperactivity Disorder (ADHD); 14. Virkkunen, et al., Epidemiology, Neurobiology, Psychol Oppositional Defiant Disorder (ODD), 65 ogy, Family Issues., M. Galanter, Editor. 1997, Plenum Conduct Disorder (CD) Press: New York. p. 173-189. 15. Heinz et al., Psychopharmacology, 2004. 174: p. 561-570. US 8,697,361 B2 77 78 16. Heil et al., Journal of Neurochemistry, 1996.66: p. 2621 bouts of binge drinking because the extent to which the 2624. 5-HT3 receptor is potentiated is inversely related to the level 17. Heils et al., Journal of Neural Transmission, 1997. 104: p. of basal 5-HT neurotransmission (Lovinger 1991; Lovinger 1005-1014. 1999; Lovinger and Zhou 1994; Lovinger and Zhou 1998: 18. Greenberg et al., American Journal of Medical Genetics, Zhou and Lovinger 1996: Zhou etal 1998). Ondansetron may, 1999.88: p. 83-87. therefore, be differentially effective in EOA with presumed 19. Lesch, et al., Science, 1996. 274: p. 1527-1531. LL variant predominance by blockade of up-regulated 5-HT3 20. Heinz, et al., Biological Psychiatry, 2000. 47: p. 643-649. receptors, thereby ameliorating the serotonergic dysfunction 21. Meltzer, et al., Psychiatry Research, 1998. 24: p.263-269. and decreasing alcohol's rewarding effects. 22. Johnson, B. A., et al., Alcoholism: Clin. Exp. Res., 2000. 10 Polymorphic variation of the SERT at 5-HTTLPR also 24(10): p. 1597-1601. may explain the therapeutic treatment response to SSRIs 23. Schuckit, et al., Biological Psychiatry, 1999. 45: p. 647 651. among type A alcoholics (similar to LOA) with presumed 24. Ernouf, et al., Life Sciences, 1993. 52: p. 989-995. SS/SL predominance (Pettinati et al 2000). This association 25. Rausch, J. L., et al., Neuropsychopharmacology, 1991. 15 is, however, probably not mediated through 5-HT3 mecha 4(2): p. 83-6. nisms. It is proposed herein that in Pettinati et al.'s type A 26. Ishiguro, et al., Alcoholism: Clin. Exp. Res., 1999. 23: p. alcoholics, predominantly with the SS/SL form, basal sero 1281-1284. tonergic function was normal. Chronic SSRI treatment, there 27. Kweon, et al., Journal of Psychiatric Research, 2005.39: fore, produced modest facilitation of 5-HT neurotransmis p. 371-376. sion and long-term inhibition of dopaminergic activity, 28. Feinn, et al., American Journal of Medical Genetics Part thereby offsetting alcohol's rewarding effects during chronic B (Neuropsychiatric Genetics), 2005. 133B: p. 79-84. drinking. Individuals with the SS/SL form of 5-HTTLPR can 29. Konishi, et al., Alcohol, 2004. 32: p. 45-52. be expected to experience a similar modest anti-rewarding 30. Javors, et al., Alcohol and Alcoholism, 2000.35: p. 390 effect during acute alcohol intake while receiving chronic 393. 25 SSRI treatment. In contrast, chronic SSRI treatment was 31. Johnson, et al., Neuropsychopharmacology and Biologi probably ineffective at reducing the protracted drinking of cal Psychiatry, in press. type B alcoholics (Kranzler et al 1996) with presumed LL 32. Rooney, et al., Administration manual of the ChIPS. 1999, predominance because serotonergic activity would have been Washington, D.C.: American Psychiatry Press. increased greatly (as there are relatively fewer SERT trans 33. Winters, et al., Adoles. Diagnostic Interview Schedule 30 porters in this state), and the ensuing marked hypo-dopamin and Manual. 1993, Los Angeles: Western Psychological ergic state probably triggered relief drinking to normalize this Services. neurochemical condition. Chronic SSRI treatment probably 34. Winters, K.C., et al., Psychology of Addictive Disorders, has little effect on 5-HT neurotransmission among acutely 1993.7: p. 185-196. drinking individuals with the LL variant because basal sero 35. Leckman et al., Archives of General Psychiatry, 1982.39: 35 tonin reuptake already is enhanced greatly. p. 879-883. The present studies were performed to determine if the 36. Kosten, et al., American Journal of Psychiatry, 1992. 149: effective of ondansetron treatment could be correlated with p. 1225-1227. the expression of the LL variant of 5-HTTLPR and alcohol 37. Sobell, L. C., Sobell, M. B., Timeline follow-back: A consumption. technique for assessing self-reported alcohol consump 40 Materials and Methods tion., in Measuring Alcohol Consumption: Psychosocial In a pre-planned interim analysis, data were examined for and biochemical methods, E.R. Litten, Allen, J., Editor. the 226 alcohol-dependent individuals (aged 18-65 years) 1992, Humana Press Inc.: Totwa, N.J. p. 41-72. enrolled into the 12-week randomized controlled pharmaco 38. Covault et al., Biological Psychiatry, 2007. 61(5): p. 609 therapy trial to determine the effect of ondansetron on drink 16. 45 ing among individuals who varied on allelic difference at the 39. Lesch, K. P. European Journal of Pharmacology, 2005. 5-HTT gene and age of alcoholism onset. All these individu 526: p. 113-124. als were enrolled at the University of Texas Health Science 40. Dawes, et al., Alcohol and Alcoholism, 2004. 39(3): p. Center at San Antonio. Briefly, the study design was 2 (LL vs. 166-177. LS/SS)x2 (early onset vs. late onset)x2 (ondansetron 4 Jug/kg 41. Pine, et al., Archives of General Psychiatry, 1997. 54: p. 50 b.i.d. vs. placebo). The inferential results below are for the 839-846. severity of drinking drinks/drinking day (DDD). 42. Soloffetal. Alcoholism: Clin. Exp.Res., 2000. 24(11): p. Demographic data were that: 74% were male and 26% 1609-1619. female: 48% were early-onset alcoholics and 52% late-onset 43. Twitchellet al., Alcoholism: Clin. Exp. Res., 2000. 24(7): alcoholics, and 20% were Hispanic and 80% White. There p.972-979. 55 were no significant differences (P-0.05) on demographics 44. Twitchell, et al., Alcoholism: Clin. Exp. Res., 2001. 25(7): between the treatment groups. Baseline mean (SD) DDD p. 953-959. (past 90 days) were also similar for the ondansetron 4 Jug/kg b.i.d. and placebo groups—9.83 (4.63) vs. 9.85 (4.49). Example 3 respectively. The inferential analyses were conducted on all 60 randomized subjects according to the intent-to-treat prin LL Alcoholics Experience Greatest Reduction in ciple. The analytic plan was first to calculate the DDD in each Drinking Severity Following Ondansetron Treatment week. We then used the difference between weekly DDD and the baseline DDD (in the past 90 days) as repeat measures. A 5-HT3 up-regulation increases the function of DA (Blan mixed-model approach (SAS PROC MIXED) was used to dina et al 1989; Blandina et al 1988: De Deurwaerdere etal 65 study the effect of treatment, genotype (LL vs. LS/SS), treat 1998), the principal neurotransmitter mediating alcohols ment and genotype interaction, age, age of onset (early Vs. rewarding effects. This up-regulation may be increased by late), gender, and age at onset of problem drinking, adjusting US 8,697,361 B2 79 80 for the baseline DDD level. Also included is a random slope of the 5'-HTTLPR, the TT genotype of the 3'-UTR of for time to study the variation in the time trend of the weekly rs 1042173, or the combination of the genotypes. DDD. Materials and Methods Results—Example 3 Subjects: It was observed that DDD for both the ondansetron and 5 289 alcohol-dependent men and women enrolled in a placebo groups had a roughly linear decreasing time pattern; 12-week treatment trial in which they received either thus, all groups improved their drinking outcomes over time ondansetron (4 ug/kg) or placebo. All Subjects also received (F-32.96: P<0.0001). The table below (Table 1-Example 3) weekly cognitive behavioral therapy as their standardized shows the cell contrasts for the different genotypes on DDD psychosocial treatment. Genotyping was conducted on all for the placebo and treatment (i.e., ondansetron) groups. 10 Subjects. There also was a main effect of treatment (F-5.64; Statistical Methods: P=0.02). The interaction of treatment and genotype was Mixed-effects models were used to study the effect of highly significant (F=6.99; P=0.0083). There also was a mar treatment and genotype and their interaction for each of the ginally significant effect of age of onset (F=3.68; P=0.06). primary drinking outcomes. The models included random 15 intercept and random slope and were adjusted for covariates There was an overall significant effect for the LL group to Such as participants’ average 90-day drinking levels prior to reduce DDD (F=5.64; P=0.02) and an effect of time the study, age, gender, ethnicity (Caucasian and Hispanic), (F=12.69; P=0.0007). From the table, the cell contrasts show that the reduction in DDD for the LL group was driven by the and center. A variance-components covariance matrix was fact that the ondansetron LL group had a significantly greater used to model different variances for the intercept and slope reduction in DDD compared with the other allelic types. and a covariance between them. Interactions of treatment, Indeed, the effect size (Cohen's d) for ondansetron’s effect in genotype, age, and center were first included in the models. LL individuals to reduce DDD was large (i.e., 0.08). The They were excluded from the final models if not significant. mean (SEM) DDD reduction from baseline across the treat Results: ment period for the different genotypes and treatment condi For drinks per drinking day (DDD) outcome, it was found tions was 5.70 (0.64) for ondansetron LL., 3.45 (0.44) for 25 that there were significant rs1042173 main effects in DDD ondansetron LS/SS, 3.54 (0.67) for placebo LL, and 4.25 (p=0.003) as well as in the rs1042173-by-5'-HTTLPR L/S (0.45) for placebo LS/SS. About 70% of those who entered alleles (LL, LS/SS) interaction effect (p=0.021) and the the double-blind phase completed the trial. 5-HTTLPR LIS alleles-by-treatment interaction effect These promising data provide the first evidence that alco (p=0.028). Patients with the TT genotype had more than a 30 1-DDD reduction compared with those with TG/GG (mean holics with the LL genotype, compared with their LS/SS difference=-1. 16: 95% CI: -1.93 to -0.39; p=0.003). Unex counterparts, experience significantly greater reduction in the pectedly, in patients with both the LL and TT genotypes (LT). severity of drinking following ondansetron treatment. the DDD reduction was much greater than in those with the TABLE 1. other genotype combinations of rs1042173 and 5-HTTLPR 35 L/Salleles (p<0.05), and there was more than a 2-DDD reduc Example 3 tion in LT individuals compared with those who had LL and TG/GG (LG; mean difference=-2.06: 95% CI: -3.27 to Lower Upper P- Cohen's -0.85; p=0.001). When treated with ondansetron, TT geno Treatment Genotype Estimate CI CI Value d type patients seemed to respond to treatment more effectively Placebo LSFSS -0.71 -2.29 O.87 0.379 0.03 40 than did TG/GG genotype patients (mean difference=-1.31; vs. LL 95%CI: -2.36 to -0.25; p=0.016). A similar treatment effect Treatment LSFSS 2.25 0.73 3.78 O.OO4. O.10 vs. LL was observed when we compared patients with the LL geno Placebo vs. LSSS -O.8O -2.03 O.43 O.203 0.04 type with those who had LS/SS (mean difference=-1.41: treatinent 95% CI: -2.46 to -0.36; p=0.009), and among patients with Placebo vs. LL 2.16 O3S 3.98 O.O2O O.O8 45 the LL genotype, those in the treatment group had a 1.5-DDD treatinent reduction compared with those in the placebo group (mean difference=-1.50; 95%CI: -2.70 to -0.31; p=0.013). Similar Critically, these new findings on serotonergic medications effects were observed for other drinking measures. revive the concept that alcoholism is a heterogeneous disor Conclusion: der associated with varying neurochemical abnormalities. 50 Ondansetron exerts a preferential treatment effect to Medications that specifically target one or more of these reduce severe drinking among alcohol-dependent individuals underlying abnormalities promise, therefore, to be powerful with the LL genotype of the 5-HTTLPR, an effect that is treatments, and their trials should advance our scientific increased among those who also possess the TT allele in the understanding of the disease. 3'-UTR of rs1042173. These data demonstrate an important 55 pharmacogenetic effect of ondansetron in alcohol-dependent Example 4 individuals. This study validates a method whereby alcohol dependent individuals identified as having either of these Methods of Predicting Responses to Treatment alleles, or their combination, can be treated effectively with Based on Different Genotypes of the 5-HTTLPR ondansetron. and the 3'-UTR of the Serotonin Transporter Gene 60 The data presented in Examples 1 and 4 demonstrate that SLC6A4 and Methods of Treatment Based on the there is an association with higher severe drinking and Sus Differences ceptibility to ondansetron treatment in alcohol-dependent Subjects homozygous for T. relative to alcohol-dependent Based on the results of the experiments described in subjects with a Gallele. Examples 1-3, a series of studies were performed to deter 65 The disclosures of each and every patent, patent applica mine whether there is a pharmacogenetic effect of tion, and publication cited herein are hereby incorporated by ondansetron to differentially treat those with the LL genotype reference herein in their entirety. US 8,697,361 B2 81 82 Headings are included herein for reference and to aid in While this invention has been disclosed with reference to locating certain sections. These headings are not intended to specific embodiments, it is apparent that other embodiments limit the scope of the concepts described therein under, and and variations of this invention may be devised by others these concepts may have applicability in other sections skilled in the art without departing from the true spirit and throughout the entire specification. Scope of the invention.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS : 19
<21 Os SEQ ID NO 1 211s. LENGTH: 2775 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens
<4 OOs SEQUENCE: 1 acagc.ca.gcg cc.gc.cgggtg cct cagggc gc gaggc.cag ccc.gc.ctgcc cagc.ccggga 60
Ccagcct coc cqcgcagcct ggcaggit ct c ctggaggcaa gg.cgaccttg Cttgcc ct ct 12O Cttgcagaat aacaaggggc titagccacag gagttgctgg caagtggaala galagaacaaa 18O
tgagt caatic cc.gacgtgtc. aatc.ccgacg at agaga.gct cqgaggtgat CC acaaatcC 24 O aag cacc cag agat caattg ggatcCttgg cagatggaca to agtgtcat ttactalacca 3 OO gcaggatgga gacgacgc.cc ttgaattict C agaa.gcagot at Cagcgtgt galagatggag 360 aagattgtca ggaaaacgga gttct acaga aggttgttcc cacccCaggg gacaaagtgg 42O
agt ccgggca aatat coaat ggg tact cag cagttcCaag to Ctggtgcg ggagatgaca 48O
cacgg cactic tatcc.ca.gcg accaccacca cc ct agtggc tigagct tcat Caaggggaac 54 O
gggagacct g gggcaagaag gtggattitcc ttct ct cagt gattggctat gctgtggacc 6 OO tgggcaatgt ctggcgctt C cc ctacatat gttaccagaa tigagggggg gCattic ct co 660 to ccctacac catcatggcc atttittgggg gaatccc.gct cittitta catg gagctic goac 72O tggga cagta ccaccgaaat ggatgcattt caatatggag gaaaatctgc cc.gattitt Ca 78O
aagggattgg titatgccatc tdcat cattg ccttitta cat togct tcctac taca acacca 84 O
tdatggcct g gg.cgctatac tacct catct cotcctt cac ggaccagotg ccct ggacca 9 OO gctgcaagaa ct cotggaac actggcaact gcaccaatta cittct c coag gacaa.cat ca 96.O cctgg accolt coatt.ccacg toccctgctgaagaattitta cacgc.gc.cac git cotgcaga O2O to Caccggit c talaggggct C caggacctgg ggggcatcag ctggcagotg gCCCtctgca O8O
tdatgctgat citt cactgtt atctact tca gcatctggaa aggcgt caag acct citggca 14 O
aggtggtgtg ggtgacagcc acct tcc Ctt at at catcct ttctgtc.ctg. Ctggtgaggg 2 OO
gtgccaccct Coctggagcc tigaggggtg ttct Cttct a cittgaalacc C aattggcaga 26 O aactic ctgga gacaggggtg tigatagatg cagcc.gctica gatcttctt C totcttggtc 32O cgggctttgg ggtc.ctgctg gCttittgct a gctacaacaa gttcaacaac alactgctacc 38O
aagatgc cct ggtgaccagc gtggtgaact gcatgacgag ctitcgtttcg ggatttgtca 4 4 O
tott cacagt gctcggittac atggctgaga tigaggaatga agatgtgtct gaggtggc.ca 5 OO aagacgcagg toccagcctic ct citt catca cqtatgcaga agcgatagoc alacatgc.cag 560
cgt.ccactitt ctittgc.catc at cittctitt c tdatgttaat cacgctgggc titggacagca 62O cgtttgcagg cttggagggg gtgat cacgg ctgtgctgga tigagttcc.ca cacgtctggg 68O
ccaag.cgc.cg ggagcggttc gtgct cqc.cg tdgt cat cac ctgcttctitt ggat.ccctgg 740
to accctgac ttittggaggg gcctacgtgg taa.gctgct ggaggagtat gccacggggg 8 OO
cc.gcagtgct cactgtc.gcg ctgat Caag cagt cqctgt gt Cttggttc tatggcatca 860 US 8,697,361 B2 83 84 - Continued cticagttctg Cagggacgtg aaggaaatgc tcggctt cag CCC9gggtgg ttctggagga 1920 tctgctgggit ggc.cat cagc cctctgtttc tcc tigttcat catttgcagt tittctgatga 198O gccc.gc.caca actacgacitt titcCalatata attat Cotta Ctggagtatic atcttgggitt actgcatagg aac CtcatCt tt catttgca to CCCaCata tatagctitat cggttgat.ca 21OO t cactic cagg gacatttaaa gag.cg tatta ttaaaagtat taccc.cagaa acaccaa.ca.g 216 O aaattic cttg tgggga catc cgcttgaatg ctgtgta aca cactic accoga gaggaaaaag 222 O gcttct coac aac CtcCt CC tccagttctg atgaggcacg cctgcctitct c cc ct coaag 228O tgaatgagtt tccagotaag Cctgatgatg gaagggcctt Ctccacaggg acacagtctg 234 O gtgcc.ca.gac t caaggcctic cagcc actta titt coatgga titc.ccctgga Catattocca 24 OO tggtag actg tgacacagct gagctggc ct attittggacg tgttgaggatg tggatggagg 246 O tgatgaaaac CaCCCt at Ca t cagttagga ttaggitt tag aatcaagtict gtgaaagtict 252O cctgitat cat ttcttggitat gat cattggit atctgat atc tgtttgcttic taaaggttt c 2580 actgttcatg aatacgtaaa Ctgcgtagga gagaac aggg atgctat citc gctago cata 264 O tattittctga gtagcatata taattittatt gctggaatct act agaacct totaatcCat 27 OO
ggcatcagga aaggaagatg taagaagcta aaatgaaaaa tagtgttgtc.c 276 O atgcaaaaaa aaaaa. 2775
<210s, SEQ ID NO 2 &211s LENGTH: 630 212. TYPE : PRT <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 2
Met Glu. Thir Thr Pro Leu. Asn. Ser Gln Lys Glin Lell Ser Ala Cys Glu 1. 1O 15
Asp Gly Glu Asp Cys Glin Glu Asn Gly Val Lieu. Glin Wall Wall Pro 25
Thir Pro Gly Asp Llys Val Glu Ser Gly Glin Ile Ser Asn Gly Tyr Ser 35 4 O 45
Ala Wall Pro Ser Pro Gly Ala Gly Asp Asp Thr Arg His Ser Ile Pro SO 55 6 O
Ala Thir Thir Thir Thir Lieu. Wall Ala Glu Lieu. His Glin Gly Glu Arg Glu 65 70 7s 8O
Thir Trp Gly Llys Llys Val Asp Phe Lieu. Luell Ser Wall Ile Gly Tyr Ala 85 90 95
Wall Asp Luell Gly Asn Val Trp Arg Phe Pro Tyr Ile Tyr Glin Asn 105 11 O
Gly Gly Gly Ala Phe Lieu. Lieu Pro Tyr Thr Ile Met Ala Ile Phe Gly 115 12 O 125
Gly Ile Pro Leu Phe Tyr Met Glu Lieu Ala Lieu Gly Glin Tyr His Arg 13 O 135 14 O
Asn Gly Ile Ser Ile Trp Arg Lys Ile Cys Pro Ile Phe 145 150 155 160
Ile Gly Ala Ile Cys Ile Ile Ala Phe Tyr Ile Ala Ser Tyr Tyr 1.65 17O 17s
Asn Thir Ile Met Ala Trp Ala Lieu. Tyr Tyr Lieu. Ile Ser Ser Phe Thr 18O 185 19 O
Asp Glin Luell Pro Trp Thr Ser Cys Lys Asn. Ser Trp Asn Thir Gly Asn 195 2O5 US 8,697,361 B2 85 86 - Continued
Thir Asn Tyr Phe Ser Glu Asp Asn Ile Thir Trp Thir Luell His Ser 21 O 215
Thir Ser Pro Ala Glu Glu Phe Thir Arg His Wall Lell Glin Ile His 225 23 O 235 24 O
Arg Ser Gly Lell Glin Asp Luell Gly Gly Ile Ser Trp Glin Luell Ala 245 250 255
Lell Ile Met Lell Ile Phe Thir Wall Ile Phe Ser Ile Trp 26 O 265 27 O
Gly Wall Lys Thir Ser Gly Wall Wall Trp Wall Thir Ala Thir Phe Pro 27s 285
Ile Ile Luell Ser Wall Lell Luell Wall Arg Gly Ala Thir Luell Pro Gly 29 O 295 3 OO
Ala Trp Arg Gly Wall Lell Phe Luell Pro Asn Trp Glin Luell 3. OS 310 315
Lell Glu Thir Gly Wall Trp Ile Asp Ala Ala Ala Glin Ile Phe Phe Ser 3.25 330 335
Lell Gly Pro Gly Phe Gly Wall Luell Luell Ala Phe Ala Ser Tyr Asn 34 O 345 35. O
Phe Asn Asn Asn Glin Asp Ala Luell Wall Thir Ser Wall Wall Asn 355 360 365
Met Thir Ser Phe Wall Ser Gly Phe Wall Ile Phe Thir Wall Luell Gly 37 O 375
Tyr Met Ala Glu Met Arg Asn Glu Asp Wall Ser Glu Wall Ala Asp 385 390 395 4 OO
Ala Gly Pro Ser Lell Lell Phe Ile Thir Tyr Ala Glu Ala Ile Ala Asn 4 OS 415
Met Pro Ala Ser Thir Phe Phe Ala Ile Ile Phe Phe Lell Met Luell Ile 425 43 O
Thir Luell Gly Luell Asp Ser Thir Phe Ala Gly Luell Glu Gly Wall Ile Thir 435 44 O 445
Ala Wall Lel Asp Glu Phe Pro His Wall Trp Ala Lys Arg Arg Glu Arg 450 45.5 460
Phe Wall Lel Ala Wall Wall Ile Thir Phe Phe Gly Ser Luell Wall Thir 465 470
Lell Thir Phe Gly Gly Ala Wall Wall Lys Luell Lell Glu Glu Tyr Ala 485 490 495
Thir Gly Ala Wall Lell Thir Wall Ala Luell Ile Glu Ala Wall Ala Wall SOO 505
Ser Trp Phe Gly Ile Thir Glin Phe Arg Asp Wall Glu Met 515 525
Lell Gly Phe Ser Pro Gly Trp Phe Trp Ile Cys Trp Wall Ala Ile 53 O 535 54 O
Ser Pro Lel Phe Lell Lell Phe Ile Ile Ser Phe Lell Met Ser Pro 5.45 550 555 560
Pro Glin Lel Arg Lell Phe Glin Tyr Asn Tyr Pro Trp Ser Ile Ile 565 st O sts
Lell Gly Tyr Cys Ile Gly Thir Ser Ser Phe Ile Ile Pro Thir Tyr 585 59 O
Ile Ala Tyr Arg Lell Ile Ile Thir Pro Gly Thir Phe Lys Glu Arg Ile 595 605
Ile Lys Ser Ile Thir Pro Glu Thir Pro Thir Glu Ile Pro Gly Asp 610 615 62O
Ile Arg Luell Asn Ala Wall 625 630
US 8,697,361 B2 91 92 - Continued <210s, SEQ ID NO 18 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Homo Sapiens
<4 OOs, SEQUENCE: 18 caagcc cago gtgattaa.ca to 22
SEQ ID NO 19 LENGTH: 18 TYPE: DNA ORGANISM: Homo Sapiens FEATURE: NAMEAKEY: misc feature LOCATION: 12 OTHER INFORMATION: n = c or a
<4 OOs, SEQUENCE: 19 citttctittgc cnt catct 18
What is claimed is: morphism serotonin transporter-linked polymorphic region 1. A method of treating an alcohol-related disease, com 5-HTTLPR; (b) determining whether a patient has the G prising: administering an antagonist of the serotonin receptor 25 allele or is homozygous for the Tallele of the single nucle 5-HT3 to a patient known to have the LL genotype of func otide polymorphism rs1042173 of the serotonin transporter tional polymorphism serotonin transporter-linked polymor gene SLC6A4; and (c) administering an antagonist of the phic region 5-HTTLPR of the serotonin transporter gene serotonin receptor 5-HT3 to the patient if the patient is found SLC6A4 and known to have the TT genotype of the single to have the LL genotype and the TT genotype so as to treat an nucleotide polymorphism rs1042173 of the serotonin trans 30 alcohol-related disease. porter gene SLC6A4. 14. The method of claim 13, wherein the 5-HT3 antagonist 2. The method of claim 1, wherein the 5-HT3 antagonist is is ondansetron. ondansetron. 15. The method of claim 13, wherein the alcohol-related 3. The method of claim 1, wherein the alcohol-related disease is alcohol dependence. disease is alcohol dependence. 35 4. The method of claim 1, wherein the patient suffers from 16. The method of claim 13, wherein the patient suffers early onset alcoholism. from early onset alcoholism. 5. The method of claim 1, wherein the patient suffers from 17. The method of claim 13, wherein the patient suffers late onset alcoholism. from late onset alcoholism. 6. The method of claim 2, wherein the ondansetron is 40 18. The method of claim 14, wherein the ondansetron is administered at a dosage ranging from about 1.0 ug/kg per administered at a dosage ranging from about 1.0 ug/kg per application to about 5.0 ug/kg per application. application to about 5.0 g/kg per application. 7. The method of claim 2, wherein ondansetron is admin 19. The method of claim 14, wherein ondansetron is istered at a dosage of about 3.0 ug/kg per application or about administered at a dosage of about 3.0 g/kg per application or 4.0 ug/kg per application. 45 about 4.0 g/kg per application. 8. The method of claim 2, wherein ondansetron is admin istered at least twice a day. 20. The method of claim 14, wherein ondansetron is 9. The method of claim 2, wherein the alcohol-related administered at least twice a day. disease is alcohol dependence. 21. The method of claim 14, wherein the alcohol-related 10. The method of claim 9, wherein the ondansetron is 50 disease is alcohol dependence. administered at a dosage ranging from about 1.0 ug/kg per 22. The method of claim 14, wherein the ondansetron is application to about 5.0 ug/kg per application. administered at a dosage ranging from about 1.0 ug/kg per 11. The method of claim 9, whereinondansetron is admin application to about 5.0 g/kg per application. istered at a dosage of about 3.0 ug/kg per application or about 23. The method of claim 21, wherein ondansetron is 4.0 ug/kg per application. 55 administered at a dosage of about 3.0 g/kg per application or 12. The method of claim 9, whereinondansetron is admin about 4.0 g/kg per application. istered at least twice a day. 13. A method of treating an alcohol-related disease, com 24. The method of claim 21, wherein ondansetron is prising: (a) determining whether serotonin transporter gene administered at least twice a day. SLC6A4 of a patient has an LL genotype of functional poly k k k k k UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION
PATENT NO. : 8,697,361 B2 Page 1 of 1 APPLICATION NO. : 12/919905 DATED : April 15, 2014 INVENTOR(S) : Bankole A. Johnson
It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below:
On the Title Page:
The first or sole Notice should read --
Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 630 days.
Signed and Sealed this Twenty-ninth Day of September, 2015 74-4-04- 2% 4 Michelle K. Lee Director of the United States Patent and Trademark Office