(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) CORRECTED VERSION (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/176636 A9 6 November 2014 (06.11.2014) P O P C T
(51) International Patent C I 1/40 Moira Street, Adamstown, New South Wales 2289 C07C 279/02 (2006.01) C07C 275/68 (2006.01) (AU). C07C 241/04 (2006.01) A61K 31/4045 (2006.01) (74) Agent: WRAYS; 56 Ord Street, West Perth, Western Aus C07C 281/08 (2006.01) A61K 31/155 (2006.01) tralia 6005 (AU). C07C 337/08 (2006.01) A61K 31/4192 (2006.01) C07C 281/18 (2006.01) A61K 31/341 (2006.01) (81) Designated States (unless otherwise indicated, for every C07C 249/14 (2006.01) A61K 31/381 (2006.01) kind of national protection available): AE, AG, AL, AM, C07D 407/12 (2006.01) A61K 31/498 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C07D 403/12 (2006.01) A61K 31/44 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C07D 409/12 (2006.01) A61K 31/12 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C07D 401/12 (2006.01) A61P 31/04 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/AU20 14/000483 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, 1 May 2014 (01 .05.2014) TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, 20139015 16 1 May 2013 (01.05.2013) AU UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, (71) Applicant: NEOCULI PTY LTD [AU/AU]; 4/25-37 EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, ΓΓ, LT, LU, LV, Huntingdale Road, Burwood, Victoria 3125 (AU). MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, (72) Inventors; and TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). (71) Applicants : PAGE, Stephen [AU/AU]; 55 Campbell Street, Newtown, New South Wales 2042 (AU). GARG, Published: Sanjay [NZ/AU]; University of South Australia, City East — with international search report (Art. 21(3)) Campus, Frome Road, Adelaide, South Australia 5001 (AU). KEENAN, Martine [AU/AU]; Epichem Pty Ltd, (48) Date of publication of this corrected version: Murdoch University Campus, 70 South Street, Murdoch, 18 December 2014 Western Australia 6150 (AU). MCCLUSKEY, Adam [AU/AU]; 405 Warners Bay Road, Charlestown, New (15) Information about Correction: South Wales 2290 (AU). STEVENS, Andrew [AU/AU]; see Notice of 18 December 2014
<
(54) Title: COMPOUNDS AND METHODS OF TREATING INFECTIONS o (57) Abstract: The invention provides compounds of Formula (I), and methods of treating or preventing a bacterial infection in a subject using a compound of Formula (I). The invention also provides the use of a compound of Formula (I) in the manufacture of a medicament for the treatment of a bacterial infection in a subject. The invention further provides a medical device when used in a method of treating or preventing a bacterial infection in a subject and to a medical device comprising the composition of the inven tion. COMPOUNDS AND METHODS OF TREATING INFECTIONS
TECHNICAL FIELD
[0001] This invention relates to compounds of Formula !, methods of treating or preventing a bacteria! infection i a subject using a compound of Formula , the use of a compound of Formula i in the manufacture of a medicament for the treatment of a bacteria! infection in a subject, and medical devices when used in a method of treating or preventing a bacterial infection in a subject.
BACKGROUND ART
GG2 ] A marked increase i prevalence of multi-drug resistance in disease-causing Gram- positive (G V ) (Staphylococcus a , Ent&rococcus spp. and Streptococcus p and Gram negative G~ve) pathogens {Escherichia iil , Eni&robacier spp., Salmonella spp., Acin&tobact&r a nii Klebsiella pneumoniae and Ps r as aeruginosa) has coincided w t an unprecedented global decline in investment in new anti-infective drugs. There are few currently registered alternatives for multidrug resistant (MDR) bacteria! infections, forcing clinicians to consider older generation drugs such as o stin with narrow spectrum and considerable potential for toxic side-effects. addition, there are fewer novel classes of n fe tive therapeutics moving through the drug development pipeline.
[0003 Since the year 2000, a period of almost S years, only 5 novel mode of action (MOA) antibacterial agents have been approved by the US FDA - ine o id (an oxazoiidinone) in 2000, daptomycin (a ipopeptid in 2003, retapa n (a p orn il n in 200 , fidax cin (a
macro i tia u icin) in 20 , and b daqui ine (a diarylq in i n ) in 2012. Notably, none of these agents has slghficianf activity against gram negative bacteria. No novel MOA antibacterial agents were approved in 20 and to date in 2014 only tedizoiid and daibavancin, both analogs of classes, have been recommended for approval in the US. While there ar mor than 300 anti-infective medicines in various stages of development, th large majority of these medicines are previously approved antibacterial compounds or their derivatives that are undergoing studies for new indications.
[0004] Furthermore, the prevalence of muStldrug-resistance in a ma -specifi pathogens together with greater regulation of th registration and usage of antimicrobials in animals, has caused veterinarians to become increasingly reliant on the traditional classes of antimicrobial agents. The risk of transfer of I DR zoonotic organisms from animals to humans has also led t calls for further restrictions on the usage som¾ recently registered ani ib fe i drugs such as the fluoroquinolones and the third and fourth generation cephalosporins.
RECTIFIED SHEET Rule 91) JSA/AU Epidemiology of antibacterial resistance development in pathogens of humans and animals
}5| Much of the evolution n resistance development Is driven by changes in the epidemiology of key D organisms. Once only restricted to human hospitals and aged care facilities, mefhieiliin resistant Staphylococcus aureus RSA) strains are now being isolated from the community in alarming proportions. Furthermore, community-acquired R A strains a more k y to carry the Pant n Vaia ine l uk cidin PVL) toxin, a virulence factor linked t skin and soft tissue lesions as well a a rapid, fulminating, necrotizing pneumonia with significant associated mortality. Recently RSA strains have become host-adapted in several key animal species including livestock, horses and companion animals and regular cases of man-to nima and animal~to~human transfer are being documented. This has important consequences for strain transmission and public health. A recent survey of 51 Australian veterinarians for MRSA nasal carriage found that a remarkable 21.4% of equin veterinarians S positive compared to 4.9% of s all animal veterinarians 0.9% of veterinarians with little animal contact These ecological shifts of RSA together with the emergence of resistance to new drugs developed specifically tor IVIRSA such as linezotid, confirm that new MRSA nt -infe ti es are urgently needed. Furthermore, hospitals that use vancomycin for treating RSA then have to contend with outbreaks of vanc my in-res lant enterocoeci VRE infections in their patients, once again with limited alternative antimicrobial choices.
[0006] The global emergence and spread within the community of highly virulent MDR Gram- negative (G-ve) bacteria such as E coil 02Sb:ST131 confirms that bacterial pathogens can simultaneously evolve both virulence and resistance determinants. Echoing recent MRSA epidemiology. E cols G25b ST , a major of urinary tract and bloodstream infections in humans, has now been isolated from extraintestinal infections in companion animals, and
poultry. The increasing significance of E. c 25 :ST 1 and other MDR Enf oba tari aceae with combined resistance to fluoroquinolones and extended spectrum -iac s and car penems is another worrying trend, especially considering there have been fe recent breakthroughs in tne development of G-ve spectrum nt infect s apart from incremental advances in the c rbape e family.
|0007] The World Health Organisation has identified antibiotic resistance as one of the three ajor future threats to global health, A recent report from the US Centers for Disease Control and Prevention (CDC) estimated that " n the United States, more than two miilion peopl sickened ©very year with antibiotic-resistant infections, with at least 23,000 dying as a result* The extra medical costs, in the USA aloha, associated with treating and managing a single case of antibiotic-resistant infection are estimated to b between US$18,588 and US$2 , 88 per year resulting in an overall direct cost to the US health system of over US$20 billion annually. I addition, the cost tp US households in terms of lost productivity is estimated at over US$35
RECTIFIED SHEET {Rule 9 1} SA A U billion p r annum. Twenty five thousand patients i the European Union (EU) still die annually from infection with D bacteria despite many EU countries having world's best practice hospital surveillance and infection control strategies, The EU costs fr o health care n d lost productivity associated with MDR infections are estimated to be at least €15 billion per year.
[ 8] There is an unmet clinical need for antibacterial agents with novel mechanisms of action to supplement and replace currently available antibacterial agents, the efficacy of which Is increasingly undermined by antibacterial resistance mechanisms. There additionally remains a need for alternative antibaeteriais the treatment of infection by multi-resistant bacteria. However, as reported by the Infectious Diseases Society of America and the European Centre for Disease Control and Prevention, few drugs a e being d that offer promising results over existing treatments (infectious Diseases Society of America 2010, C ini ai i f , 50{8}:1 1-1 83 .
[000 ] It Is an object of the present invention to overcome at least one of the failings of the prior art.
[0010] The discussion of the background art set out above is inte de to facilitate art understanding of the present invention only. The discussion is not an acknowledgement or admission that any of the material referred to is or was part of the common general knowledge as at the priority date of the application.
SUMMARY OF
[001 ] According to on aspect of the invention, there is provided a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof:
|0012] n one preferred embodiment, R is H, cycloalkyl, Formula II, or Formula III;
RECTIFIED SHEET Rule 91) 5SA AU P r a
wherein is H H O-CHrCH; H-GH -c ! r¾ HH CH l a ky , Formuia IV, Formuia V or Formula
V
is N C s H, or is C and A s bonded to ¾, v a R , a ring; wherein is , C, NH, CH CH -, C H )C-C,H or Formula V
For ula V
A is N C, NH, N-C -pheny , or Formula V»;
wherein A3, , As, A@, Ay, As, An, A«, , A«, A , A , A , * «, A¾, ,
A , and A re ndepe dentl C. 0 , N NH, S;
RECTIFIED SHEET Rule 91J SA AU wherein is C, O. N, N , N-C{G)~0-CHrCH 3 -C 0 } 0 CH(C )?, N-C(0)-NH-
C -CH 3 N-C{0)-NH-CHrPhenyi, -C{0 )-CH CH CH CH CH CH N-C(0)~ CH -furan-2-yl;
wherein A« i C NH, -N=CH-CH=, - CH~C( S} ; wherein A is -CH(CH )-, - H-, C (CH N-C(CHaOH)-;
is H, COOK, CH NH , CH R, CH NHNH , methyl, ethyl, propyl, b ty cy op nty , or Formula V and R are R are bonded together to form py idi , pyra in or triazine ring, or a d are bonded togethe to form a pyrr l d ny o ndol ring; wherein R is , NH, O , S or and are bonded, v a f¾, to form a trisz l ring, or R is and ¾ and R > are bonded together to form pyrimidine ring; wherein R is H, C , Br, F, OH, CH , CH SCH , CN, CCH, CF¾ OCF3, SCFs, , butyl, -b y , dimethylamino, phenyl, ?-prop , /-propyl, - H C(0 C , -
CH-CH-CQOH, piperazin-1-yi, or ? and are bonded together to form a substituted or unsubststuted, saturated or unsaturated aliphatic r ng, heterocyclic ring or benzene ring;
wherein R , R , R , R R and R ? are independently H OH, C , F, Br, CH ,
CN, CH GOGH, 0 CF R and R ? bond together to form a substituted o ns s iiuted , saturated or unsaturated aliphatic ring, heterocyclic ring, or benzene ring, R and R are bonded together to form a substituted or unsubstit ed saturated or unsaturated aliphatic r g, heterocyclic ring or e e ring, i¾ and R are bonded together to for a substituted or r su stitut d, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring, or and R are bonded together to form a substituted or un ubstitu d saturated or unsaturated aliphatic ring, heterocyclic ring or b e ring;
wherein R¾, ¾ , R , and R ¾are independently H, O , OH, C , , Br, H , CH , € F , H , CM, NOa, -NH-CH(OH)-CH , NH C G) CH , or ¾ and Rs are bonded together to form a substituted or unsubstituted, saturated o
unsaturated aliphatic ring, heterocyclic ring or b n¾ ne ring, or and R are bonded together to form a substituted or un ub il t d saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring;
RECTIFIED SHEET 8
wherein , , R , R¾,, R and are independently H, CS, or Br, or R and R are bonded g to form a substituted o unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or ring, or R and are bonded together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene g, or a d are bonded together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring;
wherein R , R and R are independently H, COOH.. CHa H CH H, methyl,
thyi propyl, butyl, cyciopentyS, or R and R are bonded together to form a yr oiidinyi oxindoSe ring;
wherein R S and R are independently H, CI, r . F, OH, CH , OCH , H , C , CF OCFs, SCF C½, GCH, buty i-butyi, dimethy a in , phenyl, n-propyi, /- propyl, H-C( -CH , -CH^CH-COOH, piper in - or R and « are bonded together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or n ring; and
wherein K is a double n or a single bond.
[0013] The compound of Formula \ is preferably a chloride salt.
| 14] In another aspect of the invention, there is provided a compound, or stereoisomer, ta om r, pharmaceutically acceptable salt, or prodrug thereof, selected from the list of compounds presented in Figure 1. Where a salt is presented in Figure 1, the invention covers both the salt presented and the freebase of that salt, and stereoisomers, tautoroers, other pharmaceutically acceptable salts, and also other prodrugs of the freebase.
[00 ] Preferably, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable sa t, or prodrug thereof,
wherein is C;
wherein i is ; or Formula Vii;
wherein A is or H;
wherein A , A«« As, A?, , A A A , am ; or C;
wherein , A , A , A , A , A and C;
wherein A . and are S;
RECTIFIED SHEET wherein A is NH; wherein is N; wherein s - -C H- -N-€(CH )-; o ~N-G(CH H
wherein is ; Formula IS; Formula Hi; e i alkyl;
wherein Rs is H; methyl; ethyl; CH2NHNH ; CH OH; butyl; cycfopentyl; or
Formula VII d R is bonded to , to form a p rn din ring;
wherein R is H ; Formula IV; Formula V; Formula VI; H¾ NH-N-GK-
y oa kyi; or 0-CH - H3; wherein ¾ is ; O; S; or R is and ¾ and R are bonded together to form a p ri mld ne ring;;
wherein R H; F; C ; CF¾ methyl; and ¾ are bonded together to form an unsufestituted, ring; OH; b ty : phenyl; dlrrtethyiarnino; /-propyl; n ~ propyl; ON; CCH; n- t S; SCH : ; R and R are bonded togeiher to form an uns bstitu d unsaturated heterocyclic ring; CH3; Br; F¾; pip ra ir -1 or SCF ;
wherein Rr,. R and are independently H; OH; F; CH ; F¾ et y ; C ; CN; Br; R and R are bonded togeiher to for an uns b titu ed, benzene ring;
R « and R are bonded together to form an bsti ut d, unsaturated heterocyclic ring; R . and are bonded together to form an n bstif t d benzene ring.; or and R are bonded together to form an unsubstituted, unsaturated heterocyclic ring;
wherein , R R S and are independently H; OH; NH ; CI; F; OCH ; OH; - NH~CH(OH)-CH ;
wherein ¾ is H; methyl; ethyl; CH H; or cy op nty ; wherein is H; F; CI CF ; methyl; R and are bonded together to fo m an
ns bst ted , nz ng; OH; ut i phenyl; dimethyiamino; /-propyl;
propyl; C ; CCH; n ty ; SCH ; and R are bonded together to form
u s b t ed unsaturated heterocyclic ring; OCH ; B ; CF3; piperazin~1~yl; or
SCF ¾;
wherein and R re independently H; OH; or ;
RECTIFIED SHEET (Rule 9 1) iSA/AU wherein F and are independently H; or OH;
wherein s H; CH ; Br; C ; OH; di min ; fe or F; and
wherein — s independently a single o a double bond.
[0018] More preferably, the compound is a compound of Formula I, or a stereoisomer, tautorner, pharmaceutically acceptable salt, or prodrug thereof, selected from the group comprising: NCLG08; MGL0G9; G G23 ; L025 N 2 ; NCL029; CL 6; C 37 ; CL 3 ; NCL040; C L05 ; CL081 NCL064; NGL085; CL 88; CL 7S; NCLG76; NCL078; NCL079; NC 1.. 8 NCL061; NCL084; NGUQ85; NCL088; NCL08B; NCLG89; C NC S2 ; N 0 GL 9 ; NC 7; CL098; CL089 NCL101; CL 4 ; NC 6 ; NCL10& NC 1 ; NCL 1; C 2; NCL ; C 115 CL 118; NCL1 18; NC 8 NCL121; C 122 ; NCL123; CL 24 ; NCL125; C L 2 ; NCL130; NCL131; NCL132; NCL133; NCL13S; C 138; CL137; N 138 ; NCL139; NC ; NCL141; NCL144; NCL145: CL 14 CL147 ; NCL148; NCL150; NCL152; NGL153; L 154; NCL158; CL 157; NCL158; C 159; NCL181; CL 182; MCL184; NCL185; NCL168; NCL167; NCL168; L 1 9; NCL170; NCL171; NCL172; MCL173; NCL174; NCL176; NCL177; C 178 NCL17S; CL 18 ; NCL181; NCL183; NCL184; NCL NC 8 ; CL1S7; NCL188; NCI. 189; NCL180; NCL193; NCL194; NCI..195; CL19 ; I CL1 7; C 1 8; CL 8; NCL200; NCL201; CL2 2; NCL203; NCL204; C 2 5; NCL206; NCL2G7; NCL208;
CL2 9 ; C L2 1 ; NCL21 ; NCL212; L2 13; CL2 15; C .2 18; C 2 17 ; L2 18; NCL218; CL22 NCL221; 222; CL223 ; NCL224; C 225 NCL226; C 227 ; C 22 ; 229; and NCL23Q.
[0017] Eve more preferably, the compound is a compound of Formula 1, or a stereoisomer, tautorner, pharmaceutically acceptable salt, or prodrug thereof, selected from the group comprising: NCL040; NCL078; L079 ; CL 8 NCL081; NCL084; NCL088; CL089 GL 7 ; C 9; CL 123 CL148 NCL157; CL 158 NCL177; L 3; NCL188; NCL183; CL 5 NCL ; C L 7; NCL199; NCL202; NGL2G4; CL205; CL 15; C 2 18; NCL217;
NCL2 ; r d NCL221.
[ ] Even more preferably, the compound is a compound of Formula , or a stereoisomer, tautorner, pharmaceutically acceptable salt, or prodrug thereof, selected from the group comprising: CL078 NCL079; N L O; NCL081; CL 84 ; NCL089; NC 97 7; NCL158; NCL179; CL 8; NCL193; L19 ; C 8 NCL189; NCL204; G 2 CL2 1 ; N L2 ; and 22 1
[00 ] Even more preferably, the compound is a compound of Formula , or a stereoisomer, tautorner, pharmaceutically acceptable salt, or prodrug thereof, selected from the group
RECTIFIED SHEET Rule 91} SA A comprising: CL089 NCL097; NCL 7; NCL179; NCL188; NCL193; NC 19 5 NCL196; NCL2 ; NCL21 : a d C L22 1.
00 20] Most preferably, the compound is compound of Fo r ula I. o r a stereoisomer,
a u m e r, p an © a lly acceptable salt, o r prodrug thereof, selected from the group comprising: CL 7 NC 1 7 179; C L 1 ; NC .13 ; and NCL198.
[0021] n one preferred embodiment o f the invention, the compound is a compound of Formula
, o r a stereoisomer, a uto m r, pharmaceutically acceptable o r prodrug thereof, wherein the compound not a compound se e c ted from the group consisting of: C 8 , C 01
C L 2 CL 3, C L 4 N C L 5 N C L , NCLQ07, NCL010, C L , C 12 , NCL 3,
NCL014, CL NCL 1 , C 17 , NCL018, LG1 , C 2 , NCL021, NCL022, MCL024,
NCLG27, NCL028, GL 3G C 3 1 NCL032 L 33 CL034, NCL03S, NCLQ38.. C 041 C 04 2 C 43, C 44 , C 4 5 , L046, r4CL047, C L04 8 , NCL049, NCL051, NCL052,
C 0 53 , NCLGS4, NCL055, N C L 5 , NCL057, LG5S, L 59 NCL080, G62 L 63
C 66 NGLQ67, G 39 NCL070, NCL071, NCL072, NCL073, NCL074, NCL077, NCLG82,
C L 8 3 C 8 7 , NCLG91, C 3 , C , NCL1 , C L 1 2 , C 1 3, NCL107, NCL109, NC 10, NCL 13, L 17 , C L 120, NCL127, GL128 NCL129, NCL134, NCL142, HCL143,
NCL149, N 151, GL 155, C 18G, CL1 3, C L 175, NCL182, NCL191, NCL192, and NGL214.
[0022] n a preferred aspect of invention, the compound of Formula I te not r d n a s
referenced in this specification G .8 and also known as ,3-bis[{£)-{4-
hlo ro p e n eth te r e a m inoj g a nid in , which has a structure as follows:
[0023] In one preferred embodiment of the invention, the compound is a compound o f Formula
or a stereoisomer, iautomer, pharmaceutically acceptable salt, o r prodrug thereof, wherein
is Formula II; |¾ is Formula IV; A t and are N A and A ¾ are NH; A , , A*, A , A , A , A , Aw, A and A , are C ; , R , , Rt , i R i R r ar H ; R is and
are C F ; and K in Formula f between A and , all Formula II and all Formula IV — K are double bonds. A example of a compound of th s embodiment of the invention includes:
RECTIFIED SHEET (Rule 9 ) ISA/AU [0024] in another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, ta orner pharmaceutically acceptable salt, or prodrug thereof, wherein ¾ is Formula ; is H ; A is N and A is NH; A , A¾, A , , a d A a e C; R¾ * , R , R?, d am H; ¾ is NH; R is CI; and — " in Formula between A and A ar d all Formula are double bonds. An example of a compound of this embodiment of the invention includes;
|0025] in another preferred embodiment of the invention, the compound is a compound of Formula i, or a stereoisomer, auto er pharmaceutically acceptable sa t, or prodrug thereof, wherein is Formula ; R is Formula V ; and A are ; A and A are NH; A , , , .·,
, Ar, , , A«/and A are C; R R& Re, R¾ ¾ R«, & , , i H; R s NH;
r and n are F; and — " in Formula between and A j , all Formula and Formula IV - are doubl bonds. A n example of a compound of this embodiment of the invention includes;
[0026] In another preferred embodiment o the invention, the compound is a compound of Formula or a stereoisomer, tautorner, pharmaceutically acceptable salt, or prodrug thereof, wherein R s Formula II; is Formula IV; A are N; A and A are NH; , , A$,
A « Ar.An, A , A ¾, A and A $, are C; R R R , R , R , R , Ris, « , R are H; R is NH;
and R are F: an — " in Formula between and all Formula II and all Formula IV K-~~ ~* are double bonds. A example of a compound of this embodiment of the invention includes;
[0027] in another preferred embodiment of the invention, the co poun s a compound of Formula i, or a stereoisomer, tautorner, pharmaceutically acceptable salt, or prodrug thereof,
wherein R - is Formula II; R is Formula IV A and A N; A and are NH; A , A¾, A*, A¾ , Α , , A , A RECTIFIED SHEET (Rute ) ISA/AU | 28J n another preferred embodiment of the invention, e compound is a compound of Formula , o a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula i R is Formula IV; A , and « are N A and A are NH; A¾, A*, R . Ae, A , , A ¾ A and A , a e C ; ¾ & R , , R ¾ R R«, , R i , R are H ; R is NH; Rs and R are GCH¾; and - i Formula i A and A... ail Formula i and a Formula IV «_ « double b nds An example of a compound of this embodiment of th invention includes: [0029] In another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R , is Formula II; R is N H ; Is N ; is NH; A¾, As, A*, , , and A are C; t¾, R , R , Rs an ¾ are H; is NH; R Is ; and ~ n Formula between and Α . . and all Formula I S are double bonds. An example of a compound of thi embodiment of th invention includes: [0030] In another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, whorein R is Formula II; i¾ Is Formula IV and A are ; a d » are NH; , , , As, Ae, A , A , A , A , , and A , are C ; ¾ . R » , , R , R , R13, R t are H; * i NH; R ? and R ¾ ar CF¾ an *— in Formula between A and i , all Formula II and Formula I " are doubte bonds. A n example of a compound of this embodiment of the invention Includes: RECTIFIED SHEET (Rule 91) iSA/AU [0031] n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tauto e pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula II; R Is Formula V ; A a d A are N; A and A are NH; A¾ A A ., A¾ , A r An, A ¾ A . A, and A S, are C R , R , ¾ , ¾, R , R R ¾ R , R R are H; ¾ is NH; R and R are methyl; and — n Formula I between and all Formula and Formula V -— are double bonds. An example of a compound of this embodiment of the invention includes: 32 another preferred embodiment of the invention, the compound is a compound of Formula or stereoisomer, aut mer pharmaceutically acceptable salt, or prodrug thereof, ts r i is Formula I ; Is Formula V; A and A are N; A and A are NH; A& A , , A¾ A¾, A . A and A are C; R¾ R ¾ R , R , R , , ¾ i , 1.7 H; ¾ i NH; Rs and R are methyl; and n Formula between and A-,, all Formula i and Formula IV *— " are double bonds. An l of a compound of this embodiment of the invention includes: [0033] In another preferred embodiment of the invention, the compound is a compound of Formula f or a stereoisomer, iautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula II; R Is Formula IV; A and A are N A a d are NH; Α¾ A , As, As, A?, A , i A 3 , and A«, are C; R , R& e Rr, Rg, , ¾ s, n R are ; is NH; and R ar methyl; and In Formula between and A all Formula and Formula IV are double bonds. An example of a compound of this embodiment of the invention includes: [0034] in another preferred embodiment of the invention, the compound is a compound of Formula or a stereoisomer, tautomer. pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula f; R is H ; A is N; A NH; A©, A3, A , A¾ and A are C ; ¾ R * * Rs, a d are ; » is NH; R? is C F¾ and "— in F r u I between A and A and al Formula RECTIFIED SHEET Rule 9 1 ISA/AU I are double bonds. An example of a compound of this embodiment of the invention includes: [00351 n another p e re embodiment of the invention, the compound is a compound of Formula or stereoisomer, ta omer pharmaceutically acceptable sail, or prodrug thereof, wherein - is Formula 1; ¾ is NH¾ is N A is NH; A , A , A*, , and A ? are C; ¾ ¾ R R , a d R§ are H; ¾ is NH; f¾ s CF an in Formula between A and and all Formula I are double bonds. An example of compound of this embodiment of the invention includes: [0Q3 another preferred embodiment of the invention, the compound is a compound of Formula f or stereoisomer, taytomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula II; R is NH is N; A is UH; , , , , and A are C; R , % R * F and R are H; i¾ is NH; R? is methyl; -- in Formula I between an A and all Formula II are double bonds. A n example of a compound of this embodiment of the invention includes: 0 37] n another preferred embodiment of the invention, the compound is a compound of Formula l or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula i ; R is NH ; , is N; A is NH; A A», , A ¾ and A are C; R¾ R& e ?, and. ¾ are H; ¾ is NH; ¾ is C ; and *— in Formula i between and and all Formula are double bonds. A n example of a compound of this embodiment of the invention includes; RECTIFIED SHEET Rule 9 1) ISA AU [0038 In another preferred embodiment of the invention, the compound is compound of Formula or a stereoisomer, ta t m , pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula ; R is Formula iV; a d A are N; A a d A are NH; A , A , A A , A7, A , A , A a d A , are C ; R ¾ , R , ¾ R , R 1 R« R are H; s NH; and are CI; and n or ula between A¾ and * all Formula i and Formula IV are double bonds. An example of a compound of this embodiment of the invention includes: [0039] another preferred embodiment of the invention, the compound s e compound of Formula I, or stereoisomer, tauiorner, pharmaceutically acceptable salt, or prodrug thereof, Wherein R . is Formula II; R s Formula IV; A and A are N; A and A are NH; A , Aa, A Ag, , A ?, A , A ¾ A > A an A are C; R and R methyl; R§, R , Rg, R R . R , R , R are B; is NH; R and R ar CF ; and "~— n Formula between a d , all Formula and Formula IV — are double bonds. An example of a compound o this of the invention includes: 4 ] Irs another preferred embodiment o the invention, the compound s a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula ¾ R is Formula V ; and ¾ ; A ¾ and As are NH; , , , A , , A ¾ and A , are C; R and « are methyl; R , R , R , ¾ R , R R a d i are H: NH R a d R S are I; end " in Formula between and At , all Formula II a d Formula IV are double bonds. An example of a compound of th s embodiment of the invention includes; 004 1] In another preferred embodi en of the invention, the compound a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R - is Formula ; R is H H¾ Is ; ≥ s NH; , A * , A¾, a e C; R methyl, R , R R and R are H; is NH; R is C ; and in Formula between A and , RECTIFIED SHEET (Rule 9 1) ISA/AU and a l Formula " are double bonds. An example of a compound of this embodiment of the Invention Includes: [0042] In another preferred embodiment of the invention, the compound is compound of Formuia , or stereoisomer, tau o pharmaceutically acceptable ai , or prodrug thereof, wherein Formuia II; s Formula iV; A and are N; A a d A are NH; A , , *, A , A , An, , A , A A , are C; R R , , R , R¾, R , R , R & R , a d R are H is S; and R are C ; and — in Formula I between and , all Formula I and Formula IV ~- ···" are double bonds. An example of a compound of this embodiment of the invention includes: [0043] In another preferred embodiment of the invention, the compound is compound of Formula , or a stereoisomer, a st mer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula II; R is NH ; is ;A s NH; A¾ A3, A , A ¾ A , and A are C; R R , R Rs, and are H; ¾ is NH; R ? is C ; and in Formula between A a d A . and all Formula II — double bonds. An example of a compound of this embodiment of the invention includes; [0044] in another preferred embodiment of the invention, the compound is a compound of Formula I, or a stereoisomer, a t r, pharmaceutically acceptable salt, o prodrug thereof, wherein is Formula i ; ¾ is H A is ; A is H; A , As, A As. A , and A are C; R i methyl; , , , R » are H; is NH; is CF ; and "— in Formula f A end A , and all Formuia i are double bonds. An example of a compound of this embodiment of the invention includes; RECTIFIED SHEET (Rule 9 1) SA AU | 45] In another preferred embodiment of the invention, the compound is a compound of Formula \, or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug h reof, wherein R is Formula ; R is Formula V; A , a d A are A a d A are NH; , A A*, A , As, A A A , , A and A , are C; R¾ s, . R», , R , R ¾ Rw , and R are H; R , is NH; R?. ¾ and ? are Ci; and " in Formula \ between A d A , all Formula I and Formula "-— are double bonds. An example of a compound of this embodiment of the Invention includes: [004 another preferred embodiment of the invention, the compound is a compound of Formula I, or a tautomer, pharmaceutically acceptable sa t, or prodrug thereof, wherein is Formula II; R is Formula IV A and A are ; A and A ¾ are NH; A , , A*, A . , A , , A . An, A and A , are C; R , R R & R», R R , R , d R are H; R is NH; R ? is Ci; GF R is F and * — in Formula between A and , all Formula II and Formula SV "— ¾ are double bonds. An example of a compound of this embodiment of the invention includes C 78) 0047 in another preferred embodiment of the invention, the compound is compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula I ; is Formula SV; A and A are ; A and are NH; , A¾ A*, A , Α A , , 2, , A and ί are C; R , Rs, , ¾ , , R12, R S, , and R ar H; is t NH; ? Ci; is F; and in Formula between A and i , a l FomiuSa and Formula IV " - are double bonds. An example of a compound of this embodiment of the invention includes CL 79) [0048] n another preferred embodiment of the invention, the compound is compound of Formula , o a stereoisomer, tautomer,. pharmaceutically acceptable salt, or prodrug thereof, RE T !F ED SHEET Rule 9 1) iSA/AU wherein R s Formula ! ; R is Formula IV; A a d A are N; A a d are NH; A¾ A , A*, , Ae, A A , , A ¾ and A , are C; R , R R , R , R R 3 , R , « and R are H ; is NH; s CI; « methyl; R * is CF ; and in Formula A a d A all Formula i! d Formula V " are double bonds. A n example of a compound of th s of the invention includes NGL 8 ): f 4 in another preferred embodiment of the invention, the compound is a compound of Formula L or a stereoisomer, t to er pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula IS; R is Formula IV; A are N; A and A are NH; A , , * , , A , , , , A and , C ; , Rs s. R , R13, R-«, R sand R 7 are H ; R is NH; R and R . C ; is methyl; and n Formula and A all Formula and Formula IV bonds. A n example of a compound of this embodiment of the invention includes; j n another preferred embodiment of the invention, the compound is a compound of Formula or a stereoisomer, tsutomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula ; Formula IV; a d are N A and are NH; A¾ A¾ *, As, Αβ·, A?, , 2, An, a d A are C ; z, Rs, ¾ , Rs, R«, R ?, is and are H Is NH; a d R are C ; and "— in Formula I between and A i all Formula and Formula IV ··· ·" are double bonds. An example of a compound of this embodiment of the invention Includes: 00 1] n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R, is Formula I; R is Formula IV; A A N; A and A are NH; , Α ·, *, Α , A , , An, and Ai are C; R¾ , R¾ $, s, Ria, R , and ½ are H; ¾ is NH; R -and is are ; is F; and -— in Formula 1between n At, all Formula I and Formula RECTIFIED SHEET (Rule 9 1) ISA/AU V — are double bo ds. An example of a compound of this embodiment of t e invention includes (NCLQ84): [ 62] I another preferred embodiment of the invention, the compound s a compound of Formula i. or a stereoisomer, a er, pharmaceutically acceptable salt, or prodrug thereof, Α wherein is Formula II; Formula IV; A, and A are N; and are MH; ¾ A », Α ≤ A ,. 2 ¾ and A , are C; R2, R , R , R ¾ , , ¾ R S, i and R re H; R « I NH; C ; is C ; and "— n Formula between A and A t , a l Formula II and Formula IV are double bonds. An example of compound of this embodiment of the invention includes: [00631 another preferred embodiment of the invention, th compound is compound of Formula i, or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R Formula t ; R is Formula IV: Ai and A are N; A and are NH; , , , As, A?, , A , and A , are C ; , R5, R¾, Rs, R¾ R > ¾ R14, and are H; R is. NH; is ; R is F; and — * in Formula e and A all Formula I end Formula IV ~ K are doubl bonds. An example of a compound of this embodiment of the n e n includes: |0054 in another preferred embodiment of the invention, the compound is a compound of Formula I, or a stereoisomer, tau ome . pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula f; R is Formula IV; A and are N ; Az and A are , A , A , Α , Aj, A , · ¾ and « , are G; R and R are methyl; R , , R , R , R R , R , and a H ; Is s ; R S is CF ; an "— " Formula between A ¾ and A a l Formula II and Formula I —- are double bonds. An example of compound of this embodiment of th invention includes CL08 ; RECTIFIED SHEET Rule 91} iSA/AU [0055] in another preferred embodiment of the invention, the compound is a compound of Formula !.„ or stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, Α is Formula ; ¾ Formufa IV; are N ; A and A are NH; & A¾ A*, A , , , i - . and i , are C ; R¾ f¾, R , R , R , , R are H ; NH; R and are bonded together to for an un ubst t ed benzene ring; R and R are bonded together to for a ns b ist t , benzene ring; and " ~ - in Formula ί between and A , aii Formula Si and Formula SV are double bonds. An example of a compound of this embodiment of the invention includes; [0058] in another preferred embodiment of the invention, the compound s a compound of Formula , or a stereoisomer, a io r, pharmaceutically acceptable salt, or prodrug thereof, wherein A C; A t i N is NH; R is c o ex ; F¾ is ¾ NH; R i H and — " in Formula i between and is a double bond. A example of o of this embodiment of the invention includes: [0057] in another preferred embodiment of the invention, th compound s a compound of Formula , or a stereoisomer, faut er, pharmaceutically acceptable salt, or prodrug thereof, e s Formula II; R is Formula A d A« are A and A NH; , A& , As, , Ar, , A , An, w and A , are C; R R & R¾ R , R and R are H; Ft, is NH; & R , F R , an R are OH; and - in Formula j between and A,, all Formula II and Formula IV - — are double bonds. An example of a compound of this embodiment of the invention d C L 7 ): RECTIFIED SHEET (R l 1) S A A U =00581 In another preferred embodiment of the invention, the compound is a compound of Formula I or a stereoisomer, tautomer, pharmaceutically acceptable sait, or prodrug thereof, wherein is Formula !!; Is Formula IV; A and A are N; A and A are NH; A% A 3 A*, , , A?, ¾ A and A are C; , ¾ R , Rg, R½, R , R , R a d R 7 are H ; R is R and are ~ uf ; a d i Formula 1between a d A a l Formula II and Formula are double bonds. A n example of a compound of this embodiment of the invention includes; [0059 n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer,. pharmaceutically acceptable sa t or prodrug thereof, wherein R Formula ; i Formula IV; and A e N; ? and are NH; A¾ A& A As, , , A A ¾ w are G; R , R , , R&, R , Ri , R and R S are H; R »is NH; Rs, Re, and R OH; a d — in Formula 1between A and A a Formula II and Formula "— " are double bo ds. A n example of a compound of this embodiment of the invention includes; ( 05 1 n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula I; R is Formula V ; A and A are A and A are NH; A©, A *, A Α ¾., A A » A , A and A are C; , RS & R«, and R are H; » lis NH; R R R¾ , ¾ are OH; and — n Formula between and A , a l Formula II and Formula V '---·" are doubte bonds. A example of a compound of this embodiment of the Invention includes: [0061] In another preferred © b d ent of the invention, the compound is compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, RECTIFIED SHEET (Rule 91) SSA/AU wherein R is Formula ; is Formula IV; A a d A are N ; A a d A are NH; A , , A , A , A A , A , A and A , , are C; R , R , R , R«, , and ? are H is NH; R , e, R * R , and R are OH; and — " n Formula ! w A and A a!l Formula S and Formula ' ' bonds. Ars example of a compound of this embodiment of th invention includes (NCL097): [0082 n another preferred embodiment of the invention, the compound is a compound of Formula . or a stereoisomer, iaui r, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula ; R 3 is Formula IV; A , and A re N.; A a d A are NH; A , A , A*, A , , A , A , A«, A , A and A , are C; R , R i R Rg, , R , R , R , and R are H; is NH; R arid - are OH; and ~ in Formula between and A all Formula ! and Formula IV " are double bonds. An example of a compound of this embodiment of the invention | 3 In another preferred embodiment of the invention, the compound is a compound o Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, ¾ r n is Formula I; R is Formula IV; A and i are ; and A* are H ; , , A4,, , s, A7 , A*?., i A14 and A15, are C; R , R , R , R¾ R 1 , R 3> R , and are H; is NH; F¾ and R fc are OH; an i Formula between and i , al Formula and Formula IV *— are double bonds. A n example o a compound of this embodiment of the invention includes: 0064 n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R , is Formula I ; is Formula V ; and A are A and A* are NH; ¾ , A*, A , , A , A«, A < , A « and A , C; R , R , F¾ R«, R , , and R 7 are H; R is NH; ¾ RECTIFIED SHEET (Rule 9 1) ISA'AU , R and are OH; and in Formula 1between Α and A^, a Formula II and Formula a e double bon s An example of a compound of this embodiment of the invention includes: [0065] In another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula II; ¾ is Formula V; and A a e N; A and A are NH; , A3, A*, , Α A ¾ A?, A , A A ¾ · and A , are C; R , R , R R ¾ , R ¾ R , R , R , and R are H; R s NH; R and R are phenyl; and — " in Formula I between A and A all Formula and Formula IV —- are double bonds. An example o a compound of this embodiment of the invention includes: [ 8] n another preferred embodiment of the invention, the compound is a compound of Formula I, or a stereoisomer, tauiomer, pharmaceutically acceptable salt, or prodrug thereof, Α wherein R - is Formula II; is Formula IV; and A are N; and A are NH; A¾ , A& Α , , A , A , A and , C; R¾, R R , @, R», R R , R1 , R , and R a e H; is NH; R and R are di ethyl ino; and '-~~ n Formula I between Q and A all Formula II and Formula IV " are double bonds. An example of a compound of this embodiment of the | 67] n another preferred embodiment of the Invention, the compound is a compound of Formula l or a stereoisomer, a to er pharmaceutically acceptable sa t, or prodrug thereof, wherein is Formula II; R is Formula IV; A, and A ar : A and A are NH; , A A*, A Ag, A , , A 2, i , A and ¾ are C; F , R , R , R , R , R , , and R are H; ¾ is NH; R and are CH R and R are OH; and * In Formula I between A and A a l Formula II RECTIFIED SHEET Rule 9 1} SA U a d Formula V "- a e double bonds. A example of a compound of this embodiment of the invention includes: [0068] in another preferred embodiment of the invention, the compound is a compound of Formula , o r stereoisomer, tautofrser, pharmaceutically acceptable salt. or prodrug thereof, Α wherein ¾ is Formula IS; R s Formui V ; a d are N; and A are NH; A , A , A& A , A?, A , i , 3 A and A , ar¾ C; ¾ , R , Re, R», i¾ R« i , and R are H; ¾ s NH; R and R¾ are /-propyl; an · in Formula between and .Ai, all Formuia f and Formuia IV are double bonds. A n example of a compound of this embodiment of the invention includes: 06 ] In another preferred of the invention, the compound is compound of Formula , or a stereoisomer, tauforner, pharmaceutically acceptable salt, or prodrug thereof, wherein R, is Formula ; R3 is Formuia V ; A s and A N; A A are NH; A , A , A*, s, s, A«, A, , A , and A , are C ; R , R¾ R , R , R R 3, R 4 R , and R are H; ¾ is NH; R and R are n-propyi; and " i n Formula I between and l Formula II and Formuia IV " are double bonds. An exa pl of a compound of this embodiment of the invention includes: C5 7 ] n another preferred embodiment of the invention, the compound is a compound of Formula , o a stereoisomer, tautomer. pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula II; R Is Formula V ; and i ere N and A are NH; As, A& , , A , AM, & A and A S, are C ; R , Rs, Re, Rs, R«, R13, and R, are H NH; , R? and R are F; and in Formula between d A . all Formula i! and Formuia IV — double bonds. An example of a compound of this embodiment of the invention includes: RECTIFIED SHEET (Rule 9 1) ISA AU [0071 i another preferred embodiment of the invention, the compound is a compound of Formula , o a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, Α wherein , is Formula IS; R Formula IV; A a d A are : A and A s are NH; & , A¾ , A , , A ¾ A and A , are C; ¾ R , e, Re, R¾, ¾ i , R« and R are H; » NH; and are CGH; and in Formula between and A,, all Formula and For ul IV are double b nds An example of compound of this embodiment of the invention includes: [0072] n another preferred embodiment of the invention, the compound is a compound of Formula I, or a stereoisomer, tautomer, pharmaceutically acceptable sa t, or prodrug thereof, wherein s Formula II; is Formula I ; A and A are N; A and A are NH; A , , A,, A¾ Α Α , A A , A and δ , a e C; R > R R , R , 3, R , R ar ; NH; R and are Br; and *— in Formula between and all Formula I and Formula IV are double bonds. An example of a compound of this embodiment of the invention includes: [0013] In another preferred embodiment of the invention, the compound a compound of Formula I, or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula I; F is Formula IV; and A are N; A and A are NH; , A¾, A As, , A , A , A A 3 , A and A are ; R , R« Re, R , , R«. R . R«» Rte. a d R , are H; is NH; R and are butyl; and n Formula between and A , all Formula II and Formula IV — are double bonds. A n example of a compound of this embodiment of the invention includes: RECTIFIED SHEET (Rule 9 1) 1SA A U [0074] n another preferred embodiment o f th invention, the compound is a compound of Formula 1, o r stereoisomer,, lautomer, pharmaceutically acceptable salt, o r prodrug thereof, wherein is Formula I; s Formula IV; is -C(C eH )-CH~N- and A is ~- H and A are NH; A , A*, , A ¾ A«, A , A A , « and A , are C ; R R¾, R& R R ¾ - fi and are H ; s NH; * in Formula i between and , Formula I d Formula V — are double bonds. A example of a compound o f this embodiment of the invention includes: |00?5] In another preferred embodiment of the invention, the compound is compound of Formula , o r stereoisomer, lautomer, pharmaceutically acceptable salt, o r prodrug thereof, wherein s Formula 1; is Formula V ; A a d N ; A and A are NH; A ¾ A ¾ *, s, A A , Α , A«, and i , are C R¾, , Rs, R , R ¾ « , « , R 4 , R , and R R is H ; R and R are H S : and in Formula i between and , all Formula 0 and Formula ffi ._ double bonds. A n example of a compound o this embodiment of the invention includes; [0076] i n another preferred embodiment of the invention, the compound is a compound of Formula , o r stereoisomer, lautomer, pharmaceutically acceptable salt, o r prodrug thereof, wherein R Is Formula 1; is Formula V ; A is C ; ¾ H ; A and A are .; A and are NH; and A are S ; R is NH; and are bonded together to form a substituted benzene ring; ¾ and are bonded together to form a substituted benzene ring; a n -"- in Formula I between Av, and , and ail Formula ill and Formula V — ~i are double bonds. A n example o f a compound of this embodiment of invention includes: RECTIFIED SHEET (Ruie 9 1) !SA AU 28 [00 ] In another preferred embodiment o th invention, t compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is Formula If; s Formula IV; A a d A are N; A and A are H; A ¾ As, A*, ¾ A?, A , i , , and A ,s , re C d R are methyl; , R , 7, R , R¾ ¾ , ¾. and are H; is NH; a d "— " n Formula between and A , a l Formula and Formula IV — * are double bo ds An example of a compound of this embodiment of the Invention includes: [0078] in another preferred embodiment of the invention, the compound i compound f Formula I, or stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, is Formula II; is Formula IV·; d « are ; A end A are NH; A©, A ¾ A*, A&, A@, Ar, A«, A , A,¾, A d Ai§, are C; R , R , Rs, R , R s, R13, a d are H; ¾is NH; R and are bonded together to form an ur substitu ed heterocyclic ring; R . are bonded together to form an r bst ted, unsaturated heterocyclic ring; and — ' i Formula between and A ai Fonrsula I and Formula I are double bonds. An exampl of a compound of this embodiment of the invention includes: [0079 in another preferred embodiment of the invention, the compound is a compound of F rm a , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula ; R is Formula V ; is CH-CH a d ¾ js - N~(C H ) ; A and A are NH; A , , A As, , , A , A A , C R , Rs, & R¾, Re, R12, w, a d R are H; ¾ Is NH; R7 and are CH ; and in Fon ula between A and A , all Formula il a d Formula V — ere double bonds. An example of a compound of this embodiment of the invention includes: RECTIFIED SHEET (Rule 91) ISA AU [0080] in another preferred embodiment of the invention, the compound is a compound o Formula , or a stereoisomer, tau mer, pharmaceutically acceptable salt, or prodrug thereof, wherein ¾ is Formula II; R is Formula V; A and A N; and A are NH; , , , A¾. , A?, A , . 3 A and A , are C; R R , R & R ¾ « , R , R , , and R are H; NH; a d are OH; and "—· in Formula I between and A all Formula and Formula IV » double bonds, An example of a compound of this embodiment of the invention includes: [0081] n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, ≤ wherein R is Formula I; R is Formula IV; A and A are N; a d A are NH; , A¾ A*, , A , , and ¾ , are C; R and R a e ethyl; R R , R¾, R R , R , and R are H; is NH; R and R are C ; and *— in Formula between and A ll Formula II and Formula are double bonds. A n example of a compound of this embodiment of th invention includes: 0 2 1 another preferred embodiment of the invention, the compound is a compound of Formula 1, or stereoisomer, taut me , pharmaceutically acceptable sail, or prodrug thereof, wherein R is Formula I; R is Formula V A and A are N; A a d A are NH; , A ¾ * As, A A An, An, Ai¾ and A . are C; and R are methyl; P¾, R¾ R , , R , R , R i and are H; i NH; R and R are Br; and — " in Formula betwee and A a Formula ! and Formula IV - are double bo ds An example of a compound f this e of the invention includes: RECTIFIED SHEET {Rule 9 1) iSA AU [ 83J In another preferred embodiment of the invention, the compound is a compound of Formula I, or a stereoisomer, tautomer, pharmaceutically acceptable sail, or prodrug thereof, wherein is Formula if; R Formula IV; A and A N ; A and A are NH; Ag, , A , A A , , i , A14 d A are C; R , Rs ¾ , « , , , and R are H; . is NH; R r Ci; R and R 3 are NH?.; and i Formula ί between A a d , , Formula and Formula iV — * are double bonds. An example of a compound of t is embodiment of the invention Includes ( C 7 : [0084] in another preferred embodiment of the invention, the compound is a compound o Formula i, or stereoisomer, ta to r, pharmaceutically acceptable salt, or prodrug thereof, wherein i is Formula ί; R is Formula V; A and A are N; and A » are NH; A , A A , , Ar, A « A , A s, A and A are C; R and R are ethyl; R and R are OH; ¾ , , R , . J are ; ¾ is NH; R - and R are C ; and "— " in Formula between A and A,, all Formula S and Formula V "— are double bonds. An example of a compound of this embodiment of the invention includes CL 8 : [0085] in another preferred embodiment of the invention, the compound a compound of Formula , or a stereoisomer, ta t m r pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula ii; R is Formula IV; A - a d are M; A and A ¾ are NH; A¾, A¾, A , As, A?, A A A and A are C; R and R are cyclopent ; R and R ar OH; ¾ , R , s « R > R are H; R NH; R and R are CI; and — " m Formula between an A all Formula if and Formuia IV *— are double bonds. A example of a compound of this embodiment of the invention includes: [0088] n preferred embodiment of the invention, the compound a compound of Formula , or a stereoisomer, a t mer, pharmaceutically acceptable salt, or prodrug t ereof, RECTIFIED SHEET Rule 9 1} SA AU wherein Ft, is Formula f; R is Formula IV; a d A N ; and A are NH; A , A ¾ A*, A&, A , A ,At,, A , A , , a d A , a e C ; , R , , R», i¾ R , R , and R are H; R is NH; R and R are CF ; and *—- in Formula i between A a d A ail Formula II and Formula "— s are double bonds. A n example of a compound of this embodiment of the Invention Includes: [0087] In another preferred embodiment of th invention, the compound is a compound of Formula , or a stereoisomer, tayto e , pharmaceutically acceptable sa t, or prodrug thereof, is Formula I; R is Formula IV; A and are ; A and A are NH; & A . , , A C ; R R R , F¾ R , , A A ¾ and A S, are ¾ and are methyl; ¾ R¾ R R are H: NH; R? and R are pipe azi 1 !; and in Formula between A and A all Formula I and Formula IV " - are doubte bonds. A example of a compound of this embodiment of the invention Includes: [0088] In another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, a tom r, pharmaceutically acceptable salt, or prodrug thereof, wherein s Formula II; is 0-CH -€H ; is N ; ¾ is NH; A , , A , As, and A ar C; R * is methyl; R R , and R are H; is NH; R? is C ; and — * in Formula between A e ai¾i A and all Formula I *- are double bonds. An example of a compound of this embodiment of the invention includes: [0089] In another preferred embodiment of the invention, the compound is a compound of Formula I, or a stereoisomer, tauto r, pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula II; R is Formula V; A and N; A and A are NH; A . A , As, Α Α Ae, , A , « , «·, w and δ, ar C; ¾ , Rs, , R R , ¾ R , a e H; R * is H; R and are SCF ; and ---~ in Formula between A and A ,. all Formula II and formula RECTIFIED SHEET (Rule 81 ISA A ·- are doubfe bonds. An example of a compound of this embodiment of the invention includes: [0000] another preferred embodiment of the invention, the compound i compound of F a !, or stereoisomer, a o er, pharmaceutically acceptable sa i , o prodrug thereof, wherein Ft, is Formula R is Formula V ;; A, a d A a e N A and A 9 ar NH; A¾, A*, A i A , , A A,3, A and A are C ; R , f¾, , R , R«, R , and are H; s NH; R and are €!; and R are -NH~C ( H)-C ; and "— " Formula ί between A A,, all Formula I and Formula I are double bonds An example of a co ound of this embodiment of the invention includes; A · OH HO' "· another preferred embodiment of the invention, the compound s a compound of Formula or a stereoisomer, tauiomer, pharmaceutically acceptable salt, or prodrug thereof, wherein is is H; A and are ¾ is h ¾ is Formula VII; R is Formula VII and is bonded to R forming a pyrimidine ring; —" in Formula between R ¾ and A , and between and A are double bonds; A is CH-; ¾ , R s, ¾ end ¾ are H; A , A A « and are C and R2 is An example of a compound of this embodiment of the invention includes N L17 ): RECTIFIED SHEET (Rule 9 1) ISA AU |0092] n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, ta to er pharmaceutically acceptable sa t, or prodrug thereof, S ; A A*, A & A wherein , is Formula ¾ is H ; A is ; and R are NH; , A > A¾ and are C; , R , a d R are H; Is butyl; R s C ; and "— * in Formula between d A and all Formula are double bonds. An example of a compound of this embodiment of the i includes ( C 8 [0093] I another preferred embodiment of the invenfion, the compound is a compound o Formula I, or a stereoisomer, t u ome , pharmaceutically acceptable salt, or prodrug thereof, wherein A is 0 ; is H; A and ¾ are N; s is ¾ A is Formula VH; R Formula VI and R is bonded to ¾ , forming a pyrimidine ring; "— * in Formula between R and A a d between A , and A ere double bonds; » is - -C H - R s R , R ? are H; A 3 4 , » and are C; and is C . An example of a compound of this embodiment of the invention includes NCL1 5): 4j In another preferred embodiment of the invention, the compound is a compound of Formula . or stereoisomer, aut er pharmaceutically acceptable salt, or prodrug thereof, wherein s C; R s H; and are ; R ¾is H ; A is Formula VH; R is Formula V I and R is de to R forming pyrimidirse ring; - in Formula i between R and A®, and between and A are double bonds; -C -; &, Ra and R are H ; A , A 4 , A ar d are C; a d R ¾ is OH. An example of a compound of this embodiment of the invention includes RECTIFIED SHEET Rule 9 1) !SA AU | 95] n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharrriaceutically acceptable sait, or prodrug thereof, * wherein A © s C ; s H A and ¾ are N ; is N H A is Formula V I; is Formula V a d R 2 is bonded to , forming a p ri m dine ring; in Formula between R and A¾ a d between A i and A 2 are double bonds; A is CH-; a , R27 and ¾ are H; A , A > A¾ A S and are C ; a d ¾ is Br. An of a compound of this embodiment of the invention includes CL 3): f Q 6] in another preferred embodiment of the invention, the compound i a compound of Formula i, or a stereoisomer, tautomer, pharmaceutically acceptable sail, or prodrug thereof, wherein Q is C; is H A and ¾ are M; R is ; A , is Formula V ; R is Formula V I a d R is bonded to forming a pyrimidine ring; ~ ' n Formula 1 between R and . a d between A and are double bonds; is -CH-; R , R¾, R R are H; a d A , A A and A are C. A example of a compound of this embodiment of the invention includes ( GL1 S [009?] in another preferred em odi ent of the invention, the compound is a compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable sait, or prodrug thereof, wherein A s C; is H; and are ; is NH?; i i Formula V i R s Formula VI and ¾ is bonded to .- forming pyrimidine ring; "— " in Formula \ between A ¾ and between A and A are dou bonds; A is - (C H )-; , Rzr a d R ¾ are H; A ¾ A Α ¾, A s and are C; and R s C An example of compound of this embodiment of the invention CL2 4) RECTIFIED SHEET Rule 91) SA AU [0098] n another preferred embodiment of the invention, the compound is a compound of Formula , or a stereoisomer, a er, pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula ii; s Formula IV; A : a d A are N; A and A >are N A , A A¾. A , , A and A , are C; R , Re, R , R R,¾ R , and R are H ; is NH; R and R are C ; and R are F; and in Formula I between A and - all Formula If and Formula IV "— are double bonds. A n example of a compound of this embodiment of the invention includes ( C 2 ): [00991 another preferred embodiment of the invention, the compound is a compound of Formula 1, or a stereoisomer, tauiomer, pharmaceutically acceptable salt or prodrug thereof, wherein R is Formula .1; s Formula IV; and A are ; A and A¾ are NH; A¾, ¾ A , , Ae, A I ¾ , A and A , C ; ¾ and R are methyl; R , R®, R , R , R 3 R R and R are H; R is NH; R and S are CH ; and in Formula between and A a l Formula and Formula - double bonds. An example of a compound of this embodiment of the invention includes CL ); 1010θ ' n another preferred embodiment of the invention, the compound Is a compound of Formula 1. or a stereoisomer, tauiomer, pharmaceutically acceptable salt, or prodrug thereof, wherein R is Formula II; R is Formula IV; a d are N; A and are H; A . A .. , As, , A , A , , , « and Α « are ; and R¾ are methyl; R , , R , Re, , R , R are H; is NH; R and R ar¾ -butyi; and — * in Formula between arid A all Formula I and Formula IV ~ are double bonds. An example of a compound of this embodiment of the Invention includes ( C ) 101] n another preferred embodiment of the invention, the compound is a compound of Formula I, o a stereoisomer, tautomer, r ¾ e c fi acceptable salt, or prodrug thereof, wherein A¾ C s H; A and are F is N H A is Formula V I.; R is Formula VII R RECTIFIED SHEET (Ru e 91) ISA/AU ' is bonded to i¾, forming a pyrimidine ring; "— in Formula 1between and A¾ a d between Ai and A are double bonds; A is -CH-; , & and H; A , . A , ¾ and A are G d R CF . An example of a compound of this embodiment of the i includes INCL221); 1G2j According to another aspect of the invention, there s provided a method of treating or preventing a bacterial colonisation or infection in a subject, the method comprising th step of administering a therapeutically effective amount of a compound of Formula or a therapeutically acceptable salt thereof, to the subject. n this aspect, me bacte al infection is caused by a bacterial agent. The method of treating or preventing a bacterial infection or colonisation n a subject, may also comp se the administration of the pharmaceutical or veterinary compositions of the invention. [00103] According to a further aspect of the invention, there is provided the use of a compound of Formula , or a therapeutically acceptable salt thereof, n the manufacture o medicament the treatment of a bacterial colonisation or nfectio in a subject. n this aspect, the bac e iai infection is caused by a bacterial agent. | 4] The subject may be any subject capable of colonisation and infection by bacteria. The may be mammalian, or may be piscine or avian. Preferably, the subject is selected from the group comprising, but not limited to, human, canine, feline, bovine, ovine, caprine, other ruminant species, porcine, equine, avian, or piscine. P0105] The compound of Formula ay be administered to the subject in dose selected from the group comprising 0.1 rng/ g to 250 kg body weight, preferably 1 g kg to 100 mg/kg body weight, and more preferably 5 m / g to 50 g g body weight, The compound of Formula i may be administered to the subject using a dosing schedule selected fro the group consisting of: hourly, 3 times daily; twice daily; daily; every second day; twice weekly; once weekly; once fortnightly; once monthly; once e two months or by constant rate or variable rate infusion. Preferably, the compound of Formula I i administered until colonisation or the signs and symptoms of infection or colonisation have at least been partially treated or alleviated. RECTIFIED SHEET (Rule 1) ISA/AU [00108] In one embodiment, the concentration of compound of Formula I (or a metabolite} in the subject's blood after treatment is within a range selected from the group o , but ot limited to; between 0.1 and 1 ug/rrsL at 2 hours, 1 and 20 ug/mL after 12 hours; between 0.1 and 5 ug/mL after 24 h between 0.01 and 2 g/ nt after 4S hours; between 0.0001 and 1 ug/ L after 72 . Preferably, the concentration is selected from th group comprising, but not limited to: less than 200 ug/mL after 12 hours; less than 5 ug/mL after 24 hours; less than 1 ug/L after 48 hours a d less tha 0 5 ug/mL after 72 hours. [00107] The agent causing the bacterial infection is a bacterial agent in one preferred embodiment, the agent is not a protozoan species in one preferred embodiment, the agent i not a o idiars protozoan. preferably, the agent is not Clostridium parfringaos nor a heterotrophic bacteria! species present in soi samples collected by Hansen et a from Jyndevad Denmark as discussed in the following papers: Hansen et al. 2012, Chemosphem. 86:212-215; and Hansen l. 2009, Environmental Pollution 7:474-480. 100108] In another embodiment the bacterial agent is gram negative. In another embodiment, the bacterial agent is gram positive. n another embodiment, the bacterial age t has no cell wail. n another embodiment, the bacterial infection is caused by a mixture of at least two agents selected from the group consisting of: gram negative, gram positive and bacterial agents with no cell wall. [00109] The bacterial agent causing the bacterial infection ay be a gram positive bacterial agent selected from the group comprising, but not limited to, Staphylococcal spp, Streptococci, Ent r co c spp, L& on ioc spp, Coryn act u spp, Arcanobactaria spp, Tru p rei a spp, Rhodococcus spp, Bacillus spp, Anaerobic Cocci, Anaerobic Gram-Positive Nonsporulaiing Bacilli, Actinomyces spp, Clostridium spp, Noc rd a spp, Etysip&iothrix spp, Listeria spp, Kytococcus spp, Mycoplasma spp, Uroapiasma spp, and Mycobact u spp [001 10] In one embodiment, the bacterial agent is gram positive and s selected from the group comprising, but not limited to, Staphylococcus spp. Examples of Staphylococcus spp include pid r nidis, Staphylococcus ha iyticus, Staphylococcus iugdunensls, Staphylococcus saprophyticus, Staphylococcus laris, Staphylococcus capitis. Staphylococcus apra Staphylococcus ca o us, Staphylococcus ii Staphylococcus inis Staphylococcus past n, Staphylococcus p& a kof® , Staphylococcus pu v rer , Staphylococcus saccharoiyticus, Staphylococcus s muia s. Staphylococcus schieifm, Staphylococcus warmri, Staphylococcus xylosus, Staphylococcus arlaitae, Staphylococcus casaolyticus, Staphylococcus r &g& s. Staphylococcus condiment!, Staphylococcus delphini, Staphylococcus qu r m Staphylococcus Mis, Staphylococcus um ttii, Staphylococcus g&dinarum. Staphylococcus y s s Staphylococcus RECTIFIED SHEET (Rute S1 ) iSA/AU iniermedius, Staphylococcus loosi , Staphylococcus ientus, Staphylococcus lutrae. Staphylococcus usc e, Staphylococcus nepaiensis, Staphylococcus piscifermentens, Staphylococcus pseudiniermedius, Staphylococcus sciuri, Staphylococcus sirniae, Staphylococcus succinus, and Staphylococcus vituiinus. [00 ] n another embodiment, the bacterial agent is gram positive a d s selected from the group comprising, but not limited to, Streptococcus spp. Examples of Streptococcus spp include Streptococcus agalactiae, Streptococcus atactolyticus, Streptococcus anginosus, Streptococcus canis, Streptococcus constellaim, Streptococcus cncaius, Streptococcus cdstatus , Streptococcus do ne , Streptococcus dysgalactiae subsp dysgalactiae, Streptococcus dysg iact e subsp. oquisi i is. Streptococcus equi subsp. equi, Streptococcus equi subsp. moepidemicus. Streptococcus ferus. Streptococcus gallolyticus subsp. gailoiyticus (formerly Streptococcus bovis biotype i), Streptococcus gallolyticus subsp. pasteurianus (formerly Streptococcus biolype ii/2), Streptococcus gordouii, Streptococcus hyointestinaiis, Stmptococcus hyovaginaiis, Streptococcus infantarius. Streptococcus infantarius subsp infantadus. Streptococcus infantis, Streptococcus ia , Stmptococcus intermedius, Streptococcus lutetiensis (formerly Streptococcus bovis bsoiype Streptococcus macacoae. Streptococcus tis , Streptococcus tans, Streptococcus oralis, Streptococcus odsratti, Streptococcus parasanguinis f Streptococcus peroria, Streptococcus pneumoniae. Streptococcus porcinus, Streptococcus pseudint&rmedius. Streptococcus pyogenes, Streptococcus rat i Streptococcus sa iv rius Streptococcus sanguinis, Streptococcus sobrinus, Streptococcus suis, Streptococcus thermophiius, Streptococcus vestibularis, a d Nutritionally Variant (Deficient) Streptococci {Abiotrophia defeciiva, Gra uli te la adiacens, Granuiicateiia eg s and Gmnu!icat&iia para-adsacens) a d related species such as Rothia u il ginosa {formerly Stoniaiococcus rnucitagirsosus ) and Pedlococcus. [00112] n another embodiment, the bacteria! agent is gram positive and selected from the group comprising, but not limited to, Enteromccus spp. Examples of Enterococcus spp include Enterococcus faecatis, Enterococcus f ci , Enterococ gail aru , Entorococcus du ns, Enterococcus avium, E ie co cus raffinosus, Enierococcus pattern, Entarococcus gilvus, Enterococcus cecorum, Enierococcus a odoratu , Eniemcoccus italicm, Enterococcus sanguiniooia, Enterococcus muridtii, Enterococcus se vus av& &m , Enierococcus dispar, Enterococcus hirae, Entarococcus pseudoavium, and Enierococcus hovls. [00113] n another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited to, Leuconostoc spp. Examples of Leuconostoc spp include & c s senteroides L&uconostoc pseudomesentemides, Leuconostoc para es t r id s, Leuconostoc itr u an Leuconostoc lac s RECTIFIED SHEET (Rule 91} !SA/AU 3? [00 4] In another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited to, CQrynebacterium spp. Examples of Cotynebaciersum spp include no i p phi i fermentative Corynebacterium spp such as Corynebacterium ice ns, Corynebacterium pseudotuberculosis, Corynebacterium xerosis, Corynebacteriism striatum, Corynebacterium minutissimum, Corynebacterium a ycoiatu , Corynebacterium glucuronotyticum, Corynebacterium argentoraiense, Corynebacterium m t ch t i Corynebacterium riegeiii, Corynebacterium ccnfum.ur;, Corynebacterium cysikHs, Corynebacterium diphtheria, Corymbacterium simulans, Corynebacterium aundv se, Carynebacierium t o s ns i, Corymbacterium freneys, and Corynebacterium auri o m nonlipoph i , nonfermentative Corynebacterium spp such as Corynebacterium afennentans afe ienta , Corymbacterium auris, Corynebacterium pseudodiphtheritScum, and Corynebacterium propinquum and Iipophic Corynebacterium spp suc as Corynebacterium jeikeium, Corynebacterium umaiyticum, Corynebacterium afermenians p op hi m, Carymbacienum zcol s, Corynebacterium ma gini yi Corynebacterium tubercuiostearum, Corynebacterium kroppenstediii, Corynebacterium kutscheri, Corynebacterium p os m, Corynebacterium bovis, CDC coryneform groups F-1 an G, and Corynebacterium fipophiioUavum, and other Corynebacterium spp such as Turicelta, Ari oba er, r v ba ri m, Dermabacter, Roi ia Qerskovia, icr b cterium and Leifsonia aquatiea. f00115] In another embodiment, the bacteria! agent is gram positive and selected from the group comprising, but not limited to, Atcanobacteria spp. Examples of Arcanobaoteria spp include A hae o yticu , . pyogenes (now known as Truepe ia pyogenes, originally known as Actinomyces pyogenes), a d A e ar ia , [00 ] in another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited to, R o &coc us spp. Examples of Rhodocoocus spp include Rhoriococcus equi, Rhodococcus erythropoiis, Rhodocoocus fasciens, and Rhodocoocus rhodochrou$. [00 7 in another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited to, G donia spp. [00 8] in another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited o, suka rei a spp [001 19] n another embodiment, the bacterial agent Is gram positive and selected from the group comprising, but ot limited to, Ac & as a spp. [00120] n another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited to, Actin ba e i a such as Gr s ieila q i. RECTIFIED SHEET Rule 81} !SA AU [00121] another embodiment, the bacteria! agent is gra positive and selected from the group comprising, hut ot limited to, Bacillus spp. Examples of Bacillus spp include Bacillus ant r i Bacillus re s Bacillus cir ans, Bacillus i c enifo is, Bacillus m gat ium, Bacillus pumilus, Bacillus spbaa ic Bacillus su lis Bmvibaciiius brevis, Brevibaciilus latarosporus, and Paen ba l s a!vei. [00122] n another embodiment, the bacterial agent is gram positive d selected from the group comprising, but not limited to, Anaerobic Cocci. Examples of Anaerobic Cocci include Anaamcoccus murdochn, Anaerococcus prevotii, Anaerococcus tairadius, Anaerococcus ia i s, Anaerococcus hydmgenalis, Anaerococcus l ct ly icus An &r c cc vaginalis, Atopobium parvulum, Fineg d a magna, Galiicola barn&sae, G& l a asaccharolytica, Q ma ia bergari, G & ia unl ul .. G me la bae oiysans G n a morb ll ru , Gs c i p&laiicanis, Gam li sanguinis, P rv onas i ra P pt co cus ig r, Pepionipbilus a acc roiytic $f P&pioniphiius gorbaohii, P&ptoniphifus doi cus Paptonipbilus har&i, Paptonipbilus Ivorii, Paptonipbilus lacrimalis, P&pioniphilus ols&nii, Pepiostr&ptococcus siomatls, Peptostreptococous anaerobius, Ru inococc s produciua. Slackia ! tnn red c ns, and Staphylococcus s Cc ar y ticua [00123] in another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited to, Anaerobic Gram-Positive onspor atin Bacilli Examples of Anaerobic Gram-Positive nspo la g Bacilli include A seani v a omnic ns, Atopobium species such as Atopobium minuium, Atopobium nmae, Atopobium parvuium, and Atopobium vaginae), Bifidobacteria such as Bifidobactam ad l c ti Bifidobacteria dantium, Bifidobacteria scardovii), Catabact&r bongkong&nsis, Col!ins&lia aerofaciens, Eggertb i (such as Eggartheila lent®, Egg rt lla hongkongensis and Egg rtba la sinensis). Eub&ctadum and related species (such as Eubact&rium nodaium, Eu aciar u t u Eubact&rium brac , Eubact&rium infi r u , Eubact&rium minuium, Eubactarm' m n t , Eubaciadum s p n m Eubact&rium sulci, Fi if or o is, ogib cim u imidum, og b eri , Pseudoramibact&r alactolyticus, B ile di ax u ia, and Solobacterium moorei}., Lactobacillus species (such as Lactobacillus mamnosus, Lactobacillus cases, Lactobacillus farmenium, Lactobacillus gasse , Lactobacillus plantarum, Lactobacillus acidophilus, Lactobacillus iner and Lactobacillus uit n&ns s , biiunc species such as MoMuncue curtisii, obit us ul s) r lia indoligenes, G e ella ora species suc as Ot n iia u and e profuse), ba tarium sinus, Propionibacierium such as Pr pio bact n m c s a d P pio aci nu pr p io i u ) Siackia exigua, and Turicib&ctar sanguine. 00 124] n another embodiment, t e bacterial agent Is gram positive and selected from the group comprising, but not limited to, Actinomyces spp. Examples of Actinomyces spp include Actinomyces israelii, Actinomyces naas ndi , Actinomyces VIBCQSUS Actinomyces RECT ED SHEET (Rule 91) SA AU odontoiytieus, Actinomyces meyeri, and Actinomyces gerencseriae (formerly Actinomyces israelii serotype Actinomyces europaeus, Actinomyces neuii, Actinomyces rad ga , Actinomyces gt e itz i Actinomyces hordeovuinaris, Actinomyces turicensis, Actinomyces georgsae. Ar a o a &ri {Actinomyces} pyogenes, Arcanobacieriurn (Actinomyces) bemardiae, Actinomyces funkei, Actinomyces iingnae, Actinomyces st n r s and Actinomyces cardifiensis. [00125] In another embodiment, the bacterial agent is gram positive a d selected from the group comprising, but not limited to, Ciostridium spp. Examples of Clostridium spp include Ciostridium bara 'i, Ciostridium b fermenta , Ciostridium bo uii um, Clostridium botu! u (types A, , C, D, E, F, G), Clostridium butyilcum, Ciostridium difficile, Ciostridium histoiyticum, Ciostridium vyi (type A}, Clostridium novyi (type 8 , Clostridium perf ng& s perfringens (types A-E), Clostridium remosum, Clostridium sepiic , Ciostridium sardeiii, Clostridium sp noid c, Clostridium t tiu , and Ciostridium tetani. [0012 in another embodiment, th bacterial agent is gram positive and selected fro the group comprising, but not limited to, Nocardia spp. Examples o Nocardia spp include Nooardia -asteroides, Nocardia brasili@nsisf Nocardia far nic , Nocardia Nocardia iit di caviar m and Nocardia transv ien s. 100127] in another embodiment, the bacterial agent is gram positive and selected fro the group comprising, but not Hmited to, Etysip&loibrk spp, such as Ery ip iot ri r iopat a . 0 28 I another embodiment, the bacteria! agent is gram positive and selected from the group comprising, but not limited to, Listeria spp, such as Listeria monocytogenes. [00129 in another embodiment, the bacterial agent is gram positive and selected from the group comprising, but not limited to, Kytoco u spp, such as Kytococcus ro i ri . [00130] In another embodiment, the bacteria! agent is gram positive and selected from the group comprising, but not limited to. Mycobacterium spp Examples of Mycobacterium spp include Mycobacterium abscesses, Mycobacterium rupon Mycobacterium asiaticum, Mycobacterium aubagn s Mycobacterium avium complex, Mycobacterium b iiei i, Mycobacterium boiieiii, Mycobacterium branded, Mycobacterium can&ttii, Mycobacterium cap e Mycobacterium / fe , Mycobacterium c io , Mycobacterium chimaera, Mycobacterium coiombieme, Mycobacterium c&ncepiioname, Mycobacterium compicuum, Mycobactarium e ep a is Mycobacterium fercinogenes, Mycobacterium or t u , Mycobacterium fort tu group, Mycobacterium gena ns Mycobacterium gmdii, Mycobacterium haemopbiium, Mycobacterium e kesbo e , Mycobacterium heidelh&rgense, Mycobacterium houstonense, Mycobacterium i un g num, Mycobacterium RECTIFIED SHEET (Rule 1) ISA AU inieriectum, Mycobacterium rac& u are, Mycobacterium senegaionse, Mycobacterium africanum, Mycobacterium avium subsp paratub r io is, Mycobacterium , Mycobacterium iacus, Mycobacterium &n a u , Mycobacterium leprae, Mycobacterium apraem uri , Mycobacterium ag ri nse, Mycobacterium im &nse, Mycobacterium ari n m, Mycobacterium massiii&nse, Mycobacterium microti, Mycobacterium m nt fi ren e i ) Mycobacterium morac , Mycobacterium mucogenicum, Mycobacterium nabraskensa, Mycobacterium neoa , Mycobacterium novo as n e, Mycobacterium paiustra, Mycobacterium parm&nse, Mycobacterium p &i, Mycobacterium pho aic , Mycobacterium pinnipedii, Mycobacterium porcinum, Mycobacterium p d s ti s i (fish), Mycobacterium pseudotuberculosis, Mycobacterium saskatchewanense, Mycobacterium scrofuiaoeum, Mycobacterium senuerise, Mycobacterium sapticum, Mycobacterium si iae, Mycobacterium st ma Mycobacterium s gai, Mycobacterium terrae/chr&mog&nicum complex, Mycobacterium triplex, Mycobacterium tuberculosis, Mycobacterium tusciae, Mycobacterium ulcerans, Mycobacterium woiinskyi, and Mycobacterium xenopi, [00131] In another embodiment, the bacterial agent is gra positive and selected fro the group comprising, but not limited to, r eper l!a spp. Examples of Truepereiia spp include Truepereiia ahortisuis, Truepereiia bernardiae, Trueper&iia biaiowiaiensis, T per ila bo a i, Trueparelia pyogenes {Arcangbact&rium pyogenes). 0 21 another embodiment, the bacterial agent is g a positive , gram negative or does not have a ce l wall and from the group comprising, but ot limited to, livestock pathogens. Examples of livestock pathogens include Actinobacutum suss., Actinomyces bovis, Arcanobacierium pyogenes, Bacillus antbracis, cereus, iic enlfor s, p mi s, m&taninog&nicus, Clostridium otuii u , c a vo h olyti um , vyi perfr ge , ep ticum sordeliii, tetani oilnu , Coryn ba teri pseudotuberculosis, enaie, Dar at p ilus congoi&nsis, Enierococcus spp (such as E. fs ali , E. faecium, . durans, E. avium, E. hirae), Erysipaiothrix r usi path , Listeria ivanayii, grayi, n , seelig w&ishimeri, monocytogenes, Mycobacterium avium, bovis, paratubercuioais (J hne s Disease), (such as capricohm subsp. capripneumoniae, subsp. capricoium, M. mycoides subsp mycoides, . agai&ctiae, M. ovipneumon!ae, M . conjunctivae, M. arginini, M . bovis, and M . puir facia s) Mycoplasma bovis, dispar, mycoides subsp. mycoides (such as Contagious bovine pleuropneumonia CBPP) Mycoplasma gaiiisepticum M G), iowae m & eagridi MM), synoviae (MS) Mycoplasma haem os (formerly Ep ry throz or suis), aikaiescens, bovigenitaSum, bo ir inis, bovoGuli, caiifomicum, canad&nse, cy os, equigenitaiium, gatea& a canis, &m of is, y pneumoni , yorb i , y syn v' , waa, !&achii, e agri dis, mycoid&s subsp capri, wenyonih suis, Rhodococcm equi, Staphylococcus epidarmidis, Staphylococcus sim a . Staphylococcus fails, Staphylococcus xyiosus, Staphylococcus c r &n , RECTIFIED SHEET (Ruie 8 1) SA AU Staphylococcus warned, Staphylococcus haemolyticus, Staphylococcus semi, Staphylococcus sapfophyticus, Staphylococcus hominis, Staphylococcus caprae, Staphylococcus c hn subsp. c hni Staphylococcus cohnii subsp. ur a yti us, Staphylococcus capitis subsp. capitis, Staphylococcus capitis subsp. ureaiyticus, Staphylococcus hyicus, Staphylococcus a r , Staphylococcus pseudictermedius, Staphylococcus deiphim; Staphylococcus schleiferi subsp. o&gu ans Staphylococcus aureus subsp. a er b us, Streptococcus uberis, Streptococcus oanis, Streptococcus agalactia®, Streptococcus dysgalaciia®, Streptococcus Streptococcus bovis, Streptococcus equi subsp. Zoospidemlcus, Streptococcus eq n s, Streptococcus equ (Streptococcus subsp equi}, Streptococcus equisimiiis (Streptococcus dysg i iae subsp equisimiiis), porcinus, s is, zooepidemicus, Streptococcus zooepidemicus (Streptococcus equi subsp zooepidemicus), Streptococcus dysgalactiae subsp. equisimiiis, Prop v act u , Propionibact&rium g anuiosu , Eub c ri Peptococcus ndo ic , and PepiostrBpiococcus ana ob ; a d various species of the following Gram negative genera: Actinobaciiius, A ro onas, Anap as a, Arcobacter, Avib c riurn, Bacteroid&s, Bartonella, Bordeteila, Borrelm, Brachyspira, Brucella, Campylobacter, C&pnocytephaga, Chlamydia, C la ydophi a, Chryseobacierium, C xieta Cytophaga, Dichelobacter, Edwardsieiia, Ehdichia, Escherichia, Fiavobacierium, Fr nc e ta Fu baci rl Gal i acteriu Haemophilus, Histophilus, Klebsiella, Law&onia, Leptospira, r eim a, Megaspha&ra, or xel a, Naohck&tisia, Nlc& tei a, Gmithobectarsum, P eur iia, Photobactenum, P sci iamydia, Piscirick&ttBia, Porphyromonas, Prevotelia, Proteus, Pseudomonas, Rickettsia, Ri m rel a Salmonella, Streptobaciilus, Te ci acuiu , Vibrio, and Yersinia [00133] In another embodiment, the bacteria! agent is selected from the group comprising, but not m t d to, pathogens of companion animal species such as cats, dogs and horses. Examples of such pathogens include equi e pathogens such as Streptococcus e u . Streptococcus zooepidemicus, Rhodococcus equi, Clostridium difficile, Ciostndium parfringens, C ryn ba tenum pseudotuberculosis, Clostridium piiiforrne, Actinomyces bovis, Staphylococcus aureus, β-haamoiytic Steptoooocus spp, De ai philus congoiense,. C stridiiu iei i and Clostridium boiul n Further include pathogens of dogs and eats suc a Staphylococcus spp, Streptococcus spp, Clostridium spp, Actinomyces spp, EnteroG spp, Nocardi& spp Mycoplasma spp, and ycobs ci & m spp. [00134] another embodiment, the bacterial agent is gram negative a from the group consisting of the f te in representive familie and species: A t b c acea :- R s m nas c&rvicalis; Roseomonas faunae; Ro e m nas gi rdi A&romotiadaoea®:- A romor s ii acchar phi a; Aeromonas q a i ru ; Aer o s caviae; Aer mo a y r p (a d subspecies); Ae s s&l n d ; Aeromonas s rti i; Aeromonas vemnii RECTIFIED SHEET ( l 1) iSA/AU biovar sobria (Aeromonas sobria). -- A c ig n ae:- Achromobacter xyiosoxidans; Ai aiig t ia al s; Bordelella ansorpii; Bordet&tla avium: Bordetelta bronchiseptica; Bordetelta h zii; Bordeielia o sn; Bordelella parapertussis; Bordeteiia pertussis; Bordeteiia pstiii; Bord&tella tr atu ; Oiigella ureoiyiica; Qi g a ur&thralis. ~~ Anap! sma ac a :- Anap as a phagocytophilum; Anaplasma ptatys; Anaplasma bovis; Anaplasma central®; Anaplasma marg e; Anapl odocoltei: Anaplasma ovis; Ehrlichia can s; Ehrlichia ha nsis; Ehrlichia wingi ; Ehrlichia mum; Ehrlichia ovina; Ehrlichia r inanii ; Neoehrlichia iotorfs; N &hili hia ik r nsi ; Neorickettsia heiminthoeca; Neorickettsia nsticii; Neorickettsia s is ; Woiba h a pipmntis. —Armatimonadaceae:- A at mona rosea. —Baotrnvidacesa:- Bact&roidas fofsythus; Bacteroides fragilis; Bacteroides meianinogenicus; Bacteroides ruber; a e idas uraattyicm. ~~ Bartonellacea@:~ Bartonella aisatica; Bartonella austral®; Bartonella bacrMitormis; Bartonella b tia ti; Bartonella bovis; Bartonella capreoli; Bartonella chometii; Bartonella ciarridg&iae; Bartonella doshiae; Bartonella e!lzabeihae; Bartonella grahamii; Bartonella henselae; Bartonella koehlenae; Bartonella per y c ; Bartonella phoc&ansis; Bartonella quintarm; Bartonella rattimassiiiensis; Bartonella ch iim& ; Bartonella schoonbsjchensis; Bartonella talpaa; Bartonella tamiae; Bartonella laylarii; Bartonella t ibocon i ; Bartonella vlmonii subsp .. berkhoffii; Bartonella vinsonli subsp arupenale; Bartonella vinsonii subsp. vinsonli. —Bdattovibrionaceaa:- Bdeilovibm spp. - Brachyspiraceae:- Bra yap ra spp including Brachyspim hampsonlL Brachyspira hyodysenteriae, Brachyspira murdochli Brachyspira piloslcotL — Brucatiacme:- Brucella abortus; Brucella cants; Brucella ceil; Brucella maliiensis; Brucella ovis; Brucella pinnipediatis; Brucella suis; Oc robact rm ant r pi; Ochro actr intermedium. Burkhoideriacaae:- Burkholdem aboris; Burkhotderia ambifaha (genomovar V I ; Burkholdena anthina (genomovar V ); Burkhoiderla cenocepacla (genomovar ill); Burkhoiderla cepacia (g&nomovar I}; Burkhotderia diffusa; Burkholdena dolosa (genomovar VI); Burkholdem latens; Burkholdem mallei; Burkholdem metallic®; Burkhoiderla muit vo ns (genomovar ) ; Burkholdena pseudomalioi; Burkhoiderla pyrrocinla (genomovar X ; Burkhotderia s& ina s; Burkhoidaria stabilis (g&nomovar IV ; Burkholdena ubonensts (genomovar X); Burkhotderia vietnamiensls (g&nomovar V); C pr idus pauculus; C priav us gilardil; Ra st n pickettii; Ra ton manniiolilytlca; Sphaerolilus ip ai; Spha rot s mo an s; Sphaerotiius na s. ~~ Campy bact&r ea :- Arccbacler spp inciudng Ar&ohacter sklnvwii; Campylobacter co i; Campylobacter o ncis Campylobacter urv s, Campylobacter fetus: Campylobacter gracilis; Campylobacter helveiicus; Campylobacter hominis; Campylobacter h oin st nalis; Campylobacter insutamigrae; Campylobacter jejuni; Campylobacter lantenae; Campylobacter ar ; Campylobacter landis; Campylobacter m ; Campylobacter rectus; Campylobacter sho a ; Campylobacter sputorum; Campylobacter upsaliensis., - Candidates: - Piscichiamydia al o s Cardiobacteriaceaa:- Ca dlohacter m h inis; ardi ba arium vatvarum; Dtctmtobacier nodosus. ~ hiamy i c ae: Chlamydia spp including Chlamydia avium, Chlamydia ga ac&a, Chlamydia ridar m Chlamydia suis, RECTIFIED SHEET (Rule 9 1) SA A Chlamydia trachomatis; Chiamydophiia spp including Chiamydophiia pneumoniae, Chiamydophiia p&co , Chiamydophiia psittad, Chiamydophiia abortus, Chiamydophiia caviae, and Chiamydophiia fails. - Ghth n m nadacea@ Chthonomonas calidirosea. - Cofr monadace e Comamonas iesiosteroni; Verminaphrobactar spp. Coxleilaceae:- Coxi&lia burnetii. - Cytophagaceae;- Gyi hag coiummris; Cytophaga hutchimomi; Fiexibacier echinicida; Fiexibacter ! gan ; Fiexibacter flexiiis; Fiexibacter litoraiis; Fiembacter p lym rphu ; Flaxibact&r roseoius; Fiexibacter ruber, Dasulfovibrionacaaa:- Bilophiia wadsworthia; Lawsonia intrac&lluiaris. Entarobacieriacaae:- Cedeoaa davisae; Cedecea apage ; C&d&c&a naten; amalonaiicus; Citrobacter divarsus; Citrobacter freundii; Ci ro ad ar koseri; Cronobader condiments; Cronobader dubiinensis; Cronotacter helveticus; Cronobacter maionatious; Cronobader uyt ensii; Cronobaoter pulvens; Cronobact&r sakazakii; Cronobader tuhcensis; Cronobader universalis; Cronobader zuricbansis; Edwardsiella idaluri; Edwardsiella tarda; Entarobacter aerogenes; Entambacier aggiomerans; Enterobacter doacaa; Enterobacter cowanii; Escherichia alb&rtli; Escherichia coil, including A EC - adherent invasive E. coli, EaggEC ~ enieroaggregative E. coil; EHEC = enterohemonhagic E. coii; EiEC = enteroinvasive E coii; EPEC ~ enteropathoganic E GO//; ETEC ~ enterotoxigenic E coii; ExPEC ~ extraintestinal pathogenic E. cofi, N EC ~ neonatal meningitis £. coii NTEC ~ n ecrotO g c E, coii, PEC ~ uropathogenic E. coii; Escherichia fergusonii; Ewingaiia a eri ana; Hafnia alvei; Hafnia panalvei; Klebsiella granutomatis; Klebsiella oxytoca; Klebsiella pneumonia®; Kluyvera ascorbata; Kluyvera cryocrescen$; organe a morganii; Pantoea (formerly Enterobacter} aggiomerans; Photorhabdus asymbiotica; Plesiomonas shlgelipides; Proteus mirabiiis; Proteus penned; Proteus vulgaris; Providenda aicaiifaciens; Pmvidencia rettgeri; Providencia stuartii; Raouitelia eiectrica; Raouitelia omlthinolytta; Raouitelia p tiooia; Raouitelia tenigena; Salmonella bongori, Salmonella enterics subspecies ent ti a (many serotypes); Seiratia liquifaciam; Serraiia nar a ans; Shigella boydii; Shigella dysentehaa; Shigella fl&xnari; Shigella sonnei; Yersinia an er c lti a; Yersinia pesiis; Yersinia pseudotuberculosis: Yersinia r e ri. ~~ Fimbnimonadacaaa:- Flmbnimonas gir s n is li, — Fiavobacten'aceae:- Bergey i a zooh icu ; Capnocytophaga canimorsus; Capnoeytophaga cynodegmi; Capnocytophaga gingivalis; Capnocytophaga granulosa; Capnocytophaga ha moly i ; Capnocytophaga ieadbatteri; Capnoeytophaga ochracea; Capnocytophaga sputigena; Chryseobacterium do!og n s; Chryseobacierium piscicola; Ellzsbeihkingia maningosaptica; F av ba t&ri u branchiophilum; Fiavobactarlum columnar®; Flav bact& m oncorhynchi; Fiavobact&rium piscicida; Fiavobactarium psychrophiium; y idas odomtus; y i es d timimus; Omithobaderium rhinotracheaie; Riamereiia anatipesilfer; Ri&mareila columbine; Riamereiia columbipharyngis; Tenaci acu m dic&nirarchi; Tana ibac i m discolour; Tanacibacuium geilaicum; Tanacibacuium mahtimurn; Tenaoibaoulum soleae; W&ekseiia i sa - Francisallaceae:- Fran e ia tulamnsis subsp. tu ar& i ; Francis&M iar si subsp. oiarctica; Franoiseiia tuiarensis subsp. novidda; Fr n ise la ph f g a; RECTIFIED SHEET (Rule 91) ISA/AU FranciseSIa noa u nsis; F n iselia noaiunensis s sp. ri n aiis (also termed Francimlla asiatice). — Fusobacteriaceaei- Fusobacterium spp. including Fusobactenum necrophorum, Fusobacierhm nu ea Fuso-bacterium polymorphism, ~~ Heii ob teracaa ; Helicobacter cina&di; Helicobacter fenneliiae; Helicobacter pylori ~~ Legioneilaceae:- Legionella pneumophila an other species including; Legionella anisa; Legionella birmlnghamensis; Legionella bo anni ; Legionella in inna ns s; Legionella d of i; Legionella feeleii; Legionella g r nii; Legionella backeliae; Legionella jordanis; Legionella iansingensis; Legionella longbeachae; Legionella maceachernii; Legionella micdadei; Legionella oakridgensis; Legionella pans!ens!s; Legionella saintbelens; Legionella tusconensis; Legionella wadsworibii; Legionella waiters!!. - Leptospiraceae:- Leptospira alexanderi (including Leptospira a e deri serovar e do adis, Leptospira aiexarid&ri serovar Manbao 3); Leptospira alstonl (including Leptospira aiston! s a Plngcbang, Leptospira aistoni serovar Sichua ; Leptospira hifiexa (including Leptospira bi exa serovar Ancona, Leptospira hiflexa serovar Canela); Leptospira borgpetersenii (including Leptospira borgpetersenil serovar Hardjo, Leptospira borgp&lersenii serovar Hardp-bovis, Leptospira borgpeiersenii serovar Pomona, Leptospira borgp t rseni serovar Tarassovi); Leptospira broomii (including Leptospira broomii serovar ur t r dge); Leptospira fainei (including Leptospira fainei serovar Hurstbridge); Leptospira idonii; Leptospira inadai (including Leptospira inadai serovar Lyme, Leptospira inadai serovar Malaya); Leptospira interrogans (including Leptospira Interrogans serovar A s lis, Leptospira interrogans serovar Aut iis, Leptospira interrogans serovar Bratislava, Leptospira Interrogans serovar ni a Leptospira interrogans serovar Grippotyphosa Leptospira interrogans H rd o, Leptospira interrogans serovar Hartip-bov!s, Leptospira interrogans serovar lcierQhaamonbagia& Leptospira interrogans serovar Pomona, Leptospira interrogans serovar Pyrogenes Leptosp interrogans serovar Tarassovl): Leptospira kirscbneri (including Leptospira kirschn&si serovar Bulgarioa Leptospira kirsohneh serovar Cynopteri, Leptospira kirscbneri serovar Grlppoiyphosa); Leptospira kmetyi; L&ptospira c&rasi e Leptospira meyeri (including Leptospira meyeri serovar Sofia); Leptospira noguchii (including Leptospira noguchii serovar Panama . Leptospira nogucbii serovar Pomona); Leptospira santarosai; Leptospira p ¾ ; Leptospira vanthieiii; Leptospira weiiii (including Leptospira weiiil serovar Celiedon!, Leptospira weiiii serovar Sarm ); Leptospira wolbachii; Leptospira wo ffii Leptospira yanagawae. L&ptQirichiaceae:- Leptotrichia buccalis; Streptobacilius moniliformis. -~ Methylobaoteriaceae;- Methyiobacienum extorquem group; Methy!obacterium fujisawaense; Methyiobacienum mesopbiiicum: M&thyiobacterium zat an . Moraxe la ea : Acinetobacter bau an i (genomic species 2); Acinetobacter baylyi; Aoinetobacter bouvetii; Acinetobacter cakoaceticus (genomic species i); Acinetobacter ge eri; Acinetobacter grimontii; Acinetobaeier haemolyticus (genomic species 4}; Acinetobacter hnsonii (genomic species 7); Acinetobacter junil (genomic species S); Acinetobacter IwofS (genomic species Acinetobacter parvus; Acinetobacter radioresistens (genomic species 1 ); Acinetobacter RECTIFIED SHEET te 1} iSA AU sc n ls ri Acin t ba t&r tan ii; Adnetobaci&r tjernbergim; Acinet a t&r t n ; Acinetobacter ursingii: Acinetobactar venetianus; Moraxeila atia ae; Moraxeila boavrei; Moraxaila bovls; Mo &l a bo uli; Moraxeila caw 's; Mo xei a capraa; Moraxeila caiarrhalis; Moraxeila came; Momxeila cuniculi; Moraxeila q i; Moraxeila lacvnata; Moraxeila lincolriii; Moraxeila mac ga ; Moraxeila nonliquafaciens; Moraxeila obionga; Moraxeila osioansis; Moraxaila vis; Moraxeila phenyipyruvica; Moraxeila piuranimeiium; Moraxeila p r i. — Moriie!iaceae:- Moriieiia abyssi; M italia da r nsis; Morit&!la Japonica; Monteiia manna; Monteiia pro-funda; Monteiia viscose; Moriieiia yayanosii. ~ Neisseriaceae;- Ghromobactarium vi a &um; Eikenalla oormdens; Kingella d ni ifica ing& a kingaa, inge ia oralis. Kingaila pctus; Neisseria d n a; Neisseria elongate; Neisseria flavescens; Neiss a gonorr o a ; Neisseria ladamica; Neisseria meningitidis; Neisseria mucosa; Neisseria poiysacchama; Neisseria sicca; Neisseria sub ia ; Neisseria weaver; Vitraosciila spp. - Niirosomonadaceae:- Niirosomonas eutropha; Nitrosomonas a ophila; Nitmsomonas oligotrophy. P sta r iiac ae: Actinobaciiius actinomyc&iemcornitans; Actinobaciiius eq uli; Actinobaciiius iignieresii; Actinobaciiius pl ropne m nia ; Actmobacilius semlnis; Adinobaciilus s cd n ge es; Actinobaciiius ureae; Aggregaiibaoter adinomycetemcomltans, Aggr&gatibacter segnis, Aggmgatibad&r aphrophiius; Aviba eri avium; Avibactarium endocanJitidis; Avibaderium gailinarum; Avibact&rium paragailinarum; Avibact&rium voianiium; Bib&rsteinia trehalose; Galiibacierium anatis; Gailibacterium genomospecies 1; Gailibacterium ganomospedes 2; Gailibacterium genomospecies 3; Galiibacterium group V; Galiibaciarium melopsittaci; Ga libacteri rr salpingitidis; Gailibacterium trehaiosifermentans; Haemophilus aegypiius; Haemophilus avium; Haemophilus ducreyi; Haemophilus haemoiyticus; Haemophilus influenzae; Haemophilus parahaemolyticus; Haemophilus pmainfluenzae; Haemophilus parasuis; Hisiophilus somni; Mannheimia cavsae; Mannheimia g c sida; Mannheimia granuiomaiis; Mannheimia haemoiytica; Mannheirnia ruminalis; Mannh&imia a gena; Nicoiateiia semolina; Pa u la aerogenas; Pastaureiia batiyae; Past lia cabaiii; Pasteumlia canis; Pasteuralia dag a ls; Pastaureiia ultoc da (subspecies multocida, septicum, galticida); Pastaureiia pneumotropica; Pasteumiia stomaiis; Pasteur&lla trehalosi ~~ Plscirickettsiacaaa> Piscirickettsia salmonis. - Pi s monada & :- Pfastornonas shigalioidas. - Polyangiaceae:- Sorangium oatluiosum. - Porphyro onada &ae Dysgonomonas capn c i p ag d -s; Dysgonomonas gadai; Dysgonomonas hofstadii; Dysgon o s moa$ii; Dysgonomonas oryzarvi; Dysgonomonas wimpe y ; Porphyromonas gingivalis - Prevoteliaceae:- Prevotella sppJncluding Pramtalla inte dia, Pfevotella malaninogenica, Pseudomanadaceae:- Chryseomonas iuieola; Pseudomonas aeruginosa; P do a luteals; Ps&u o nes fluorescens; Pseudomonas putida; Pseudomonas sl z ri; Pseudomonas oryzihabitans. Rhizobiaceae:- Agrobactarium tu facie ; z i radiobacter, Rickettsiaceae:- Grientia t ; Qsientia tsu sug shi; Rickettsia a c li m r ii; Rickettsia afhcae; Rickettsia akari; Rickettsia argasii; Rickettsia asiatica; Rickettsia australis; RECTIFIED SHEET (Rule 91) iSA/AU 0483 46 Rickettsia be!lii; Rickettsia canadensis; Rickettsia conorii; Rickettsia c ley ; Rickettsia is; Rickettsia heiionqii&ngensis; Rickettsia heivetica; Rickettsia honei; Rickettsia hoogstraaiii; Rickettsia huiinensis; Rickettsia huiinii; Rickettsia ap n a; Rickettsia marmionii; Rickettsia martinet; Rickettsia massiiiae; Rickettsia na nsis; Rickettsia o ia ei sis; Rickettsia monteirai; Rickettsia moreii; Rickettsia parked; Rickettsia p ac k i; Rickettsia p iiipi Rickettsia prowazekii; Rickettsia ra iii ; Rickettsia rhipicephaii; Rickettsia riokettsii; Rickettsia sibirica subgroup; Rickettsia siovaca; Rickettsia ta ra ; Rickettsia typhi. - S &wa !i caaa:- Shewaneiia p efaci ns ~~ Sphingomonadaceae:- Sphingobactenum it v r ; Bphmgobacierium spiritivorum; Sp ingom n pa c obil s. ~~ Spiri !la a :- Spirillum minus; Spirillum voiutans; Spiriiium wi gradskyi ~~ Spirochaeiaceae:- Borre!ia afzeiii; Borreiia aoserioa; Bo iia bsssetiii; Borreiia burgdorferi; Borreiia c nac& : Borralia duttonii; Borreiia garinii; Borreiia h&rmsii; B r& ia hispanica; Borreiia japonic®; B rr ionestari; Borreiia iusilaniae; Borreiia iya ot i; Borreiia parked; Borreiia parsica; Borreiia r nentis; Borreiia spieinia.nk; Borreiia turicatae; Borreiia turicatae; Borreiia vataisisna; r p ne a caraieum; Treponema pallidum ssp demic m; Treponema pallidum ssp. pallidum; Treponema pallidum ssp. perten e S scc ibn nacaae: Anaerobiospirfilum spp. ~~ Sutiaretiaceae:- Sutt r i! spp including utt& ia w&dsworthia. ~~ Ther ac a :- ei t er us spp - Thenwotogaceae:- T arm t ga n&apoliiana. ~ V&iloneliaceae:- Diaiister spp; &ga nas.spp; g p a ra spp; P i tus spp; Pei s s spp; Propionispora spp; Spo m sa spp; V i on& spp.; Zym&pMus spp - Vib c&ae P t b teri m dams&iae; Vibno adaptatus; Vibrio aigmo!yticus; Vibrio azasii; Vibno campbeiiii; Vibrio cholera; Vibrio damsel; Vibrio fiuviaiis; Vibrio fumisii; Vibrio hollisae; Vibrio metchnikovsi; Vibrio micus; Vibrio para ae oiy icus; Vibrio vulnificus. ~~ Woibachieae:- Woibachia spp, - Xanthom nada a Luteimonas aestuarii; Luteimonas aquatica; Luteimonas compos ; Luteimonas iuti a s; Lut&imonas marina; Luteimonas mephitis; Lutei o as vadosa; Paeudoxant o na broegbernensis; Pseudomnthomonas japonensis; S enot p o ona maitophi!ia; Steno p omon s nitrii ir d cens (00 Most preferably, the bacteria! agent causing the bacterial infection is gram a d is selected from the group comprising; A inet ba ter species, Aeromoms bydr p a Ciirobacter species, Enterobactar species, Escherichia coil, Klebsiella pneumoniae, Morganeila morganii, Pseudomonas aeruginosa, and Ster ptroph mot a maitopbilia. [00138] In another preferred embodiment, the bacteria agent causing the bacterial colonisation or infection is resistant a conventional antibiotic used to the colonisation or infection. In preferred embodiment, the bacterial age t is resistant to a d selected from t e grou comprising: one o more of aminoglycosides (for g nta i n, tobramycin, amikacin, or netilmicin); anti SA cephalosporins {for example ce l ne ); an p e d r na penicillins *· p a ta as inhibitors fo example t car iin c v a ic acid or RECTIFIED SHEET Rule 91) !SA/AU piperacillin-tazGbactam); carbapenems (for example ertapenem, i ip nem, ropene or d p nem); non-extended spectrum cephalosporins; 1st a d 2nd generation cephalosporins (for example c a ofin or cef r ime ; extended-spectrum cephalosporins; 3rd and 4th generation cephalosporins (fo example cefotaxime o ceftriaxone); cephsmycins (for example cefoxitin or cefoietan); fluoroquinolones (for example ciprofloxacin); folate pathway inhibitors for example tr methop sutp a eth a ole); giycy i n s (for example t ge yc ine); rnonobactams (for example aztreonam); penicillins (fo example ampi n); penicillins β- iactamase Inhibitors (for example a xi i !in- !av ianic acid or mpieil in s lb c am ; phen ois (for example chloramphenicol); phosphonic adds (for example f s my in); polymyxins (for example colistin); and tetracyclines (for example tetracycline, doxycyciine or minocycline. Preferably, the bacterial agent resistant to these compounds is gram negative. =0 37] Preferably, the bacterial agent is resistant to a compound selected from the group comprising: penicillins, cephalosporins, carbapenems, ono actams and other β-lsctam antibiotics, f i anes, aminoglycosides, fluoroquinolones, sfreptogramins, tetracyclines, glycylcyclines, chloramphenicol and other phenicois, acro ides and ket iides, in o amides, oxazolidinones, arnlnocyclitols, polymyxins, glycopeptides, iipopeptides, bacitracin, m p ri ci n . ple ro uti ins ri a y ins, s lphonar id s and trimethoprim. Preferably, the compound is selected fro the group comprising: beta lactams, glycopeptides, Iipopeptides, macroiides, oxa^lidinones and tetracyclines. Preferably, the bacterial agent is resistant to the compound when th compound is at a concentration range selected from the following: 0.001 g/r L - 1G Q 0 g/ L; 0.01 g/ - 1000 pg/mL: Θ.10 pg/ L - 00 pg L; and 1 pg/mL - 50 pg/mL [ 0 38] n another preferred embodiment, the bacterial agent causing the bacterial infection i selected from the group comprising, but not limited to, gram positive bacteria. The microbe is preferably a gram positive bacterial agent selected from the group comprising Staphylococcus aureus, Staphylococcus pseudlnterm&dius, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agai ctl Str p o c & is, Eni&tx occ s f i m, Entarococcus faacaiis, and Clostridium di icii . [00 9 n one preferred embodiment, the bacterial agent has no ceil wall. Preferably, the bacterial is selected from the group comprising: l spp, Mycoplasma ag lac ia , Mycoplasma alka!escens, Mycoplasma p riforrrs Mycoplasma arginmi. Mycoplasma bovlg&nitalum, Mycoplasma bovirhinis. Mycoplasma bovis, Mycoplasma bovoculi, Mycoplasma buccal®, Mycoplasma caii lcum Mycoplasma canadanse, Mycoplasma capricolum s p. c pri oium c p o m subsp. c prlp n Mycoplasma conjunctivae. Mycoplasma cynos, Mycoplasma dispar, Mycoplasma , Mycoplasma f c . Mycoplasma fails, Mycoplasma fonrientam ( ncog it s sir), Mycoplasma gaiiisapticum MG , Mycoplasma gat&m, Mycoplasma g l a l , Mycoplasma &mocani RECTIFIED SHEET (Rule 91) ISA AU Mycoplasma haemof&lis, Mycoplasma ae s s (formerly Eperythrozoon suss}, Mycoplasma hominis, Mycoplasma yopn on a Mycoplasma hyorhinis, Mycoplasma hyosynovias, Mycoplasma iowae && gri is ( Mycoplasma owa , Mycoplasma &ac ii Mycoplasma ipophil , Mycoplasma meleagridis, Mycoplasma mycoides subsp capri, Mycoplasma mycoides subsp mycoides. Mycoplasma mycoides subsp. mycoides (such as Contagious ine u o CBPP).. Mycoplasma o lef Mycoplasma vipneu n e, Mycoplasma ovis, Mycoplasma penetrans, Mycoplasma pir , Mycoplasma pneumoniae. Mycoplasma primatum, Mycoplasma putr&faciens. Mycoplasma sa!ivariu Mycoplasma sp&rma op il m Mycoplmma ui , l synovia® (MS), Mycoplasma y nii Mycoplasma, r apia s p, Ur apla a p&rv , r aplas a un ytic m r&ap a m , a d Ureoplasma dimrsum. [G 40 another mos preferred embodiment, the bacterial agent is Staphylococcus aureus. Q1 J In another preferred e odirrs , the bacteria! agent is resistant to a compound selected fro the group comprising: one or more of aminoglycosides for exa ple e nt rn cin); ansamycins for example ri fa icin); anti-MRSA cephalosporins (for example cef a iine anti- staphylococcal β-lactams (or epham d ns) (for example oxacillin or cefoxitin); carbapenems (for example er ap nem irnipenem, m rop nem or doripenem); non-extended spectrum cephalosporins; t and 2 d generation cephalosporins (for example cefa n or f xim ) extended-spectrum cephalosporins; 3rd and 4th generation cephalosporins (for example cefotaxime or ceftriaxone); eephamycins (for example cefoxitin or cefotetan); fluoroquinolones (for example ciprofloxacin or moxif oxacin ; folate pathway inhibitors for example t i op m s phamet oxa Qe); f d dan s (for example f sidi acid); giycopepfides (for example vancomycin, e op ani or fe a an n ; glycyicycJines (for example tigecy i e fin sa d s (for example clindamycin); ypopeptides (for example dapto ycin ; macroisdes (for- example erythromycin); xazoiid ones (for example linezoiid or ted o id); phenicois (for example chloramphenicol); ph phon c adds (for example fosfomycin); strepfogramins (for exa pl quinuprisiin-dalfopristin); and tetracyclines (for example tetracycline, dox y in or minocycline). Preferably, th bacterial agent resistant to these compounds i gram positive. .GG142J n another most preferred embodiment, the bacterial agent ® S pto oc s pneumonias. The Streptococcus pneumoniae may be a strain that is resistant to one or more of actams and maorolides. another most preferred embodiment, the bacterial agent is RECTIFIED SHEET (Rule 8 1) SA AU [00144] n another most preferred embodiment the bacterial agent Streptococcus aga!aciiae. 100145] in another ost preferred embodiment, the bacterial agent s either En eroco c s f i or E r co cus faecaiis. The Enterocoocus faeciufn or Ent&rococcus f ca s may he a strain that is resistant to aminoglycosides (for example gentam c n h gh level) or streptomycin (for example streptomycin (high level)); carbapenems (for example irr ip ne , meropenem or doripenem); fluoroquinolones for example ciprofloxacin, leyof xa in or moxif xa in ; ojycopeptides (for example vancomycin or te c pianin) glycylcyclines (for example tigec ln lipopeptides for example daptornydn); oxazoiidirsones (for example inez l d); penicillins (for example ampicil'in); streptograroins (for example q nupnst n-da fopristin ; tetracycline (for example doxycyciine or minocycline). [00146] in another most preferred embodiment, th bacteria! agent is Clostridium difficile. [00147 The bacterial infection in the subject ay cause a disease selected from the group comprising, but not limited to, nosocomial pneumonia caused by Staphylococcus aureus ( D , XD PD or ef ici iin sus ap tible or -resistant strains), or invasive pneumococcal diseases such as pneumonia, bronchitis, acute sinusitis, otitis media, conjunctivitis, meningitis, bacteremia, sepsis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, cellulitis, and brain abscess caused by to pneumoniae (including multi-drug resistant strains D 8 P] such as those resistant to β-lactams and macrolides), complicated skin a d skin structure infections, including diabetic foot infections, with or without concomitant osteomyelitis, caused by Staphylococcus aureus (methicillin-susceptible and -resistant strains), Streptococcus pyogenes, or Streptococcus agaiactiae, uncomplicated skin and skin structure infections caused by Staphylococcus aureus (rnethiciliin-susceptible and -resistant strains) o Streptococcus pyogenes, community-acquired pneumonia caused by Streptococcus pneumoniae (including multi-drug resistant strains [ DRSP], including cases with concurrent bacteremia, or Staphylococcus aurous (methicillin-suseeptible and -resistant strains) and Staphylococcus aureus bloodstream infections (bacteremia), including those with right-sided infective endocarditis, caused by methicillin-susceptible and methicsliin-resistant isolates, vancomycin- resistant enterococcus infections, including cases with concurrent bacteraemia, an treatment of Clostridium -associated diarrhea (CDAD). [00148] Gram negative organisms are important cause of many infectious diseases in humans and other animal species. Bone and joint infections ( ra negat re organisms or mixed bacteria, ar an important cause of vertebral osteomyelitis and septic arthritis), cardiovascular system infections {including endocarditis caused by the HAGEK group - para n uenz e, Haemophilus ap roph i Aggregatibactar RECTIFIED SHEET (Rule 91) SA A aciinomycetemcomitans, Car ioba eri u hominis, Eikenella corrodens, rig l ki gae , central nervous system infections (the commonest causes of bacteria! meningitis are Neisseria meningitidis. Streptococcus pneumoniae and, in nonvaccinated young children, Haemophilus influenzae type b (Hi in neonates and infants less than 3 months of age, St p s agalactia® (group 8 streptococcus), Escherichia col and other aerobic Gram-negative rods are Important pathogens, brain abscess or subdural empyema, the infecting organism(s) vary with the underlying predisposing cause but where the likely s te of origin Is the ear, enteric Gram- negative bacilli are commonly involved), eye infections (common pathogens include Haemophilus influenza, Neisseria gonorrhoeae or Chlamydia trachomatis), gastrointestinal tract infections (a wide range of pathogens are implicated including enterotoxigenic Escherichia c (ETEC), Salmonella, Campylobacter, Shigella, Vibrio cholera and Yersinia enierocolitica), genital infections (bacte a vaginosis is a polymicrobial clinical syndrome with high concentrations of anaerobic (eg MoMuncus species) and other fastidious bacte a (indudlng Gardnereila vaginalis and At p b vaginae), and Mycoplasma hominis n n sex a y acquired pelvic inflammatory disease P!D) is usually caused by mixed vaginal flora, indudlng anaerobes, facultative Gram-negative bacteria and Mycoplasma hominis, while sexually acquired D i usually Initiated by C. trachomatis or N, gonorrhoeae with growing evidence that M , genitaHum infection is involved in a significant minority of cases), intra-abdominal infections (peritonitis due to perforated s us is usually a polymicrobial infection with aerobic and anaerobic bowel flora spontaneous bacterial peritonitis SBP) is usually caused by enteric Gram-negative bacilli, such as Escherichia co i and Klebsiella species, Klebsiella pneumoniae is an increasingly identified cause of liver abscess), community-acquired pneumonia (Mycoplasma pneumoniae, Chlamydophila (Chlamydia) pneumoniae, Chlamydophila (Chlamydia) psi aci, Haemophilus influenza, aerobic Gram-negative bacilli including Klebsiella pneumonia, Pseudomonas aeruginosa, Aclnetobacter baumannii, Burk oki ria pseudomelia!), otitis externa (including acute diffuse) (bacterial cultures commonly yield Pseudomonas aeruginosa. Staphylococcus aureus, and Proteus and Klebsiella species), otitis media (including acute) (common bacterial pathogens include Streptococcus pneumoniae, Haemophilus influenzae a d r& & a c arrh lis), sepsis (including severe) (including Acinetobacter baumannii, disseminated gonococcal sepsis, Gram-negative enteric bacteria, Neisseria meningitidis (meningococcal sepsis) and Pseudomonas aeruginosa), Systemic infections (Spotted fevers (Rickettsia) and scrub typhus {Qrientla}, Brucellosis, Cat-scratch disease and other Bartonella infections, Leptospirosis, Lyme disease, Melioidosis, Q fever, Typhoid and paratyphoid fevers (enteric fevers), urinary trac infections (acute cystitis, acute pyelonephritis, recurrent urinary tract infections and atheter-sssociafed a teriu ia and urinary tract infections). [0 149 n humans gram negative bacteria are common causes of intra-abdominal infections (1MB), urinary tract infections (UT s , hospital acquired pneumonia, and eraemi . RECTIFIED SHEET (Rule 9 1) SA AU Escherichia c i (£. //} Klebsiella pneumoniae (ft. pneumoniae), and Ps do onas aeruginosa (P. aeruginosa) are important pathogens in the hospital setting, accounting for 2 % of all pathogens 70% of all Gram-negative pathogens causing healthcare-associated infections [Si ve DM, Ricks P, Edwards JR, t a . Antimicrobial-resistant pathogens associated with healthcare-associated infections: summary of data reported to the National Healthcare Safety Network the Centers for Disease Control and Prevention, 2009-2010. infect Control Hosp Epidem iol 2013;34:1-14,]. [00 150 Gram negative bacteria are showing rising rates of resistance to current therapies. .The production of extended-spectrum a tamase ESBL) enzymes is a common mechanism of resistance. Rates of ESBL-producing £. cols and K. pneumonia® have risen substantially, with the result that these bacteria are increasingly resistant to widely use antimicrobials. |0 15 1 P aeruginosa is the most common Gram-negative cause of nosocomial pneumonia and the second most common cause of catheter-related UT s in the U.S. |00152] £ col? is the most common cause of UTIs. Cases of UTl caused by ESBL- pr d cing £ . co and pneumoniae as well as P aeruginosa, including DR strains, are increasing. ESBL-producing E. coil and K. pneumoniae are also frequently isolated in patients with complicated A c lA . [00153] P. aeruginosa is a clinically challenging and virulent pathogen that can be a cause of common infections in humans such as nosocomial pneumonia, UTl, A , an bloodstream infections. P. aeruginosa is the most common Gram-negative organism causing ventilator associated pneumonia and the second most common cause of catheter-associated UTIs. [00154] The increase in the number of infections caused by Gram-negative bacteria is being accompanied by rising rates of resistance. Treatment options to meet this challenge ar increasingly limited. There is a critical need for new antibiotics to meet the needs of patients now and in the future. 00 155 In one preferred aspect, more than one compound of the invention is administered to the subject. [00156] in another preferred embodiment, a compound of the invention, or a therapeutically acceptable salt thereof, is administered together with a compound or &g n that removes or substantially removes or reduces the nteg ty of the cell wall of the bacterial agent. As an example, the compound is selected fro the group consisting of: β lactams, fo sf m c n, RECTIFIED SHEET Rul 91) !SA AU lyso y ne , polymyxins and chelating agents su h as ethyienediamineietraacetic acid (EDTA As an example, the age t is a immunological agent (such as an antibody or vaccine) tha reduces the integrity of the cell wall. n one preferred embodiment, the compound, or therapeutically acceptable salt thereof, s administered together with a compound that removes or substantially removes or weakens the integrity of the outer cell wail of a gram negative bacterial agent. [ 7] According to another aspect of the invention, there is provided an antibacterial pharmaceutical composition comprising a therapeutically effective amount of a compound of Formula , or a therapeutically acceptable salt thereof. Preferably, the composition is an a ti- bacteria! pharmaceutical composition. [00158] According to another aspect of the invention, there is provided a antibacterial veterinary composition comprising a therapeutically effective amount of a compound of Formula , or a therapeutically acceptable salt thereof. Preferably, t e composition is a anti-bacterial veterinary composition. 15 Th pharmaceutical composition may optionally include a pharmaceutically acceptable excipsent or carrier. The veterinary composition may optionally include a veterinary acceptable excipsent or carrier. [G 80] The pharmaceutical or veterinary composition of the invention preferably contains a compound of Formula , or a pharmaceutically acceptable salt at a concentration of selected from the groupd consisting of: 1 mg/g to 500 mg g; 5 g to 400 mg/g; mg/g to 200 mg/g; 20 g/g to 0 mg/g; 30 mg/g to 70 mg/g; and 40 mg/g to 60 g/g . 0 1 1] n another embodiment, the pharmaceutical or veterinary composition comprises Impurities, wherein the quantity of impurities as a percentage of the total weight of the composition is selected from the group consisting of: less than 2 % impurities (by total weight of the composition); less than 15% impurities; less than 10% impurities; less than % impurities; less than 5% impurities; less than 4% impurities; less than 3% impurities; less than 2% impurities; less than 1% impurities; less than 0.5% impurities; l ss than 0.1% impurities. n one embodiment, the pharmaceutical or veterinary composition comprises microbial impurities or secondary metabolites, wherein the quantity of microbial Impurities as a percentage of the total weight of the composition is selected from the group consisting of: less than 5%; less than 4%; less than 3%; less than 2%; less than 1%; less than 0.5%; less than 0.1% less than 0.01%; less than 0.001%. in one embodiment, the pharmaceutical or veterinary composition is sterile and stored sealed and sterile container in one embodiment, the pharmaceutical or veterinary composition contains no detectable level of microbial contamination. RECTIFIED SHEET (Rule 91) SA A [00 2] The pharmaceutical or veterinary composition of the invention may comprise a further antimicrobial agent. T e further antimicrobial agent ay be an antifungal agent or antibacterial agent, The method of treating or preventing a bacterial infection or colonisation in a subject, may also comprise the administration of compound of the invention wit a further antimicrobial agent. [00183] The pharmaceutical or veterinary composition of the invention may comprise more than one compound of th invention. For example, a combination of compounds. The method of treating or preventing a bacterial infection or colonisation in subject, ay also comprise the administration of more than one compound of the invention. 0 1 4 In on embodiment, the antifungal agent is selected from the group comprising, but not limited to naturally occurring agents including Echinoeandins Anid laf ngin, Caspofungin, icaf ngin , Polyenes (Amphotericin 8. Candicidin, F ipin, Fungichromin (P ntarn ), Hachimycin, Ha ny n L nso y in, ep rtricin ata ycin, Nystatin, Pecilocin, Panmycin), and other naturally occurring antifungal agents including Gr se f rs, Of gom cins, Pyrrolnitrin, Si canin and Vi in. The antifungal age t may be a synthetic compound selected fro the group comprising, but not limited to ylamin s Bufenaf n , a ifin Terbinafine) Imidazoles (Bifonazole, B conazoie, Cblorrnida ie C i ba oie, Crooonazoie ( l ona ole , Clotrimazole, Eb rcon oie Eeonazole, Enileonazote, Fenticonazole, F strima o , Fos ucona Oie i o ona o e, Ketoconazole, ano ona ote licona o , Miconazole, i onazoie, Omooonazoie, Gxi ona le Nitrate, Parconazoie, Sert conaz l S lco oie T oeo azole) Thiocarbamates (Li an ft te, To!ciclate, To indate T lnaf a e) Trlazaies (Fluconazole, fsavuconazole, Itraconazole, Posac nazo e Ravuconazole, Saperconazola, ' r ona oi , Vo ©na e},and other synthetic agents such as A s cin, Amorolfsne, Bromosaifcylchioraniiide (BromochlorosaiicySaniiide). Buciosamide, Calcium Propionate, Chtorphenesin, Gi i x Cfoxyquin (Clo q in Coparaffinate, Exaiamid®, Flucytosine, Haiop g n He et din Loflucarban, if rate , furox e, Piroefona, Potassium iod , Propionic Add, Pyrithione, Saiicylanilide, Sodium Pa hi ben oata, Sodium Propionate, Sulbenfine, Tenonitrozoie, Triacefin, Trimetrexate, n e enic Add (Undecenoic A d), and Zinc Propionate. [00105] The composition of the invention may comprise an antibiotic adjunct selected from the group comprising., ut not limited to, -Lac ama inhibitors Av a am Cia ui Acid, Sulbactam, Sultamid i , T zobact ), Renal Dipeptidase inhibitors (Ciias atin and Rena Protectant (B ta ipr ). [001681 n one embodiment, the composition of the invention comprises further antibiotic selected from the group comprising, but not limited to, 2,4 DiA ! PY D NES, RECTIFIED SHEET (Rule 9 1) iSA A including Baquiioprim, Br ds pri , iclaprim, Or e opri , Pyrimethamine, Tetroxop i , Trimethoprim; A OCO U AR S , including Novobiocin; AMfNOCYCLITOLS, including Sp in yGin,; AMINOGLYCOSIDES, including Amikacin, Apra y in, Arbeka in Bakana d n, Butirpsin, Di a n, D hydr tr p yd n, Efimicin, F rt i i ins Ast rni in), Fr n c fin, Geniamicin, Hyg myd n B , sep id n, Kana yc n icra r s id Neomycin, Netilmicin, Paromomycin, Piazornicin, bosfamy in, Sisomicrn, Streptomycin, Tobramycin, Vardamidn; AMINOMETHYLCYCLiNES, including Omadacyciine; Ai PHE iCOLS, including A ida ersi , Chloramphenicol, Ft rf i ol, T mp en l; A SA YC including Rifabutin, am de, Rifampin (Rsfampicirs), Rifamycsn, R fap n in . Ri sximin ANTISEPTIC AGENTS, including Acridine derivatives (including aeri f avin , aminoacridina, ethaeridina, proflavine), Bi py din s (including ct id n dihydr c ds ), Br inat d a cy niiid s (including br a r s C i r axidin Phenol derivatives (including thymol and t d san , Guarternary ammonium compounds (including Al idim thyf hylhan y Ammonium Chloride, enza koniu chloride, tyipyri dini n chloride, benz th ni r c lo de, c trim ni r A T TUBERC LA . AGENTS, including Cycloserine, Delamanid, Et a but , Ethionamide, lsonia2id (Flivazida), rinamid p-Aminosaiicyiic Acid (PAS), Protionamide, Pyrazinamide, Te id , T ioa atazon , Tiooarfide; RSE iCALS including Arsaniiic Add, R xar n ; BACT f C S, including NtSin, Briiacidin (P X-3 63) β-LACTAM CARBAGEPHEMS, including t ra ar f; β- A CTA CARBAPENEMS, including Biap m, Do pa am, £rtap@n@m, Faropenem, f p nem, r p@ne , Panipenam, Razupen R tipsn , Su op ne , Tebipenam, T mop nem; β-LACTA CEPHALOSPORINS, including Cef trife , Cefaclor, C df xi , Cafa in G aiogl in, C f i nium, Cefaloridine, C f oth n, C fama d e, fapir n, C fa ri zi , C azaf r Cefazedone, Cefa n, Ce c pan ,. Cef nir, Cefditoren, C f pi e, Cefetamet, C f xim Cef noxi C di ima, Ca ni i d, Caf p ra ne, Ceforanida, Cef s is, Cefotaxime, C fo i m, C f ved n, C f prar , Caf pimiz a C fpiramid C fpir m C f pod xim , C fpro , Cefquinome, Cafradina, Cafraxadina, u! din, Ceftarolina, Ceftazidime, Cefi ra C ft zole C f bu en C i fu , Cef z xima , Ceftobiprole, C f ol zane, C radin C t ezoie , Ceftriaxone, Caftroxadine, C ur xim , Ce uz a , Pivcafalaxin; -LACTAM CEPHA YC S, including Cefbuparazona, C le, Cefminox, fot an, Cefoxitin; LACTAM MONOBACTAMS, including t eonam Caas ara , igam n ; p- LACTAM GXACEPHEMS, including rnox , Laia x f o¾a ia $a -LACTA v PENICILLIHS, including Amdinociilin ( l ina Amoxicillin. A m pici i n Apaldii Aspoxicisn, Azido i n, Azlocillin, Ba a pi ii!in, Carbenicii!in, Carindadllin, Cid ad l in Ci iz i Penicillin, Ci m d lin, C xa i n, Cyciadliin, Did xa i in, Epi Fa b ici in, F x i in (F ci x ci lin), Hataci! L namp ii n ii na , afe , hi ilin Sodium, ei lin, a in Oxacillin, Parsamaciin, Penethamate ydri dida, Penicillin Q, Penicillin Q Banzathine, Penicillin Pr cain , P ic lli N, Penicillin P ni i in V , Phenethidilin Potassium, P per d il n, Pivampidllin, Piv d i na , P pte ii , RECTIFIED SHEET Rule 91) ISA AU Quinaciilin, Sulbenidilin, Su mi i iin, Taiampiciilin, Te c iin, Tic r n: SICYCLOMYCINS, including B c za ycin BORON CONTAINING ANTIBACTERIAL AGENTS, including AN3385 mino e lb nax xa ro les), GSK2251052 yl-i R A synthetase inhibitors}; CYCLIC ESTERS, induding F s y n; FATTY ACID SYNTHESIS INHIBITORS (Fab , AFN-1252, UT 5 3&9, FAB-001 FLUOROQUINOLONES, including Avarofioxadn, Balofloxadn, Ba i xacin, Chinfloxacin, in xad n, Ciprofloxacin, nafi xad r , Danof a in, D af x c n, Dif!oxaein, Enoxadn, Enro ioxa in Finafloxacin, Fieroxadn, F umequin Garenoxacin, G l ! acin, Gemifloxacin ., Grepafioxadn, afl oxad n L v f xacin, L f xad n, a b floxad n, !lo ad n; v oxif xacin, Nad floxad , Norfloxacin, Ofloxacin, Oi i xad n, Pazufioxacin, Pa xacin Pradofioxadn, Prulifloxadrs, R s xad n , Ryfloxadn, S afioxad n, Siiafioxacin, Sparftoxacin, T ma i xad n, Tosuffoxadn, Trovafloxadn, Z b f a n; FUS!DANES, including R sid c Add; GLYCOUPGDEPS!PEPTiDE, including Ramoplanin; GIYCQPEPTIDES, including Avopardn, Daibavandn, rva o cin, O ta and n, T c p!anin, Tslavandn, Vancomycin,; GIYCOPHOSPHGLIPIDS, including Bamb r ycin (bamberrnydn, nomy ns, fiavop sph Sip ); GLYCYLCYCL!NES, induding Tigecydine; HYBRIDS, Cada o! d O a l din ne-q noi ne} TD- 92 giycopept da cop alosp n); LfNGGSA DES, including Clindamycin, Lin y n, Pirlimydn; LIPGPEPTIDES, induding Dap ycin S t yc n; fVIACROLIDES, including Azithromycin, Carbornyein, C thr yd , Cla fo yd n, Oirithramydn, Erythromycin, Fidaxomicin, F ri yd n, Gam t r yd , Josarrrycin, i asa yd , L uc ycin l u yd n, . ld amyd n , oka yd n IV!irosarnydn, Oleandomycin, P yd n, R it rnyd n, Rcsara nid , Roxithromycin, S d n, So t ycin, Spiramycin, Telithromycin, Terdeeamydn, T ldipir s n, Ti ico in, Tr i and myd nV T lai r cin, Tyi si , Tylvalosin; N T OFURA S Including Furaitadone, Furazidin, Furazolidone, Furazolium Chloride, Nifuratei, N furf l e, if xazide, ifurpfrino , Nifus in i ifur de Nit of ra , Nitrofurantoin, N r fu a on ; TRQI VliDAZGLES, induding D fid szol e Metronidazole, Qrnida a, onida oie, S cn dazoS , Tinidazoie; OLIGOSACCHARIDES, induding Avi!am n, Eveminomidn; OTHER ANTIBACTERIAL AGENTS, including A ri c s n , Chloroxine, C i rquina l, C q in l C ofoct i, Halquinoi, L ti b in, f and li Add, th na in { sx n ) Nit e, itroxo in , Perc io n , Taurolidine, Thanoic Acid, X b rn ; OXAZOLIDINONES, including Epar zo id Lins id, Po i olid Radezoiid, Suteaolsd, Tedizolid o z fid). PEPTIDE DEFORMYLASE INHIBITORS, induding GS 322322; PEPTIDES, including Omiganan, P x anan; PLEUROMUT!LiNS, including apa in, T ia u i , V lne li t; POLYETHER lONOPHORBS. induding Lsidlomydn, Lasaiodd, Ivladuramicin, c sin, Narasin, Saiinomydn, Ssmdurarnidn; POLYMYXINS, induding Colistin, Polymyxin B; POLYPEPTIDES, including A p m n, Badiradn, Ca r omyd n, E d rad din, Enramycin, Envi y in, Fusafunglna, Gra i id n(s) Iseganan. again n , N d h p ide, Ristocetin, T io r pton, Tubaractinomycin, Tyroddine, Tyra t n, Vi ny n; PSEUDOMONIC ACIDS, induding upir d ; QUINOLONES, induding RECTIFIED SHEET {Rule 9 1} ISA A Nalidixic Acid, Nemonoxacin, x in c Acid, Qzenoxacin, P p idic Acid, P r idic Add; QUSNOXALiNES, including Garbadox, O aquind x; RI INOFE AZ NES , including Clofazimine; STATINS, including Atofvastafin, Fiuvastatin, Lovastatin, v eva ta in Pravastatin, Pravastatin, Rosuvastatin, Simvastatin; 3TREPT 6 RA I S, including Da f prisfin, Floprisfin, Lsnopristin, Pristinarnycin, Guinupristin, Virginiamycin; ST EPT T R C S including o r t ricsn; SULFONAMIDES, including Acetyl S fam th xypyra ine, C ra i -B, C oran ine T, Dich rarrsin T , For os if thiazole af nid N4-S ifara i su!fani i , N pr ls fa id , - Suifani!yl~3,4-xyiarnide Gr r a s lfath a le Phthaly ulfa ta de, PhthalylsuifafhiaEOle, Sa azosulfadirnid n S ccinyis ifathia o e, S !fa en a nide Suifaearbamide, Sulfacetamide, S ifac to rpyrida n , Suifac r s idine S if d o i e, Suifacytine, Sulfadiazine, S fadiera ide, S l d m tho ine, Sulfadimidine, S l adoxin , Su f eth d S , Suifaguanidine, S faguanol , Su alen , S ifa xi Acid, S !fa raz ne, S ifa e r Sulfamethazine, Suifa e hfe S l ametho d ne Sulfamethoxazole, Sulfamethoxypyridazine, Sulfam t y th a Se, S lf met pyra ine, Suifametroie, S ifa nidoc r s dine, S fa onom t oxine Su fa xoie, Sulfanilamide. Suffanilyiurea, S aperi e, Sulfap ena oie Su fap xy irse , S apy a n , Suifapyridine, u a uinoxalina Su at ia o e Su thiour a, Su fatroxa o e, Su fiso d ne, Su fis xa ole u faf ra ole ; SULFONES, including Acediasuifene, Dapsone, Glucosuiiene Sodium, p-S l i yl n yi min , Su cisuifo e S fani ic Acid, Su!foxone Sodium, Thia su fon TETRACYCLINES, including C iort a yc in , C!omceydine, Demedoeydine, Doxycycline, Era acyd i e, Guameeydine, Lyrrse yd e, ed cy ine, e yd in Minocycline, Oxytetracycifne, P ni epi y ine, Pipacydine, Rofstetracyc!ine, Sar y i ne , and Tetracycline. [00187] The composition of the invention may further comprise an excipient selected fro the group comprising, but not limited to, binders and compression aids, coatings and films, colouring agents diluents and vehicles disintegrate, emulsifying and solubilising agents, flavours and sweeteners, repellents, g idan s and lubricants, plastici rs preservatives, propelianls, solvents, stabilisers, suspending agents and viscosity enhancers. [001 SB] According to a further aspect of the invention, there is provided a medical device when use in a method of treating or preventing a bacterial infection in the subject. [00 9 According to further aspect of the invention, there is provided a medical device comprising the composition of the invention. The composition of the invention may be any slow release form, and/or in the form of a coating of the medical device. [00170] Th medical device may be in a form selected from the group comprising: impla t . a plaster, a bandage, and other dressing applied to a bacterial infection in a subject. RECTIFIED SHEET (Rule 8 1} ISA/AU [ According to further aspect of the invention, there is provided a method of killing bacteria, the method including the step of contacting the bacteria with a compound of the invention, or a therapeutically acceptable salt thereof. [ 172] According to further aspect of the invention, there is provided the use of a compound of the invention, or a therapeutically acceptable salt thereof, to kill bacteria, said use comprising the step of contacting the bacteria with a compound of the invention, or a therapeutically acceptable salt thereof. 00 3 Terms used herein will have their customary meanings n the art unless " specified. As used herein, the term benid ne, CL8 (also known as i ,:5- is : EVi '* - c oro ny ) eth neaminolguanidine) refers to a compound having the following chemical structure: A H A BRIEF DESCRIPTION OF THE D A GS [00174] Further features of the present invention are more fully described the following description of several non-limiting embodiments thereof. This description is included solely for the purposes of the present invention ft s oui not be understood as a restriction on the broad summary, disclosure or description of the invention as set out above. The description will be made with reference to the accompanying drawings in which: Figure 1 presents the chemical name and chemical structure of the compounds C LGG1 Figure 2 shows a graph of the effect of CL8 on DNA n a ro lec ia synthesis in S ap /o o c s aureus according to example 2; Figure 3 shows a graph of the effect of N on R A macromo!ecuiar synthesis i Staphylococcus aureus according to example 2; Figure 4 shows graph of th effect of C S 2 on protein niacromolecuiar synthesis in Staphylococcus aureus (ATCC29213) according to example 2; Figure 5 shows graph of the effect of CL8 12 on cell wall macromolecular synthesis in Staphylococcus ATCG29 13 according to example 2; RECTIFIED SHEET R ule 9 1) !SA/AU Figure 8 shows a graph of the effect of CL o lipid acr ie i ar synthesis in Staphylococcus aureus (ATCC29213) according o example 2; Figure 7 shows a graph summarising the effect of CL8 on ac rn ie iar synthesis in Staphylococcus aureus (ATCC292 according to example 2 ; Figure 8 shows a graph of the effect of CL8 o ATP release from Staphylococcus aureus (ATCC2 according to example 3; Figure 9 shows a graph showing the average melting point peaks for the negative derivative dF/dT after real-time polymerase chain reaction of the ecA gene i ethi i in resistan S. aureus isolates grouped by ec gene complexes, A {n 4 , B n 1G) C2 n~4) and unclassified (n-2). Groups indicated with different superscripts are significantly different (P< . 5) according to example 4; Figur shows a graph of the optical densities of the ynsupplemented growth control, mp liin and different concentrations of antibacterial agent CL against methicillin-susceptible S. aureus ATCC 49775 using broth microdilufion methodology according to example 4, The concentrations of CL8 tested were at the MIC and four times the MIC determined under conditions, up to 24 h incubation. Ampiciin was tested at the MIC Bactericidal activity was teste at 0, - , . 4, 8, , and 24 h for antibacterial; Figure shows a graph of kill kinetic curves for methicii!in-susceptible S aureus ATCC 49775 demonstrating bactericidal activity o CL8 using the Clinical and Laboratory Standards Institute macrodslution methodology n a 10 ml v ai according to example 4 The concentrations of antibacteriais tested w re at 1 and the v C determined under test conditions. Bactericidal activity was determined at 0, 1, 2, 8, 1 and 24 h after antibacterial addition. Bactericidal activity defined as a 3log (99.9%) decrease in the number viable bacte a fro the initial inoculum size; Figure 2 s ows a graph indicating the change o H during macro-broth dilution assay for S. pneumoniae strain 038 exposed to 4 g mL in CL8 and 0.0023 µρ, L ampiciin according to example 5; Figure s ows a graph illustrating the 48-hour time-kill of S. pneumoniae strain D3 treated with CL81 according to exampie 5; RECTIFIED SHEET (Rule 91) ISA/AU Figure shows a graph illustrating the 48-hour time-kill of pneumoniae strain D39 treated with CL062 according to example 5; Figure shows s graph illustrating i the 14-hour time-kill of S. pneumonias strain D3 treated with CL8 2 according to example 5; Figure 16 shows a graph illustrating i the 14~h r time-kill of S. pneumonia® strain D3 treated with GL062 according to example 5; Figure 17 shows a graph illustrating the 14-hour time-kill of S. pneumoniae strain D39 treated with ampicillsn according to example 5; Figure 1 shows a graph illustrating the 12-hour time-kill of S, pneumoniae strain 039 treated with C 8 adopted from the Figure 43, according to example 5; Figure 1 shows a graph Illustrating the 12-hour isms-kill of S. pneumoniae strain 39 treated with NCL062, adopted from the Figure 44, according to example 5 Figure 20 shows a graph illustrating the 48-hour time-kill of & pneumoniae strain 039 treated with amp s n according to example 5; Figure 2 1 shows a graph illustrating the 48-hour time-kill of S pneumoniae strain D39 treated with erythromycin according to example 5; Figure 22 shows a graph illustrating the 48-hour time-kill of S pneumoniae strain D3 treated with NC 8 2 and 5% choline chloride; Figure 23 shows a graph illustrating the 12-hour time-kill of S. pneumoniae strain D3 treated with C and 5% choline chloride according to example 5; Figure 24 shows graph illustrating the 48-hour time-kill of S. pneumoniae strain D39 treated with CL 2 an 5% choline chloride according to example 5; Figure 25 shows a graph illustrating the -hour time-kill of 8. pneumoniae D3 treated with NCL062 and 5% choline chloride according to example 5; Figure 26 shows a graph illustrating the 48-hour time-kill o pneumoniae D3 treated with a p ciliin and choline chloride according to example 5; Figure 27 shows a graph of the relative MBC of D39 treated with NCL812 or NCL082 for 48 hours according to example 5; RECTIFIED SHEET R l 1) ISA/AU Figure 28 shows a graph illustrating the relative minima! bactericidal concentration { C} of S pneumoniae strain D39 treated with ampici!iin over a 48 ti e period according to example 5; Figure shows a graph illustrating the relative BC for S. pneumoniae strain D3 treated with erythromycin over a 48 h time period according to example 5; Figure 30 shows a graph illustrating the viable count i g CFU/ } of 5 . pn ni strain D39 treated with CL8 fro a macro-broth dilution of time-kill over 24 hours according to example 5; Figure 3 1 shows graph illustrating the viable count lo CFU/mi) of S. pneumoniae strain D3 treated with ampicil!irs from a macro-broth dilution of time-kill over 24 hours according to example 5; Figure 32 is a bar graph illustrating the mea cell membrane thickness of treated and untreated D39 according to example S; Figure 33 is a bar graph illustrating the mean width of p iplasmic space of treated ( g/ CL812) a d untreated 039 sample according to example 5; Figure 34 shows the kill kinetics of MRSA 580 isolate obtained at different concentrations of CL 2 over a period of 8 hours according to example 7; Figure 35 shows the kill kinetics of MRSA 5 0 in different concentrations of NCL over period of 24 ft according to example 7; Figure 36 shows the kill kinetics of v RSA 8 n different concentrations of .. over a period of 24 according to example 7; Figure 37 shows the kill kinetics of VRE 26 dc) at different concentrations of GL over a period of 24 ft according to example 7; Figure shows the kill kinetics of VRE 16c dc at different concentrations of CLS over a period of 24 ft according to example 8; Figure 39 shows the kill kinetics assay of Staphylococcus r KC 1 t different concentrations of C 81 , up to 24 h incubation according o example 8; Figure 40 shows the k ll kinetics assay of E r c s fa a is S 1 at different concentrations of CL81 , up to 24 h incubation according to example 8; and RECTIFIED SHEET Rule 9 1) ISA AU 8 1 Figure 4 1 is a graph illustrating the cumulative release of CL812 a NCL099 from Formulation B according to example 10. 00 5] Before describing the present Invention in detail, it is to be understood that the invention is no limited to particular exemplified methods or compositions disclosed herein. It is also to be understood that the terminology used herein is fo the purpose of describing particular embodiments of the invention n y, and is not intended to e limiting. |00178| Ail publications referred to herein, including patents or patent applications, ar incorporated by reference in their entirety. However, applications that are mentioned herein are referred to simply for the purpose of describing and disclosing the procedures, protocols, and reagents referred to in the publication which may have been used in connection with the invention. The citation of any publications referred to herein is not to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. [0 7] in addition, the carrying out of the present invention makes use of, unless otherwise indicated, conventional microbiological techniques within the skill of the art. Such conventional techniques are known to the skilled worker. [D0178] As used herein, and in the appended claims, the singular forms ¾' "an", and 'the" include the plural unless the context clearly Indicates otherwise. [00179] Unless otherwise indicated, all technical and scientific terms used herein have the sa e meanings as commonly understood by one of ordinary skill in the art to which this Invention belongs. Although any materials and methods similar to, or equivalent to, those described herein may be used to carry out the present invention, the preferred aterial and methods are herein described. 00 0] The invention desc bed herein may include one or more ranges o values (e.g. sl¾ concentration, dose etc). A range of vaiues will be understood to include a l values within the range, including the values defining the range, and values adjacent to the range that lead to the same or substantially the same outcome a the values immediately adjacent o that value which define the boundary of the range. [GD j The pharmaceutical or veterinary compositions of the invention ma fee administered in a variety of unit dosages depending on the method of administration, target site, RECTIFIED SHEET (Rule 9 1) SA A 82 physiological state of the patient a d other medicaments administered. For example, unit dosage form suitable for oral administration include solid dosage forms such as powder, tablets, pills, and capsules, a d liquid dosage forms, such as elixirs, syrups, solutions and suspensions. The active ingredients may a so be administered a in sterile liquid dosage forms. Gelatin capsules may contain the active ingredient and inactive ingredients such as powder carriers, glucose, lactose, sucrose, man tol, starch, cellulose or cellulose derivatives, magnesium s a at stea c acid, sodium saccharin, talcum, magnesium carbonate, and th like. [00182] The phrase "therapeutically effective a ounf as used herein refers to an amount sufficient o Inhibit bacterial growth associated with a bacterial infection or colonisation. That is, reference to thfe administration of the therapeutically effective amount of a compound of Formula according to the methods or compositions of the invention refers to a therapeutic effect n which substantial bacteriocidal or bacteriostatic activity causes a substantial inhibition of bacterial infection. The term "therapeutically effective amounf as used herein, refers to a sufficient amounf of the composition to provide the desired biological, therapeutic, and/o prophylactic result. The desired results include elimination of bacterial infection or colonisation or reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An effective amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation. Irs l to a pharmaceutical or veterinary composition, effective amounts ca be dosages that are recommended in the modulation of a diseased state or signs or symptoms thereof. Effective amounts differ depending on the composition used and the route of administration employed. Effective amounts are routinely optimized taking in o consideration pharmacokinetic and pharmacodynamic characteristics as wel as various factors of a particular patient, such as age, weight, gender, etc and the area affected by disease or disease causing microbes. 1 3] As referred to herein, the ter s "treatment" or "treating" refers to the full or partial removal of the symptoms and signs of the condition. For example, in the treatment o a bacterial infection or colonisation, the treatment completely or partially removes the signs of the infection. Preferably in the treatment of infection, the treatment reduces or eliminates the infecting bacterial pathogen leading to microbial cure. | 0 4] As referred to herein, the term "bacteria" refers to members of a large domain of prokaryotic microorganisms. Typically a few micrometres in length, bacteria have a number of shapes, ranging from spheres to rods and spirals and can be present as individual cells ©r present in linear chains or clusters of variable numbers and shape. Preferably the terms "bacteria" and its adjective "bacterial" refer to bacteria such as Oram positive St p c ciJ spp, St pt ccc s spp, 8 spp, Eni r o spp. t& spp, and RECTIFIED SHEET (Rule 91} ISA AU anaerobic bacte a Gram negative Escherichia coli, Enierobacter spp, Klebsiella spp and Pse do na spp; and the ce l wall free bacteria such as Mycoplasma spp and Ureap as a spp. The terms may refer to an antibiotic-sensitive strain or an antibiotic-resistant strain In preferred embodiment, he terms refer to SA or RSP another preferred embodiment, the terms refer to Staphylococcus spp, Streptococcus spp, E te rococc s spp, Clostridium difficile, Escherichia coli, En eroba t ' spp, Klebsiella spp and Pseudomonas spp, [ 85! Refemed to herein, the term "rnethic-liin-resistant bacteria" such as rnethic!in- resistant Staphylococcus) refers a bacteria isolate that demonstrates resistance at any dose to all ~ac ams including penicillins, carbapenems and first to fourth generation cephalosporins, but not to the fifth generation anti SA cephalosporins (for example ceftaroiine). ltidr g- re an (MDR) s defined as acquired non-susceptibsiity to at feast one agent in three or more antimicrobial categories, extensively drug-resistant (XDR) is defined as non-susceptibility to at least one agent in all but two or fewer antimicrobial categories (i.e. bacterial isolates remain susceptible to only one or two categories) and pandrug-resistant (PDR) is defined non- suseeptibity to all agents in all antimicrobial categories currently available. [0 An example of susceptible, MDR, XDR and PDR bacteria includes the following. W S type, antibacterial unexposed isolates of Staphylococcus aureus that are likely to be susceptible to all of the following antibacterial categories (and agents): aminoglycosides (fo example gentamscin); nsa ycin (for example rifampi in ; anti RS cephalosporins (for exampl ceftaroiine); nti-staphyto c ca β-Iactams (for example oxacillin or cefoxitin); carbapenems (for example ertsoenem, ipenem, meropenem or do p rsem); non-extended spectrum cephalosporins; 1st and 2nd generation cephalosporins (for example cefazo i or cefuroxime); extended-spectrum cephalosporins; 3rd and 4th generation cephalosporins (for exa ple cefotaxime or ceftriaxone); cep am cin (for example cefoxitin or cefotetan); fluoroquinolones (for example ciprofloxacin or moxiftoxacin); folate pathway inhibitors (for example trimethopnm-sulphamethoxazole); fuddanes (for example fusidic acid); giycopep de (fo example vancomycin, te planin or teiavanein); gl cylcycl ne (for example tigecyciina); l n osam des (for example clindamycin); lipopeptides (for example daptomycin); rr a r i es (for example erythromycin); oxazolidinones (for example !ine d or tedi id); phe ic ls (for example chloramphenicol); phosphonic acids (for example fosfomycin); s r p og a ns (for example quinuprisiin-daSfoprisiin); and tetracyclines (for example tetracycline, doxyc i e r minocycline). Isolates that are non-susceptible to more than one agent i more than three antimicrobial categories are classified as MDR (all V SA for example, me t the definition of I DR ). isolates that are non-susceptible to mor than one agent in a l but one or two antimicrobial categories are classified as XD R Isolates that are non-susceptible to all listed antibacterial agents are PDR. RECTIFIED SHEET (Rule 9 1) SA AU [Q0 7] Pharmaceutically and veterinary acceptable sa ts include salts which retain the biological effectiveness and properties of the compounds of the present disclosure and which are not biologically or otherwise undesirable, i many cases, the compounds disclosed herein capable of forming acid and/or base salts by virtue of the presence of ami o and/or carboxyl groups or groups similar thereto. Acceptable base addition salt can be prepared from inorganic and organic bases. Salts derived fro inorganic bases, Include by way of example only, sodium, potassium, lithium, ammonium, calcium and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary a d tertiary amines, such as by way of e only, alkyl amines, dialkyl amines, alkyi amines, substituted a ky amines, di{subsrituted alkyl) , tri($ubstituted alkyl) amines, aikanyl amines, dialkenyl amines, frialkenyl amines, substituted alkenyl amines, dl{suhstituted alkenyl) amines, tri{substifuted alkenyl) amines, cycloalkyi amines, di(cydealkyi) amines, t (c c oaik ! amines, substituted cycloalkyi amines, disubstituted cy J aiky! amines, trisubstituted cycloalkyi amines, cycioalkenyl amines, di(cycloalkenyi) amines, th{cycJoaikenyi) amines, substituted cycioalkenyl amines, disubstituted cycioalkenyl amines, trisubstituted cycioalkenyl amines, ary amines, diary) amines, triaryi amines, heteroaryl amines, diheteroaryf amines, triheteroaryl amines, heterocyclic amines, diheterocyclic amines, triheierocyclic amines, mixed di- and tr -amin where at least two of the substttuents on the a ine are different and are selected from the group consisting of alkyl, substituted alkyl, aike y substituted afkenyi, cycloalkyi, substituted cycloalkyi, cycioa!kenyi, substituted cycioalkenyl, aryl, heteroaryl, heterocyclic, and the ike . Also included are amines where the two or three s stifuents, together with the amino nitrogen, form a heterocyclic or heteroaryl group. [0 8 Pharmaceutically and veterinary acceptable add addition salts may be prepared from inorganic and organic acids. The inorganic acsds that can be used include, by way of example o ly, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like. The organic acids that can be used include, by way of example only, acetic acid, propionic acid, glycoiic acid, pyruvic a d, oxalic acid, a Sc acid, malonic acid, succinic acid, aIsl acid, fumaric acid, tartaric acid, cit c acid, benzoic acid, cinnamic acid, mand c acid, methanesulfonic acid, ethanesulfonic acid, p~toluenesuSfonic acid, salicylic acid, and the like. 00 0] The pharmaceutically or veterinary acceptable salts of the compounds useful in the present disclosure can b synthesized from the parent compound, which contains a basic or acidic moiety, by conventional chemical methods. Generally, such salts can be prepared reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, eihanoi, isopropanol, or a etonit are preferred. Lists of suitable salts are found n Remington's Pharmaceutical Sciences. 17th ed. RECTIFIED SHEET Rule 91) SA AU Publishing Company, Easton, Pa. (1985), p. 1418, the disclosure of which is hereby incorporated by reference. Examples of such acceptable salts are the iodide, acetate, phenyl acetate, tri f! oro et te, aery! ate, asc rb te, benzoate, ch r b nzoate, di trohenz aie, hydr xybenz ate methoxybsnzoate, athylben oate o ac tox ben oate naphfhai©ne-2~ ben ate bromide, isob rate, phenyJbutyrafe, γ-hydroxybutyrate, hydroxybutyra e yne- i,4-dioate, haxyr?e-i,4-dioate, hexyne- ,6-di ate caproate, apry t , chloride, i nama e, citrate, deoan a e, formate, fumarate, glyeollafe, heptanoate, hippurate, lactate, alafe aleat , hydr y at at , n onate mandeiate, mesylate, nicotinate, is ni ti st , nitrate, oxalate, phthalate, tarepht te phosphate, monohydrogenphosphate, dihydroganphosphaie, etaphosphate pyrophosphate, p opi ate, propionate, phenyipropionate, salicylate, s ba a , succinate, s be te, sulfate, bisuifate. pyrosulfate, sulfite, bisulfite, sulfonate, benzenes nate p^romophanylsirifonate, chlorobenzenesulfonafe, propanesulfonate, ethanesuifonate, 2- hydroxyethanesultonate, rnerhanesulfonate, naphtha ene su fonat , naphthalene-2-sulfonate, p-toluenesulfonate, xyienesuifonate, tartarate, and the like. [00190] The pharmaceutical or veterinary compositions of the invention may be formulated in conventional manner, together with other pharmaceutically acceptable excipients if desired, into forms suitable for oral, parenteral, or topical administration. The modes of administration may include parenteral, for example, intramuscular, subcutaneous and intravenous administration, oral administration, topical administration and direct administration to sites of infection such as intraocular, intraaurai, intrauterine, intranasal, inframarnmary, intraperitoneal, n raies onai, etc. 100191] The pharmaceutical or veterinary compositions of the invention may be formulated for oral administration. Traditional inactive ingredients may be to provide desirable colour, taste, stability, buffering capacity, dispersion, or other known desirable features. Examples include red iron oxide, silica gel, sodium laurel sulphate, titanium dioxide, edible i ink, and the like. Conventional diluents may be used to make compressed tablets. Both tablets and capsules may be manufactured as sustained-release compositions for the continual release of medication over a period of time. Compressed tablets may b in the form of sugar coated or film coated tablets, or enteric-coated tablets for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration may contain colouring and/or flavouring to increase patient compliance. As an example, the oral formulation comprising compounds of the invention may be a tablet comprising any one, or a combination of, the following exc pia is calcium hydrogen phosphate dehydrate, i rocrysta ine cellulose, lactose, hydroxy-propyl methy cellulose, and talc. [00192] The compositions described herein may be in the form of a liquid formulation. Examples of preferred liquid compositions include solutions, emulsions, injection solutions, RECTIFIED SHEET (Rule 9 1} SA AU solutions contained in capsules. The liquid formulation ay comprise a solution thai includes a therapeutic agent dissolved in a solvent. Generally, any solvent that ha the desired effect may be used in which the therapeutic agent dissolves and which can be administered o a subject. Generally, any concentration of therapeutic agent that has the desired effect ca b used. The formulation i some variations is a solution which is unsaturated, a saturated or a supersaturated solution. The solvent may be a pure solvent or may be a mixture of liquid solvent components. In some variations the solution formed is an in situ elling formulation. Solvents and types of solutions that may be used are well known to those versed in such drug delivery technologies. |0 93] The composition desalted herein may be in the for f a liquid suspension. The liquid suspensions may be prepared according to standard procedures known the art. Examples of liquid suspensions include micro-emulsions, the formation of o plexing compounds, and stabilising suspensions. The liquid suspension may be In undiluted or concentrated form. Liquid suspensions for oral us may contain suitable preservatives, antioxidants, and other exciplents known i the art functioning as one or more of dispersion agents, suspending agents, thickening agents, emulsifying agents, wetting agents, soi bi isi g agents, stabilising agents, flavouring and sweetening agents, colouring agents, and the like. The liquid suspension may contain glycerol and water. [ 01 4] The composition described herein may be n the form of an oral paste. The oral paste may be prepared according to standard procedures known in the art, [001 5] The composition is described herein may be in the form of a liquid formulation for injection, such as intra-muscuiar injection, and prepared using methods know i the art For example, the liquid formulation may contain polyvinylpyrrolidone 3 and wafer. [00 6] The composition is described herein may be in the form of topical preparations. The topical preparation may be in the form of a lotion or a cream, prepared using methods known in the art. For example, a lotion may be formulated with an aqueous or oily base and may include one or more exciplents known in the art, functioning as viscosity enhancers, emulsifying agonis, fragrances or perfumes, preservative agents, chelating agents, pH modifiers, antioxidants, and the like. For example, the topical formulation comprising one or more compounds of the invention may be gal comprising anyone, or a combination of. the following exciplents: PEG 8000, PEG 4000, PEG 200, glycerol, propylene glycol. Th NC 8 compound may further be formulated into a solid dispersion using oi P ys (BASF, www.solupius.eomJ and formulated with anyone, o a combination of, the following exciplents: PEG 8000, PEG 4000, PEG 2G0, glycerol, and propylene glycol. RECTIFIED SHEET (Rule 9 1) SA AU GG1 7] For aerosoi administration, the composition of the invention is provided in a finely divided form together with a non-toxic suffactant and a propellent The surfactant is preferably soluble in the propeilant. Such surfactants may include esters or partial esters of fatty acids. 0 198] The compositions of the invention may alternatively be formulated for delivery b injection. As an example, the compound is delivered by injection by any one of the following routes: intravenous, intramuscular, intradermal, intraperitoneal, and subcutaneous, [00199] The compositions of the invention ma alternatively be formulated using nanotechnotogy drug delivery techniques such as those known in the art. anot ehn logy- based drug delivery systems have the advantage of improving bioavailability, patient compliance a d reducing side effects. [00200] The formulation of the composition of the invention includes the preparation of nanoparticles in the form of nanosuspensions or nanoemulsions, based on compound solubility. Nanosuspensions are dispersions of nanosized drug particles prepared by bottom-up or top down technology and stabilised with suitable excipients. This approach may be applied to the compounds of the invention which ca have poor aqueous a d lipid solubility, in order to enhance saturation solubility and improve dissolution characteristics. An example of this technique set out in Sharma and Garg (2010) Pure drug and polymer-based nanotechnotegies for the improved solubility, stability, bioavailability, and targeting of anti-H!V drugs. d ed Dr g Delivery R&views, 82: p. 491 -502). Saturation solubility will be understood to he a compound-specific constant that depends on temperature, properties o the dissolution medium, and particle size < 1~2 m . [00201] The composition of the invention may be provided in the of a nansuspension. For nanosuspensions, the increase in the surface area may lead to an increase in saturation solubility. Nanosuspensions are colloidal drug delivery systems, consisting of particles below 1 m. Compositions of the invention may be n the form of nanosuspensions including nanocrystalline suspensions, solid lipid nanoparticles SL s), polymeric nanoparticles, nanocapsuies, polymeric micelles and dendrimers. Manosuspensions may be prepared using a top-down approach where larger particles may be reduced to nanometre dimensions by a variety o techniques known in the art including wet- milling and high-pressure hornogenisation. Alternatively, nanosuspensions may be prepared using a bottom -- p technique where controlled precipitation of particles may be carried out from solution. [GG202] The composition of th invention may be provided in the form of a nanoemuision, Nanoemulsions are typically ear Qi!~in~water or water-irvoil blphasic systems, with a droplet size i the range of 100-500 n , and with compounds o interest present in the hydrophobic phase. The preparation of nanoemulsions may improve the solubility of the compounds of the RECTIFIED SHEET (Rule 91) i A AU invention described herein, leading to better bioavailability. anosi ed suspensions may include agents for electrostatic o steric stabilisation such as polymers and surfactants. Compositions in the form of SLNs may comprise biodegradable lipids such as triglycerides, steroids, waxes and e s fi rs such a soybean lecithin, egg lecithin, and poioxamers. The preparation of a SLN preparation ma involve dissolving/dispersing drug in melted lipid followed by Hot or cold homogenisation. If hot homogenisation is used, the melted !ipidic phase may be dispersed in an aqueous phase and an emuision prepared. This ay be solidified by cooling to achieve SLNs. f cold homogenisation is used, the lipidic phase may be solidified in liquid nitrogen and ground to micron size. The resulting powder ay be subjected to high-pressure homogenisation in an aqueous surfactant solution. [00203] The Compounds of Formula as described herein may be dissolved n oils/liquid lipids and stabilised sn an emuision formulation. Manoemuissons may be prepared using high- and low-energy droplet reduction techniques. High-energy methods may include high-pressure homogenisation, uit as i ati n and microfluidfsafion. f the low-energy method is used, solvent diffusion and phase inversion will generate a spontaneous nanoemuision. Lipids used in nanoemulsions may be selected from the group comprising triglycerides, soybean oil, saff wer oil, and sesame oil. Other components such as ernulsifiers, antioxidants, pH modifiers and preservatives may a so be added. [00204] The composition may be in the form of a controlled-release formulation and y include a de rad ie or non-degradable polymer, h droge organogel, or other physical construct that modifies the release of the compound. t is understood that such fonrtuiations may include additional inactive ingredients that are added to provide desirable colour, stability, buffering capacity, dispersion, or other known desirable features. Such formulations may further include liposomes, such as emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers and the like. Liposomes for use in the invention ay be formed from standard vesicle-forming lipids, generally including neutral and n ativ ! charged phospholipids and a sterol, such as cholesterol. [00205] The formulations of the invention may have the advantage of increased solubility and or stability of the compounds, particularly for those formulations prepared using nanotechnology techniques. Such increased stability and/or stability of the compounds of Formula 1 may improve bioavailability and enhance drug exposure for oral and/or parenteral dosage forms. [00208] Throughout this specification, unless the context requires otherwise, the word ''comprise" or variations such as ''comprises* or "comprising", wil be understood to imply the RECTIFIED SHEET (Rule 9 1) SA AU inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers EXAMPLES The minimum inhibitory concentrations ( !C) for NCL 1 in thi l in- resistant Staphylococcus aureus (URSA), vancorrrycin-rasistant nt cc $ spp. (VRE) and Streptococcus pneumoniae. [002 ] As is apparent from the preceding summary of the invention, the invention relates to compounds of Formula , methods of treatment of a bacte al infection, uses and medical devices. [00208] This study was undertaken to determine minimum inhibitory concentrations (MIC) for antibacterial agent C 8 . The antibacterial agent represents a potentially new class of drug with a narrow spectrum of activity against bacteria and a novel mechanism of action. This study focused on recent isolates of three major opportunistic pathogens of humans where the development of antibacterial resistance to existing antibacterial classes is problematic: methiciiSin-resistartt Staphylococcus aureus ( SA), vanco in-res tan Enterococcus spp. (VRE) and Streptococcus pneumonia®. [00209] in this example, NCL8 minimum inhibitory concentrations ( Cs were determined for 6 1 Australian cfinicai isolates (comprised of 2 1 SA, 20 putative V E and 20 . p @u nl & isolates). The MIC profiles for CL812 ware found to be remarkably consistent, with and values of 4 g/mL recorded for each of the species tested. and Bacteria! ol Collection sn identification [00210] Sixty one test isolates were soureed fro clinical diagnostic microbiology laboratories. The isolates were originally cultured on selective Brilliance MRSA Chro o en Agar (Oxoid). Suspect colonies were selected on the basis of their colony appearance on this agar and identification as Staphylococcus was determined using colony characteristics on non-selective Sheep Blood Agar (SBA and phan ypic characteristics such a Gram stain, positive a afase test, positive eoagulase test (tube eoagulase test using rabbit plasma) and dumping factor (agglutination with the Oxoid Staphyfect latex test), positive Voges Pros a r test, and the ability to produce acid from trehalose. A positive cefoxitin resistance screen confirmed the isolates as MRSA. All Enterococcm isolates underwent a standard biochemical identification. Biochemical profiling provisionally identified four of the VRE RECT IFIED SHEET (Rule 9 1) ISA/AU isolates as Ent roc c s faeca!is and the remainder as Ent r s fae i . All S. pneumoniae isolates were identified on the basis of standard biochemical profiling. Preparation of Antibadariais [0021 ] Analytical grade CL81 (batch 20081 214} with a defined potency of 00 mg/g (ie 100% was obtained. The powder was stored at a temperature of -20 X . Ailquots (1 ml) of stock solution 25,6 / L were prepared in D V Q a d stored at -80 C and defrosted immediately before use. Preparation of 96 w roti re plates for broth i r b n MIC test using NCL812 [00212] Cation adjusted Mueller Hsnton Broth (CA B) was prepared using 100 mL sterile Mueller Hinton broth pH adjusted). To each 0 mL volume, 125 L of calcium stock solution (10 g Ca + per ml) and 43 L magnesium stock solution 1 rng per l ) was aseptica!ly added. Sufficient broth is made up for daily use, with unused portions being stored at 4 C overnight. [00213] cro ii tion trays with 4% fy ed horse blood in CA HB was prepared b lysing horse blood (Oxosd) by repeated freezing and thawing 3-4 times) and aseptica l mixing the sed horse blood (LHB) 50:50 with sterile distilled water. A ce l free suspension was obtained by entrif gi g 50% LHB at 1 ,000 g 7000 rprrt) for 20 mi . The supernatant was decanted, recentrifuged and stored frozen. 50% LHB was diluted with CAMHB to obtain a final concentration of 4% (7 l LHB into 93 mL CAMHB). 4% LHB-CAMHB was used Instead of CAMHB in all steps in the preparation of the mlcrodiiution frays and preparation of antimicrobial solutions for Streptococcus species. [0 214 A stock antibiotic working solution of CL812 was prepared to a concentration of 25 80 ng/ L. Potency was described 1000 mg/g or 0% The powder was dissolved in 10 mL DMSQ and 1 mL volumes were aiiquoted into ppend r tubes and stored at -80 C. When added to CAMHB, a fine cloudy precipitate formed, and was shaken well before and during aiiquoting. [ 2 1 ] A stock solution of ampicillin was prepared to the concentration of 2 .60 mg/mL. Ampicil!in was used for internal quality control. The powdered ampicillin was dissolved in 4 mL of phosphate buffer pH 8.0, 0.1 L, then diluted in L phosphate buffer pH 6.0, 0.1 mo!/L. 1 mL volumes were aiiquoted into eppendorf tubes and stored at -80 002 ] Fo Staphylococcus a a working solution of 25 / L was prepared by diluting stock solutions as described above 1:100 n CAMHB (100 into 9. mL). When Θ0 pL RECTIFIED SHEET (Rule 9 1} !SA/AU was added to each weli 2 , there was a 1:2 dilution so that vveiS 2 had 1 8 g/ L o antibiotic. The range of antimicrobial was calculated as 0.25 g/ L (well 3} to 1 8 g/rnL (well 12 . [00217] For E ter ss species, a working solution of 84 g/ n L was prepared by diluting stock solutions as described above 1:400 in CAMHB (100 pL into 9.9 ml, then further dilute this :4 , he n 90 pL was added to w el there was a 1:2 dilution so that well 12 had 32 g/ L of antibiotic. [00218] For Streptococcus pneumoniae, a working solution of 64 pg/ L was prepared by diluting stock solutions as described above 1:400 in 4% L -CA B 0 i to 9.9 mL, the further diluting this 1:4 When 90 pL Mars added to w e l 1 there was a 1:2 dilution so that well 12 had 32 g/rnL of antibiotic. [00219] Se al dilutions ware prepared in 98 w e i plates were set up in a safety cabine according to methods standard n the art. Brifely: 90 pL of the working antibiotic solution was added to each weli n Column 12 of the plate, and mixed well, before 90 µ was transferred to column 11. The solutions were mixed again, and then transferred to the next column as before, continuing the dilutions through to column S. Mixing the well requires the pick u p and expulsion of in each w e 3-4 times before picking up and transferring the 90 pL t the next w el Column 2 (bacterial positive control) and column 1 (negative control) did not form part of the serial dilution. The frays were set up as follows: 2 strains were tested in duplicate in one tray, such that strain 1 was located in rows A to D, strain 2 was located in rows E to H , etc. The !C pg/ L) Interpretive Standard for Ampiciliin using Control strains is shown in Table 1 below. Staphylococcus aureus AT C 29213 Acceptable range for Ampiciliin 0.5 to 2 pg/mL Enierococcus fa ca is ATCC 29212 Acceptable M\C range for Ampiciliin - 0.5 to 2pg/mL, Streptococcus pneumoniae ATCC 49819 Acceptable range for A mpic n - 0 ,0 to 0.25 rnL Table 1: \C (Mg/mL) Interpretive Standard for Ampiciliin using Control strains according to Example . if im ._ Preparation of bacterial suspension for broth icro i tion MIC method [00220] Fres cultures of bacteria were prepared for testing on sheep blood agar (SBA) and overnight incubation at 3 C as follows; 2-3 colonies of each strain in 7 ml sterile saline, and the O Ds measured as an indication of the density (approx. 0 .5 08 FU/m or 0.5 RECTIFIED SHEET (Rule 9 1) ISA AU McFariand Standard). The bacteria! suspension was adjusted to a final bs rban e of 0.08 to 0.1 0 , using saline to achieve correct density, and as the blank. Within minutes of preparation, the adjusted bacterial suspension with sterile saline 1:20 ( 1 L into 19 ml sterile saline) to achieve a final bacterial concentration of 4 to s CFU/rnL. The bacterial solution was placed into a sterile trough and of bacteria! solution added into wells through to 12 on each required row (dilution of 1:1 with final concentration of bacteria in wells = 5* 5 CFU/mL). Th tray was seated and incubated at 3? °C for 18-24 h. The pu ty of bacterial suspension was confirmed by streaking out 50 o he 1:20 dilution onto a SBA p!ate, which incubated for 37 °C for h and examined. Viable counts were carried out to ensure that the correct concentration of bacteria and been added to the wells. The diluted bacterial solution (4 to 5 1 CFU/mL) was diluted 1:1 downwards b adding 0 µ to 900 p of sterile saline in sterile tubes, and the serial dilutions continued 1:10 for 5 tubes. 100 pL (4-5 drops) of the 4 h and 5 dilutions tub© 4 105 and tube 5 = 8 CPU/ml) was plated around in duplicate on pre- dried P A agar plates and incubated at 37°C overnight. The following day the number of colonies on the plates was counted and the average count in 100 L obtained. Th study was multiplied by 10 to obtain a viable bacterial count per mL. Description and identification of isolates [00221] The RSA isolates were originally cultured on selective Brilliance RSA Chfo geni Agar (Oxoid). Suspect colonies were selected on the basis of their coiony appearance on this agar and identification as Staphylococcus r& s was determined using colony characteristics on non-selective SBA and phenotypic characteristics such as Gram stain, positive catalase test, positive coaguiase test (tube coaguiase test using rabbit plasma) and clumping factor (agglutination with the Oxoid Staphytect latex test), positive Voges Proskauer test, and the ability to produce acid from trehalose. A positive cefoxitin resistance screen confirmed the isolates as IV!RSA. [00222] RSA clonal complexes were determined by rapid molecular typing. Two of the strains could not be typed using the rapid method, a shown in Table 2 below. Table 2: a table showing the MRSA clonal complexes according to Example . RECTIFIED SHEET (Rule 9 1) ISA AU using the and are currently being identified using tra 01 [00223] Enter cc s isolates underwent a simplified bio on Quinn et. a . 1994, Clinical Veterinary Microbiology, y Ltd Biochemical profiling provisionally identified four of the VRE isolates as En &ro c a/'s and the remainder possibly En &r Qcc s fa&ci All S. pn ni isolate: basis of standard biochemical profiling. Test product storage [00224] Analytical grade CL812 (batch 20081214) with a def s 00 mg/g (i 0% wm obtained and the powder was stored at a temperature ) °C, q e s (1 mL) of stock solution (25.8 T g/ L) were prepared n D S and stored s 10 C and defrosted Immediately before use. [00225] Minimum inhibitory concentrations pg mL were determined using the broth ic r d i t t S method recommended by the Clinical and Laboratory Standards Institute ( S!) (Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aer bi a ly; Approved Standard ~ Seventh Edition. CLS M7-A7, 2006; Performance Standards fo Antimicrobial and Dilution Susceptibility Tests for Bacteria isolated from Animate; Approved Standard Second Edition. CLSI 31-A2, 2002; Performance Standards for Antimicrobial Susceptibility Testing; CLSI 2-A9, 2008 RECTIFIED SHEET (Rule 9 1) ISA AU [00228] The MIC was regarded as the the lowest concentration of an antimicrobial agent that completely inhibited growth of the organism in the microdilution wells as detected by the unaided MIC breakpoints were determined by visual assessment and then confirmed using EL ISA plate reader, measuring abs r ance levels at 450 nm. Bacterial growth (turbidity) in the wells wit antimicrobial was compared with the amount of growth (turbidity) in the growth- control well (containing no antimicrobial). All isolates were tested in duplicate, if there was a difference of greater than one two-fold dilution in the results, the test was repeated a third ti e The purify of the isolates was closely monitored during testing by subculturirsg the prepared bacterial inoculum onto 8 8 A Control organisms Ent&r c s faeca!ss strain ATCC 29212, S. aureus strain ATCC 29213 and 5 . pneumoniae strain ATCC 49619) were used throughout the testing to monitor quality control. The M Cs of the control strains for the antimicrobial ampiclin (range 1.0, 2.0 and 0.06 i , respectively) were determined for each testing ru as an interna! quality control The ! s - MIC range (minimum and maximum) were calculated for each of the bacterial groups. Results [00227] Ampiciin !C values obtained for the ATCC control strains were within the normal range expected on the basis of CLS recommendations. The NCL81 and ampiciin M C values for each isolate are indicated in Table 3 (MRSA isolates), Table 4 (VRE isolates) and T te {S, pn on ae isolates) below. IC o, C ¾ MIC mode and M C range for each of the species of bacteria tested are shown in Table 6 below. The considered to be the lowest concentration which inhibits visible growth for 50% of the isolates. The ¾ considered to be the lowest concentration which inhibits visible growth for % of the isolates. The MIC mode is the most commonl occurring M C value and MIC range the minimum and maximum M C values obtained. Table 3; The Minimum Inhibitory Concentrations for the individual Staphylococcus aureus isolates according to Example 1. RECTIFIED SHEET (Rule 91) ISA/AU AMP m m 4; The Minimum inhibitory Concentrations for the individual Enter c isolates ng to Example : The n m Inhibitory Concentrations for the individual Streptococcus p u on ites according to m 1. RECTIFIED SHEET (Rule 91) !SA/AU h i 8: The CL8 C CSQ> MIC mode and MIC range for Australian isolates of URSA, E ar d . pneumoniae. - - s - i , e S ¾as* - ss » $w & » . [00228] C L values were consistent within and between each of the three species. and C ;¾ values were both equal (4 g/ i for RSA VRE and S. pneumonia® isolates, with less than % of isolates showing MSG values either 1-2 dilutions below or only one dilution above this figure. | 2 9 O n the baste of these results, L8 12 represents a antibacterial. ¾ LE ; Effect of NCL81 2 o n Stap y c $ a a ro o ie ar Synthesis RECTIFIED SHEET (Rule 91 ISA/AU T&st compounds | 230] Test compound NCL was transported to the experimental facility under conditions of ambient temperature a d then stored at 2-8 °C until assayed, Stock solutions were ade by dissolving CL81 dry powder in 100% OMSQ to a concentrators of 8,400 g mL Vancomycin (Cat # 4335 , ifamp cin Cat # -73 Z) and Csrulenin Cat # C 238 ) wer all obtained from Sigma, Ciprofloxacin was obtained from USP Cat. # 1134335} a d Unazolid was obtained fro Ch mPa i c (Cat # 35710). ini i inhibitory Concentration Testing [00231] The MIC assay method followed the procedure described by the Clinical and Laboratory Standards institute, or CLS (Clinical and Laboratory Standards Institute &th s lor Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobicaiiy; App w &d Standard—Eighth Edition. CLSl document M07-A8 [ISBN -56238· 8 - . Clinical and Laboratory Standards Institute, 4 Q West Valley Road, Suite 1400, Wayne, Pennsylvania 087- 9 USA, 2009), and employed automated liquid handlers to conduct serial dilutions and liquid transfers. The medium employed for the !C assay was Mueller Hinton I Broth v H B - Becton Dickinson, Sparks, D Cat No 212322; Lot 9044411). S. aureus ATCC 29213 served as the quality control strain, and SinezoSid was utilized as the quality control antibiotic to validate th assay. NCL8 and Isnezoltd were both dissolved in 100% DM80 before addition to the growth medium. a r oi cuiar Synthesis A Bacteria and growth conditions [00232] The effect of NCL812 on whole cell DMA, R A , cell wall, protein and lipid synthesis was investigated using . AT C 29213. Cell were grown at 3 °C overnight on Trypticase Soy agar. A colony from the plate was used to inoculate ml of Mueller Hinton broth Η Ι ), and the culture was grown to early exponential growth phase D∞ - 0.2 to 0.3) hile incubating in a shaker at 35 °C and 200 rp n. DNA, RNA, and protein synthesis [00233] When ceils reached early exponential phase, 1 0 L of culture was added to triplicate we ls containing various concentrations of test compound o control antibiotics 5 L) at the final concentration in 1 0% D SO. A 5% D SO treated culture served as the "no drug" control for a l experiments. Cells were added n ΗΒ Ι at 105% to account for the volume of RECTIFIED SHEET (Rule 91) ISA/AU drug added to each reaction or n 9 minimal medium for protein synthesis reactions. Following min incubation at room temperature, either [ H] thymidine (DMA synthesis), H uridine ( A synthesis) or [ H| leucine (protein synthesis) was added at 0.5-1,0 µ ί per reaction, depending on the experiment. Reactio were allowed to proceed at roo temperature for -30 mi arid then stopped by adding 12 pL of cold 5% trichloroacetic acid (TCA) or 5% TCA 2% casamsno acids (protein synthesis on y). Reactions were incubated on ice for 30 min and the TCA precipitated materia! was collected on a 25 mm GF/A filter. After washing three times with 5 ml of cold 5% TCA, the filters were rinsed tw times with 5 m 0% efhanol, allowed to dry, and then counted using a Beckman LS3801 liquid scintillation counter. C&il wall synthesis [ 0234 Bacterial cells in early exponential growth phase were transferred to 9 minimal medium and added to 1.5 ml eppendorf tubes (100 pL/tube) containing various concentrations of tes compound or control antibiotics (5 pL) at 20* the final concentration in 0% D SO as described above. Following a 5 min incubation at 37 C, [ C acety g uc sarni e .4 i/reacfion} was added to each tube and incubated for 45 min in a 37 C heating block. Reactions were stopped through the addition of 1 0 µ of 8% SOS to each tube. Reactions were then heated at 95 X for 30 in a heating block, cooled, b efly centrifuged, and spotted onto pre-wet HA filters (0.45 µ . After washing three times with 5 mL of 0.1% SOS, the filters were rinsed two ti es w th 5 ml of deio ed water, allowed to dry, and then counted using a Beckman LS3801 liquid scintillation counter. Lipid t i [00235] Bacterial cells were grown to early exponential growth phase in HBi! broth and added to 1.5 ml eppendorf tubes (i triplicate) containing various concentrations of test compound or co tra antibiotics as described above. Following a 5 min incubation at room temperature, [¾H glycerol was added at 0.5 Ci per reaction. [00238] Reactions were allowed to proceed at room temperature fo m n and then stopped through the addition of 375 ch!orofor / athan l 2) followed by vortexing for 20 seconds after each addition. Chloroform (125 uL was then added to each reaction, or ed, followed by the addition of 125 uL d 0 and vortexing. Reactions were centrifuged at ,000 rp for 10 min, and the 1 0 µ .. of the organic phase was transferred to a scintillation v a! and allowed to dry in a fum hood for at least 1 nr. Samples were then counted via liquid scintillation counting. RECTIFIED SHEET Rule 9 1) ISA/AU Results 1002371 Susceptibility testing was conducted with NCL812 S. aureus ATCC 292 to determine the concentrations of drug needed In the mae o nolec lar synthesis assays. 100238] Ta 7 shows that the M C for CL8 2 was 4 µο L, wh te the quality control agent line o id was with n the CLSI-established quality control range (Clinical and Laboratory Standards Institute. Performance t for Antimicrobial Susceptibility Testing; Nineteenth inf rmatk &! Supplement CLS1 document M10G-S20 [ISBN 1-56238-716-21. Clinical and Laboratory Standards Institute, 840 West Valley Road, Suite 1400, Wayne, Pennsylvania 087-1 8 USA, 20 . Precipitation of CL8 was observed at g/mt in plates that were prepared in an identical fashion, but did not receive an inoculum of S. aureus, Macromolecular synthesis inhibition studies were performed using concentrations of CL that were equivalent to 0, 0.25, 0.5, 1, 2, 4 or 8-fold the MIC value 4 g m ) for S, aureus ATCC 29213 (Figures - . Table 7: Minimum Inhibitory Concentrations values for CL 12 ro enidin ) and l n zolid against Staphylococcus aureus ATGC29213 according to Example 2. [ 0239 Figure 2 shows the effect of CL812 on DNA synthesis. NCL812 demonstrated no inhibition at 0.25 fold the MIC, 40% inhibition at 0.5 fold, and approximately 5% inhibition at the MIC. This s compared to the control ciprofloxacin which showed approximately 5 1% at S fold the MIC (0.5 /rnL . The results for NCL8 inhibition of RNA synthesis were very similar to the DNA synthesis study, with rifampicin serving as the positive control 3 . It should be noted that precipitation was observed at 4 t 8 fold the MIC n the Mueller Hinton broth II utilized in the DNA and RNA synthesis assays. |00240] Protein synthesis was inhibited in a dose dependent manner at 0.25, 0.5, and 1 fold the Ivt C value of CL8 2 showing up to 7% inhibition at the MIC (Figure 4. U n stid demonstrated approximately 81% inhibition of protein synthesis at 8 fold the M\C (2 n L) Precipitation o C 8 occurred at 4 and 8 fold the M\C n the protein synthesis assay. [00241 in Figure CL8 2 also showed a somewhat dose-dependent Inhibition of ce wall synthesis, though there was a large Increase in inhibition from 1 to 2 fold the MIC. RECTIFIED SHEET (R i 91) ISA A However, inhibition dropped to approximately 88% and 52% at 4 fold and 8 fold the M C, respectively. Precipitation of NCL8 occurred at 2, 4, and 8 fold the MIC in the MB minimal medium used for the cell wall synthesis assay, and that s the likely cause o the decline in inhibition. In comparison, the positive control vancomycin showed 96% inhibition at fold the MIC 2 g/mL , N .. demonstrated a similar inhibition profile against lipid synthesis as that shown for DMA and RNA synthesis, reaching approximately 90% inhibition at the (Figure 6). The positive control inhibitor cerulenin demonstrated 2% inhibition at 8 fold the (32 pg/mL). [00242] y re 7 represents a composite of ail five macromoiecuiar synthesis reactions. It cars be observed that the inhibition curves were similar for each pathway, suggesting global inhibition of several pathways simultaneously by CL8 . it is possible that CL8 targets cell membrane, causing leakage of essential ions and/or metabolites, thereby leading to a global shutdow of the cell synthesis pathways. Q24 3 . summary, CL8 2 inhibited DMA, RNA, protein, ceil wail, and lipid pathways in a growing culture of S. aureus. Though some instances of dose-dependent inhibition of pathways was observed, all five macromoiecuiar synthesis reactions were similarly sensitive to CL8 3: Effect of NCL8 on ATP Release from Staphylococcus aureus Materials Methods Test compounds | 244 The tost compound N L was shipped under conditions of ambient temperature and then stored at 2-8 C until assayed. Stock solutions were made by dissolving NCLS1 dry powder n 100% SO to a concentration of 1,600 pg/mL Polymyxin B was obtained from Sigma Cat. # P-4932). T& Organism 0024 ] S. aureus ATCC 292 was originally acquired from the American Type Culture Collection (Manassas, VA). ATP Release Assay [ 24i The CeliTiter-G!o Luminescent Cel Viability Assay Promeg ) utilized to measure the leakage of ATP frora bacteria. Cultures were grown to early exponential phase (0.2 - 0.3 e er-H n n Broth II and then treated with seven different ti of either NCL8 2 or polymyxin B (positive control) utilizing the MIC for each compound a guide RECTIFIED SHEET (Rule 9 1) ISA AU (0, 0.25, .5 1, 2, 3, 4, or 8 fold the MIC). The negative control received 2% DMSO, which represented the final DMSO concentration in each assay. After a 30 rnin exposure to d , ceils were se i ented by centrifugation and the supernatant l fo the presence of ATP. Results were expressed as ATP concentration released to the medium ip . Results [00247] The V fC for CL has been previously determined to be 4 µ mL The ATP release assay is conducted by growing S. aureus to exponential phase and then adding drug at multiples of the C in an effort to detect a dose-dependent response, [0 2 ] As shown in Figure S the positive control polymyxin B released ATP from S. aureus cells in dose-dependent fashion with maximal release of approximately 0.34 ATP at 8 fold the (258 g L . ATP release in the presenc© of C 8 2 was dose-dependent at 0.5-1 fold the MIC, resulting in maxima release (0.33 µ ) observed at the MIC 4 pg/ . ATP releas actually decreased thereafter at 2 to fold the MIC, It should be noted that in previous studies precipitation of NCL812 was observed at 4 to 8 fold the MIC in u Hinton broth 11. [00249] n summary, NCL812 demonstrated dose-dependent release of ATP from actively growing S. aureus cells. ATP release from the cells nto the growth medium reached maximum levels at the MIC value, a d this was followed by a decrease in ATP release at higher doses. The data indicated that 8 may interact with the cell membrane of S. causing leakage of vital metabolites such as ATP. EXAMPLE 4 : -in vitro antibacterial activity of NCL8 against methidiSin-resistant and athicill n suscepti e Staphylococcus aureus i ¾ d Antimicrobial agents [00250] Aliquo s of stock solution of CL (25.6 g/ ) was prepared in DMSO,. stored at ~S0 °C an defrosted immediately before use. A pici in stock was obtained from Sigma- Ald h (Australia). Antimicrobial discs were obtained from Thermo Fisher Scientific (Australia). i 100251] Clinical isolates of S tha represented the ost common sequence types of both hospital-acquired (HA) and community-associated (CA) MRSA in Australia were obtained and are described i Table 8 below. The S. control organism CC 49775 was used isolate identification was confirmed by conventional phenotypic methodologies, including th RECTIFIED SHEET (Rule 91) ISA/AU s d coaguiase test, V gues Pr ska er test, polymyxin B sensitivity 300 units), and Staphyteet P us Protein A ate slide agglutination (Thermo Fisher Scientific Australia). Bacteria were stored at -80 C in 40% glycerol broth a d routinely grown from stock on sheep blood agar (SBA) incubated at 37 C In subsequent experiments, only fresh cultures « 24 h were used. RECTIFIED SHEET (Rule 9 1) SA A Tabte Staphylococcus aureus cione/is at name, typ©, source, anfibi gram, clindamycin resistance status, multi-locus sequence type (ML staphylococcal cassette chromosome SCC e type, clonal complex, Panton-Vatentine ie k d n status PVL and sp type for Isolates u according to example 4 3 f I 1 i isolate resistotyping [00252] Antibiotic-susceptibility profiling of the isolate collection was undertaker* using rby-Ba er disc diffusion, as recommended by the Clinical and Laboratory Standards Institute C S ) on il r-Hinton agar solate were grown overnight on S8A at 37 C . Colonies were suspended n physiological saline. Turbidity was adjusted to a 0 5 cFar an standard and suspensions were spread over the medium. Antibiotic discs according to Table 9 below were transferred onto the inoculated medium and analysed after 24 h incubation at 37 C. Isolates labelled as RSA that were not -lac am-r si tant on the basis of the irb - a er test were grown from stock on plate count agar supplemented with 5 g/ l a p ii in and subject to repeat testing, as PBP2a expression can be induced by exposure to aet antimicrobials. a e δ : Antibacterial agent zone diameter interpretive sizes fo Kir y Ba er disc diffusion, as used in Example 4. Disk Zone i {mm i Class rst conterst Aminoglycoside Gentamicin 10 g < 2 13-14 5 Ans y in fa p cin g si 6 17-19 Cephalosporin Cephalexin 30 < 15-17 - C p yc r C ot ti n 30 < 13-15 >1 Folate pathway Tri eth pr - 1.25/23.75 1G 11-15 16 inhibitor s f ethoxa ol p y opepfide Vancomycin 30 pg - 15 i n sam Clindamycin 2 PS <14 S-2Q ≥2 1 c o ide Erythromycin 15 g ≤13 14-22 >2S Fluoroquinolone Ciprofloxacin S 5 16-20 ¾21 Tetracycline Tetracycline 0 14 15-18 ≥ ~ ¾ r P nic to G 10 units 2 2 RECTIFIED SHEET (Rule 1) SA AU 88 cu ar detection of the A and cA gems to confirm. MRSA status [00253] isolate identities were confirmed genotypieaily using a duplex polymerase chain reaction (PCR) test targeting the spa (protein A) and mecA methi llin resistance) genes in addition, the isolates were tested in a & A and spa Sybr green real-time PCR. Approximately ten colonies of each overnight bacterial subculture was suspended in 1 phosphate buffered saline pH 7.4} and vortexed, Isolates were subject to DMA extraction using the QSAa p DNA Mini Kit (Giagers, Australia) following the manufacturers protocols. Template DNA was eiuted n 50 p of elution buffer and either used directly in PCR, or stored at 20 prior to DNA amplification using the forward (5,-TGATAGAGTAAATGACATTG -3 ) and reverse (S'~ TTCTTATCAACAACAAGTTC -3 ) primers and &cA forward 5 - ΤΤΟΘτΘΤ ΤΤη ΑΑΤΑΑΘΤΘΑΘΟ -3') and re (5 - TGAAGTGGTAAATGGTAATATCG- ) primers ( r itrog n, Australia). Conventional PCR amplification was performed in a 20 volume containing 10 HotStarTaq Plus Master Mix ( iage Australia), 0.5 of each spa primer, 0.2 µ of each mecA primer, and 3 of extracted DNA. An automated thermal cycler ( 10 Thermal Cyder, Bio-Rad) was used for PCR amplification of the and mecA ge es according to the following conditions: PCR Stage (Enzyme activation at 95 C for 300 s followed by 38 amplification rounds of 94 °C for 30 (denaturafcn), 50 C for 30 s (annealing) and 72 C for 38 s (extension) a d then a cooling stage of 2 C until required); Real-time PCR Stage (Enzyme activation at 5 C for 300 s, followed by 40 amplification rounds of 95 C for s (denaturation), 50 C for 20 s (annealing) and 0 C for 40 § (extension), a single round at 5 C for 5 s, a s nige round at 55 C for 20 s, continuous melting curve from 95 *C to 0 and a cooling period of 40 C for 30 s. The ecA and spa amplified products of 32 and 1 0 bp, respectively, were detected by Ge ed staining followed by electrophoresis in 2% agarose i . Mi imu inhibitory concentration testing [00254] The in vitro activities of NCL8 and ampici in as a positive control were determined by broth mierodi!ution as recommended by the C S in cation-adjusted Mueller- H nt n t broth ic t er plates containing two-fold dilutions of each antimicrobial agent were inoculated with FU/m of each isolate n a 0 uL final volume. Plates were incubated for RECTIFIED SHEET (Rule 9 1) SA A 24 h at 37 °C. Turbidity abs rb ne at OD ) was measured using a Bio-Rad Benchmark Plus mieroplate spectrophotometer in icroplate Manager® version 5,2.1 (Bio-Rad) Minimum inhibitory concentration (M C) endpoints were defined as the lowest antimicrobial concentration assessed by the spectrophotometer that inhibited bacterial growth. ATCC 49775 included the isolate collection as control organism using breakpoints defined by the CLS . Th (concentrations tha inhibited growth of the lower 50% and 90% of total organisms, respectively}, and MIC range (minimum and maximum) were calculated to profile the antimicrobial susceptibility of the isolate collection. Bactericidal activity [00255] The bactericidal activity of NCLS12 was established by determination of the minimum bactericidal concentration (MBC) and time-kill analyses using CLS guidelines. The 8 C was defined as the lowest drug concentration at which 98.95% of the original inoculum was eliminated. [002561 Time-kill assays for ATCC 49775 were performed in cation-adjusted Vlu - Hinion \\ broth in Microtiter plates and again in 10 m voiumes for m crodi tion at antimicrobial concentrations equivalent to 1 and 4 * the M C Bactericidal activity in macrodilution assays was identified as a l decrease from the initial inoculum s ze . Bacteria were cultured overnight at 37 X on SBA Colonies were suspended in broth and the turbidity was adjusted to a 0.5 McFariand standard to obtain a bacterial suspension of '- * CFU/mi. Bacterial suspensions were incubated at 37 °C with shaking. Aliqudts were removed at 0 , 1, 2, 4 , 8, 2 , and 24 ft after antimicrobial addition, diluted, plated onto SBA and incubated for 48 at 37 ¾ for viable count determination. Turbidimetric growth curves for . were obtained for cr ti r plate assays by monitoring optical density changes using a Bio-Rad Benchmark Plus mieroplate spectrophotometer at 800 n . Optical densities were measured at 0, 1, 2, 4 . 8, 12, and 24 h after antimicrobial addition. Statistical methodology [00257] Microbiological data was interpreted using CLSI guidelines. Dat wa examined using the student's t t sf Fisher's exact test, analysis of variance, and a generalized linear mode for tests of beiween-subjects effects where appropriate. Differences were considered significant at the 0.05 evel in BM SPSS® version .0. s Confirmation of Staphylococcus identity a d r status RECTIFIED SHEET (Rule 91 SA AU [Q0258] Latex agglutination tests confirmed thai all 30 isolates were protein A positive. The isolates tested positive for c ag iase activity slide agglutination. Voge -P oska er a d polymyxin B resistance tests confimied that a l isolates were 5 , aureus except for a single h ii!in-s s pt b e isolate; SSA DE 25, as shown i Table 10 he w. Based on spa gene PGR amplification, this isolate was not identified as a S. aureus isolate despite testing positive in the protein A latex agglutination and slide coaguiase tests. This canine-origin Staphylococcus spp. was identified as Staphylococcus int r & i s based on biochemical characteristics. A conventional and. real-time PGR results confirmed that 66.68% of the isolates were classified as eth cil in- sis a t on the baste of possession of the e A gene. There were no significant differences between the abiiity of conventional and real-time PGR to detect the @ A gene {P>G.05}. RECTIFIED SHEET (Rule 9 1) ISA/AU Table 10 Percentage of presumptively identified S. aureus Isolates reporting positive to selected phe pi and en t pic teste accordin l 4 , Biochemical «sis PCR a5t P R S V g s- r A Protein A Polymyxin 8 $p rs spa gene Organism g s Pr ska r gene 0% 100% 8 % 0% % 0% 90% 0% ¾ i r s 1 ¾ A SA 100% 100% 100% 0% 100% % 0% 100% 0% 100% 10 % 0% 100% 90 100% 10 % Tot®! n~3. 0% 3 . 7% % HA SA ; hospital-acquired . CA-MRSA; n -ass t d 5 , aureus , S. aureus soSates were Identified as t s i protein A latex agglutination (Protein A , slide ag as , V o es P s ka er and polymyxin 8 resistance tests, a s w e l a s testing positive polymerase chain reaction (PGR) and real-time PCR amplification of the spa gene, t fl in- esis ant 3 , aun u isolates were Identified a s sol testing positive to the criteria described above, as well as positive for PCR and real-time PGR of the A gens. Ta : Resistance of S. aureus isolates to antibacterial agents using the Kirby-Bauer disc diffusion method according to example 4 Staphylococcus aureus antimicrobial susceptibility profiles [00259] Antimicrobial susceptibility assays revealed that HA-MRSA isolates had the highest mean prevalence of resistance to multiple antimicrobial dasses (P<0.000). CA RS isolates were next most resistant (P<0.GG7), followed by methicillln-susceptibte staphylococci (P . 37) shown i Table i 1 above. Oxacillin resistance was expressed i only 80,00% and 10.00% of HA- SA and CA- SA Isolates, respectively. Cefotetan resistance was expressed in 80.00% and 20.00% of HA-MRSA and A- RSA isolates, respectively. Although oxacillin and cefotetan did not significantly differ in their ability to detect MRSA (P>0.05), detection was significantly improved w en using the e A PGR when compared to disc diffusion P<0.0 The majority of HA-MRSA isolates expressed resistance to amoxidSlin-olavulanic acid, cefotetan, cephalexin, clindamycin, erythromycin, oxacillin, and penicillin-G, whereas the majority of CA-MRSA soiafes were resistant to c niy clindamycin, erythro ycin and penicillin-G. Non of the isolates sssted were vancomycin ssistant. Overall, the s t prevalent resistance p n types were p n i in G (83.33%), erythr e ycin (73.33%), a d clindamycin (43.33%), whilst only single isc at s {3.33%} were resistant to trimethoprim -sulfamethoxazole and rifamplcin. mec gene complex inteTactions [00260] All MRS A isoiates belonging to mec gene complex A xpressed resistance to both oxacillin and e stetan, as shown in Tab! e 12 below. However, niy 20% of mec gene complex B MRSA iso t s were phenotypically resistant to these antimicrobials. Of the MRSA isolates belonging to mec gene complex C2, on y a single isolate expressed methiciliin resistance to oxacillin and onl two isoiates expressed resistance to cefotetan. Unclassified MRSA isolates expressed fu l resistance to oxacillin and cefotetan. Ta 12: Number and percentage of ideniifiec mec gene complexes in 20 S. f strains classified as ethi i iin-resistant according to example 4 » eri®complex CC e Oxacliisn resistant ta m {number of isolates! types ate 3 (10 % 3 (100%) A 1 100%) 1 (100%) n > Overall 4(100%) 4 (100%) 8 i 1 50%) 1 (50%) (n*10) IV 1 (12.5%) 1 (12.5%) RECTIFiED SHEET (Rule 91) SA AU Respective staphylococcal cassette chromosome (SCCmec) complexes and types express ng pi ypic resistance to oxacillin and cefotetan are indicated as well as real-time mecA status, and average negative dF dT peak obtained from melting point analysis from real-time PGR of the mecA gene [0.0261] Melting point peaks for the &cA real-time PGR negative derivative plot d /cT differed between mec & complex (P< .003 9. On average, mec gene complex B and unclassified isolates demonstrated higher melting point peaks than other SCCmec types P< .012) Physical properties of test antimicrobiais and comparison of minimum inhibitory concentration results from initial analogue testing [00262] Test antimicrobiais were selected on the basis of solubility and antimicrobial activity from preliminary studies. Cloudy precipitates were observed when both C were dissolved in cation-adjusted u ller H nt n I broth, as shown n Table 13 below. Following i structure-activity testing on each synthesized analogue, CL 2 was found to have consistent values in this present study. Table 13: Characteristics of antibacterial CL812 and the β-!actam antibacterial ampiciin according to Example Detailing antibacterial solubility in dimethyl sulfoxide ( SO solubility in cation-adjusted uei r-Hinton If broth (CA HB . and average minimum Inhibitory concentrations (MIC) g/ a 24 h) against m thic n-resi tant S. re s SA determined fro preliminary studies and those determined during this present study. ATCC 48775; et i i n-s scepti S. .aureus RECTIFIED SHEET (Rule 91) ISA AU t and ATCC control strain. MRSA58G; me hici lin r sist n S. aureus Isolate #5 0 RSA 98: methiciin-resistarit S. aureus isolate #6 8 i vitro activities: minimum i it f concentrations [00263] ! s a d values for lead compound CLS 4- d 4 8 m are shown in Tafote 14 . values differed by S. aureus classification (susceptible, HA or CA- RSA (Ρ <0.0 5 . n many cases, C 8 had significantly increased activity against CA MRSA and m t i l n-suscept e staphylococci by one dilation when compared to HA- SA P 0 .0 2 a d P< , 2 , respectively), however there we e no significant differences between MIC values for m thicillin susce t le staphylococci and CA RSA P 5 . Ampi l in MI values obtained for the ATCC control strain we e within the normal range expected on th basis of CLS guidelines Table : in v activities of the novel antibacterial CL a d the β-lactarn antibacterial a p ieil i against S. t@ s clinical isolates according to Example 4 . HA-MRSA; hospital-acquired meihiciin-resistant S. aureus. CA-MRSA; co n ty- s iated methiei -resistant S. aureus. MIC; minimum inhibitory concentration ( g/ . MBC; minimum bactericidal concentration g i). C/ BCrange; minimum a d maximum iC BC for all isolates. C BCs ; C BC et which 50% of isolates are inhibited. IC C »; C SC at which 90% of isolates are inhibited RECTIFIED SHEET (Rule 91} iSA AU in vitro antibacterial activities: minimum bactericidal concentrations 0Q2 4 The BCs determined fro NCL812 were equivalent to the M C for 93,33% and 83.33% of S. aureus isolates, respectively (Table 14). In a i remaining cases, MBCs were one dilution higher. For C 12, 8 Cs ranged from 2-8 g and 4-18 µ /mL, respectively. Tirne-kiii studies [00285] n comparison to the turbidimetric growth curve of ATCC 497 5, no visible bacte al growth was observed when ATGC 49775 was inoculated into cation-adjusted Mueller Hin n ! broth supplemented with NCL812 at 1* and 4 t e \ in icro dft i n assays P [0 26 When analysed in 10 ml. macrodilution assays, broth supplemented with antimicrobials at and 4 the \C and inoculated w th ATCC 49775 displayed significantly reduced viable counts for both CL8 concentrations when compared to the growth control .GG [002671 . summary, the example set out above demonstrates bactericidal activity against both et ilSin-s sceptib e staphylococci and RSA . C and C values were consistently low across the selection of isolates ( IC - ¾i i 2-8 g/mt . CL 1 retained good in vitro antimicrobial activity against common, m ltld g-res stant MRSA isolates, including the epidemic UK E RS - , E RSA- , and RSA 7, Irish E RSA , AUS E SA-3, MY/JAPAN HA RSA , and predominant CA- RSA clones. NCL8 was also active against one S. ps& n &r i isolate that was originally identified as a S. -aureus strain. [00288] Preliminary testing suggests that Ct .8 2 targets the S. aureu cell membrane, causing dose-dependent release of vital metabolites such as ATP.. Disruption of the bacterial membrane bllayer or proteins that are integral to membrane function in bacteria is a target for numerous large antimicrobials which are ubiquitous in nature; including g c p ds iipopaptides, lipoproteins, fatty adds, neutral lipids, phospholipids, and hl s a tants Although NC 8 is a low molecular mass ( 5 0 D } synthetic compound, it does appear to exert bactericidal activity in similar manner to other antimicrobials which target the Gram-positive cell membrane, including the high molecular weight cyclic !ipodepsipeptide antimicrobial agent daptomydn or RECTIFIED SHEET (Rule 9 1) ISA/AU the low molecular mass quinoSone-derived Ϊ 81, whose chemical structure is not currently available. of these lipophilic antibacterial agents are a so ot effective against Gram- negative microorganisms due to the presence of the outer lipid bi y membrane, which contains narrow ponn channels reducing the net penetration of some compounds into the ce l £00269] The insolubility of CL8 at even lo concentrations n microbiological media may reflect the amphlpathic and oligomers© nature of thi antimicrobial and suggests that the real MIC ay be much lower than observed, as it is likely that it is only CL in solution that is biologically active. In time-kill studies, CL exerted rapid in vitro bactericidal activity against ATCC 49775. Again, these findings ere consistent with a time-kill profile of c il membrane function inhibitors such as daptomyein and HT [00270] Importantly, the apparent short fe vitro aSf i e of this antimicrobial resulted n bacteria! regrowt observed at 12 h after antimicrobial addition. This suggests that if a viable bacterial population survives the initial exposure to CL prior to antimicrobial in ctiv¾tio bacterial regrowth wil occur. The development of resistance to C 2 in these studies was ruled out as test bacteri remained susceptible to L 2 following harvesting, washing and testing. Whilst the apparent short in vitro half-life of CL may be a desirable characteristic for Mure i v application, it does suggest that . should be administered every 8 h in ure vivo safety and efficacy experiments to maintain adequate systemic concentrations, though it would appear fro the time-kill profile that the CL compound series are concentration-dependent rather than lime-dependent antimicrobials. 0027 11 To overcome the methicillin-susosptibie pher ot p , extending disc diffusion incubation time from 24 to 48 compensates for the slow derepression of the & R gene. Although the effects o longer incubation were not examined, an the small sample size of RSA isolates prevented further investigation into m c complex interactions; genetic techniques were of significantly improved sensitivity when compared to phen t pic methods fo confirmation of the mecA status of the isolates in this study. Although genetic techniques are not always employed as a routine method for detecting VRSA , real-time PGR identification of the presence of th &c gene in a Staphylococcus spp. isolate remains the diagnostic gold standard. RECTIFIED SHEET (Rule 91) ISA/AU E L 5: In vitro pharmacodynamics of a new antimicrobial agent for Streptococcus pneumoniae. te and ¾ i s Pneumococcal antimiorobi&l susceptibility P oGca strains and growth conditions [00272] Twenty pneumococcal isolates that comprised six characterised laboratory strains and 14 clinical isolates were the subject of this study (P9 8A, P21/3, WCH16/8A, WCH43 4 , WCH4 /4 WCH57/8, WCH77/5, WCH86/4, WCH8 /7 WCH92/4, CH137/ A , WCH158/19F, WCH1 4 19F and WC-H211/11; stra in sero p . respectively). Other isolates used in th s example were: 86 1/3 (Francis e a/., 2001. m rs. 8 : 3350-2358); EF3G3 / F (Briies ef 2003 J f c. Diseases. 188:339-348); L820 6B (B i es ei l., 0 0 infect I un. 88:796-800); T G 4/4 (Tetttelin et , 2001 i 293:498-506); and VVU2/3 (Briies ei a/., 1981 J, Exp @d , 153:894-705). See Table 15 below for the p n rt yp ic characteristics of the isolates used n this study. The n Collection of Type Cultures (NCTC) control strain D39 Avery ef a/., 20 Nature Reviews Microbiology :280-2 was used as a control for all M C and M assays. D39 was later designated fo kill kinetics, poin of resistance assays and transmission electron microscopy (JEM) studies a s it i a well documented laboratory strain with a defined in viva pathogenesis (Table 15) that displayed consistent NCL812 !Cs a d . Table Pneumococcal isolates and t eir phenotypic description according to Example 5. RECTIFIED SHEET ( ute 1) ISA A U ~ ot e erm ne [00273] For all n vitro assays, fresh pneumococcal isolates were grown overnight (Q/ ) n horse blood agar (HBA) plates (39 g/L Columbia blood agar base fOxoid] % /v] defribinated horse blood [ x id at 37 °C with 5% supplemented COj). eS r-H rst n blood agar with 5% defibrinsted sheep blood HSBA Roseworthy Media and Blood Service) was used for d sk diffusion analysis as directed by Clinical Laboratory Standards Institute (CLS standards. n ococc were routinely grown n broth consisting of 4% !ysed horse blood LHB) with Cation Adjusted Mueller Hinton Broth C H , Difc J) at 37 C with S supplemented € . Horse serum broth (HSB, % (v/v) donor horse serum in nutrient broth [10 g/L peptone, 1 g/L Lab Lemco (Oxiod) and 5 g/L C was also used in some MIC assays. Isolates were stored in HSB at -80 , C. Antibiotic stacks and r g is [00274] CL812 was provided in dry powder form. A total of 258 g was dispensed into L of 1 0% S t make a stock of 25.8 g , which was than diluted 1: 0 CAH B to make a final working stock of 256 ί , A i iiin dry powder was from Sigma A 1 8 The original 25 6 mg/ L stock was diluted n saline 1:100, 1:4, 1:20 and finally 1:16 in A to make & final working stock of 0.18 m Erythromycin was purchased fro Sigma Ald i d choline chloride was from Roche Diagnostics. Twenty micro litres of 0.05 pg/mL erythromycin was diluted 1:25 i 4.980 ml of AMHB to give a final working stock of 0.2 Mg/mL. Choline chloride ( .5%) was added to 4% LHB:CAMH8 for specific kill kinetic assays. f antimicrobial susceptibility of pneumococcal isoiat&s [00275] Isolate susceptibility to 2 different antimicrobials (Tab © } was determined by CLS! and European Committee on Antimicrobial Susceptibility Testing E CAST) methods. Antimicrobials were selected based upon the CLS and EUCAST guidelines. Standardised bacteria! suspensions ware spread onto HS A using a sterile cotton swab. Bacterial suspensions from of Streptococcus pneumonias were standardised to an GD 0.08 and 0.1 using a spectrophotometer and the diluted :20. Bacterial colonies were taken from an Ό horse blood agar plate. To ensure the purity of the :20 bacterial suspension, SO L was RECTIFIED SHEET (Rule 91) ISA A spread pSa e onto horse blood agar and incubated N at 37 "C with % C0 . The CFU was calculated a d compared to the initial plate counts. Antibiotic disks (Purchased from Sigma A!dr c ) were placed usi g a disk dispenser (Purchased from Oxoid) according to C S! standards. HSBA plates were incubated for 18 h 24 h at 37 G n 5% C ¾ . Zones of complete inhibition w re measured in triplicate to the nearest millimetre using a ruler on natural light-reflected growth, a d the ode was represented as the diameter for each isolate. Pneumococcal isolates were categorised as sensitive, intermediate (!) or resistant (R) by CLS standards and quality control ( C ranges (Table 16). Table S: Antibacteriais used for disc diffusion analysis with interpretive standards of zone diameters (mm) according to Example 5 . 278] Zone diameters or antim crobia s other t an iprofl oxacin or , pneumon ae we e determined by CLSI standards . iamefers for Ciprofloxacin antimicrobial susceptibility to S. pneumoniae were determined EUCAST Determination o†NCL812 /C , iC , MIC range and A SC * C MSG range Gs for NCL812 for all isolates listed i Ta le 1 were determined by measuring QDW (Spectramax spectrophotometer, Molecular Devices Corporation) as an indicator of bacterial growth sing 9 well microtitre trays afte incubation for 24 h at 37 in 6% C0 . [Micro-broth dilutions a d 98 well trays are prepared by the following method: 90 p of 4% LH8 :CA H is aliquotted into all wells using a multichannel pipette. 90. µ of working antimicrobial stocks were no serial diluted dow the tray by a 1:2 dilution. Negative broth controls and dilution control were taken into account when planning the set up of a 98 well tray.] RECTIFIED SHEET (Rule 81) SA/AU 10 pL of bacterial suspension was then added to the appropriate wells in the 8 well tray. Appropriate positive no antimicrobial) , negative ( o antimicrobial or bacteria) and negative dilution (a serial dilution control of antimicrobial and broth) controls were included in each assay. MSG and plate counts for kill kinetic assays were determined by aiiq ot ng 20 pL from each well of the 9 well microtitre tray onto HBA, and incubating at 37 ° with % CO . The C was determined by a 99.85% inhibition of S. pneumoniae, taking into account the dilution factor. Cs and B wore determined n quadruplicate and the mode was taken as the representative value. The C C and C range and , C and MBC range we e determined according to CLS standards. The \C and fG¾ , or BC BC > ¾ defined by the lowest concentrations which, when a l the Cs and MBCs of the isolates are arranged from lowest to highest, inhibited the 50th and 90th percentile of the total amount of isolates, respectively. Micro-broth dilution time kill studies with NCL812 ing strai D39 [00278] Bacterial suspensions were added in triplicate to a 98 well mscrotilre t ay containing C 812 w th a starting concentration of 128 g mL and serially diluted 1:2 sequentially to concentration of 0.25 g/mL Negative dilution controls were subtracted from the median growth value to obtain a suitable indicator of overall bacterial production. The 98 well tray was incubated at 37 C in 5% CC¾ and OD read every 2 h for the first 12 h followed by final reads at 24 and 4 h. To further supplement this data, a separate experiment in 96 well tray was read automatically at half hourly intervals using a spectrophotometer (Spectramax spectrophotometer, Molecular Devices Corporation) for 14 h was performed to confirm the trends in growth curves observed from original micro-broth dilution studies. MBC ti & kill studies w th NCLB12 using in D3& [002701 MBC kill kinetics assays Involved the preparation of three 98 well microtitre trays. At specific time points, aSiquots obtained f om these trays provided viable counts following incubation at 37 in % C on HBA, and the MBC was determined after 24 h of growth. i t n time kiti studi&s of D39 with NCL8 1 0028 ] Bacterial suspensions and working antibiotic stocks were prepared as described abov [For preparing macro-broth dilutions, 20 l tubes were filled each with S of 4% L B:CA HB. 9 m of a working antimicrobial stock was diluted 1:2 when added to to one of the tubes, and then serial diluted down from a high to low concentration of antimicrobial 1 ml of S. pneumonia® bacterial suspension was added to the appropriate tubes, Including the p ftiv control. Tubes were incubated at 37 ¾C with 5% with gentle ma ual tilting of the tubes RECTIFIED SHEET Rule 91) !SA AU treated th C 8 every 0 in for the first . At every 2-3 h during the rst o growth a d then at 24 h and 4 h, 50 of each bacterial suspension was spread plated onto HSA and incubated at 37 *C with 5% C0 or 24 . [00281] Table 1 below indicates concentrations used so? each antimicrobial. Cultures were incubated a! 37 C in 5% C0 with gentle manual tilting every 10 in for the first 12 h Viable counts from 50 L aiiq s of each concentration were read following incubation at 37 C in 5% C0 for 24 h. The pH of each sample was measured at specific time points using pH indicator strips. Confluent growth was defined when more than 00 colonies were counted per plate, A bactericidal effect was defined as a 00 fold reduction (99.9%) of the original cell suspension determined at 24 h for each concentration. T 17: Antibacterial agent concentrations used in macro-broth dilution assays according to Example 5. Point of resistance assay for NCLS1 [002821 Macro-broth dilutions were prepared above. Broth cultures of strain D39 10 mL were incubated in the presence of 2 g/mL and g/m of CL8 and 0 022 g/ L of Arnp i f r 8 h at 37 °C in 5% CO?. Samples were centrifuged at relative centrifugal force ( CF) of 1 45 g for min and washed in 50 mL of phosphate buffered saline (PBS) twice to remove any residual antimicrobial, and/or bacterial end products and media. Washed bacte a were resusp r d d and C were performed. Effect of CL81 on D39 cei & bra ultra-structure Transmission Electron Microscopy [00283] Morphological appearance and morphometry analysis of the ce l membrane was determined using transmission electron microscopy (TEM). Bacteria! suspensions and 10 mL cultures of D3 were prepared as before. Samples were incubated at 37 C n 5% C ¾ with gentle manual tilting of the cultures every 10 min. Cultures were exposed to either 1 m , 4 /mL or 1 g/m of CL and harvested at 6 or h by entrifu tion at RCF of 45 RECTIFIED SHEET ( i 91) SA AU for 20 in and washed twice in 5 mL of PBS. C tical time points for TE work were determined b analysing trends the growth curves produced from the kill kinetics studies. Samples were res p nded in PBS containing 20% glycerol d stored at -80 °C until required. Before fixation. 20% glycerol was removed by nt f ga ion and washing on ice three times in 50 mL of PBS. [00284] Samples were fixed using modified protocols defined by a previous study examining cell wall lt astr c re of S. pneumoniae r c idt S. e a 2 5. f& t i n 73 4 3-4 6 7). A lysine acetate-based forma!dehyde-glut¾raldehyde ruthenium red- osmium fixation procedure i volved fixing the bacterial pellets with a eacodylate buffer solution containing 2% formaldehyde^ 2,5% lut r d hyde 0.075% ruthenium red and 0.075 of acetate for 1 h. After washing with ac dylafe buffer containing 0.075% ruthenium red three times, a second fixation in acody ate buffer solution containing 2% formaldehyde, 2.5% glutaraldehyde and Q.07S% ruthenium red was undertaken for .5 h. Cells were subsequently washed three times with cacodyfate buffer containing 0.075% ruthenium red and underwent final fixation in 1% osmium tetro de in cacodyiafe containing 0.075% ruthenium red for 1 . The samples were then washed three times in cacodyiafe buffer containing 0 75% ruthenium red only. 0285 Samples were washed and dehydrated using a graded series of ethanaf 70 9 , 85 and 0%) for -2 min, two times for each step. Samples were infiltrated using 50:50 LR White resin in 100% ethan for 1 , and subsequently washed with 0% LR White resin for 1 h and lef N in a third change of 0% LR white to ensure adequate infiltration of resin. The samples were then embedded in fresh LR White resin and incubated at 50 f r 48 h. Sections were cut to 1 using s glass knife, stained with To uiden Blue and viewed under a light i pe at 400« to identify the presence of stained pneumocoeci. At least four ultr - h n sections were then cut to 90 n using a diamond knife and placed on matrix grids, one section per grid. tra h n sections were then stained with uranyl acetate and lead citrate alternatively at min intervals, f by three washes with distilled wafer in-between each exposure. Stained sections were then placed on grids and viewed between 2S0 and 1 0GQG o a Philips CM100 Transmission Electron Microscope Images were obtained at 0000* magnification and analysed using ana ySI [Olympus Soft Imaging Systems]. Statistical analysis 2 S¾] Statistical analyses were conducted using statistics program GtaphPad Prism 5fh ad, GraphPad Software inc.) for Windows. Fo growth curves, data presented were the mean and standard error of mean {SEM) (represented as error bars) for each data point x pt RECT IFIED SHEET (Rule 91) SA AU for macro-broth dilution studies where multiple replicates could not be obtained due to the high costs involved in this assay. Two tailed, unpaired -tests were performed ft Pharmacodynamics GL81 its S pneumoniae Q a controi disk diffusion analysis for 2 S. pneumoniae i o/a [00267] Although nine out of the twelve antimicrobials used for disk diffusion analysis had established QC ra ges by EUCAST. QC ranges were not defined for a oxi il iri- a u anate, clarithromycin and clindamycin (Table 18 Table 18·. C and C 4 were both resistant to at least two antimicrobials whereas EF3030 and WC 1 7 we e intermediate and resistant to t m th pri - sulpham fhoxa le respectively (Table 19). The other remaining sixteen isolates were sensitive to all twelve antimicrobials. Sensitivity to amp iliin was confirmed for ach isolate, enabling the use of a pici lin as a positive control in later micro- broth dilution assays Table 18). RECTIFIED SHEET Rule 9 1) SA/AU b © : Antibacterial susceptibility of 20 S. pneumoniae isolates for six different antlbacteriafs according to Example 5 . Blue cells represent isolates; orange cells represent intermediate (!) ; green ceils represent resistant R) Isolates. Table 1 : Antibacterial susceptibility of 20 S, pn& on e isolates for six different antibacterial® according to example 5 4 Solubility and activity f NC 812 and NCLQ62 in different media [00288] CL 1 visually appeared to have higher solubility in 0% O compared to NCLG82 a d only developed turbidity when it was further diluted into CAMHB or PBS (Table 20). Although a CAMHB diluent for CL082 appeared to be transparent by visual inspection (Table 28 further studies on NCLG82 with a CAMHB diluent resulted complete confluence in i robrot dilution assays for six . pneumoniae isolates in comparison to growth with the D VSQ diluents (Table 21 a d Table 22). T te 20 Vlsuai analysis of CL and NCL062 and ampiciilin solubility according to Example 5. 1 % horse r -syppie nt d broth ~ i Precipitate T [Transparent Ta 21; Individual iCs of NCL082 for each pneumococcal isolate according to Example 5 Table 22; Difference in activit of NCL a d NG 2 in different media using micro-broth dilution to obtain an MIC as a predictor according to Example 5 RECTIFIED SHEET (Rule 91) ISA/AU * S7 Sensitive i ent 0.09 0,09 I 02S ] Growth of S. pneumoniae strain D39 in an MIC assay for C 8 and NCL062 using % HS (220 rnL of horse serum is filtered to % in 0 L of Lemco nutrient broth) resulted in threefold increase n the MIC for D39 treated with CLS1 and HCL062 23} with twofold increase for the positive ampicilirn control. There was no notable change for D39 with differing storage conditions of pre~prepared 98 well microtitre trays (Table 24). During macro-broth dilutions, the pH of the media did not change compared to appropriate controls re 12. Table 23: Growth of S pneumoniae strain D3 in an MIC assay fo NCL8 and CLQ82 using horse serum supplemented broth [ 29 Table 24: Storage of prepared mi ro- iter trays for micro-broth dilution does not change of D3 according to Example 5 . Determination of . pneumonias in vitro Susceptibility to NCL812 a d NCL062 Determination CL812 NCL 2 C & C a MIC [00291] C 8 2 exhibited and iC of 8 g m MIC range of 4-8 pg mL whereas for CL 82 these values were higher and more variable Tafete 2 ar Table 28 . The MIC for ampidlfin was comparable to recent published findings using micro-broth RECTIFIED SHEET Rule 9 1} ISA A U dilution as a n endpoint for antimicrobial resistance in pneumococcal isolates, thus confirming the sccuracy of MiCs obtained for C L8 12 and NCL062 (Tables 2 t o 2β a r « Figure 13 . Table 25; C so. MIC*}, Β , and MIC range for ai isolates treated with CL8 , CLG and a pi llin according to Example 5 . 26: MiCs of NCL81 2 of each pneumococcal isolate according to Example 5 . Determination NCL812 and NCL062 B C $ , 8 MBC range [002921 bactericidal concentrations B ¾ MBC range respectively) were determined for CL and a pic lin for all twenty isolates 2 5 to Table 26 The BC S B ¾ , and MBC range was lower and ore consistent for NC 8 compared with L 2 Ta b le 25). RECTIFIED SHEET (Rule 9 1) SA7A U cr -b ih dilution time kill studies of D39 treated with NCL812 and NCL062 | 293| D39 exposed to sub-inhibitory concentrations { 2 g/m ) of NCL812 or NCLG62 grew similarly to unexposed controls over a 48 h period (Figure 13 14. Higher concentrations of C 8 and NCL062 1 g/mL ©suited in no bacteria! growth for 48 14 ¾ 15, These growth characteristics were validated by a micro-broth kiii kinetic study using a Spectramax spectrophotometer, which measured growth (represented as D∞ ) at half-hourly intervals for 14 for L 62 and (Figures 5 t o 1? There was an approximate six hour difference between the commencement of exponential growth for D39 treated with NCL8 and D39 treated with NC 062 (Figures 13, 14, 19). 294] The growth of D39 treated with NCL81 2 or CL 62 was compared to D3 treated with a pi itir or erythromycin oyer 48 h (Figures 21). 0 3 treated with ampiciln exhibited similar growth to D3 exposed to CL8 or CL 82 over 48 h (F¾ure 20). Erythromycin-treeted D39 produced very different growth curves fro C 8 and NCL062 where a larger difference i growth between concentrations was observed (Figure 21). The addition of 5% choline chloride to the media over 48 h period resulted in no significant difference in growth for CL 1 and NCL062 compared to positive and growth controls (Figures 22 to 26). Point of resistance testing 00295] D39 treated with 4 pg/mL CL81 entered a log phase of growth at 6 (Figure 13 ar¾d 18), as shown in four independent experiments. The possibility of antimicrobial resistance to NCL8 2 between 5 and 6 h was investigated by determining further Cs on D39 exposed o 2 pg/mL CL8 4 pg/mL NCL812 and 0.0225 pg/mL ampiciflin for 8 h. Results showed no significant increase in M\C for all samples of D3 exposed to NCL8 compared to growth controls, and a p ci ii (Table 2?). Table 27: Cs of D39 exposed to 2 L or 4 pg/mL of NGL81 for 8 h according to Example S. RECTIFIED SHEET ( le 1) ISA AU *D39 growth control: S. pneumoniae strain D3S grown for 8 hrs n 4 HB:CA H8 . * * D39 growth2 coniroi: S. pneumoniae strain D3 on HBA G/N, resuspended in saline 0 .1 O 1/20 sterile saline. Micro-broth dilutions by measuring n v MBC at specific fem points Q2 8] Relative Cs were determined at specific time intervals from using broth dilution assays incubated for 48 for C 8 12 and NC.L062 (Figure 27) and control antimicrobials ampicillin and erythromycin (Figures 20 ar¾d 21). V Cs of ar pie i!in and erythromycin for 038 were determined (Tables 26 r 28). The comparative features of the growth of ampicillin, and erythromycin are described (Figures 28 a d 2 ). Amptci!!ir? and erythromycin demonstrated a time-dependent reduction in bacteria. NCL082 exhibited rapid bactericidal action, with an immediate (within the first mm of administration) MBC of 8 pg/r (Figure 27). Although there were inconsistencies in the B for CL 82 between 5 and 1 h, NCL062 maintained a constant bactericidal concentration (4 g/mL) betwee 24 and 48 h. CL81 exhibited fast bactericidal action, evidenced by an approximate 3 foid decrease in MBC within 5 2 ) . A consistent bactericidal concentration (8 pg/mL) was maintained for the full 48 h for NCL812. 7] TaMe 28: MIC and MBC for erythromycin with D3 according to Example S. isolate status to MBC Sensitive 0.00275 i 0.00275 Macro-broth dilution t me kill studies Q D39 with NCL812 and NCLQ62 | 029 ] Viable o nts for each time point we e represented as a fog CF mL reduction for NCL812 (Figure 30} and a pi i iin (F s e 31 . Consistent confluent growth (determined by a limit of - CFU was observed for unexposed controls and 2 pg/mt GL8 2. Complete bactericidal activity (defined by a reduction in CFU) for 1 8 L of CL 2 was observed by 4i g reduction of CFU in 3 h and concentrations between 18 pg/mL and β4 pg/mt CL812 were effective at eli inati g bacterial growth within 8 h (Figure 30 . C 812 at 4 p mL and 8 g/ L appeared to be inactivated at 11 h post-exposure, as increased growth of strain D3 after this time point was observed (F and 31). The viable counts of strain D3 treated with a ic liin demonstrated consistency for this particular assay by showing a constant diminished time-dependant killing over 48 h (Figure 31). Transmission electron microscopy RECTIFIED SHEET (Rule 91} ISA AU 10 [00299] Morphometry analysis revealed significant changes to the eel! e brane n strain D3 exposed to 1 g mL NCL812 for 8 h compared to growth controls. Samples treated with 4 . as weli as 1 h cultures were not considered for m rph ethc analysis to the lack of bacteria! ceils available n each section. Treated samples possessed significantly thicker cell .membranes (8.43 ± 0.29 nm compared to untreated samples 4 .35 ± 0.24 nra) (p |00300] Table 29: Morphometric studies on the ultra structures of D38 treated with L for 6 hours according to Example . Treatment Statistical test ± SE Mean ± S.E Unpaired (P Ce l membrane 4.35 ± 0.24 nm, 6.43 ± 0.29 nm, F < 0 0 1 n ~ 12 n = 13 j ripi smic space 4.54 ±0.096 nm, P < 0.001 n 11 n ~ 1 1 301] n summary, CL8 1 produced highly consistent ! s and equivalent B s for the . pneumoniae strain collection, confirming that it is bactericidal against this organism. n k ll kinetics xpe menis which measured the relative C over a 48 h period, a consistent bactericidal effect was elicited in D3 after 6 h from initial exposure to CLS1 . 302 This demonstration of bactericidal activity is the first to be observed n 8 . . This demonstrates that C is effective against pneumococcal in vitro. [00303] Competitive binding between components in blood, serum or broth decreased the antimicrobial activity of N L This was reflected in the increase of IC observed between different broth types and diluents. Following the completion of these studies, rece t independent research confirmed precipitation of CLS1 in PBS and reported complete solubility in water containing 4% DMSO, following initial dilution in 100% DMSO. A water-soluble NCL8 will greatly improve i vivo bioavailability and negative interaction between blood or serum proteins. [00304] Based on the findings of this study, CL8 exhibits a mechanism of action against S. that is different from β a tam or macr !i e classes, as it appears to exhibit concentration-dependent bactericidal activity as opposed to time-dependant qualities identifying the maximum pharmacokinetic serum concentration of GL8 in vivo will assist RECTIFIED SHEET (Rule 8 1) ISA/AU confirmation of its concentration-dependant pharmacodynamic activity. Furthermore, the addition of choline chloride to the media confirmed that the mechanism of action for NCL is ot associated with the affinity to cell wa f choline binding proteins, and therefore may not be ce l wai associated. 00305 iv orph me ric analysis of the membrane and per pla mic space of D30 treated with g/mL CL for 6 h showed thai the ceil membrane and periplasmic space was larger in treated samples, compared to control samples. The apparent increase in membrane could be due to an accumulation of electron dense intracellular material beneath the cell membrane. The increase in the of the periplasmic space ay be have been due to disruption of the cell membrane, potentially by depolarization or ATP inhibition. The mechanism of action of CL 12 may not be calcium-dependant as it appears that no competitive binding between NCL812 and ruthenium re a calcium channel inhibitor of lipid bilayers, was observed in electron micrographs. [00308] In conclusion, this in vitro study has demonstrated that C ..8 12 has many desirable characteristics as a fast-acting concentration-dependent bactericide! antimicrobial that appears to target the cell membrane of S. pneumoniae. These characteristics are desirable to treat acute pneumococcal infections. As C 8 2 may possess a mechanism of action that targets the cell membrane, it will act much more quickly than time-dependent antimicrobials such as β-lac a s and ma ro des and potentially more effective than other bactericidal concentration-dependent antimicrobials such as fluoroquinolones which have intracellular targets. E Characterization of methicillin-susceptible and methfcitlin-resistani Isolates of Staphylococcus ps udint& &diu from Australia and preliminary n vitro efficacy of a new anti st phy ococca compound Materials S p/ collection and identification of me lcill n susceptible Staphylococcus p e d t nn s SP) t icili i ta i Staphylococcus p$ d t@m diu$ SP [0030 71 A total of 23 Staphylococcus ps d ter &d isolates were obtained from dogs (Table 30). RECTIFIED SHEET (Rule 91) !SA A RECTIFIED SHEET Rule 91) SA AU [00308] Te meihiciilin susceptible a d 13 meihiciilin resistant Staphylococcus &u nt r were collected for the study isolates were phenotypicai!y classified meihiciilin resistant on the basis of in vitro resistance to oxacillin and genetically for the presence of & A gene according to standard procedures [00309] Oxacillin and cefoxitin susceptibility testing using disk diffusion technique and Epsilometer testing were performed identification of & gene was performed usi g polymerase chain reaction PGR) (00310] CLSi disk diffusion susceptibility testing was performed on the 23 Sp, isolates for the following antimicrobials: penicillin, amoxicillin, erythromycin, gentamicin, clindamycin, ciprofloxacin, cephalexin, chloramphenicol, tetracycline, oxyteiraeycline, vancomycin, cafoietan, oxif oxacin and rifampin. [ 031 ] Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) testing was undertaken using CLSi methodology for CL8 and induded ampiciliin as a control Anti-stsphyiococcai compounds were then tested against all 23 isolates and mini u inhibitory concentrations {MIC} were determined according to standard protocols. After the Cs were determined, the minimum bactericidal concentrations were perfcsfmed to determine if these compounds a bacteriostatic or bacteriocidal. Results 100312] The A gene was present in 13 isolates of R P and negative in 1 MSSP (Tables 30 a d 31 . Ail SP Isolates were resistant to oxacillin based on disc diffusion ≤1? m ) and E est MIC (&0.5 mg/L). RECTIFIED SHEET ( uie 91) !SA/AU RECTSFSED SHEET (Rule 9 1} SA/AU V [00313] When cefoxitin resistance breakpoint was set at <24 m , 3/13 (23%) a d 5/13 38%) of RSP tested respectively were susceptible to cefoxitin. When cefoxitin resistance point was set at 30 mm, only 1/ (7 7%} ! RSP tested was susceptible (Tables 30 [003 14 The MRSP isolates were resistant to multiple antibiotic classes. Of the MRSP soi tes, all were susceptible to rifampin. 3/ 23%) were susceptible to chloramphenicol; 10/13 (77%) were susceptible to vancomycin (Tables 30 and 31). [003 interestingly, 3/13 (23%) of the MRSP isolates were susceptible to amoxicillin; 8/13 (62%) were susceptible to c pha i in; 12/13 (92%) susceptible to cefotetan and 12/13 (82%) s sc pt e to oxifioxac (Tables 30 31). [00316] All 23 isolates were susceptible to CL812 based on C . s addition, L has been be bactericidal based on minimal bactericidal concentrations ( v BC . The I range of CLS12 against th Staphylococcus ps d r r di Isolates was found to be between 1 g / and 4 / (Ta le 32). The C a d M s of CL.8 against the Staphylococcus pse dint r dkjs isolates was found to be 2 g/r t an 4 g/ rrsL respectively (Tabte 33). The fC mode and MSG range of CL8 2 against the tap i o G p e t r di s isolates was found to be 2 g/rnL and 1-4 g/ L respectively 32: C of NCL8 and a pi l in against Staphylococcus p d ni r d $ isolates rsg to Example 8. RECTIFIED SHEET (Rule 9 1) ISA AU Ta l e 33: IC5 , C G, the M C mode, an C rang© of NCL812 against Staphylococcus pseudsnteritsedius isolates according to Example 8. 0 318] Vst i iin resistant Staphylococcus p au ni rr iu SP is an emerging problem in dogs, cats d horses. Two major clonal RSP g hav been reported from dogs in Europe (ST 1} and North America (ST 88). There were also reports of RSP affecting dogs i Japan and a single case of RSP in veterinary personnel n Hong Kong. [00319] in this study, rV RS P isolates were determined using a combination of presence o gene and i vitro resistance to oxacillin. Cefoxitin susceptibility has been used as a substitute for oxacillin for meth ci in resistant Staphylococcus aureus. However, cefoxitin disk diffusion tests using interpretive guidelines recommended f r human isolates of methiciliin resistant Staphylococcus aureus and coagulase negative staphylococci are unreliable identifying RSP, A cefoxitin breakpoint resistance of ≤30 mm~resistant and >3 -susceptible has been proposed by Be i ai, 2G12[Bemis, D. A., R. D. Jones, et a/. (2012). "Evaluation of cefoxitin disk diffusion breakpoint for detection of methiciliin resistance in Staphylococcus pseudintermedius isolates from dogs." Journal of Veterinary Diagnostic Investigation 24(5): 864- 967], This study is in agreement that this breakpoint may be more reliable in predicting methiciliin resistant Staphylococcus p& i& d s. 0320] SP isolates are generally resistant to multiple antibiotic classes. Bacteria! culture end antibiotic susceptibilities are therefore recommended for all suspect SP RECTIFIED SHEET (Rule 9 1) !SA/AU infections to allow appropriate selection of antibiotics. A limitation noted n this study is the apparent in vitro susceptibility of R P isolates to amoxicillin and cepfiaiosporins pha o in and cefotetan). 00321] CL.8 12 was effective against a 23 isolates of both S and MRSP. A larger scale study is warranted to confirm the effectiveness of CL 2 against Staphylococcus p nt r i as it ay provide a safe alternative antibiotic option for emerging MRSP infections in domestic animals. EXAMPLE 7: Preparation and testing of CL8 analogues (also known as compounds of the invention). Materials i d NCL812 Analytical grade CLS with a defined potency of 960 mg/g i.e . 98%) was obtained. The powder wa stored in a sealed sample container out of direct sunlight and at room temperature at the stud site. Aliquots 1 L) of stock solution (containing 25. nig/ml of CL in D v SO) were prepared and stored at -80 °C and defrosted immediately before use. Syn s ing a d Testing of NCL81 Analogues Q32 2 Analogues C 1 to CL230 , as identified in Figure 1, were synthesized using standard methods in the art. As an exampia, the methods used to manufacture compounds CLG9 ; CL157; L17 ; NCL188; NCL195; and CL19 are as follows: CL 0 7 ( '- is - ri ydro pheny m thy ene arbonimidic dihydrazide hydrochloride) GG32 3 A suspension of S^S-trihydroxybenzaldehyde (412.0 rng, 2.873 i, 2 21 © .) and -dia inog anidine hydrochloride (152,0 mg, 1.211 o!) in EtOH (5 mL) was subjected to microwave irradiation (150 W ) at °C for in. The reaction was then allowed to coo! to ambient temperature. The resulting precipitate was collected a d washed with chilled EtOH (5 mL) and Et (5 mL) to afford the car ni idicdi y r z d (369.0 g, 77%) a a pate brown i d . 292 * (Decomp.). H R (300 MHz, D SO-d 9.06 (br s, 6H), 8.25 8.01 (m, 4H). 6 83 (s, 4H . C NMR (75 MHz, D SO-d ) δ 152.2, 149.7, 146.2, 138.5, 123.7»107.4. L S(ES ) 361.95 [ + 1 * . CL 1ST p,2 , bis (2-a ino-4 ch oro pheny!) etr y1ene]c rbonimidic dihydrazide hydrochloride) RECTIFIED SHEET (Ru e 9 1) SA AU |00324] Synthesis of 2~arnino--4~chlora~N~ni&thoxy~N-rn&thyibenzamidB. To a of 2 a i 4-c rob r¾Q add (5.6691 g, 33.041 rn , G-dimeth hyd oxy anrnne hydrochloride (5.7504 g, 58,954 rnmol, 1.78 eq. , V-(3-d hyl i opr pyi)- i - ethylearbodiimide hydrochloride (7.7825 g, 40.649 rnmol, 1.23 eq.) and hydrox n otr a ote hydrate 52 371 g 38.793 ! (anhydrous basis), 1 17 eq.) in (100 L) was added dsisopropySeihylamine ( S 0 mL, 13.4 g, 104 moi, 3.15 eq.) a d the brown solution stirred at ambient temperature for 7 h. The reaction was then concentrated in vacuo before dilution with aOH ( 0 ml) a d extracting with CH C! (3 100 mL) The combined organic extracts were washed with 1 HC (100 mL) before drying over SCv and concentrating in vacuo to afford a brown syrup. This oil was then further dried at §0 C under high vacuum to afford the crude e nreb amid¾ (7.021 g, 99%) as a brown syrup that crystallised on standing. The crude material was used without further purification. R (400 MHz, CD ) δ 7.24 d, J ~ 8 4 Hz, 1H), . 2 (d, J 1 Hz, 1H), 8.54 (dd, 8.4, 1.9 Hz, 1.H), 4.75 (s, 2H), 3.48 (s, 3H), 3.24 (s, 3H). ¾ N (101 MHz, CDC ) δ 1 9 2, 148.4, 137.1, 130.6, 118.6, 11 .1, 115.0, 1.1. 34.Q. [00325] Synthesis of 2~& f ~4 i r benz i yd . Crude 2-amino-4-chloro-fV- h x -A thy b nz mid (751.1 mg, 3.532 mmoi) was broken up into a. 120 mg batches and each dissolved in THF ( mL) and cooled to 0 °C before L IH (2 in THF, 0 mL) was added to sacfi and the solutions stirred for 16 , allowing the reactions to achieve room temperature. The reactions were with saturated 1 mL) before be ng combined, diluted with saturated aHC ¾ (160 mL) and extracted with CHCi (2 0 mL, 1 75 mL), The combined organies were dried over d concentrated in & to afford the crude benzaldehyde (483.3 rng, 85%) as yellow/orange crystals. The material was used without " further purification. Ή (400 MHz, CD3 D) 9.77 (d, J ~ Hz, 1H), 7.46 (d, J - 8,3 Hz, 1H), 83 δ 6.71 (rn 1H)S 6.63 dd, J = 8,4, 1.9 Hz, 1H), C HMR (101 MHz, CD OD) 194 6, 153.0, 142.5, 138,4, 118.3, 116,8, 1 6.1. [00328] Synthesis of 2,2' bi [(2- inQ c r ph&nyl} ethyl n ] dihydrazide hydrochlorides. suspension of 2- amino- 4- chlorobenzafdehyde ( 8.0 mg, 0.823 m oi, 1.78 eq.) and -diamin g ani ine hydrochloride (58.0 rng, 0.482 mmoi) i EtOH (2 mL) was subjected to microwave irradiation 100 ) at 60"C for 5 minutes. Most solvent wa then removed in vacuo, EtOH ( 1 mL) was added and the flask transferred to the freezer to effect crystaiiteation. The resulting precipitate was collected and washed with EtOH ( 1 L) to afford the carbonimidiGdihydrazsde (21,0 mg, 13%) as a pa e yello solid. H HMR (400 MHz, D SO -d ) δ .7 (br , 2H), 8.40 (s, 2H), 8.37 (s, 2H), 7.29 (d, J 8.4 Hz, 2H), 6.67 d. J 2.0 H∑, 2H), 6.73 (br s, 4H , 6.S© (dd, J = 8.3, 2.0 Hz, 2H). C NMR ( 1 , ) δ 152.1, 151.5, 148,9, 136.0, 34 .7, 115,1, 114.5, 112.8. RECTIFIED SHEET (Rule 91} SA AU [00327] A suspension of 2-arnino-4,6-dihydrazinylpyrirnidine (67.3 g, 0.434 moi) and 4-chiorobenzaidahyde (198 8 rng, 1.414 mmoi, 3.26 eq. n EtOH (25 mL) was heated at reflux for h. After this t me, the condenser was removed and the solution concentrated to p ro x 1 and the resulting precipitate filtered hot and washed w t E 0 (10 mL) to afford the aminopyriraidine (42.8 mg, 25%) as an off-white amorphous powder. M.P. 275 * C (Dscomp.). H N (400 z Ό ) δ 10.70 (s, 2H), 8,02 (s, 2H), 7 67 (d, J - 8.4 Hz, 4H), 7.52 (d, J = 8.4 Hz, 4H . 6.28 (a, 1H), 5.85 (a, 2H). 3C NMR (101 MHz, D SQ) δ 182,8 182.6, 138.8, 134.1, 133.1, 128.9, 127.8, 73.5. CL1 (( )-2-(1-(4-c of pheny!)p nt iden )hydra i e~1- arboxim da?S e hydrochloride) [00328] A suspension of 1-(4-chloropheny!)penianane (1.8318 g, 9.3146 mmoi, 1.9 eq.) and aminoguanidine hydrochloride (527.6 mg, 4.773 mmoi) in E OH (1 mL) was at 65 C for 1 h. The crude was cooled to ambie t temperature before being diluted w th 0 ( 0 L) and cooled to 0 °C to precipitate unreached aminoguanidine hydrochloride (174.5 g). The o er liquors were then concentrated in vacuo and the residue dissolved in Et 0 (20 mL) The solution was then boiled and hexanes ( mL) added to afford the caboximidamide as cream δ solid. H NMR (400 MHz, D SO .54 (s, 1H), 7.99 ( , J ~ 8.7 Hzf 2 , 7.90 (S, 3H), 7.47 ( , J 8.6 Hz, 2H), 2.91 - 2.82 (m, 2H), 1.48 1.32 ( , 4H), 0.89 0.84 (m, 3H) 3C NMR (101 MHz, DMSO) δ 156.2, 153.8, 134.8, 134.4, 128.7, 128.4, 28.1, 26.8, 22.0, 13.8 CL 1 (4 8~bis 2-((E -methylben yiiden hyd a in i)pyr m din-2~am n ) A suspension of 2~amino~4 dihydra in py m d r e (58.9 mg, 0.380 mmoi) and 4- m th ben aidehyde (0.10 ml, 100 mg, 0.832 mmoi, 2.1S eq.) in EtOH (4 mL) was heated at reflux for h. The reaction mixture was cooled to ambient temperature before collecting the pe et- ike precipitate, washing with E 0 (20 mL). The 'pellets' were then crushed and the solid further washed with Et (10 ml.) to afford the pyrimidine (85.8 mg, 83%) as white 'fluffy' powder. UP. 274-276 C. NMR (400 MHz, DMSO) δ 10.51 s, 2H), 8.00 CL1 6 (4,4, E, ((2-am opy midine ,§-di l) is(hydr zin-2- h1 ylidene))bis(methanylyiidene))iJiphenol) {003293 A suspension of 2-amino-4,8-dihydrazinopyrimidine (70,4 mg,. 0.454 mmoi) and 4~hydroxybenzaidehyde (140.3 mg, 1.149 mmoi, 2.53 eq ) in EtOH (3 mL) was heated at reflux for 16 . The reaction mixture was cooled to ambient temperature before collecting the precipitate, washing with Et (25 mL), to afford the pyrimidine (9 .4 mg, 55%) as off-white powder. MP. 298 C (Decomp.). H NMR (400 MHz, DMSO) δ 10.31 (s, 2H), 9.74 (s, 2H), 7 94 RECTIFIED SHEET (R S 1) SA/AU s, 2H), 7.48 , J = 8.6 Hz, 4H), 6.83 (d, J 8.6 Hz, 4H), 6.20 s 1H , S O (s, 2H). C (101 MHz, D SO) δ 182.7, 162.5, 158.3, 140.5, 12 .7, 126.3, 5.7, 73.0. MiC tests [QG330] i inhibitory concentrations ( g/m!) were determined using the broth mi rodi uti on method recommended by the Clinical and Laboratory Standards Institute (CLSI) MIC breakpoints were determined by visual assessment and then confirmed using an EL SA plate reader, measuring abs rbanc levels at 600 n . Bacteria! growth (turbidity) in the wells with antimicrobial was compared with the amount of irowth (turbidity) in the growth-control well (containing o antimicrobial). A l isolates we e tested in duplicate, if there was a difference of greater than one two-fold dilution n the results, the test was repeated a third time. The purity of the isolates was closely monitored during testing by subculturing the prepared bacterial inoculum onto SBA (sheep blood agar). The vt Cs of the control strains for the antimicrobial ampicillin were determined fo each testing run as an interna! quality control The C s, and M C range (minimum and maximum) were calculated for each of the bacterial groups. Activity f NCL812 and MiC against Gram-negative bacteria [00331] The activity of CL8 12 against Gram-negative bacteria was assessed using the broth icrodil fi method recommended by the Clinical and Laboratory Standards Institute (CLSI), and the C ( g t.) for C 8 and ampiclin were determined. Determination of Minimum Bactericidal Concentration (MBC) C S! methodology [00332] Briefly, 1 L of the contents of each well starting at the MIC was Inoculated on to a Columbia SBA plate and incubated at 37 °C for 4 . Plates were examined a 24 an 48 h and the MBC was recorded as the lowest concentration of C 3 a which no colonies of bacteria were observed on the plate (or significant inhibition of growth was observed compared to th control) (CLSI 2005). kinetics assays RSA V E [00333] ?v S /V' E were grown overnight on Columbia SBA at 37 C A few colonies of bacteria were then suspended In CA VHB and adjusted to an optical density of 0.08 to . . The bacterial suspension was diluted 1:10. One r ilitr of the bacteria was added o mL of CA HB containing various concentrations (up to 4 x M C) of CL to achie a final bacteria! concentration of 1 to 3x s CFU/m!. The tubes were incubated at 37 eC. order t determine the number of viable bacteria present at various time points, a 0 aliquot was RECTIFIED SHEET (Rule 9 1) !SA/AU removed fro each tube and diluted in normal saline. Then, 0 of each dilution was spread o to colony count agar, in duplicate, and incubated for 48 h at 37 C . After 24 the numbers of colonies present o each plate were counted and therefore the number of viable bacteria present in the original suspension enumerated. Plates were re-checked after 4 8 hours. Synergy studies with other classes of anii i r bi i ag&nt [00334] The checkerboard method (G ni s e af., 2000 Int. J. Anfi icr . Agents 14:239- 42} was used to find interactions (synergy, antagonism, no effect) of NCL8 in combination with tetracycline, chloramphenicol, erythromycin (macroiide), am pi i n (p-iactam broad- spectrum gentamiein (aminoglycoside), ciprofloxacin (fluoroquinolone), sulfamethoxazole su p onsrnide ' or penicillin G iacta narrow -spectrum) For Initial experiments, a laboratory strain of Staphylococcus aureus Ϊ 3-129 was used, however this strain gave inconsistent results for some of the antimicrobials and a new strain of Staphylococcus spp designated 1 (definitive species identification currently in progress) that was sensitive to all tested antimicrobials was used n subsequent tests. [ .335 Firstly the MIC of each antibiotic alone was determined in accordance to C S I standard guidelines. Secondly, the combination of CL8 with each of above antibiotics w tested in duplicate. To evaluate the effect of the combination the fractional inhibitory concentration (F C ) was calculated for each antibiotic as follows: F C of tested antibiotic = I fC of tested antibiotic i combination / I 1IC of antibiotic alone. C of NCLB12 = MIC of .8 in combination / MIC of C 8 12 alone. F C = FIC index = F C of C 8 2 + FIC of each tested antibiotic. 0033 @1 According to the checkerboard guidelines, Synergy (S) was defined as an F!C j . . No effect (HE) was defined as G 5 Testing of NCL812 Analogues 00337] NCL812 analogues were stored at 4 C until assayed. C were determined against two strains, two VRE strains and one strain each of £ . and P e d on s . Results Determination of Minimum inhibitory Concen &ti n ( i RECTIFIED SHEET (Rule 91) ISA AU [00.338] The comparative NC a d mpici ! MIC values for 2 1 RSA isolates were obtained. The results for the original experiments (phase ), and repeat testing phas S) are shown in Table $4. Each M C test was performed i duplicate. RECTIFIED SHEET (Ru e 1) ISA/AU RECTIFIED SHEET (Rule 91) ISA/AU Table 3S Comparative CL81 and rr n MIC values g/ ) for 13 VRE isolates obtained according to Example 7. [00339] The comparative C L8 and arnpiciilin . values ( g/mL) for 13 VRE isolates were obtained. The results for the original experiments (phase \), and repeat testing (phase I) are shown in 3S. Each MIC test was performed i duplicate. 100340] CL8 12 ICS , MIC and MIC range were obtained for Australian isolates of V SA and VRE, as shown Tab 6 Comparative iC values for ampi iin .are shown in parentheses. Activity of NCLS12 /C against G n&g&t bacteria Comparative CL8 12 and arnpiciilin MIC (pg/ L for Escherichia coii, P d na i and Salmonella ark o were obtain eel. as shown in T s© 3 , Each v C test was performed in duplicate. Comparative CL8 and ampiciliin M values g/m ) for Esch as aeruginosa and Salmonella ari na obtained according to Example [00342] The antimicrobial ' activity of C 8 against the selected Gra -n gati e bacteria was > g rrs D i of Minimum Bactericidal Concentration (MBC) [00343] MBC results for RSA Isolates are shown in T 3? which shows NC 8 MBC values ( g L for 20 URSA isolates. Each MBC test was performed n duplicate starting fro the C 8 M concentration to times the MIC. For all isolates, the MBC was equal to the MIC. However, inconsistent growth on agar plates was recorded for some concentrations. T 37; CL 12 MBC values (pg for 2D SA isolates according to Example ?. RECTIFIED SHEET {Rule 91) ISA AU [00344] The results for 10 VRE Isolates are shown i Table 38. Each C test was performed i duplicate starting from NCL M C concentration to 32 times the !C. As with the R8A isolates tested, the M C appears o be equal to the MIC. However, with the VRE isolates, anomaly was observed at higher CL812 concentrations. There is significant inhibition of growth at concentrations near to the MIC, but as the NCL812 concentration increases, bacteria appear to be less subject t inhibition. H h numbers of bacteria were observed on the plates at NCL812 concentrations s 8 g/ L. T te 38: CL8 values g/ml for VRE isolates according o Example 7 RECTIFIED SHEET {Rule 9 1) SA A VRE 2 VRE- 2c " of after 24 hours per m of s (CFU/mi); any bacteria growing on the plate (too many to c n ) [G0345] CL 12 was found to be bactericidal against Gram-positive bacteria at concentrations equivalent to the MIC. Kill kinetics assays (MRSA & VRE} £0 34 ] in preliminary experiments, colony counts were performed at ί = , 3 45 and 6 min. No significant changes in the bacterial concentration were observed at t ese time points, suggesting that CL8 2 is not rapidl bactericidal (by comparison, the tipoglycopeptide ritav ncin (McKay el a . (2009 . Ant i r b. Chemother, 83 (6): 0 1- 99} caused a 3S g reduction in viable count within an hour of exposure to a concentration equivalent to the Cm ). Therefore, for future experiments, sampling time points were extended out to one and then two hour intervals [Q 347 n the initial experiments, for MRSA, at 4 a reduction of at least 2.5log, CFU/mL was observed in comparison to the growth control. At 8 h there was at least a 3 5 og CFU/mL difference between the control and the bacteria exposed to CL8 . After 24 h the numbers of bacteria present n all L 1 concentrations was not significantly different to the control There was a consistent reduction in bacterial numbers at CL 2 concentrations from 4-1 § g up to S h, but the same was not observed for concentrations greater than g/mL By comparison, most bactericidal antimicrobial agents, used or being developed for the treatment of MRSA and VRE { r s ancin , apt ycin vancomycin) are rapidly bactericidal achieving similar log reductions within 1 h of exposure in a concentration dependent manner McKay et a/, 2009). in k kinetics experiments bacteriostatic antimicrobials recommended for the treatment of MRSA and VRE Infections op anin inezo id only marginally decrease the viable count and growth). [00348] For VRE the observed decrease in the CFU/mL of bacteria exposed to NCL 1 was less than for MRSA. At 4 h there was approximately a 2log reduction in the viable count RECTIFIED SHEET (Rule 9 1) iSA/AU compared to the control, and at 8 h there was approximately a 2 5log reduction.. However, at 24 the growth of bacteria was no longer as significantly reduced n comparison to the control. Bacterial numbers increased after 8 h incubation and this affect appeared to be more pronounced with increasing concentrations of CL8 . | 034 ] The ki kinetics of RS 80 were obtained at different concentrations o CL over a pe od of 8 h, as shown in 34 The kill kinetics of RSA 580 in different concentrations of CL8 over a period of 24 h are shown in Figure 3S After 4 h of incubation the media was changed to fresh media containing the same concentration of CL8 . [00350] The ksii kinetics of URSA 698 in different concentrations of C 8 over a period of 24 h is shown in Figure 3 After 4 h of incubation the media was changed to fresh media containing the same concentration of GL8 . 100351] The kill kinetics of VRE 2 {dc) at different concentrations of N over period of 24 h are shown in F g r 3 . [00352] The kill kinetics of VRE 8c(dc) at different concentrations of CL8 2 over a period of 24 are shown i Figure 38 Test for b&ct&nai resistance to NC 8 [00353] Preliminary tests were carried out to determine whether bacterial resistance ay account for the observations of bacterial growth at higher concentrations of CL and the increase in bacterial in kill kinetics experiments at 24 h incubation. Bacte a ( v RSA growing at high concentrations of CL8 , in the 96 well micro itre tray, were subcuitured on to S8A and incubated for 24 h, then M\C testing was performed. There was no change in the M C of these bacteria. Bacteria growing in broth used for kill kinetics experiments was also tested for any change in the . Mo change was observed. [00354] Additi onally bacteria exposed to NCL812 at high concentrations were then subcuitured on to plate count agar containing NC ( 4 g/ L and 12 g/ L) and Incubated for 24 h at 37 , C . Bacte a growing o n the plate were then used for running an C test. There was s ill no change in th !C of the bacteria. [00355] In summary, C S has bactericidal activity against RSA which is less pronounced against VRE strains. The bactericidal effect is not rapid in comparison to bactehcidal antimicrobials developed for MRSA and VRE infections dap o ycin, oratovancin, vancomycin). Aberrant bactericidal results at higher concentrations of C 8 are not indicative of resistance development, but may be suggestive of loss of activity. Stability testing of the compound in broth media should therefore be undertakers before exploring these interesting but RECTIFIED SHEET (Rule 9 1) ISA/AU currently unexplained results. This wi l include a detailed examination o the literature to determine if this phenomenon observed in other classes of antimicrobial age t i this case, closer examination of the Kill kinetics between 8 and 24 h will he required NCL81 kill curves f r URSA and VRE suggest more bactericidal activity in co pa son to bacteriostatic antimicrobials iine o d p!anin K ll curves should now be generated for Streptococcus pneumoniae once stability issues of CLB are investigated, as for example with line z i i, some antibacterial agents can be bacteriostatic against some bacteria and bactericidal against Synergy studies with other of antimicrobial agent ¾ iCs, FJCs, d interaction between C 1 and eight antibiotics i shown in Table S. None of the eig tested compounds, representing distinct classes o arstimicrobiaf agent showed either posit; (synergism) or negative (antagonism) interaction with CI.. consistent with an additive when antibacterial agents are added to C . Table MfGs, Cs s F and the interaction between NCL81 and eight antibiotics according to Example 7. RECTSFiED SHEET (Rule 9 1) ISA/AO ' S. a strain 3 29 ·'' Staphylococcus spp. Strain K1 F C, ~ MIC of antibiotic in na i n with NCL8 M C of antibiotic a one F i - M C of NCL812 in combination with antibiotic/MIC of NCL atone IG = C index Testing N L.8 Analogues [00357] The chemical structures of analogues CLQ0 1 to C L23 a e shown in Fig 1 00358 C for C 8 and analogues NC 0 -070 shown in Table 4 . 1 0S5 !Cs for analogues NCL071 to 7 1 are shown in T¾ 4 1. '0 3 0 Cs for analogues NC to 230 are show in Table 4.2. RECTfF!ED SHEET Ruie 9 1} SA A U Table 40: MICs for NCL812 and analogues NCL001-070 according to Example 7 . RECTIFIED SHEET Rule 9 1 (ISA/AU) _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l o z Z z z Z Z Z Z Z Z z Z Z z Z Z Z z Z z z z RECTIFIED SHEET Rule 9 1 (ISA/AU) z z z z z z Z RECTIFIED SHEET Rule 9 1 (ISA/AU) Table 4 1 : MICs for analogues NCL071 - 170 according to Example 7. RECTIFIED SHEETS RECTIFIED SHEETS (Rule 9 1) ISA/AU > 128 > 128 4 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 132 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 133 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 134 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 135 > 128 > 128 > 128 > 128 > 128 > 128 64 128 32 128 > 128 > 128 NCL 136 64 128 32 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 137 > 128 > 128 > 128 > 128 > 128 > 128 > 128 32 > 128 > 128 > 128 > 128 NCL 138 > 128 32 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL1 39 > 128 > 128 > 128 > 128 > 128 > 128 > 128 16 2 8 > 128 > 128 NCL 140 > 128 32 2 8 > 128 > 128 > 128 > 128 16 > 128 > 128 > 128 NCL 14 1 > 128 > 128 16 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 142 > 128 > 128 > 128 > 128 > 128 > 128 16 16 8 8 > 128 > 128 NCL 143 16 16 8 8 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 144 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 145 > 128 > 128 > 128 > 128 > 128 > 128 8 16 16 16 > 128 > 128 NCL 146 8 16 16 16 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 147 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 148 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 149 > 128 > 128 > 128 > 128 > 128 > 128 128 128 > 128 > 128 > 128 > 128 NCL 150 128 128 > 128 > 128 > 128 > 128 64 64 128 64 > 128 > 128 NCL 15 1 64 64 128 64 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 152 > 128 > 128 > 128 > 128 > 128 > 128 32 16 8 8 > 128 > 128 NCL 153 32 16 8 8 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 154 > 128 > 128 > 128 > 128 > 128 > 128 8 8 16 8 > 128 > 128 NCL 155 8 8 16 8 > 128 > 128 > 128 > 128 > 128 > 128 > 128 > 128 NCL 156 > 128 > 128 > 128 > 128 > 128 > 128 2 2 2 2 > 128 > 128 NCL 157 2 2 2 4 > 128 > 128 8 16 16 16 > 128 > 128 NCL 140 8 16 16 16 > 128 > 128 8 8 8 8 > 128 > 128 NCL 038 8 8 8 8 > 128 > 128 4 4 4 > 128 > 128 NCL 158 4 4 4 4 > 128 > 128 64 128 16 128 > 128 > 128 NCL 159 64 128 16 128 > 128 > 128 32 128 16 64 > 128 > 128 NCL 160 64 128 16 64 > 128 > 128 RECTIFIED SHEET Rule 9 1 (ISA/AU) RECTIFIED SHEET R le _1) A A U RECTIFIED SHEET Rule 9 1 (ISA/AU) >128 128 8 >128 >128 > S > 28 > 8 128 1 8 8 128 CL2 1 32 18 8 8 S >128 32 12S > 8 >128 8 L2 2 8 8 8 8 12 >128 8 8 8 s- 8 > 8 NCL203 32 84 32 32 128 >128 32 84 64 32 > 8 >1 GL204 4 4 >128 > 28 > i . 8 84 >128 >12 >12 N L2 5 4 4 64 >128 >128 128 8 64 128 > 8 > 8 CL2 8 2 8 8 128 >128 >128 8 > 8 128 > 8 CL2 ? 18 32 128 128 > 2 >128 3 32 > >128 >128 128 CL2 S >128 8 128 > 8 8 1 .8 » S 8 >128 1 >128 CL2 9 12S > 28 2 >1 8 >128 >128 S >128 8 >128 >128 >«8 CL21 128 >128 8 32 8 >12β >12S 28 8 4 > »1S8 C 2 11 >128 >128 [ >128 >128 128 8 ® >128 ) > 8 8 128 C 2 2S 8 32 > 8 >1 8 12S 128 32 18 2& 128 NGL213 > 28 8 128 28 >128 >128 8 > 8 >128 8 >128 >1 8 NC 2 > 28 > 8 >128 >12 8 >12δ >128 128 128 >128 > 8 > CL2 8 S 2 4 > 8 >128 16 8 4 8 >12S >128 NCL21S 2 2 2 4 : 8 12 4 2 4 > 8 >128 L 1? 4 4 2 128 > 28 4 4 2 4 >128 >128 CL2 128 > 8 18 > 8 > 28 >128 > 8 >128 18 12S >1¾8 > 8 C 219 2 2 16 18 1 8 >128 2 2 1 16 8 8 1 1® 32 32 > 8 >128 18 16 32 32 8 8 C 221 4 2 ©4 84 128 > 8 4 2 4 64 > 8 8 RECTIFIED SHEET (Rule 9 1) SA AU NCL222 > 128 j > 128 > 128 > 128 > 128 j > 128 > 128 > 128 > 128 ] > 128 > 128 > 128 NCL223 > 128 > 128 > 128 > 128 > 128 j > 128 > 128 > 128 > 128 > 128 > 128 j > 128 NCL224 > 128 | > 128 > 128 ] > 128 > 128 > 128 NCL225 > 128 > 128 > 128 > 128 > 128 j > 128 NCL226 > 128 | > 128 > 128 > 128 > 128 > 128 NCL227 > 128 | > 128 > 128 ] > 128 > 128 > 128 NCL228 > 128 > 128 > 128 > 128 > 128 > 128 NCL229 > 128 | > 128 > 128 > 128 > 128 > 128 NCL230 > 128 | > 128 > 128 > 128 > 128 > 128 RECTIFIED SHEET Rule 9 1 (ISA/AU) [00381] The NCL analogues showing the highest level of Gram-negative antibacteria! activity included NCL030 {especially Ps d nas), C 4 , NCL043, CL 44 (especially Pse nas , NCL052 {especially Ps d nas , a d NCL053 (especially Ps nas} NCL097 (especially P na ), CL10 and CL188 {especially E, cols). [0 3 2] The C analogues showing greatest activity against Iv RSA included: NCLG21: CL 23; CLG2 ; NCLG ; NCL035; CL03 NCL039; NCL04G; NGLQ 1; NCL043; NCL044; CL0 2; NCLG54; NCL062; NCLQ89; NCL072 NCL073; CL074 ; CL 7 ; NGL079; NCL08Q; CL S1 CL0 2; CLG84; NCL0 NCL089 CL093 CL 4 NCLG37; NCLQS9; NCL 1; NCL : NCL107; C 1 8; NCL1 1 ; NCL113, CL 7 ; NCL120; NCL121; NCL123; CL13 ; NCL138; CL14 NCL143 NCL148; NCL150 NCL151; NCL153; MCL155; NCL 157; NCL158; NC ; CL1 0; NCL161 NCL168 NCL ; NCL171; C 2 CL1 3 CL 4; NCL177; NCL 178; NCL179. CL18 ; NCL181 NCL182; NCL183; CL184 NCL185; NCL186; NCL 7; NCL 188; NCL 18 CL 0; CL 1 NCL192; CL1 3; C S5; CI.. ; NCL197: GL ; NCL201; CL2 2; NCL203; CL2 4 NCL2Q5; NCL207; CL2 ; NCL2 ; CL2 ; NCL2 NCL220; and NCL221. The NCL analogues showing greatest activity against VRE included: NCL011; NCL021; NCL023; NCL029: CL03 : CL 35: CLG38; NCL039; NCL040; NCL041; NCL 43 CL 44 ; NCL052; NCLQ54: NCL061; CL 62 NCL S NCL07 CL 72; CL 73; CL 78 CL08 CL 1; CL 82 NCL099; NCL101: CL1 S NCL 7 NCL 1 8 NCL1 1; NCL112; NCL113; CL NCL121; NCL 12 NCL 3 1; CL1 8 NCL 1; CL 3; NCL15& NCL157 CL 8; NCL 158 NCL160; NCL161; C 1 8 NGL168; NCL 188; NCL 1; NCL173; NCL174 CL1 5; CL 7: NCL178; NCL179; NCL180; NCL181; NCL182; CL1 3; CL NCL 5 NCL ; CL187 CL 8 CL 9; NCL 0 NCL 9 ; CL 2; CL 3; NCL 5 MC .136; HCL197; NCL202: CL2 3; CL2 4 MCL205; N L2 ; CL 1S NCL218; NCL2 CL2 ; NCL219: CL22 ; d NCL221 0384j The bioassay ranking of the analogues tested shown in , T te 43: The bioassay ranking of the analogues tested according to Example 7. RECTIFIED SHEET {Rule 91) SA A U NCL053 NCL1 79 3 8 NCL81 2 3 8 NCL21 7 3 8 NCL054 3.5 9 NCL054 3 9 NCL079 3 9 NCL21 7 3.5 10 NCL221 3 10 NCL080 3 10 NCL081 3.75 11 NCL1 99 3.5 11 NCL078 3 11 NCL1 93 3.75 12 NCL084 4 12 NCL1 95 3.5 12 NCL079 4 13 NCL21 7 4 13 NCL082 3.5 13 NCL080 4 14 NCL1 58 4 14 NCL074 3.75 14 NCL1 58 4 15 NCL089 5 15 NCL1 79 4 15 NCL082 5.25 16 NCL081 5 16 NCL054 4 16 NCL078 5.5 17 NCL079 5 17 NCL1 58 4 17 NCL1 20 6 18 NCL080 5 18 NCL088 4 18 NCL088 7 19 NCL099 6 19 NCL1 23 4 19 NCL099 7 20 NCL204 6 20 NCL21 5 4.5 20 NCL1 77 7 2 1 NCL205 6 2 1 NCL1 93 5 2 1 NCL21 5 7.25 22 NCL082 7 22 NCL1 20 5 22 NCL1 97 7.5 23 NCL1 20 7 23 NCL035 5 23 NCL040 8 24 NCL078 8 24 NCL1 40 5 24 NCL038 9 25 NCL1 77 8 25 NCL1 77 6 25 NCL202 9 26 NCL1 97 8 26 NCL1 97 7 26 NCL21 9 9 27 NCL040 8 27 NCL099 8 27 NCL1 23 9.5 28 NCL038 8 28 NCL040 8 28 NCL074 9.875 29 NCL1 55 8 29 NCL202 8 29 NCL1 55 10 30 NCL088 10 30 NCL021 8 30 NCL035 10.5 3 1 NCL21 5 10 3 1 NCL1 43 8 3 1 NCL021 12 32 NCL202 10 32 NCL1 53 8 32 NCL1 13 12 33 NCL1 13 12 33 NCL038 10 33 NCL1 43 12 34 NCL1 46 12 34 NCL1 55 12 34 NCL1 46 14 35 NCL1 07 12 35 NCL1 13 12 35 NCL1 53 16 36 NCL1 23 15 36 NCL21 9 16 36 NCL1 88 16 37 NCL074 16 37 NCL1 46 16 37 NCL1 73 17 38 NCL035 16 38 NCL1 88 16 38 NCL023 20 39 NCL021 16 39 NCL1 73 18 39 NCL220 24 40 NCL1 43 16 40 NCL1 74 18 40 NCL1 74 25 4 1 NCL1 88 16 4 1 NCL039 20 4 1 NCL1 90 28 42 NCL1 73 16 42 NCL023 24 42 NCL039 30 43 NCL023 16 43 NCL21 2 24 43 NCL1 2 1 30 44 NCL220 16 44 NCL1 2 1 28 44 NCL029 32 45 NCL1 53 24 45 NCL220 32 45 NCL221 33.5 46 NCL1 90 24 46 NCL1 90 32 46 NCL1 68 40 47 NCL207 28 47 NCL029 32 47 NCL1 69 40 48 NCL1 74 32 48 NCL1 69 32 48 NCL203 44 49 NCL1 2 1 32 49 NCL1 80 32 49 NCL1 07 46 50 NCL029 32 50 NCL1 84 32 50 EXAMPLE 8 : The effects of NCL812 on antimicrobial sensitive isolates of Staphylococcus aureus and Enterococcus faecalis Materials and Methods Strain information RECTIFIED SHEET Rule 9 1 (ISA/AU) [00385] Two Staphylococcus aureus isolates were used in the following experiments; S. aureus 01 a hu an skin strain, and S. aureus C01 an equine skin strain. These isolates were identif ied by Gram stain and biochemical methods, including the Reme Staphaurax commerce! kit. One Enter C c us f a isolate S }, was not identified as a V E As this isolate has previously been speciated, it was not subjected to further testing, except fo observation of pyre, characteristic growth o b ood agar. Inv& tigat n of B i& ici a C ncentr ti n BC C S/ e gy |0 36 ] As previous experiments, 1 µί of the contents of each well starting at the was inoculated on to a Columbia SBA piste and incubated at 37 °C for 48 h. Plates were examined at 24 and 48 h and the MBC was recorded as the lowest concentration of CL 12 at which no colonies of bacteria were observed on the plate or significant inhibition of growth was observed compared to the control) (CLS! 2 S). Kill kinetics assays for S, aureus C & fae a sUSA0.1 003 73 5 . aureus KC 1 and E faecalis 1, not determined to be URSA or VRE, respectively, were grown overnight on Columbia SBA at 37 C. A few colonies of bacteria were then suspended CA HB (cation-adjusted Mueller Hirston broth) and adjusted to of 0.08 to 0.10. The bacteria! suspension was diluted 1:10. One miiiitre of the bacteria were added to 9 L of CAMHB containing various concentrations (up t 4 € ) of C , t achieve a final bacteria! concentration of to 3 CFU/mL The tubes were incubated a 37 with constant shaking. In order to deter i e the number of vi bacteria present at various time points, a 10 µ aliquot was removed from each tube and diluted. Then, 0 µί of each dilution were spread onto colony count agar, in duplicate, and incubated for 4 h at 3? "C. After 24 h the numbers of colonies present on each plate were counted and therefore the number of viable bacte a present in the original suspension enumerated. Plates were re-checked after 48 hours. Minimum inhibitory C nir t n (MIC) [00308] The JCL8 2 MIC for isolates S. aureus KG1 arid KC01 and E. faec fe USA01 wss investigated. The results were: . aureus Κ0 ~ 4-8 g/mL, S. aureus C01 - 2 L , £ faecaiis USA 0 1 4 g m [00369] S. aureus isolates and C 1 were investigated and no growth, or growth only a low concentrations of C 8 2 /m , was observed, indicating that C 8 i RECTIFIED SHEET (Rule 91)_ISA/AU bactericidal against S. aureus. For the E. faecalis isolate tested (USA01) however, growth of bacteria was observed at all concentrations of NCL812 tested. There was an obvious reduction in the number of bacteria with increasing concentration, but growth was present compared with no growth for S. aureus. A summary of these results can be seen in Table 45. Table 45 shows the results for NCL812 MBC tests on two non-MRSA S. aureus isolates and one non-VRE E. faecalis isolate. Each MBC test was performed in duplicate. No change in the results was observed at 48 h . Table 37 shows NCL812 MBC values (Mg/mL) for 20 MRSA isolates. Each MBC test was performed in duplicate starting from NCL812 MIC concentration to 16 times of MIC. Table 38 shows NCL812 MBC values (Mg/ml) for 10 VRE isolates. Each MBC test was performed in duplicate starting from NCL812 MIC concentration to 32 times the MIC. Table 45: NCL812 MBC tests on two non-MRSA Staphylococcus aureus isolates and one non- VRE Enterococcus faecalis isolate according to Example 8 . + = Growth on Sheep Blood Agar; 0 = No Growth on Sheep Blood Agar; N = Not Cultured; Numbers in Parenthesis are the Number of Bacteria Growing after 24 hours per ml of sample (CFU/ml) Kill kinetics assays for S. aureus KC01 & E. faecalis USA01 Method [00370] Colony counts were performed at t = 0 , 120, 240, and 360 min, then again at 24 h . At the 2 h time point S. aureus KC01 showed a minimum of a 2.5log 0 reduction in bacterial numbers from initial numbers, and greater than a 3log 0 reduction in comparison to the control at the same time point. A minimum of a 2log 0 reduction was still evident at 6 h incubation, however after 24 h the numbers of bacteria present had increased and this was not significantly different to the control. [00371] Similar results were obtained with E. faecalis USA01, however the reduction in bacterial numbers observed was less than for S. aureus KC01 . A 2log 0 reduction in CFU/mL was observed at 2 h , compared to the growth control. However, the reduction in CFU/mL compared to the original bacterial numbers was only just greater than 1log 0 . At concentrations of 4-16 µg/mL of NCL812 this reduction in bacterial numbers remained consistent until the 6 h µ time point. At concentrations of 32 and 64 g/mL however, there was approximately a 1log 0 RECTIFIED SHEET Rule 9 1 (ISA/AU) 14 8 rise in bacterial numbers over the same time period. At 24 bacterial numbers at all concentrations had increased to almost the same level as the growth control. [00372] The results observed with these strains of S. aureus and E. f calis are consistent with the results observed for the kill kinetics assay for all RS an VRE isolates tested. The kill kinetics assay of Staphylococcus aureus -C 1 at different concentrations of NCL 2 , up to 24 incubation are shown in Figure 38. The kill kinetics assay of En cocc faecalis U8AG1 at different concentrations of NCLS12, up to 24 h incubation are shown in Figure 4 . EXAMPLE 9: Formulations of Compounds [00373] The following formulations were prepared using standard methods in the art. Formulation A - Topical Formulation - PEG~®a$ed Get with compounds of the invention 4.0g PEG 4000; 3.5g PEG 200; 0,8g propylene glycol; 1 Sg water; and .204g of Compound for example, MC 89) I00374] PEG 4000, PEG 20 and propylene glycol were mixed and heated to 50 C and until all solid crystals were dissolved. Compound was added to wafer and sonicated for 30 minutes until fully suspended. The Compound solution and gel solutions were mixed and allowed o cool and solidify. Formulation A will likely demonstrate acceptable viscosit , ease of skin application, uniform suspension and consistent and fine texture. Formulation 8 - Topical Formulation ~ .G- s Gel with compounds of the invention 3 0g PEG 4000; O PEG 8000; 3.0g PEG 200; 1. g propylene glycol; .9g water; and 0 .202g of Compound (for example, CL0 9) [0037 PEG 4000, PE 8000, PEG 2 0 and propylene glycol were i and heated to 1SO C and until all solid crysiais were dissolved. Compound for example, NCL089) was added to water and sonicated for 30 minutes until fully suspended. The Compound solution and gel solutions were mixed and allowed to cool and solidify. Formulation B demonstrated acceptable viscosity, ease of skin application, uniform suspension and consistent and fine texture. Formulation C - Topical Formulation PEG-has&d Gal with Compound S l pi s RECTIFIED SHEET (Rule 9 1} !SA AU 2.5g PEG 4000; 4.0g PEG 200; 2.5g propylene glycol; 1.0g water; and 1.8g solid dispersion of Compound-SoluPlus. [00376] Soluplus was purchased from BASF (www.soluplus.com). Compound-SoluPlus was prepared using standard methods in the art. PEG 4000, PEG 200, Compound-SoluPlus and propylene glycol were mixed and heated to 150 °C and until all solid crystals were dissolve. Water was added and then the solution was sonicated. The solution was allowed to cool and solidify. Formulation C demonstrated acceptable viscosity, ease of skin application, uniform suspension and consistent and fine texture. Formulation D - Tablet Formulation 30mg Calcium hydrogen phosphate dehydrate; 80mg Microcrystalline cellulose; 50mg Lactose; 8mg Hydroxypropyl methyl cellulose 1.5mg Talc 10mg of compound (for example NCL099) [00377] The excipients were weighed and mixed for 5 minutes. The mixture was fed into a feed hopper of a tablet press machine and the machine was operated according to standard procedures in the art. Formulation D demonstrated acceptable tablet hardness, disintegration and frability. Formulation E - Oral Suspension 2.0 ml Glycerol; 1.5ml Absolute ethanol; 600mg NCL812; and To 60ml Vehicle (Ora Sweet and Ora Plus, 1:1). [00378] NCL 812 powder was sieved through a 75 µ τ ι sieve. 600 mg of sieved NCL 812 was mixed with 2.0 ml glycerol and 1.5 ml absolute ethanol. The mixture was placed in a mortar and manually milled until all NCL 812 was suspended uniformly. The suspension was sonicated for 30 minutes. Vehicle (55 ml of Ora Sweet and Ora Plus mixture) was then added to the suspension and milled for another 10 minutes. Volume was made up with the Ora plus and Ora sweet mixture to 60 ml by transferring to a measuring cylinder [00379] Formulation E demonstrated acceptable suspension and demonstrated acceptable short term stability. RECTIFIED SHEET Rule 9 1 (ISA/AU) Formulation F -- intramuscular injection 20 g l Polyvinylpyrrolidone 3Q (PVP 30) 0 .09 g ml NCL812; and 50ml water, [ 38 ] Two percent of w/v PVP K3 solution was prepared by the addition of .0 g of PVP 30 to 50 ml of iiliQ water. The solution was then placed in a r ieat r for 3 minutes to equilibrate a d 4 5 g of C 8 was added to the PVP solution a d placed on an incubator shaker at a maximum speed of 10 rpm over a period of 24 hours, with controlled temperature of 25±1 C. Solution was transferred to 5 ml vials and checked for clarity, appearance, pH and short-term stability. The pH of solution was 7.25. [0Q3S1] Formulation F demonstrated acceptable transparency and short term stability. E 1 : Release of NCL812 and NCL from Formulation 8 . [00382] The objective of this study was to measure the release of NCL812 and CLG 9 from Formulation B prepared in Example 9. j00383] r s diffusion ceils were utilized to quantify the release rate of CL 812 and CL from its topical formulations. Five mi! !itr s of absolute efhanoi, which was chosen as the desired release medium, was loaded into the receptor chamber. Temperature of the ':' receptor fluid was kept constant, at 32±i C using a water jacket. Acetyl cellulose e bra es., with pore size of 0,45 rn (Pal Corporation) was selected and placed between donor and receptor chamber. Followed by that, a number of test samples (Formulation B was loaded into the donor chamber. One mi l tre of receptor fluid was collected at regular time intervals of 0.25, 0.50, 0.75, 1 2, 3, 4 , , 8, 7, 8 a d 24 hours through the sampling port. One milliiitre. of fresh absolute ethanol was immediately returned to the receptor chamber. UY-HPLC was utilized to analyse the content of the receptor fluids attained. [00384] Figure 4 1 presents the cumulative release of C 81 and CL0 9 over time. This study demonstrates that Formulation provides an acceptable release profile for NCL8 and NCL . EXAMPLE 11: Speeroscopy Lists of Compounds NC 8 , NCL001 CL230 RECTIFIED SHEETS [00385] NMR Spectroscopy was performed on compounds NCL812, NCL001-NCL230 using standard methods in the art. The lists of the NMR spectroscopy are presented in Table 46. RECTIFIED SHEET Rule 9 1 (ISA/AU) RECT ED SHEET {Rule 91) ISA AU NCL024 1H NMR (400 MHz DMSO) δ 12.32 (br. s , 2H), 8.67 (br. s , 2H), 8.44 (br. s , 2H), 8 .15 (d, J = 8.6 Hz, 4H), 7.98 (d, J = 8.6 Hz, 4H) NCL025 1H NMR (400 MHz DMSO) δ 8.75 (br. s , 2H), 8.50 (d, J = 8.2 Hz, 2H), 7.97 (d, J = 7.4 Hz, 2H), 7.85 (t, J = 7.6 Hz, 2H), 7.68 (t, J = 7.6 Hz, 2H) 1H NMR (400 MHz DMSO) δ 12.26 (br. s , 1H), 8.66 (br. s , 1H), 8.55 (s, 2H), 8.43 (br. s , 2H), 8.21 (d, J = 7.8 Hz, 2H), 7.94 (d, J = 7.8 Hz, 2H), 7.71 (t, J = 7.8 Hz, NCL026 2H) NCL027 1H NMR (400 MHz DMSO) δ 11.78 (br. s , 2H), 8.31 (br. s , 3H), 7.87 (d, J = 8.6 Hz, 4H), 7.04 (d, J = 8.6 Hz, 4H), 3.83 (s, 6H) 1H NMR (400 MHz DMSO) δ 12.00 (br. s , 2H), 8.75 (br. s , 2H), 8.39 (br. s , 2H), 8.22 (d, J = 6.7 Hz, 2H), 7.44 - 7.52 (m, 2H), 7 .14 (d, J = 8.2 Hz, 2H), 7.05 (t, J = NCL028 7.6 Hz, 2H), 3.89 (s 6H) NCL029 1H NMR (400 MHz DMSO) δ 11.98 (br. s , 2H), 8.48 (br. s , 2H), 8.36 (br. s , 2H), 7.56 (s, 2H), 7.35 - 7.49 (m, 4H), 7.04-7.1 0 (m, 2H), 3.84 (s, 6H) NCL030 1H NMR (400 MHz DMSO) δ 11.83 (br. s , 1H), 8.1 6 (s, 1H), 7.91 (d, J = 8.2 Hz, 2H), 7.75 (br. s , 1H), 7.53 (d, J = 8.2 Hz, 2H) NCL031 1H NMR (400 MHz DMSO) 11.91 (br. s , 1H), 8.22 (s, 1H), 8.09 (d, J = 8.2 Hz, 2H), 7.93 (d, J = 8.2 Hz, 2H) 1H NMR (400 MHz DMSO) δ 12.1 2 (s, 1H), 8.48 (s, 1H), 8.38 (d, J = 7.8 Hz, 1H), 7.94 (d, J = 7.8 Hz, 1H), 7.86 (br. s , 2H), 7.80 (t, J = 7.8 Hz, 2H), 7.64 (t, J = 7.6 NCL032 Hz, 1H) NCL033 1H NMR (400 MHz DMSO) δ 11.93 (s, 1H), 8.50 (s, 1H), 8.20 (s, 1H), 8.1 4 (d, J = 7.8 Hz, 1H), 7.90 (d, J = 7.8 Hz, 1H), 7.66 (t, J = 7.8 Hz, 1H) 1H NMR (400 MHz DMSO) δ 11.87 (br. s , 1H), 8.48 (s, 1H), 8.09 (d, J = 7.8 Hz, 1H), 7.70 (br. s , 2H), 7.38 - 7.49 (m, 1H), 7 .11 (d, J = 8.6 Hz, 1H), 7.01 (t, J = 7.4 NCL034 Hz, 1H), 3.86 (s 3H) δ O NCL035 1H NMR (400 MHz DMSO) 12.32 (br. s , 2H), 8.69 (br. s , 2H), 8.49 (br. s , 2H), 8.1 8 (d, J = 7.8 Hz, 4H), 7.86 (d, J = 8.2 Hz, 4H) NCL036 1H NMR (400 MHz DMSO) δ 12.51 (br. s , 1H), 8.80 (br. s , 2H), 8.72 (br. s , 1H), 8.59 (d, J = 7.8 Hz, 2H), 7.78 - 7.91 (m, 4H), 7.71 (t, J = 8.0 Hz, 2H) 1H NMR (400 MHz DMSO) δ 12.28 (br. s , 2H), 8.70 (br. s , 2H), 8.50 (br. s , 2H), 8.38 (s, 2H), 8.22 (d, J = 7.8 Hz, 2H), 7.85 (d, J = 7.8 Hz, 2H), 7.74 (t, J = 7.8 Hz, NCL037 2H) NCL038 1H NMR (400 MHz DMSO) δ 11.92 (br. s , 2H), 8.41 (br. s , 2H), 8.36 (br. s , 2H), 7.83 (d, J = 8.2 Hz, 4H), 7.31 (d, J = 7.8 Hz, 4H), 2.37 (s, 6H) 1H NMR (400 MHz DMSO) δ 11.99 (br. s , 2H), 8.73 (br. s , 2H), 8.41 (br. s , 2H), 8.1 9 (d, J = 7.8 Hz, 2H), 7.37 (t, J = 8.0 Hz, 2H), 7.30 (t, J = 7.8 Hz, 4H), 2.46 (s, NCL039 6H) 1H NMR (400 MHz DMSO) δ 11.97 (br. s , 2H), 8.44 (br. s , 2H), 8.37 (br. s , 2H), 7.76 (s, 2H), 7.71 (d, J = 7.8 Hz, 2H), 7.38 (t, J = 7.8 Hz, 2H), 7.31 (d, J = 7.8 Hz, NCL040 2H), 2.38 (s, 6H) NCL041 1H NMR (400 MHz DMSO) δ 11.94 (s, 1H), 8.25 (s, 1H), 8.1 1 (d, J = 7.8 Hz, 2H), 7.71 - 7.91 (m, 4H) NCL042 1H NMR (400 MHz DMSO) δ 12.04 (s, 1H), 8.46 - 8.56 (m, 2H), 7.70 - 7.93 (m, 5H), 7.66 (t, J = 7.8 Hz, 1H) NCL043 1H NMR (400 MHz DMSO) δ 11.88 (s, 1H), 8.33 (s, 1H), 8.26 (s, 1H), 8.1 4 (d, J = 7.8 Hz, 1H), 7.80 (d, J = 7.8 Hz, 1H), 7.69 (t, J = 7.8 Hz, 1H) NCL044 1H NMR (400 MHz DMSO) 11.71 (br. s , 1H), 8.1 3 (s, 1H), 7.76 (d, J = 8.2 Hz, 2H), 7.27 (d, J = 7.8 Hz, 2H), 2.35 (s, 3H) NCL045 1H NMR (400 MHz DMSO) δ 11.69 (br. s , 1H), 8.45 (s, 1H), 8.06 (d, J = 7.4 Hz, 1H), 7.67 (br. s , 2H), 7.30 - 7.39 (m, 1H), 7.20 - 7.29 (m, 2H), 2.42 (s, 3H) NCL046 1H NMR (400 MHz DMSO) δ 11.64 (br. s , 1H), 8.1 2 (s, 1H), 7.53 - 7.77 (m, 4H), 7.34 (t, J = 7.8 Hz, 1H), 7.27 (d, J = 7.8 Hz, 1H), 2.35 (s, 3H) NCL047 1H NMR (400 MHz DMSO) δ 10.47 (s, 1H), 8.23 (s, 1H), 8.1 6 - 8.21 (m, 1H), 7.42 - 7.50 (m, 1H), 7.30 - 7.40 (m, 2H), 6.57 (br. s , 2H) NCL048 1H NMR (400 MHz DMSO) δ 10.40 (s, 1H), 8.08 - 8.1 5 (m, 1H), 8.05 (s, 1H), 7.34 - 7.44 (m, 1H), 7.1 7 - 7.28 (m, 2H), 6.54 (br. s , 2H) NCL049 1H NMR (400 MHz DMSO) δ 10.51 (s, 1H), 7.93 (d, J = 8.2 Hz, 1H), 7.86 (s, 1H), 7.83 (d, J = 8.2 Hz, 1H), 6.63 (br. s , 2H) «fis o ~ o S * « ø o S O _ . ~ ~ i ...i _ — . ~ „ ! _ -j _ . J ™ 0 y ϋ ¾ a 0 0 0 ¾ X : X X 2 : X X X X - RECTIFIED SHEET (Rule 9 1) !SA AU 10 00 00 r r r r 00 00 00 00 00 00 00 00 00 00 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 z z z z z z z z z z z z z z z z z z z z z z RECTIFIED SHEET Rule 9 1 (ISA/AU) RECTfFIED SHEET R fe 9 1} iS.A/AU 1H NMR (400 MHz, DMSO) δ 8.68 (s, 2H), 8.43 (s, 2H), 8.28 - 8.1 6 (m, 2H), 7.77 - 7.64 (m, 2H), 7.58 - 7.46 (m, 2H). NCL 123 13C NMR ( 1 0 1 MHz, DMSO) δ 153.0, 150.8 (dd, J = 250.6, 13.0 Hz), 149.9 (dd, J = 245.9, 13.2 Hz), 146.6, 13 1 .2 (dd, J = 6.4, 3 .4 Hz), 126.0 (dd, J = 6.4, 2.8 Hz), 117.8 (d, J = 17.7 Hz), 115.7 (d, J = 18.5 Hz). 1H NMR (400 MHz, DMSO) δ 10.84 (br s , 2H), 9.29 (s, 2H), 8.80 (d, J = 8.6 Hz, 2H), 8.43 (s, 2H), 7.94 (d, J = 9.0 Hz, 2H), 7 .87 (d, J = 7.9 Hz, 2H), 7.64 - 7.56 (m, NCL 124 2H), 7.43 - 7.38 (m, 2H), 7.34 (d, J = 8.9 Hz, 2H). NCL 125 1H NMR (400 MHz, DMSO) δ 9.21 (br s , 2H), 8.42 - 8.1 7 (m, 4H), 7.43 (d, J = 1.9 Hz, 2H), 7.25 (dd, J = 8.4, 1.9 Hz, 2H), 6.99 (d, J = 8.4 Hz, 2H), 3.83 (s, 6H). NCL 126 1H NMR (400 MHz, DMSO) δ 12.27 (br s , 2H), 8.58 (s, 2H), 8.42 (s, 2H) , 7.96 (d, J = 8.3 Hz, 4H), 7.58 (d, J = 8.2 Hz, 4H), 4.39 (s, 2H). NCL 127 1H NMR (400 MHz, DMSO) δ 12.84 (br s , 2H), 8.84 (s, 2H), 8.74 (s, 2H), 8.46 (d, J = 8.6 Hz, 2H), 7.71 (d, J = 1.6 Hz, 2H), 7.54 (dd, J = 8.6, 1.2 Hz, 2H). NCL 128 1H NMR (400 MHz, DMSO) δ 8.64 (s, 2H), 8.36 (s, 2H). NCL 129 1H NMR (400 MHz, DMSO) δ 8.84 (s, 2H), 8.69 (s, 2H), 8.41 (dd, J = 7.8, 1.7 Hz, 2H), 7.70 (dd, J = 8.0, 1.0 Hz, 2H), 7.48 (t, J = 7.3 Hz, 2H)*, 7.44 - 7.37 (m, 2H)*. NCL 130 1H NMR (400 MHz, DMSO) δ 8.66 (s, 2H), 8.37 (s, 2H), 7.79 (d, J = 1.6 Hz, 2H), 7.68 - 7.62 (m, 2H), 3.92 (s, 6H), 3.78 (s, 6H). NCL 13 1 1H NMR (400 MHz, DMSO) δ 12.45 (br s , 2H), 8.68 (s, 2H), 8.41 (s, 2H), 8.29 (s, 2H), 7.87 (d, J = 7.8 Hz, 2H), 7.70 - 7.63 (m, 2H), 7.44 (t, J = 7.9 Hz, 2H). NCL 132 1H NMR (400 MHz, DMSO) δ 12.69 (br s , 2H), 8.61 (s, 4H), 7.34 (dd, J = 9.0, 2.8 Hz, 2H), 7.22 (td, J = 8.6, 2.9 Hz, 2H), 7.03 (dd, J = 8.8, 4.6 Hz, 2H), 5.29 (s, 4H). NCL 133 1H NMR (400 MHz, DMSO) δ 12.51 (br s , 2H), 8.49 - 8.28 (m, 4H), 8.1 6 (s, 2H), 7.35 (s, 2H). NCL 134 1H NMR (400 MHz, DMSO) δ 12.42 (br s , 2H), 8.60 (s, 2H), 8.42 (s, 2H), 7.91 (d, J = 8.5 Hz, 4H), 7.69 (d, J = 8.5 Hz, 4H). NCL 135 1H NMR (400 MHz, DMSO) δ 12.24 (br s , 2H), 8.66 (s, 2H), 8.49 (br s , 2H), 7.79 (s, 2H), 7.24 (s, 2H), 3.88 (s, 6H), 3.85 (s, 6H). 1H NMR (400 MHz, DMSO) δ 12.21 (br s , 2H), 8.44 (s, 2H), 8.39 (s, 2H), 7.83 (d, J = 8.2 Hz, 4H), 7.30 (d, J = 8.2 Hz, 4H), 2 .63 (t, J = 7.7 Hz, 4H), 1.61 - 1.52 (m, NCL 136 4H), 1.36 - 1.26 (m, 4H), 0.90 (t, J = 7.3 Hz, 6H). NCL 137 1H NMR (400 MHz, DMSO) δ 12.94 (br s , 2H), 8.68 (s, 2H), 8.33 (s, 2H), 7.60 (d, J = 7.9 Hz, 4H)*, 7.49 (dd, J = 8.7, 7.4 Hz, 2H)*. NCL 138 1H NMR (400 MHz, DMSO) δ 12.1 2 (br s , 2H), 8.21 (s, 2H), 7.97 (s, 2H), 7.54 - 7.47 (m, 6H), 7.42 - 7.36 (m, 6H), 7.31 - 7.21 (m, 8H), 6.84 (d, J = 9.8 Hz, 2H). NCL 139 1H NMR (400 MHz, DMSO) δ 12.65 (br s , 2H), 9.63 (d, J = 1.8 Hz, 2H), 8.88 - 8.58 (m, 6H), 8.1 3 - 8.01 (m, 4H), 7.88 - 7.79 (m, 2H), 7.68 (t, J = 7.4 Hz, 2H). NCL 140 1H NMR (400 MHz, DMSO) δ 12 .17 (br s , 2H), 8.46 (s, 2H), 8.37 (s, 2H), 7.86 (d, J = 8.2 Hz, 4H), 7.34 (d, J = 8.2 Hz, 4H), 2.53 (s, 6H). NCL 14 1 1H NMR (400 MHz, DMSO) δ 8.66 (s, 2H), 8.60 (d, J = 1.9 Hz, 2H), 8.52 (br s , 2H), 8.49 (s, 2H), 8.09 (d, J = 8.6 Hz, 2H), 7.50 (dd, J = 8.6, 2.0 Hz, 2H). NCL 142 1H NMR (400 MHz, DMSO) δ 8.80 (s, 2H), 7.41 - 7.20 (m, 12H), 5.56 (s, 2H), 3.79 (d, J = 3.4 Hz, 4H). NCL 143 1H NMR (400 MHz, DMSO) δ 11.91 (br s , 2H), 8.66 (br s , 2H), 8 .10 - 8.00 (m, 4H), 7.51 - 7.41 (m, 6H), 2.45 (s, 6H). NCL 144 1H NMR (400 MHz, DMSO) δ 12.36 (br s , 2H), 8.38 - 8.23 (m, 4H), 7 .16 (d, J = 3.5 Hz, 2H), 6.82 (d, J = 3.5 Hz, 2H). NCL 145 1H NMR (400 MHz, DMSO) δ 12.41 (br s , 2H), 8.41 - 8.21 (m, 4H), 7.20 (d, J = 3.5 Hz, 2H), 6.73 (d, J = 3.5 Hz, 2H) . 1H NMR (400 MHz, DMSO) δ 11.97 (br s , 2H), 11.45 (s, 2H), 8.47 (s, 2H), 8.30 (s, 2H), 8.02 (s, 2H), 7.80 (dd, J = 8.6, 0.9 Hz, 2H), 7.48 (d, J = 8.5 Hz, 2H), 7.45 - NCL 146 7.40 (m, 2H), 6.53 (s, 2H). 13C NMR ( 1 0 1 MHz, DMSO) δ 152.4, 150.6, 137.4, 127.6, 126.7, 124.5, 12 1 .8, 120.3, 111.9, 102.0. NCL 147 1H NMR (400 MHz, DMSO) δ 13.09 (br s , 2H), 9.97 (s, 2H), 9.01 (s, 2H), 8.73 (s, 2H), 8.1 9 - 8.09 (m, 4H), 7.95 - 7.84 (m, 4H). 0» s 3 o » o to x w t Js- s ø « 5 S ~ s X z . RECTSF!ED SHEET SA A ! =* _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l _ l z z z z z z z z z z z z z z z z z z z z RECTIFIED SHEET Rule 9 1 (ISA/AU) c s 3 5 M a¾ o o s o ... CM CM i -J _ _ l .„( - ϋ ϋ C5 0 X X RECTIFIED SHEET (Rute 91) ISA/AU 1H NMR (400 MHz, DMSO) δ 12.43 (br s , 2H), 8.66 (br s , 2H), 8.62 (br s , 2H), 8.38 (t, J = 8.3 Hz, 2H), 7.61 (dd, J = 10.5, 1.9 Hz, 2H), 7.45 (dd, J = 8.6, 1.6 Hz, 2H). NCL21 6 13C NMR ( 1 0 1 MHz, DMSO) δ 160.7 (d, J = 254.5 Hz), 152.8*, 140.8*, 136.3 (d, J = 10.8 Hz), 128.5, 125.3, 120.2 (d, J = 10.0 Hz), 116.7 (d, J = 24.7 Hz). *Broad signals 1H NMR (400 MHz, DMSO) δ 11.66 (s, 2H), 8.61 (s, 2H), 7.94 (d, J = 8.2 Hz, 4H), 7.25 (d, J = 8.1 Hz, 4H), 2.41 (s, 6H), 2.35 (s, 6H). NCL21 7 13C NMR ( 1 0 1 MHz, DMSO) δ 154.0, 153.3, 139.7, 133.9, 129.0, 127.0, 2 1 .0, 14.9. 1H NMR (400 MHz, DMSO) δ 10.73 (s, 2H), 8.05 (s, 2H), 7.70 (d, J = 8.58 Hz, 4H), 7.31 - 7.27 (m, 4H), 6.24 (s, 1H), 5.92 (s, 2H), 4 .17 (dq, J = 7.06, 8.70 Hz, 8H), NCL21 8 1.28 (td, J = 1.01 , 7.05 Hz, 12H). 1H NMR (400 MHz, DMSO) δ 11.74 (s, 2H), 8.60 (s, 2H), 7.95 (d, J = 8.6 Hz, 4H), 7.45 (d, J = 8.6 Hz, 4H), 2.42 (s, 6H), 1.31 (s, 18H). NCL21 9 13C NMR ( 1 0 1 MHz, DMSO) δ 154.1 , 153.3, 152.6, 134.0, 126.8, 125.0, 34.5, 3 1.0, 14.9. NCL220 1H NMR (400 MHz, DMSO) δ 10.61 (s, 2H), 8.03 (s, 2H), 7.70 (dd, J = 8.7, 5.6 Hz, 4H), 7.29 (t*, J = 8.9 Hz, 4H), 6.27 (s, 1H) , 5.82 (s, 2H). NCL221 1H NMR (600 MHz, DMSO) δ 10.89 (s, 2H), 8.1 1 (s, 2H), 7.86 (d, J = 8.2 Hz, 4H), 7.81 (d, J = 8.4 Hz, 4H), 6.34 (s, 1H), 5.94 (s, 2H). NCL222 1H NMR (400 MHz, DMSO) δ 10.76 (s, 2H), 7.99 (s, 2H), 7.70 (td, J = 1.7, 9.2 Hz, 2H), 7.54 - 7.41 (m, 4H), 6.30 (s, 1H), 5.87 (s, 2H). NCL223 1H NMR (400 MHz, DMSO) δ 10.48 (s, 2H), 10.07 (s, 2H), 7.98 (s, 2H), 7.65 (d, J = 8.7 Hz, 4H), 7.58 (d, J = 8.7 Hz, 4H), 6.24 (s, 1H), 5.76 (s, 2H), 2.07 (s, 6H). 1H NMR (400 MHz, DMSO) δ 8.36 (s, 1H), 7.96 - 7.90 (m, 2H), 7.86 (s, 1H), 7.79 - 7.73 (m, 2H), 7.54 - 7.47 (m, 6H), 4.26 (q, J = 7 .1 Hz, 2H), 1.27 (t, J = 7 .1 Hz, NCL224 3H). 1H NMR (400 MHz, DMSO) δ 8.35 (s, 1H), 7.98 - 7.91 (m, 2H), 7.87 (s, 1H), 7.79 - 7.74 (m, 2H), 7.51 (dd, J = 2.8, 8.5 Hz, 6H), 3.99 (d, J = 6.5 Hz, 2H), 1.95 NCL225 (hept, J = 6.7 Hz, 1H), 0.93 (d, J = 6.7 Hz, 6H). O 1H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 9 .18 (t, J = 5.6 Hz, 1H), 8.38 (d, J = 10 .1 Hz, 2H), 8.32 (s, 1H), 7.99 - 7.92 (m, 2H), 7.83 (d, J = 8.5 Hz, 2H), 7.57 - NCL226 7.46 (m, 5H), 3.30 - 3.20 (m, 2H), 1.14 (t, J = 7.2 Hz, 3H). 1H NMR (400 MHz, DMSO) δ 11.00 (s, 1H), 9.68 (s, 1H), 8.52 (s, 1H), 8.41 (s, 1H), 8.32 (s, 1H), 8.01 - 7.80 (m, 4H), 7.56 - 7.46 (m, 4H), 7.36 (d, J = 6.00 Hz, NCL227 4H), 7.30 - 7.21 (m, 1H), 4.56 - 4.33 (m, 2H). 1H NMR (400 MHz, DMSO) δ 10.95 (s, 1H), 9.22 (t, J = 5.6 Hz, 1H), 8.40 (s, 1H), 8.34 (s, 1H), 8.32 (s, 1H), 7.98 - 7.90 (m, 2H), 7.87 - 7.80 (m, 2H), 7.55 - 7.48 NCL228 (m, 4H), 3.22 (q, J = 6.6 Hz, 2H), 1.56 - 1.46 (m, 2H), 1.39 - 1.25 (m, 6H), 0.88 (t, J = 6.6 Hz, 3H). 1H NMR (400 MHz, DMSO) δ 10.98 (s, 1H), 9.60 (s, 1H), 8.54 (s, 1H), 8.40 (s, 1H), 8.30 (s, 1H), 8.01 - 7.89 (m, 2H), 7.85 (d, J = 8.4 Hz, 2H), 7.64 - 7.59 (m, 1H), NCL229 7.54 - 7.47 (m, 4H), 6.42 (dd, J = 1.8, 3.3 Hz, 1H), 6.31 (m, 1H), 4.44 (d, J = 5.5 Hz, 2H). NCL230 1H NMR (400 MHz, DMSO) δ 10.41 (s, 2H), 7.98 (s, 2H), 7.59 (d, J = 8.9 Hz, 4H), 7.02 (d, J = 8.9 Hz, 4H), 6.23 (s, 1H), 5.73 (s, 2H), 3.80 (s, 6H). EXAMPLE 12; Treatment of a bacterial infection in vivo by the administration of CL8 or NCLG99. [00388] The objective of this study was to determine the efficacy of an investigational Veterinary Product containing NC 8 or MC . n t e treatment of a skin infection in mice [00387] Summary of the Model: A useful a i al model system should be clinically relevant, experimentally robust, ethically acceptable, convenient to perform and should provide reliable and reproducible results. There are many ani a models of topical ski infection that have been described including the croton oii nf amed sk n model (Akiyama, H , H. m Y Abe, Tads and J. Arata (1994). "Staphylococcus aureus infection on experimental croton ©if- inflamed skin mice." Journal of Dermatologjcal Science 8(1): 1-10), the burnt skin model S i t , D. .. A . Bonds, D, Dermott and E. B. Michaels (1982). A burned mouse odel o evaluate anti-pseudomonas activity of topical agents." Journal of Antimicrobial Chemotherapy 9(2): 133-140), the skin suture-wound model ( icRip ey . . J. and . R. Whitney (1 6). "Characterization and Quantitation of Experimental Surgical-Wound Infections Used to Evaluate Topical Antibacterial Agents. * Antimicrobial Agents and Chemotherapy 10(1): 38-44), the skin tape-stripping model ( ugelb r E., T. Norstrdm, T. . Petersen, T. Duvoid, D. . Anderss and D. Hughes (2005). "Establishment of a Superficial Skin infection d in Mice by Using Staphylococcus aureus and Streptococcus pyogenes," Antimicrobial Agents and Chemotherapy 48(8): 3435-3441) and the linear full thickness scalpel cut method (Quo, Y., R. I. Ramos, J. 8 . Cho, . P. Donegan, A. L. Cheung and L S. Milter (2013). "in Vivo B iu ine cence Imaging To Evaluate Systemic and Topical Antibiotics against Community-Acquired eth! ii-n-Resistant Staphylococcus aure s ln ected Skin Wounds in i ." Antimicrobial Agents and Chemotherapy 57(2): 855-863) [003881 Preliminary studies prior to the conduct of the current study established a new method of skin infection arising from a detailed study of the models mentioned above. Briefly, study m ce are anaesthetised, a patch of dorsal skin is clipped to reveal the skin and a circular area of skin is removed with a hand held punch, leaving a wound on the dorsum wit a central cavity. The wound is infected with known number of the challenge organism. Approximately four to six hours after infection, the wound is either treated topically with a vehicle formulation or an active formulation. The infected skin wound is retreated every hours fo a lota of 14 treatments. Mice are humanely ©uthanased, the area of the original infected wound is dissected and removed and its bacterial content quantified by standard microbiologic tests. In this way, the change in bacterial concentration due o treatment with th© active formulation can be readily determined by examining the reduction in bacterial burden compared with the vehicle control. RECTIFIED SHEET (Rule 9 1) ISA AU Materials and Methods Preparation of Infection Inoculum [00389] Fresh cultures of bacteria (Staphylococcus aureus) were grown on Sheep Blood Agar at 37 °C for 16 - 18 hours. A few typical colonies were selected and suspended in 10 ml of Tryptic Soy Broth and incubated overnight in a shaking incubator (240 rpm) at 37 °C. The overnight suspension was vortexed and diluted ( 1 :100) in fresh Tryptic soy broth (100 µ Ι [0.1 ml] in 9.9 ml broth). The fresh suspension was incubated for 3 hours in a shaking incubator (as above) in order to obtain mid-logarithmic phase bacteria. Bacteria were pelleted through centrifugation at 7,500 rpm for 10 mins. Broth supernatant was removed and bacteria suspended in 10 ml Phosphate Buffered Saline (PBS). These steps were repeated a further two times. The density of the suspension was checked by measuring absorbance at 600 nm, using a spectrophotometer with saline as a blank, to confirm the target density at a reading of approximately 0.100, consistent with a bacterial density of 2.5 x 107 CFU/ml. The suspension was placed into a rack placed into a lockable transport box with an ice brick to maintain refrigeration during transport, followed by storage in cool room upon arrival at the mouse skin infection laboratory. Final suspension was mixed thoroughly before inoculating the skin wounds created in mice. [00390] In order to ensure the purity and accuracy of the suspension, the following steps were performed prior to placement into lock box. [00391] Purity of bacterial suspension ensured by spreading 100 µ Ι of the final suspension onto a SBA (sheep blood agar) plate which was incubated at 37 °C for 18 hours and examined to confirm uniform growth of one colony type. Viable counts were performed on final suspension by prepping saline in Eppendorf tubes (approximately 900 µ Ι per tube), removing 100 µ Ι sample and adding to first Eppendorf tube, vortexing the mixture and repeating using 2 nd Eppendorf tube containing saline. This process was continued for 5 - 6 tubes. Finally, 100 µ Ι of 5th and 6th dilutions were plated out on plate count agar, incubated at 37 °C for 18 hours and colony counts performed to confirm that the CFU/ml was approximately 2.5 x 107. Following inoculation of the wounds, this process was repeated to ensure that no contamination or decrease in viable counts had occurred during the time of the surgery. Skin Wound Surgical Procedure [00392] Each mouse was placed into induction chamber and anaesthesia induced using 2% isoflurane. Eyes of each anaesthetised mouse were covered with veterinary eye lubricant in order to prevent corneal dehydration. Each mouse removed from induction chamber and placed onto surgical area, in front of individual aesthetic nose cone. While under anaesthesia each RECTIFIED SHEET Rule 9 1 (ISA/AU) mouse was monitored for assessment of depth of anaesthesia (response to pain, ii k reflex, skeletal muscle tone) and respiratory and cardiac function. Back skin hai was shaved from surgical area with mechanical clippers. Shaved area was cleaned usi g 70% ethano! applied to paper owel followed by 10% w/v povidone -iodine solution. Once the iodine solution was dry, a subcutaneous Injection of the nonsteroidal ant f amrnatro agent mefoxieam was administered. Dorsal skin was pinched gently to allow creation of a circular fu i thi c ness wound using ear punch/biopsy punch Vehicle control and CL8 2 and NCL0 mice had wounds inoculated with 1 pi of bacterial suspension using a r pip tt (2.5 x CFU/ pi). Once the bacterial suspension was dry, mice were placed i to individual recovery boxes labelled with the mouse number. The time of inoculation was recorded. Initial body weights of each mouse were recorded on the appropriate score sheet. Mice recovered to full consciousness w thin 5 minutes. Recovered mice were returned to individual housing and monitored hourly for post¬ surgical or anaesthetic complications. P t-S rgic Cam 4 hours post-surgery) [00393] Mice were assessed for post-surgical complications and observations recorded on clinic record sheet. Each mouse was carefully removed from VC and placed into an assessment container, avoiding excessive handling or touching of the surgical site. Once the mouse was inside assessment container, it wa assessed and the observations recorded on the post-surgical clinical record sheet. Whenever the suggested wellness breakpoints were reached, post-operative analgesia was administered and recorded on the clinical record sheet Animal Monitoring d Daily Cam |00394] Antibiotic Administration 7 m and 8pm). The first administration of vehicle or CL or CLG99 ointment occurred 4 hours post-surgically. Each ointment container was weighted prior to administration and the weight recorded. Each mouse was carefully restrained. Ointment (vehicle or CL8 2 or C 099 was applied to the lesion a ea and the treated mouse was returned to VC where each mouse was observed to ensure ointment was not immediately removed by grooming. The weight of the ointment container post-administration was recorded. The vehiele and active NG products were applied to the skin wou d each 12 hours following the first administration for a total of 1 consecutive treatments Both the CL81 and C 99 products (Formulation , as presented in Example 9) contained their respective active ingredients at a concentration of 20 mg/g.. Approximately 0.1- 2 g of ointment wa applied on each occasion, delivering a total topical dose of NCL8 or NCLQ99 between 2 and 6 r g to mice weighing between 18 g and 25 g. RECTIFIED SHEET (Rule 9 1) S /AU [00395] Daily Monitoring. Monitoring of each mouse took place once daily at around 12pm. Each mouse carefully removed from IVC and placed into observation container, avoiding excessive handling or touching surgical site. The coat, posture, eyes, behaviour, vocalisation and activity whilst in the container were carefully assessed and observations recorded on assessment sheet. Mouse faeces (either on floor of cage or in container) were checked for consistency and observations recorded. The weight of each mouse was determined whilst it was in the container and change in body weight calculated and recorded. The observation container was disinfected with ethanol and set aside to dry while a fresh container was used for the next mouse. For every second day, mice were again anaesthetised using 2% isoflurane and photographed using a ruler for size referencing. These photos were used to assess lesion size and infection progression during the trial period. Tissue analysis and assessment of antibacterial efficacy [00396] At the end of the 7 day skin wound assessment period, all test mice were euthanased prior to wound collection for post mortem examination. The skin wound was dissected from the dorsum of each mouse. The sample was placed in a sample tube and weighed before 1 ml PBS and sterile tissue homogenisation beads were added. Tissue samples were homogenised for 10 mins using a tissue homogeniser (Next Advance Bullet Blender) and then vortexed for approximately 30 seconds. 100 µ Ι of supernatant was removed and placed into an Eppendorf tube containing 900 µ Ι of PBS. This procedure was repeated using serial dilutions for a total of 8 dilutions. Finally, 100 µ Ι of each dilution was pipetted onto a plate count agar in duplicate and incubated overnight at 37 °C. Ten microlitres of original suspension was placed onto sheep blood agar to assess culture purity and incubated overnight at 37 °C. The following day, viable counts were performed using incubated plate count agar plates and the identity of Staphylococcus aureus (the challenge organisms) as the harvested strain was confirmed. Results [00397] The mean colony count per g of tissue observed in vehicle treated group was 5,888,436 (6.77 log 0) . The mean colony count per g of tissue observed in NCL812 group was 141 ,254 (5.15 log 0) . The mean colony count per g of tissue observed in NCL099 treated mice was 1,318 (3.12log 0) . The log 0 colony forming units per gram of tissue and % reduction are summarised in the following table. RECTIFIED SHEET Rule 9 1 (ISA/AU) J &b 47: colony forming units per gram of tissue and percentage reduction following topical administration of vehicle and treatment. e Lo w CF g) ] r ct Vehicle C 8 5.15 8 .6 C G [ 3 8 is clear this table that treatment with either C or CL leads to high level reductions n the number of infecting Staphylococcus a . These results demonstrate effective ent o a bacterial colonisation or infection in vivo by administration of compounds of t invention RECTIFIED SHEET Rule 91) !SA/AU A compound of Formula !, or a stereoisomer, a to er, pharmaceutically acceptabte salt, or prodrug thereof; rein i is H, loai y! Formula i, or Formula Hi; ¥ xi l&II Fs n fi a 5 · R is H , H NH , 0-CH -CH , N ( -phen l, H-c orophe y , -CH -chiorophenyi, H~ =CH cy o l yS, Formula , Formula V or Formula I in Is N, C CH, or is C a d A is bonded o ¾ , f¾, oie ring; wherein is , C, , or Formula VII; RECTIFIED SHEET (Rule 8 1) ISA/AU 014/176636 -| QQ PCT7AU2014/000483 Formula VII A2 is N, C, NH, N-C(0)-phenyl or Formula VII; Α wherein A3, A4, A5, A6, A7, A8, A A 2 , A 3 , A 4 , A 5 , A 6 , A 7 , A 8 , Θ, A2 , A2 A23, A24, A25, A26 and A27 are independently C, O, N, NH, S ; wherein A9 is C, O, N, NH, N-C(0)-0-CH 2-CH3, N-C(0)-0-CH(CH 3)2, N-C(0)-NH- CH2-CH3, N-C(0)-NH-CH 2-phenyl, N-C(0)-CH 2-CH2-CH2-CH2-CH2-CH3, N-C(O)- CH2-furan-2-yl; wherein A 0 is C, NH, -N=CH-CH=, -N=CH-C(C 6H5)-; wherein A22 is -CH(CH 3)-, -N-CH-, -N-C(CH 3)-, N-C(CH 2OH)-; R2 is H, COOH, CH2NH2, CH2OH, CH2NHNH 2, methyl, ethyl, propyl, butyl, cyclopentyl, or Formula VII and R2 are R4 are bonded together to form a pyrimidine, pyrazine or triazine ring, or R2 and R9 are bonded together to form a pyrrolidinyl oxindole ring; wherein R4 is N, NH, O, S, or R4 and A0 are bonded, via R2, to form a triazole ring, or R4 is N and R4 and R2 are bonded together to form a pyrimidine ring; wherein R7 is H, CI, Br, F, OH, CH3, OCH 3, SCH3, CN, CCH, CF3, OCF 3, SCF 3, N0 2, butyl, f-butyl, dimethylamino, phenyl, n-propyl, /-propyl, -NH-C(0)-CH 3, - CH=CH-COOH, piperazin-1-yl, or R7 and R8 are bonded together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring; wherein R6, R8, R 4 , R 6 , R25 and R27 are independently H, OH, CI, F, Br, CH3, CN, OCH 3, COOH, N0 2, CF3, R8 and R7 bond together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring, or benzene ring, R 4 and R 5 are bonded together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring, R8 and R9 are bonded together to form a substituted or RECTIFIED SHEET Rule 9 1 (ISA/AU) unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring, o ¾ and are bonded together to form a substituted or unsubstituted saturated o unsaturated aliphatic ring, heterocyclic ring or benze e ring; wherein , ¾ ; . and R are independently. H, O, CI, F, Br, NH , Η Η Ο Η Η CHi , CH , CN, 0 . phenyl, · - }·€ . H C{0 }- H or and R are bonded together to form substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring o benzene ring, or R and R - are bonded together to form a substituted or unsubstituted saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring; wherein R Q, R , R R i R and R are independently H, CI, or Br, or and i are bonded together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring, or R and R are bonded together to form a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring, or and R are bonded together to form substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring; wherein and are independently H, COOH, CH H¾ C OH, methyl, ethy , propyl, butyl, cyclopentyl, or R - a d R $ are bonded together to form a pyrr ! din i oxindole ring; wherein R and R 2 are independently H, C , Br, , OH, CH , OCH , SCH ,. CN, CF CF , SCF , N0 , CCH, n bu . b tyi, dimethylamino, phenyl, r?-propyl, /- propyl, H C( VCH , CH H C O p perazin y or R and Rw are bonded together to fo m a substituted or unsubstituted, saturated or unsaturated aliphatic ring, heterocyclic ring or benzene ring; and wherein "—~ is a double bond or a single bond. 2. A compound of Formula , or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof, selected from the compounds presented in Figure . 3 . A compound of Formula I, or a stereoisomer, tautomer, pharmaceutically acceptable salt, or prodrug thereof wherein C ; wherein A is ; or Formula VII; RECTIFIED SHEET Rule 9 1} ISA/AU wherein A2 is N; or NH; wherein A , are N; or C ; A3 A4, A6, A7, A 2 , A14 , A 5 , wherein and are C ; A5, A 3 , 23 A24, A25, A26 A27 wherein A8 and A2 are S ; wherein A9 is NH; wherein is N; A10 is )- wherein A22 -N-CH-; -N-C(CH 3 ; or -N-C(CH 2OH)-; wherein is H; Formula II; Formula III; cycloalkyl ; wherein R2 is H; methyl ; ethyl ; CH2NHN H2; CH2O H; butyl ; cyclopentyl ; or Formula V II and R2 is bonded to R4, to form a pyrimidine ring ; wherein R3 is NH2; Formula IV; Formula V ; Formula V I; NH2, NH-N=CH- cycloalkyl ; or O-CH 2-CH 3; wherein R4 is NH; O ; S ; or R4 is N and R4 and R2 are bonded together to form a pyrimidine ring ; wherein R7 is H; F; C I; CF3; methyl ; R7 and R8 are bonded together to form an unsubstituted, benzene ring ; O H; f-butyl ; phenyl ; dimethylamino ; /-propyl ; n - propyl ; CN; CCH ; n-butyl ; SCH 3; R7 and R8 are bonded together to form an unsubstituted, unsaturated heterocyclic ring ; OCH 3; Br; OCF 3; piperazin -1-yl ; or SCF 3; wherein and R are independently H; O H; F; OCH ; CF ; methyl ; CI; R6, R8, R 4 , 6 3 3 CN; Br; R8 and R7 are bonded together to form an unsubstituted, benzene ring ; R8 and R7 are bonded together to form an unsubstituted, unsaturated heterocyclic ring ; and R are bonded together to form an unsubstituted, benzene ring ; or R 4 5 R 4 and R 5 are bonded together to form an unsubstituted, unsaturated heterocyclic ring ; wherein and R are independently H; O H; NH ; C I; F; OCH ; O H; - R5, R9, R 3 , 7 2 3 NH-CH(OH)-CH 3; wherein is H; methyl ; ethyl ; CH OH; or cyclopentyl ; R 2 2 RECTIFIED SHEET Rule 9 1 (ISA/AU) 8 wherein R is H; F; Ci; CF ; methyl; R S and R are bonded together to form an su sti ted, benzene ring; OH; bu y ; phenyl; dimeihySamino; /-propyl; n- propyi; C ; CCH; -b t ; SCH ; R and e bonded together to form an unsubsf uted, unsaturated heterocyclic ring; CH3; Br; CF ; piperazin-l-yi; o SCF ; wherein R F are independently H; OH; or Ci; wherein and R are independently H; or OH; wherein R is H; CH3; Br; C ; OH; dimethyiamino; ~0 -P{0 Et ; CF ; or F; and is independently single or a double bond. A compound ac rding to a y one of the pr ceding cia r s, where i the compound is selected from the group comprising: CL S; L 09; CL 23 ; NCL025; NCLG26; NCL029; G36; NCLQ37; NCLG39; NCLG4G; NCL 50; CLG6 1 NC 0 4; CL065; NCLQ88; CL 75; NCLG76; NCL078; NCL079; C 8G; NCL081 NCL084; L 8S; CL0S NGL088; CL 8 ; CL 9G; CL082; CL S4; C 95 NCL097; CL 98; NCL0 9 NCL101; NCL104; NCL 05 NC 08 GL 8; NCL111 NCL 2; NCL1 4 ; NC ; CL ; NCL : NCL 19; NCL121; CL1 2; NCL123 NC .124; NCL125; NCL126; NCL130 NCL131; L1 2; NC 3; L 5; L NCL137; CL ; CL 8; L14 0; NCL141; NCL144; NCL145; NCL146; CL 7 NCL148; NCL150; L152 NCL153; NCL154; NCL 8; NCL 7: CL 8 ; NCL159 ; NCL 1; NCL182; CL 4; NCL165; N ; C 1 7; NCL188; N L 9 C 7 , NCL171; NCL 72 NCL173; NCL174; NCL178; NCL177; NCL 8; CL 9; NC 0; CL 1; NGL183; GL 4; NCL 5; NCL188; NCL187; NCL 8; GL 9; NCL ; NCL 3 CL 4 NCL19S; NCL1 8 NCL197; CL S; CL1 9; CL200; NCL201 ; NCL202; NCL203; CL2 4; NGL2Q5; GL2G ; NCL207; NCL208; C 20 ; G 210; NCL2 ; NCL212; CL2 ; CL2 ; CL2 ; CL2 17; CL2 ; GL2 ; CL22 ; NCL221; C 222; and NCL223. The compound according to a y one of the pre d ng claims, wher ein the compound is selected from the group ompnsing: NCL04Q; NCL078; NC 07 ; GL 8 ; NCLQ81; L 84; NCLG88; NCL089; I CL0 7 NCL039: CL 3; NCL1 8; NCL157; CL 8; NCL177; L 9; L 8; CL 3; NCL 5; CL 8; CL 7; CL1 ; C 2G2; CL2 4; GL2 5; CL2 N L21 ; CL2 ; NCL219; and NCL221 . The compound according to any one of the preceding claims, wherein the compound is selected from the group comprising: NCL078; NCL07 LG8 ; NC . NCLQ84; RECTIFIED SHEET (Rule 91) iSA/AU NCL089; NCL097; NCL1 57; NCL158; NCL179; NCL1 88; NCL1 93; NCL1 95; NCL1 96; NCL1 99; NCL204; NCL216; NCL217; NCL21 9 ; and NCL221 . 7 . The compound according to any one of the preceding claims, wherein the compound is selected from the group comprising: NCL089; NCL097; NCL1 57; NCL1 79; NCL1 88; NCL1 93; NCL1 95; NCL1 96; NCL216; NCL21 9 ; and NCL221 . 8 . The compound according to any one of the preceding claims, wherein the compound is selected from the group comprising: NCL097; NCL1 57; NCL179; NCL1 88; NCL195; and NCL1 96. 9 . The compound according to any one of the preceding claims, wherein the compound is a chloride salt. 10. The compound according to any one of the preceding claims, wherein the compound is not a compound selected from the group comprising: NCL812, NCL001 , NCL002, NCL003, NCL004, NCL005, NCL006, NCL007, NCL010, NCL01 1, NCL012, NCL013, NCL014, NCL015, NCL01 6, NCL01 7, NCL018, NCL01 9, NCL020, NCL021 , NCL022, NCL024, NCL027, NCL028, NCL030, NCL031 , NCL032, NCL033, NCL034, NCL035, NCL038, NCL041 , NCL042, NCL043, NCL044, NCL045, NCL046, NCL047, NCL048, NCL049, NCL051 , NCL052, NCL053, NCL054, NCL055, NCL056, NCL057, NCL058, NCL059, NCL060, NCL062, NCL063, NCL066, NCL067, NCL069, NCL070, NCL071 , NCL072, NCL073, NCL074, NCL077, NCL082, NCL083, NCL087, NCL091 , NCL093, NCL096, NCL100, NCL1 02, NCL103, NCL107, NCL1 09, NCL1 10, NCL1 13, NCL1 17, NCL1 20, NCL127, NCL1 28, NCL129, NCL134, NCL142, NCL143, NCL149, NCL151 , NCL1 55, NCL1 60, NCL163, NCL1 75, NCL182, NCL191 , NCL192, and NCL214. 11. A method of treating or preventing a bacterial colonisation or infection in a subject, the method including the step of administering a therapeutically effective amount of a compound of any one of claims 1 to 10, or a therapeutically acceptable salt thereof, to the subject, wherein the bacterial infection is caused by a bacterial agent. 12. The method according to claim 11, wherein the subject is an animal most preferably selected from the group comprising: human, canine, feline, bovine, ovine, caprine, porcine, avian, piscine and equine species. 13. The method according to either claim 11 or claim 12, wherein the compound is administered to the subject in a dose in the range of 0.1 mg/kg to 250 mg/kg bodyweight. 14. The method according to any one of claims 11 to 13, wherein the bacterial agent is gram positive. RECTIFIED SHEET Rule 9 1 (ISA/AU) 15. The method according to claim 14, wherein the bacterial agent s selected from the group c p s g : Abiotraphia defective, Achoiapiasma spp., Act bacu um suis, Actinomyces bo is Actinomyces europaeus, Actinomyces georgiae, Actinomyces gererics&riaa, Actinomyces graavenitzii, Actinomyces hordeovuineris, Actinomyces israelii sere-type I, Actinomyces israelii, Actinomyces y i, A ctinomyces a slundi Actinomyces neuii Actinomyces odontoiyticus, Actinomyces radingae, Actinomyces spp, Actinomyces turicensis, Actinomyces viscosus, Alioscardovia omnicoiens, Anaerococcus hydrogenalis, Anaerococcus iaciolyticus, Anaerococcus murdochii, Arsa&rococcus octavius, AnaarocQccus prevotii, Anaerococcus tetradius, Anaerococcus vaginalis, Arcanobactarium (Actinomyces) bernardiae, Arcanobactarium (Actinomyces} pyogenes, Arcanobactarium bernardiae, Arcanobactarium oarditf&nsis, Ar anob &ri u n funkei, Ar anobacie iu haamoiyticum, Arcanobactarium houstonensis, Arcanobaoterium linguae, Arcanobacterium pyogenes (Actinomyces pyogenes}, Arihrobaciar, Aiopobium rninutum, Aiopobium parvulum, Atopobium ri aa, Atopobium spp, Atopobium vaginae. Bacillus antbracis. Bacillus cereus, Bacillus circuians, Baciiius tichanifomm, Bacillus megaterium, Baciiius meianinog&nicua, Baciiius pumilus, Bacillus sp aeri c s, Bacillus subiilis, beta haemoiytic Stepiococcus spp, Bifidobacteria adolesceniis, Bifidobacteria dentium, Bifidobacteria scardovii, Bifidobacteria, Brevibaciitus brevis, Br vib&ci us taterosporus, Brevlbacterium, Butteidia extructa, Catabacter hongkongensis, CDC corynaform groups F-1 and Q, Closiridiium tetani, Clostridium baraiii, Clostridium bifermantans, Clostridium botulinum (types A, B, C, D, E, F, G), Clostridium botulinum, Clostridium butyrloum, Clostridium c auvoe Clostridium coiinum, Clostridium difficile, Clostridium haemotyticum, Clostridium hlstoiyiicum, Clostridium novyi type A, Clostidium novyi type B, Clostridium novyi Clostridium perfnngens type , Clostridium perfringens types A-E, Clostridium perfringens, Clostridium piliforma, Clostridium ramosu , Clostridium septicum, Clostridium sordeili. Clostridium sphenoid&s, Clostridium spiroforma, Clostridium spp, Clostridium tertium, Clostridium tetani, CQliinseiia aorofaciens, Corynebactarium a o ens Corynebacterium afarmenians afar ent s Corynebacieriun} afermenians iipophiium, Corynebacterium amycolatum, Corynebacterium arg&ntomtensa, Corynebactarium aurimucosum, Corynebacterium auris, Corynebactarium bovis, Corynebacterium c fus m Corynabaciarium cystidis, Corynebacierium diphiharia, Corynebacierium frsneyi, Corynebaci&rimn glucumnoiyticum.. Coryn&bactanum jeikeium, Corynebacierium kroppenstediii, Corynebacterium kuischori, Corynebacierium lipophilofiavum, Corynebact&rium ma g iey , Corynebacterium matruchoiii, oryneba &riu minuiissimum, Corynebacterium pilosum, Corynebacierium propinquum, Corynebactarium pse dodlp t riticum, Corynebacterium pseudotuberculosis, Corynabactarium renal®, Corynebact&rium riegelti, Corynebactarium s mu ans, Corynebactarium striatum, RECTIFIED SHEET (Rule 91) ISA AU Corynebacterium sundvallense, Corynebacterium thomssensii, Corynebacterium tuberculostearum, Corynebacterium ulcerans, Corynebacterium urealyticum, Corynebacterium xerosis, Crossiella equi, Dermabacter, Dermatophilus congolense, Dermatophilus congolensis, Eggerthella brachy, Eggerthella hongkongensis, Eggerthella infirmum, Eggerthella lenta, Eggerthella minutum, Eggerthella nodatum, Eggerthella saphenum, Eggerthella sinensis, Eggerthella sulci, Eggerthella tenue, Eggerthella, Enterococcus avium, Enterococcus bovis, Enterococcus casseliflavus/flavescens, Enterococcus cecorum, Enterococcus dispar, Enterococcus durans, Enterococcus faecalis, Enterococcus faecium, Enterococcus gallinarum, Enterococcus gilvus, Enterococcus hirae, Enterococcus italicus, Enterococcus malodoratus, Enterococcus mundtii, Enterococcus pallens, Enterococcus pseudoavium, Enterococcus raffinosus, Enterococcus sanguinicola, Enterococcus spp, Erysipelothrix rhusiopathiae, Eubacterium, Filifactor alocis, Finegoldia magna, Gallicola barnesae, Gemella asaccharolytica, Gemella bergeri, Gemella cuniculi, Gemella haemolysans, Gemella morbillorum, Gemella palaticanis, Gemella sanguinis, Gordonia spp., Granulicatella adiacens, Granulicatella elegans, Granulicatella para-adiacens, Kytococcus schroeteri, Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus iners, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus species, Lactobacillus ultunensis, Leifsonia aquatic, Leuconostoc citreum, Leuconostoc lactis, Leuconostoc mesenteroides, Leuconostoc paramesenteroides, Leuconostoc pseudomesenteroides, Listeria grayi, Listeria innocua, Listeria ivanovii, Listeria monocytogenes, Listeria seeligeri, Listeria welshimeri, Microbacterium,M obiluncus curtisii, Mobiluncus mulieris, Mobiluncus spp, Mogibacterium timidum, Mogibacterium vescum, Moryella indoligenes, Mycobacterium senegalense, Mycobacterium abscessus, Mycobacterium africanum, Mycobacterium arupense, Mycobacterium asiaticum, Mycobacterium aubagnense, Mycobacterium avium complex, Mycobacterium avium subsp paratuberculosis, Mycobacterium avium, Mycobacterium bolletii,Mycobacterium bovis, Mycobacterium branderi, Mycobacterium canettii, Mycobacterium caprae, Mycobacterium celatum, Mycobacterium chelonae, Mycobacterium chimaera, Mycobacterium colombiense, Mycobacterium conceptionense, Mycobacterium conspicuum, Mycobacterium elephantis, Mycobacterium farcinogenes, Mycobacterium florentinum, Mycobacterium fortuitum group, Mycobacterium genavense, Mycobacterium goodii, Mycobacterium haemophilum, Mycobacterium heckeshornense, Mycobacterium heidelbergense, Mycobacterium houstonense, Mycobacterium immunogenum, Mycobacterium interjectum, Mycobacterium intracellular, Mycobacterium kansasii, Mycobacterium lacus, Mycobacterium lentiflavum, Mycobacterium leprae, Mycobacterium lepraemurium, Mycobacterium mageritense, Mycobacterium malmoense, Mycobacterium marinum, Mycobacterium massiliense, RECTIFIED SHEET Rule 9 1 (ISA/AU) Mycobacterium microti, Mycobacterium moniefiorense (eels), Mycobacterium morac s& Mycobacterium mucogenicum, Mycobacterium nebrask&nse, Mycobacterium ne a r , Mycobacterium no o astrans Mycobacterium paiusire, Mycobacterium paratub&rcuiosis (Johne's Disease), Mycobacterium pa i ns , Mycobacterium phiei, Mycobacterium p aicu , Mycobacterium pinnip&dii, Mycobacterium porcinum, Mycobacterium pseudoshottsii (fish), Mycobacterium pseudotuberculosis, Mycobacterium sask che a nse Mycobacterium screfuiaceum, Mycobacterium s&nuense, Mycobacterium septicum, Mycobacterium slmiae, Mycobacterium smegmaiss, Mycobacterium spp. Mycobacterium z gai, Mycobacterium t&rrae/chmmogenicum complex, Mycobacterium triplex, Mycobacterium tuberculosis, Mycobacterium iusciae, Mycobacterium lc r s, Mycobacterium wolinskyi, Mycobacterium xenopi, Mycobacterium, Nocardia astemidas, Nocardia brasiliensis. Nocardia farc c , Nocardia n , Nocardia otiiidiscav ar m, Nocardia spp, Nocardia transvaiensis, Oarskovia, Oisenaiia oral spp, Qiseneila profuse, Olsenelia i, Qribacterium sinus, Paaniba us alvoi, Parvimonas micra, Pediococcus, P&ptococcus Indoiicus. P pi occ s niger. Peptoniphiius a a haretyt cus Peptoniphiius gorbachii, Peptoniphiius ham, Peptoniphiius indoiicus, Peptoniphiius ivoni, Peptoniphiius lacrimals, Peptoniphiius oisanii, Peptosireptococcus anaerobius, P&ptostrepiococcus stomatis, Propionibacterium acnes,. Propionibacterium gr u osum Propianibacierium prop o i u , Propiombacteriurn, Pseudoramibactar aiactoiyticus, Rhode-coccus q , Rhodocoecus erythropoiis, Rhodococsus fasciens, Rhodocoecus rh d hrou , Rothia, Ruminococcus productus, Siaekia igua, Siaekia haiiotrinireducens, S iobac eti m moor&L Staphylococcus ariettas, Staphylococcus aureus subsp. anae bi s, Staphylococcus aureus, Staphylococcus auricuiaris, Staphylococcus capitis subsp. capitis. Staphylococcus capitis subsp. ureaiyticus, Staphylococcus capitis. Staphylococcus caprae, Staphylococcus carnosus, Staphylococcus caseolyticus, Staphylococcus c ro og n s, Staphylococcus cohnii subsp. cohnii, Staphylococcus cohnii subsp. ureaiyticus, Staphylococcus cohnii, Staphylococcus condimanii, Staphylococcus deiphini, Staphylococcus epidBrmidis, Staphylococcus qu ru . Staphylococcus fells, Staphylococcus fiaur&ttii, Staphylococcus galiinarum, Staphylococcus ba olytic s. Staphylococcus bominis. Staphylococcus yic s, Staphylococcus intermedins, Staphylococcus kioomi, Staphylococcus &n , Staphylococcus iugdunensis, Staphylococcus iutrae, Staphylococcus uscae. Staphylococcus nepaiensis, Staphylococcus pasteuri, Staphylococcus pettenkoferi, Staphylococcus piscifetmantans, Staphylococcus psaudintemadius, Staphylococcus puivareri, Staphylococcus sac ar lyiic Staphylococcus sapropbyticus, Staphylococcus schieifeh subsp. g ians, Staphylococcus sct i i Staphylococcus s&iuri, Staphylococcus s a , Staphylococcus si isns Staphylococcus spp, RECTIFIED SHEET (Rule 91} !SA/AU Staphylococcus succinus, Staphylococcus vitulinus, Staphylococcus warneri, Staphylococcus xylosus, Staphylococcus vitulinus, Stomatococcus mucilaginosus (reclassified as Rothia mucilaginosa), Streptococcus agalactiae, Streptococcus anginosus species group (Streptococcus intermedius, Streptococcus constellatus, and Streptococcus anginosus), Streptococcus bovis species group (S. gallolyticus subsp. gallolyticus (formerly S. bovis biotype I), Streptococcus bovis, Streptococcus canis, Streptococcus dysgalactiae subsp. dysgalactiae, S. equi subsp. equi, S. equi subsp. zooepidemicus, S. porcinus, S. canis, S. suis, S. iniae), Streptococcus dysgalactiae subsp. equisimilis, Streptococcus dysgalactiae, Streptococcus equi (Streptococcus equi subsp equi), Streptococcus equi subsp. zooepidemicus, Streptococcus equi, Streptococcus equinus, Streptococcus equisimilis (Streptococcus dysgalactiae subsp equisimilis), Streptococcus gallolyticus subsp. pasteurianus (formerly S. bovis biotype 11/2), Streptococcus infantarius subsp Infantarius, Streptococcus lutetiensis (formerly S. bovis biotype 11/1), Streptococcus mitis species group (S. cristatus , S. infantis, S. mitis, S. oralis, S. peroris, S. orisratti), and Streptococcus mutans species group (S. cricetus, S. downei, S. ferus, S. hyovaginalis, S. macaccae, S. mutans, S. ratti, S. sobrinus, Sanguinis Group, S. gordonii, S. parasanguinis, S. sanguinis), Streptococcus pneumoniae, Streptococcus porcinus, Streptococcus pyogenes, Streptococcus salivarius species group (S. alactolyticus, S. hyointestinalis, S. infantarius, S. salivarius, S. thermophilus, S. vestibularis), Streptococcus spp, Streptococcus suis, Streptococcus uberis, Streptococcus zooepidemicus (Streptococcus equi subsp zooepidemicus), Streptococcus zooepidemicus, Trueperella abortisuis, Trueperella bernardiae, Trueperella bialowiezensis, Trueperella bonasi, Trueperella pyogenes (Arcanobacterium pyogenes), Tsukamurella spp., Turicella, and Turicibacter sanguine. 16. The method according to claim 15, wherein the bacterial agent is selected from the group comprising: Staphylococcus aureus, Staphylococcus pseudintermedius, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, Enterococcus faecium, Enterococcus faecalis, and Clostridium difficile. 17. The method according to any one of claims 11 to 13, wherein the bacterial agent is gram negative. 18. The method according to claim 17, wherein the bacterial agent is selected from the group comprising: Acetobacteraceae:- Roseomonas cervicalis; Roseomonas fauriae; Roseomonas gilardii. - Aeromonadaceae:- Aeromonas allosaccharophila; Aeromonas aquariorum; Aeromonas caviae; Aeromonas hydrophila (and subspecies); Aeromonas salmonicida; Aeromonas shubertii; Aeromonas veronii biovar sobria (Aeromonas sobria). - Alcaligenaceae:- Achromobacter xylosoxidans; Alcaligenes faecalis; Bordetella RECTIFIED SHEET Rule 9 1 (ISA/AU) ansorpii; Bordetella i ; Bordetella bronchiseptica; Bordetella hinzii; Bordetella holmesii; Bordetella parapertussis; Bordetella pertussis; Bordetella petit; Bordeieiia tramatum; Oiigeiia ureolytica; Oiigeiia urethrals. - Anapiasmataceae:- Anapiasma phagocytophilurn; Anapiasma piatys; Anapiasma bovis; Anapiasma cen al ; Anapiasma marginal®; Anapiasma odocoilei; Anapiasma ovis; Ehrlichia canis; Ehrlichia chaffeensis; Ehdichia awingii; Ehrlichia muris; Ehrlichia ovina; Ehrlichm ruminantium; Neo&hriichia iotoris; N rf hia mikurensis; Neorickeitsia helminthoeca; Neorickattsia risiicii; Neorickeitsia senneisu; W bachia pipientis. - Armatimonadaceaa:- Armatimonas rosea; Bact&roktaceae:- Bacferoides forsythus; Bacteroides fragiiis; Bacteroides malaninogenicus; Bacteroides ruber; Bacteroides urea!tyicus, — Bartoneiiaceae:- Bartoneila ai a ca; Bartonella austraiis; Bartonella baciiiiformis; Bartonella birtlesii; Bartonella bovis; Bartonella capreoii; Bartonella chomeiii; Bartonella ciarndge ; Bartonella eshiae; Bartonella eilzabethae; Bartonella gmhamii; Bartonella henselae; Bartonella koehierae; Bartonella peromysci; Bartonella phoceensis; Bartonella quintana; Bartonella rattimessiiiensis; Bartonella rochaiimae; Bartonella sehoenbuch&nsis; Bartonella talpae; Bartonella tarniae; Bartonella iaylorii; Bartonella tnbocorum; Bartonella vinso subsp . berkhoffii; Bartonella vinsonii subsp, arupensls; Bartonella vinsonii subs vinsonii. ~ Bdeihvibdonaceae:- Bdeliovibno spp Brachyspiraceae:- Brachyspira spp including Brachyspira hampsonii, Brachyspira hyodysent&riae, Brachyspira murdochii, Brachyspira pilQSi o ~~ Bruceilaceae:- Brucella abortus; Brucella canis; Brucella ceti; Brucella meliiensis; Brucella ovis; Brucella pirmipediaiis; Brucella suis; Ochrobactrum anihropi; Ochrobactrum intermedium. - Burkholderiaceae:- Burkhoideria aborts; Burkholdena ambifaria (genomovar VII); Burkhoideria anthina (genomovar V /j ; Burkfioldaria ce oc pac a (genomovar lit); Burkhoideria cepacia (genomovar }; Burkhoideria diffusa; Burkhoideria dolose (genomovar VI); Burkhoideria latens; Burkholdena mallei; Burkholdena metailica; Burkhoideria ultiv rans (genomovar I ; Burkhoideria pseudo al ; Burkhoideria pyr c a (genomovar IX); Burkho &na sernmalis; Burkholdena stabilis (genomovar V ; Burkhoideria b n&ns s (genomovar X ; Burkhoid&da vietnamlensis (genomovar V); Cupriavidus paucuius; Cupnmidus giiardii; Ralstonia pickettii; Raistonia mannitoliiytica; Spha&ro u hlppai; Sphaerotilus montanus; phaerp ii s natans. — Campyiobacteraceae:- Arcobactar spp including Arcobacier skirmwii; Campylobacter coii; Campylobacter n is s; Campylobacter rv s Campylobacter fetus; Campylobacter gracilis: Campylobacter h vatic s; Campyiobacter hominis; Campyiobacter hyointesisnalss; Campyiobacter ins f& n g & Campylobacter jejuni; Campyiobacter anien e; Campylobacter la ; Campyiobacter l&sibis; Campylobacter u osalis; Campylobacter rectus; Campylobacter showae; Campylobacter spulonim; Campylobacter upsaliensis. ~~ Candidaius;- Pisoichtamydia sai o is. — Cardiobacten&ceae:- Cardiobaciarium hominis; Cardiobaclanum valvarum; RECTIFED SHEET (Rule 91) SSA/AU Dichelobacter nodosus. - Chlamydiaceae:- Chlamydia spp including Chlamydia avium, Chlamydia gallinacea, Chlamydia muridarum, Chlamydia suis, Chlamydia trachomatis; Chlamydophila spp including Chlamydophila pneumoniae, Chlamydophila pecorum, Chlamydophila psittaci, Chlamydophila abortus, Chlamydophila caviae, and Chlamydophila felis. - Chthonomonadaceae:- Chthonomonas calidirosea. - Comamonadaceae:- Comamonas testosteroni; Verminephrobacter spp. - Coxiellaceae:- Coxiella burnetii. - Cytophagaceae:- Cytophaga columnaris; Cytophaga hutchinsonii; Flexibacter echinicida; Flexibacter elegans; Flexibacter flexilis; Flexibacter litoralis; Flexibacter polymorphus; Flexibacter roseolus; Flexibacter ruber. Desulfovibrionaceae:- Bilophila wadsworthia; Lawsonia intracellularis. Enterobacteriaceae:- Cedecea davisae; Cedecea lapagei; Cedecea neteri; amalonaticus; Citrobacter diversus; Citrobacter freundii; Citrobacter koseri; Cronobacter condimenti; Cronobacter dublinensis; Cronobacter helveticus; Cronobacter malonaticus; Cronobacter muytjensii; Cronobacter pulveris; Cronobacter sakazakii; Cronobacter turicensis; Cronobacter universalis; Cronobacter zurichensis; Edwardsiella ictaluri; Edwardsiella tarda; Enterobacter aerogenes; Enterobacter agglomerans; Enterobacter cloacae; Enterobacter cowanii; Escherichia albertii; Escherichia coli, including AIEC = adherent invasive E. coli, EaggEC = enteroaggregative E. coli; EHEC = enterohemorrhagic E. coli; EIEC = enteroinvasive E. coli; EPEC = enteropathogenic E. coli; ETEC = enterotoxigenic E. coli; ExPEC = extraintestinal pathogenic E. coli, NMEC = neonatal meningitis E. coli, NTEC = necrotoxigenic E. coli, UPEC = uropathogenic E. coli.; Escherichia fergusonii; Ewingella americana; Hafnia alvei; Hafnia paralvei; Klebsiella granulomatis; Klebsiella oxytoca; Klebsiella pneumoniae; Kluyvera ascorbata; Kluyvera cryocrescens; Morganella morganii; Pantoea (formerly Enterobacter) agglomerans; Photorhabdus asymbiotica; Plesiomonas shigelloides; Proteus mirabilis; Proteus penneri; Proteus vulgaris; Providencia alcalifaciens; Providencia rettgeri; Providencia stuartii; Raoultella electrica; Raoultella ornithinolytica; Raoultella planticola; Raoultella terrigena; Salmonella bongori, Salmonella enterica subspecies enterica (many serotypes); Serratia liquifaciens; Serratia marcesans; Shigella boydii; Shigella dysenteriae; Shigella flexneri; Shigella sonnei; Yersinia enterocolitica; Yersinia pestis; Yersinia pseudotuberculosis; Yersinia ruckeri. - Fimbriimonadaceae:- Fimbriimonas ginsengisoli. - Flavobacteriaceae:- Bergeyella zoohelcum; Capnocytophaga canimorsus; Capnocytophaga cynodegmi; Capnocytophaga gingivalis; Capnocytophaga granulosa; Capnocytophaga haemolytica; Capnocytophaga leadbetteri; Capnocytophaga ochracea; Capnocytophaga sputigena; Chryseobacterium indologenes; Chryseobacterium piscicola; Elizabethkingia meningoseptica; Flavobacterium branchiophilum; Flavobacterium columnare; Flavobacterium oncorhynchi; Flavobacterium piscicida; Flavobacterium psychrophilum; Myroides odoratus; Myroides RECTIFIED SHEET Rule 9 1 (ISA/AU) odorati i us; O nit obacteriu rbinolracheale; Riemerella anatipestlfer; Riemerella coiumbina; Riemereila ipharyngis; Tena ibac i dicenirarchs; Tenacibacuium discolour; Tenacibacuium gailaicum; Tenacibacuium &riiirn ; T cibacul m s i a ; Weeksalla vir sa - Francisetlaceae:- Frandsalia t ia ns s subsp. ia nsis; Franciseiia tularensls subsp. nolar iic ; F n ise a tularensls subsp. novicida; Franciseiia pMomiragia; Franciseiia noaiunensls; Franciseiia noaiunensls subsp, oriental!® (also termed Franols&lia asiaiica). ~~ Fusobac ena : Fusobacterium spp. including Fusobacterium necrophofum, Fusobacterium n l at m, Fuso-bacierium potymorphum. -~ Helicobactaraceae:- Helicobacter cinaedi; Helicobacter fennaillaa; Helicobacter pylori. - Legioneilaceae:- Legionella pneumophila and other including; Legionella a isa; Legionella bir ingha sis; Legionella b zem ni ; i inc nati&n is; Legionella urno i; Legionella feeleii; Legionella gormanii; Legionella aoke i e; Legionella jordanis; Legionella !ansingensis; Legionella longbeachae; Legionella maceachemii; Legionella mi dadel Legionella oakridgensis; Legionella p sie is; Legionella salni ele ; Legionella tusconensis; Legionella adsw rt i; Legionella waltersli — Leptosplraceae:- Leptospira alexanden (including Leptospira aiaxanden serovar Hebdomadis, Leptospira atexanderl serovar Manhao 3); Leptospira alstoni (including Leptospira aisioni serovar Pingchang, Leptospira alstoni serovar Sichuan); Leptospira bifiexa (including Leptospira bifiexa serovar Ancona, Leptospira bifiexa serovar aneia ; Leptospira borgp&tersenii (including Leptospira borgpetersenii serovar Hardjo, Leptospira borgpetersenil serovar Hardj bovis, Leptospira borgpeiersenii serovar Pomona, Leptospira borgpetersenii serovar Tamssovi); Leptospira broomii (In ding Leptospira broomii serovar Hursibndge); Leptospira fainel (including Leptospira fainei serovar Hurstbridge); Leptospira o ; Leptospira inadai (including Leptospira inadai serovar Lyme, Leptospira inadai serovar Malaya); Leptospira Interrogans (Including Leptospira interrogans serovar Australis, Leptospira interrogans serovar Aui mn lis Leptospira interrogans s&mvar Bratislava, Leptospira interrogans serovar Canicoia, Leptospira interrogans serovar Grippo p os Leptospira interrogans serovar Hardjo, Leptospira interrogans serovar H rdj e bov s, Leptospira interrogans serovar lcterohaamorrbagiae, Leptospira Interrogans serovar Po ona Leptospira interrogans serovar Pyrogenas, Leptospira interrogans serovar Tarassovi); Leptospira kirschnen (Including Leptospira kirschrseri seiovar Bulganca, Leptospira klrscbnen serovar Cynopierl, Leptospira kirschneii serovar Grippotyp ; Leptospira etyi; Leptospira ioeras e; Leptospira e en (including Leptospira eyer s&rovar Sofia); Leptospira noguchii (including Leptospira noguchii se var P n& a, Leptospira noguchii serovar Pomona); Leptospira santamsei; Leptospira t&rpsi ; Leptospira vanthielli: Leptospira weilii (including Leptospira weilii serovar Celiedoni, Leptospira weilii serovar Sa n); Leptospira wolbaohll; Leptospira w f i ; Leptospira RECTIFIED SHEETS (Rule 9 1) ISA/AU yanagawae. - Leptotrichiaceae:- Leptotrichia buccalis; Streptobacillus moniliformis. - Methylobacteriaceae:- Methylobacterium extorquens group; Methylobacterium fujisawaense; Methylobacterium mesophilicum; Methylobacterium zatmanii. Moraxellaceae:- Acinetobacter baumannii (genomic species 2); Acinetobacter baylyi; Acinetobacter bouvetii; Acinetobacter calcoaceticus (genomic species 1); Acinetobacter gerneri; Acinetobacter grimontii; Acinetobacter haemolyticus (genomic species 4); Acinetobacter johnsonii (genomic species 7); Acinetobacter junii (genomic species 5); Acinetobacter Iwoffi (genomic species 8/9); Acinetobacter parvus; Acinetobacter radioresistens (genomic species 12); Acinetobacter schindleri; Acinetobacter tandoii; Acinetobacter tjernbergiae; Acinetobacter towneri; Acinetobacter ursingii; Acinetobacter venetianus; Moraxella atlantae; Moraxella boevrei; Moraxella bovis; Moraxella bovoculi; Moraxella canis; Moraxella caprae; Moraxella catarrhalis; Moraxella caviae; Moraxella cuniculi; Moraxella equi; Moraxella lacunata; Moraxella lincolnii; Moraxella macacae; Moraxella nonliquefaciens; Moraxella oblonga; Moraxella osloensis; Moraxella ovis; Moraxella phenylpyruvica; Moraxella pluranimalium; Moraxella porci. - Moritellaceae:- Moritella abyssi; Moritella dasanensis; Moritella japonica; Moritella marina; Moritella p ro funda; Moritella viscosa; Moritella yayanosii. - Neisseriaceae:- Chromobacterium violaceum; Eikenella corrodens; Kingella denitrifleans, Kingella kingae, Kingella oralis, Kingella potus; Neisseria cinerea; Neisseria elongata; Neisseria flavescens; Neisseria gonorrhoeae; Neisseria lactamica; Neisseria meningitidis; Neisseria mucosa; Neisseria polysaccharea; Neisseria sicca; Neisseria subflava; Neisseria weaver; Vitreoscilla spp. - Nitrosomonadaceae:- Nitrosomonas eutropha; Nitrosomonas halophila; Nitrosomonas oligotropha. - Pasteurellaceae:- Actinobacillus actinomycetemcomitans; Actinobacillus equuli; Actinobacillus lignieresii; Actinobacillus pleuropneumoniae; Actinobacillus seminis; Actinobacillus succinogenes; Actinobacillus ureae; Aggregatibacter actinomycetemcomitans, Aggregatibacter segnis, Aggregatibacter aphrophilus; Avibacterium avium; Avibacterium endocarditidis; Avibacterium gallinarum; Avibacterium paragallinarum; Avibacterium volantium; Bibersteinia trehalose; Gallibacterium anatis; Gallibacterium genomospecies 1; Gallibacterium genomospecies 2; Gallibacterium genomospecies 3; Gallibacterium group V; Gallibacterium melopsittaci; Gallibacterium salpingitidis; Gallibacterium trehalosifermentans; Haemophilus aegyptius; Haemophilus avium; Haemophilus ducreyi; Haemophilus haemolyticus; Haemophilus influenzae; Haemophilus parahaemolyticus; Haemophilus parainfluenzae; Haemophilus parasuis; Histophilus somni; Mannheim ia caviae; Mannheimia glucosida; Mannheim ia granulomatis; Mannheimia haemolytica; Mannheimia ruminalis; Mannheimia varigena; Nicoletella semolina; Pasteurella aerogenes; Pasteurella bettyae; Pasteurella caballi; Pasteurella canis; Pasteurella dagmatis; Pasteurella multocida (subspecies multocida, septicum, gallicida); Pasteurella pneumotropica; Pasteurella stomatis; Pasteurella RECTIFIED SHEET Rule 9 1 (ISA/AU) trehalosi. - Pis i ck ttsi8 aa:- Piscirickettsia s i nis. - Pi si nada :- Plesiomonas shigeiiosdes. - Poiyangiaceae:- Sorangiurn ceiiuiosum. P rp yr n ia ®a& ~ Dysgonomonas capnocytophagoides; Dysgonomonas gadei; Dysgonomonas hofstadii; Dysgonomonas nossii; Dysgonomonas otyzarvi; Dysgonomonas wimpennyi; Porphyromonas gingivals, Prevoiollaceae:- Prevoteiia spp.inciuding Prevoi&iia intermedia, Prevoteiia meianinogenica. Pseudomonadaoeae:- Chryseomonas iuteoia; Pseudomonas aeruginosa; Pseudomonas luteola; Pseudomonas fluorescens; Pseudomonas putida; Pseudomonas zeri; Pseudomonas ry abitan . ~~ Rhizobi e: Agrobacierium tum&faci&ns; Rh obiu radiobacter. - Rick siacea : Orientia chuto; Orientia tsutsugarnushi; Rickettsia aescbiimannii; Rickettsia africae; Rickettsia akari; Rickettsia argasii; Rickettsia asiatica; Rickettsia austr&lis; Rickettsia b ii; Rickettsia canadensis; Rickettsia conorii; Rickettsia cooleyi; Rickettsia fails; Rickettsia heilongjiangehsis; Rickettsia helvetica; Rickettsia h r i; Rickettsia hoogstraaiii; Rickettsia hulinansis; Rickettsia Sn ii; Rickettsia japonica; Rickettsia marmionii; Rickettsia martinet; Rickettsia as iliae; Rickettsia monacansis; Rickettsia montanensis; Rickettsia monteiroi; Rickettsia moraii; Rickettsia parked; Rickettsia p ac ck i; Rickettsia phiiipii; Rickettsia prowazekii; Rickettsia ra tii; Rickettsia rhipicephali; Rickettsia ncketisii; Rickettsia sibirica subgroup; Rickettsia siovaca; Rickettsia tan rae; Rickettsia typhi. - Sh&wanel!aceae:- Sbewaneila putrefaciens. - Sp ingo onada a Sp ingoba ted mutiivorum; Sphingobaciedum spsntivorum; Sphirigornonas paucimobHis. - Spiriiiao&ae:- Spirillum minus; Spirillum vo!utans; Spirillum winograd$kyL - Spirocha&taceae:- Sorrels afzeiii; Borreiia anserine; Borreiia bisseWi; Borreiia burgdorferi; Borreiia o aceae; Borreiia duttonii; Borreiia garinii; Borreiia berrnsii; Borreiia hfspanica; Bormiia japonica; Borreiia tonestad; Borreiia iusitaniaa; Borreiia miyamotoi; Borreiia parked; Borreiia persica; Borreiia recurrentis; Borreiia spielmanii; Borreiia t ri ata ; Bormiia iuricatae; Borreiia iaisian ; Treponema carateum; Treponema paiiid ssp. endemioum; Treponema pallidum p . pallidum; Treponema paiiidum ssp pe tenu . - Sucdnivibrionaceae:- Ana robi spirii u spp. Suttereilaceao:- Sutterel!a sp including Sutterefia wadsworibia. — Ther a ae:- eio errnus spp. — Tliermotogaceae:- T er ot ga neapolitana. V& i!one i eae:· i li ter spp; ega onas spp; egasp a spp; Pecti t s spp; Peiosinus $pp; Pmpionispora spp; Spon usa spp; Veiiionetia spp.; Zy op il spp. - Vibrionaceee:- Photobacterium damseiaa; Vibrio adapiatus; Vibno aiginoiytieus; Vibrio azasii; Vibrio campbeitii; Vibrio cholera; Vibrio damsel; Vibrio fiuvialis; Vibrio f r i ii; Vibno o isae; Vibrio etc ikovii; Vibrio rnimicus; Vibrio parahaemoiyticus; Vibrio vulnificus. - Wolbachie&e:- Woibachia spp. — Xanthornonadac&aa:- Lut&imonas aestuarii; Luteimonas aq ti a; Lut&imonas composii; Luteimonas ti ads; Lut &imo a marina; Luteimonas mephitis; Luteimonas vadosa; Pseudoxanthomonas br egb er sis; RECTIFIED SHEETS (Rule 91) ISA/AU Pseudoxanthomonas japonensis; Stenotrophomonas maltophilia; and Stenotrophomonas nitritireducens. 19. The method of claim 18, wherein the bacterial agent is selected from the group comprising: Acinetobacter species, Aeromonas hydrophila, Citrobacter species, Enterobacter species, Escherichia coli, Klebsiella pneumoniae, Morganella morganii, Pseudomonas aeruginosa, and Stenotrophomonas maltophilia. 20. The method according to any one of the preceding claims, wherein the compound of Formula I, is administered together with a compound that reduces the integrity of the cell wall of the bacterial agent. 2 1. The method according to any one of claims 11 to 13, wherein the bacterial agent has no cell wall. 22. The method according to claim 2 1 , wherein the bacterial agent is selected from the group comprising: Mycoplasma spp, Mycoplasma agalactiae, Mycoplasma alkalescens, Mycoplasma amphoriforme, Mycoplasma arginini, Mycoplasma bovigenitalum, Mycoplasma bovirhinis, Mycoplasma bovis, Mycoplasma bovoculi, Mycoplasma buccale, Mycoplasma californicum, Mycoplasma canadense, Mycoplasma capricolum subsp. capricolum, Mycoplasma capricolum subsp. capripneumoniae, Mycoplasma conjunctivae, Mycoplasma cynos, Mycoplasma dispar, Mycoplasma equigenitalium, Mycoplasma faucium, Mycoplasma felis, Mycoplasma fermentans (incognitus str.), Mycoplasma gallisepticum (MG), Mycoplasma gateae, Mycoplasma genitalium, Mycoplasma haemocanis, Mycoplasma haemofelis, Mycoplasma haemosuis (formerly Eperythrozoon suis), Mycoplasma hominis, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Mycoplasma hyosynoviae, Mycoplasma iowae meleagridis (MM), Mycoplasma iowae, Mycoplasma leachii, Mycoplasma lipophilum, Mycoplasma meleagridis, Mycoplasma mycoides subsp capri, Mycoplasma mycoides subsp mycoides, Mycoplasma mycoides subsp. mycoides (such as Contagious bovine pleuropneumonia CBPP), Mycoplasma orale, Mycoplasma ovipneumoniae, Mycoplasma ovis, Mycoplasma penetrans, Mycoplasma pirum, Mycoplasma pneumoniae, Mycoplasma primatum, Mycoplasma putrefaciens, Mycoplasma salivarium, Mycoplasma spermatophilum, Mycoplasma suis, Mycoplasma synoviae (MS), Mycoplasma wenyonii, Mycoplasma, Ureaplasma spp, Ureaplasma parvum, Ureaplasma urealyticum, Ureaplasma, and Ureoplasma diversum. 23. The method according to any one of claims 11 to 13, wherein the bacterial agent is gram positive, gram negative or does not have a cell wall and is selected from the group RECTIFIED SHEET Rule 9 1 (ISA/AU) comprising, but ot & to, the following livestock pathogens: Actinobaculum suis, Actinomyces bovis, Arcanobaciehum pyogenes, Bacillus a thrac s, cereus, fich nif r is, p nus, &l nin ge i j s, subtiiis, Clostridium botulinum, c auv i, haamoiyticum, novyi, perfringens, septicum, s r llii, tani, colinum, rynaba te riu pseudotuberculosis, rar l , Dermatophsius congolensis, Ent&rococcus spp (such as E. fa cal s, E. fa&dum, E durans, E. avium ., E hiraa), Erysipehthrix rhusiopathiae, Listeria ranovii grays, innocua, seeligeri, we!shi ri, monocytogenes, Mycobacterium avium, bovis, paratuberculosss (Jo ne' Disease), Mycoplasma (such as capdcolum subsp. captipneumoniae, subsp. cap l n, . mycoides subsp mycoides, . agaiaci a , , ovipneumonlae, . conjunctiva®, . arginlni, . bovis, and . putrefaciens) Mycoplasma bovis, dispar, mycoides subsp. mycoides (such as Contagious bovine pleuropneumonia CBPP) Mycoplasma ga s p t cum (MG), iowae meb&gridis (MM), synovia® (MS) Mycoplasma haemosuis (formerly Eperythrozoon suss), atkalescens, b vig italum, bovirhinis, bovocuS, califomicum, car dens , cynos, qu g&n ta i m, gateae, haemocanis, haemofelis, hyopneumoniae, hyorhinis, hyosynoviae, iowae, l&acbii, meieaghdis, mycoides subsp capn, wenyonii, su s, Rhodococcus equi, Staphylococcus epid&rmidis, Staphyiococcus simulans, Staphylococcus i&!is. Staphylococcus xyiosus, Staphylococcus chro ogan s, Staphylococcus wameri, Staphylococcus haemolyticus, Staphylococcus sciun, Staphylococcus saprophyticus, Staphylococcus hominis, Staphyiococcus cap a Staphylococcus cohnii subsp. pohnsi, Staphyiococcus c h subsp ur aiyti us, Staphylococcus capitis subsp. capitis, Staphyiococcus capitis subsp. uroa yii s, Staphylococcus hybus, Staphyiococcus aureus, Staphylococcus paeudmtermedius, Staphylococcus d&iphini, Staphyiococcus sc & f ri subsp, coag ia , Staphyiococcus aureus subsp. ana ro us Streptococcus uteris, Streptococcus canis, Streptococcus agaiaciiaa, Streptococcus dysgalaotiaa, Streptococcus pyogenes, Streptococcus bovis, Streptococcus equi subsp. Zooapidemicus, Streptococcus aqulnus, Streptococcus equi (Streptococcus equi subsp equi), Streptococcus equisirnilis (Streptococcus dysgaiactiaa subsp equis m is , pordnus, s s, zmepidamicus, Streptococcus zooepid&micus (Streptococcus qui subsp zoo&pidemicus), Streptococcus dysgaiactiae subsp. equisirniiis, Propionibact&rium acnes, Pr pio bact rium g nu o um Eubactemm, P&piococcus indoiicus, and P&ptostrepiococcus anae bi s; Actinobacillus, A&mmonas, Anaplasma, Arcobacter, Avihactenum, Bactamides, Bartonella, B rdet& a, Borreiia, Brachyspsra, Brucella, Campylobacter, Capnocytophaga, Chlamydia, Cb!amydophiia, Chryseobacterium, x a, Cytophaga, Dich&iobacter, Edwardsiaiia, Ehrlichia, Escherichia, Fiavobacterium, Francsseila, Fusobactenum, Gaiiibact&rium, Haemophilus, Histophilus, Klebsiella, Lawsonia, Leptospira, Manntieirnia, Megaspbaera, Mora e a, n k& s a, O i boba te u , Past&ureila, Photob&ct&rium, Piscichiamydia, Pisc keiisi , RECTIFIED SHEETS (Rule 91) ISA/AU W O 2014/176636 -| 2 PCT7AU2014/000483 Porphyromonas, Prevotella, Proteus, Pseudomonas, Rickettsia, Riemerella, Salmonella, Streptobacillus, Tenacibaculum, Vibrio, and Yersinia. 24. The method according to any one of claims 11 to 13, wherein the infection or colonisation is caused by a mixture of at least two bacterial agents selected from the group comprising: gram postive bacteria, gram negative bacteria and bacteria with no cell wall. 25. The method according to any one of claims 11 to 24, wherein the bacterial agent is resistant to one or more compounds selected from the group comprising: penicillins, cephalosporins, carbapenems, monobactams and other beta lactam antibiotics, fusidanes, aminoglycosides, fluoroquinolones, streptogramins, tetracyclines, glycylcyclines, chloramphenicol and other phenicols, macrolides and ketolides, lincosamides, oxazolidinones, aminocyclitols, polymyxins, glycopeptides, lipopeptides, bacitracin, mupiricin, pleuromutilins, rifamycins, sulphonamides and trimethoprim. 26. The method according to claim 25, wherein the bacterial agent is resistant to one or more compounds selected from the group comprising: beta lactams, glycopeptides, lipopeptides, macrolides, oxazolidinones and tetracyclines. 27. The method according to claims 25 or 26, wherein the bacterial agent is resistant to the compound when the compound is at a concentration range selected from the following: 0.001 Mg/mL - 10,000 g/m L; 0.01 µg/mL - 1000 g/m L; 0.10 µg/mL - 100 g/m L; and 1 µg/mL - 50 µg/mL. 28. The method according to any one of claims 11 to 27, wherein the bacterial infection or colonisation in the subject substantially causes an indication selected from the group comprising: nosocomial pneumonia caused by Staphylococcus aureus or Streptococcus pneumoniae; complicated skin and skin structure infections caused by Staphylococcus aureus, Streptococcus pyogenes, or Streptococcus agalactiae; invasive pneumococcal diseases including pneumonia, bronchitis, acute sinusitis, otitis media, conjunctivitis, meningitis, bacteremia, sepsis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, cellulitis, and brain abscess caused by Streptococcus pneumonia; uncomplicated skin and skin structure infections caused by Staphylococcus aureus or Streptococcus pyogenes; community-acquired pneumonia caused by Streptococcus pneumoniae, Staphylococcus aureus or Staphylococcus aureus; bloodstream infections (bacteraemia) caused by methicillin-susceptible and methicillin-resistant isolates; vancomycin-resistant Enterococcus infections; Clostridium difficile associated diarrhea (CDAD); and gram negative, gram positive or mixed bacterial bone and joint infections; RECTIFIED SHEET Rule 9 1 (ISA/AU) central nervous system infections; eye infections; gastrointestinal tract infections; genital infections; intra-abdominal infections; respiratory tract infections; otitis externa; otitis media; sepsis; systemic infections; intra-abdominal infections ( A Ss ; urinary tract infections (UT s ; and bacferaemia. 29. The method according to any one of claims to 28, wherein the therapeutically effective amount of compound of Formula I, or a therapeutically acceptable salt thereof, is administered to the subject by oral administration. 30. The method according to any one of claims to 28 wherein the therapeutically effective amount of compound of Formula I, or a therapeutically acceptable salt thereof, s administered to the subject by parenteral administration. 31. The method according to any one of claims 11 to 28, wherein the therapeutically effective amount of compound of Formula , or a therapeutically acceptable salt thereof, is administered to the subject by topical administration. 32. An antibacterial pharmaceutical composition comprising a therapeutically effective amount of compound of Formula , or a therapeutically acceptable salt thereof, and optionally a pharmaceutically acceptable ex ipien or carrier. 33. An antibacterial veterinary composition comprising therapeutically effective amount of a compound of Formula , or a therapeutically acceptable salt thereof, and optionally a veterinary acceptable excipient or carrier. 34. The composition according to either claim 32 or clai 33, wherein the composition comprises a further antimicrobial agent selected from the group comprising: antrbacteriai and antifungal agents. 3 . The composition according to either claim 32 or claim 33, wherein the composition is adapted for oral administration. 36. The composition according to either claim 32 or clai 33, wherein the composition is adapted for parenteral administration. 37. The composition according to either claim 32 or claim 33, wherein th composition s adapted for topical administration. 38. Use of a compound of Formula , or a therapeutically acceptable salt thereof, in the manufacture of a medicament for the treatment of a bacterial colonisation or infection in a subject. RECTIFIED SHEETS (Rule 91) ISA/AU 39. The use according to claim 38, wherein the use comprises administering a therapeutically effective amount of compound of Formula I, or a therapeutically acceptable salt thereof, to the subject. 40. The use according to claim 39, wherein the compound of Formula I is administered to the subject in a dose in the range of 0.1 mg/kg to 250 mg/kg body weight. 4 1. The use according to any one of claims 38 to 40, wherein the medicament is administered to the subject by oral administration. 42. The use according to any one of claims 38 to 40, wherein the medicament is administered to the subject by parenteral administration. 43. The use according to any one of claims 38 to 40, wherein the medicament is administered to the subject by topical administration. 44. A medical device when used in a method of treating or preventing a bacterial colonisation or infection in the subject, wherein the medical device comprises the composition according to any one of claims 34 to 37. 45. The medical device according to claim 44, wherein the medical device is in a form selected from the group comprising: a plaster, a bandage, a dressing or implant applied to a bacterial or colonisation infection in a subject. 46. A method of killing bacteria, the method including the step of contacting the bacteria with a compound of Formula I, or a therapeutically acceptable salt thereof. 47. Use of a compound of Formula I, or a therapeutically acceptable salt thereof, to kill bacteria, said use comprising the step of contacting the bacteria with a compound of Formula I, or a therapeutically acceptable salt thereof. 48. A method, a composition, device or a use, substantially as described herein with reference to the accompanying Examples and Figures. ABSTRACT The invention provides compounds of Formula I, and methods of treating or preventing a bacterial infection in a subject using a compound of Formula I. The invention also provides the RECTIFIED SHEET Rule 9 1 (ISA/AU) use of a compound of Formula in the manufacture of a medicament for the treatment of a bacterial infection in a subject. The invention further provides a device when used in a method of treating or preventing a bacteria! infection n a subject and to a medical device comprising the composition of the invention. RECTIFIED SHEETS (Rule 9 1) ISA/AU A. CLASSIFICATION OF SUBJECT MATTER [See Supplemental Sheet] According to International Patent Classification (IPC) or to both national classification and IPC B. FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) STN Registry, CAPlus & Keywords: Structure or molecular formula search based on the compounds of Formula (I) as exemplified in the specification as filed and limited to therapeutic use and combination with keywords such as 'antibiotic', 'antibacterial', 'germicidial', 'bacterial', 'microbial', 'infection', 'microorganism' and like terms. Espacenet & Applicant / Inventor: 'NEOCULF, 'PAGE, Stephen', 'GARG, Sanjay', 'KEENAN, Martine', 'MCCLUSKEY, Adam' or 'STEVENS, Andrew'. AusPat & Applicant / Inventor: 'NEOCULT', 'PAGE, Stephen', 'GARG, Sanjay', 'KEENAN, Martine', 'MCCLUSKEY, Adam' or 'STEVENS, Andrew'. C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. Documents are listed in the continuation of Box C | IFurther documents are listed in the continuation of Box C | | See patent family annex * Special categories of cited documents: "A" document defining the general state of the art which is not "T later document published after the international fding date or priority date and not in considered to be of particular relevance conflict with the application but cited to understand the principle or theory underlying the invention "E" earlier application or patent but published on or after the "X document of particular relevance; the claimed invention cannot be considered novel international filing date or cannot be considered to involve an inventive step when the document is taken alone "L" document which may throw doubts on priority claim(s) or "Y document of particular relevance: the claimed invention cannot be considered to which is cited to establish the publication date of another involve an inventive step when the document is combined with one or more other citation or other special reason (as specified) such documents, such combination being obvious to a person skilled in the art "O" document referring to an oral disclosure, use, exhibition or other means document member of the same patent family "P" document published prior to the international filing date but later than the priority date claimed Date of the actual completion of the international search Date of mailing of the international search report 18 August 2014 18 August 2014 Name and mailing address of the ISA/AU Authorised officer AUSTRALIAN PATENT OFFICE Bradley Man PO BOX 200, WODEN ACT 2606, AUSTRALIA AUSTRALIAN PATENT OFFICE Email address: [email protected] (ISO 900 1Quality Certified Service) Telephone No. +61 (02) 6283 2034 Form PCT/ISA/210 (fifth sheet) ( uly 2009) Supplemental Box - IPC Marks C07C 279/02 (2006.01) C07C 241/04 (2006.01) C07C 281/08 (2006.01) C07C 337/08 (2006.01) C07C 281/18 (2006.01) C07D 249/14 (2006.01) C07D 407/12 (2006.01) C07D 403/12 (2006.01) C07D 409/12 (2006.01) C07D 401/12 (2006.01) C07C 275/68 (2006.01) A61K 31/4045 (2006.01) A61K 31/155 (2006.01) A61K 31/4192 (2006.01) A61K 31/341 (2006.01) A61K 31/381 (2006.01) A61K 31/498 (2006.01) A61K 31/44 (2006.01) A61P 31/12 (2006.01) A61P 31/04 (2006.01) Form PCT/ISA/210 (Su lemental Box) (Jul 2009) ont nuat on . Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. CAS RN 1024798-1 7-1, STN Entry Date 3 June 2008 X See whole document 1 and 3 CAS RN 902275-25-6, STN Entry Date 17 August 2006 X See whole document 1 and 3 CAS RN 387363-92-0, STN Entry Date 28 January 2002 X See whole document 1 and 3 CAS RN 1159783-84-2, STN Entry Date 24 June 2009 X See whole document 1, 3 and 9 CAS RN 1159808-94-2, STN Entry Date 24 June 2009 X See whole document 1, 3 and 9 CAS RN 133476-56-9, STN Entry Date 26 April 199 1 X See whole document 1 MAKKI, M. S. T. et al., "Synthesis of New Bioactive Sulfur Compounds Bearing Heterocyclic Moiety and Their Analytical Applications", International Journal of Chemistry, 201 1, Vol. 3, No. 1 pages 181-192. X See compound 9a-d and 8a-d; page 186, 'Antibacterial activity' 1, 3, 32, 33, 46 and 47 TEHRANI, K. H. M. E. et al., "Synthesis and Antimycobacterial Activity of Symmetric Thiocarboliydrazone Derivatives against Mycobacterium bovis BCG", Iranian Journal of Pharmaceutical Research, 20 13, Vol. 12, No. 2, pages 33 1-346. Published in the Spring 201 3 edition. X See compounds SRI-224, SRI-286, Derivative 1, 3, 12, 15 and 22; page 341, Table 1; 1, 3, 32, 33, 46 and 47 page 337, 'In- vitro evaluation of anti-mycobacterial activity' WO 2008/014266 A2 (UNIVERSITY OF MARYLAND, BALTIMORE) 31 January 2008 X See page 57, compounds 7, 8 and 10; page 28, compounds 16-19; page 27, compounds 1, 3, 9 and 11-47 7 and 8; para. [18]; page 133, claim 31; para. [24] and [29]; page 13 1, claims 12 and 16; para. [22]; para. [1 ] PELTTARI, E. et al., "Carbohydrazones of Substituted Salicylaldehydes as Potential Lead Compounds for the Development of Narrow-Spectrum Antimicrobials", Zeitschrift fur Naturforschung C, 2007, Vol. 62, pages 483-486. X See compounds a-h; page 483. 'Experimental' 1, 3, 32, 33, 46 and 47 PANDEY, A. et al., "Synthesis of Schiff Bases of 2-amino-5-aryl- l ,3,4-thiadiazole and Its Analgesic, Anti-Inflammatory and Ami-Bacterial Activity", Journal of Chemistry, 201 2, Vol. 9, No. 4, pages 2524-253 . X See compounds 2a-e 1 and 3 HOSNY, M. A. et al., "A New Type of Synthesis of 1,2,3- Thiadiazole and 1,2,3- Diazaphosphole Derivatives Via-Hurd-Mori Cyclization", Journal of Chemistry, Vol. 9, No. 3, pages 1276-1287. X See compounds 7-10; page 1284, Table (2) 1, 3, 32, 33, 46 and 47 KUMAR, A. et al., "Syntheses, Antibacterial and Antifungal Screening of Some 1,3,4- Oxadiazole Analogues.", International Journal of Pharmacy and Pharmaceutical Sciences, 2012, Vol. 4, Supplement 1, pages 440-443. X See compounds 2A-H 1 and 3 Form PCT 'ISA/210 (fifth sheet) (July 2009) ont nuat on . Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. SHI, Z. et al., "Synthesis of new deoxycholic acid bis thiocarbazones under solvent-free conditions using microwave iiTadiation", Journal of Chemical Research, 201 , Vol. 35, No. 4, pages 198-201 . X Compounds 2a-j 1 KUMAR, S. et al., "Synthesis and biological activity of 5-substituted-2-amino- 1,3,4- oxadiazole derivatives", Turkish Journal of Chemistry, 201 1, Vol. 35, pages 99-108. X See compounds 3a-c 1 and 3 ONIGA, O. et al., "Synthesis of Some 2-(Acetophenon-hydrazin)-thiazoles and 2-(4- thiazolyl-methynhydrazin)-thiazoles as potential antibacterial and antifungal agents", Farmacia, 20 10, Vol. 58, No. 6, pages 825-833. X See compounds 1a-c 1 and 3 PAVAN, F. R. et al., "Thiosemicarbazones, semicarbazones, dithiocarbazates and hydrazide/hydrazones: Anti - Mycobacterium tuberculosis activity and cytotoxicity", European Journal of Medicinal Chemistry, 201 0, Vol. 45, pages 1898-1 905. X See compounds 8, 9 and Haptsc; page 1904, 'Anti-M. tuberculosis activity assay'; page 1, 3, 32, 33, 46 and 47 1900, Table 1 US 2009/0285772 A l (PHIASIVONGSA et al.) 19 November 2009 X See Example I, compounds 13 and 4 1, 3 and 9 CASTILLO-GARIT, J. A. et al., "Ligand-based discovery of novel trypanosomicidal drug-like compounds: In silico identification and experimental support", European Journal of Medicinal Chemistry, 201 1, Vol. 46, pages 3324-3330. & CAS RN 18087-41-7, 443 144-54-5 and 443 144-58-9 X See whole document 1 and 3 Form PCT/ISA/210 (fifth sheet) (July 2009) Box No. II Observations where certain claims were found unsearchable (Continuation of item 2 of first sheet) This international search report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons: 1. I IClaims Nos.: because they relate to subject matter not required to be searched by this Authority, namely: the subject matter listed in Rule 39 on which, under Article 7(2)(a)(i), an international search is not required to be carried out, including 2. X Claims Nos.: 2, 4-8, 10 and 48 because they relate to parts of the international application that do not comply with the prescribed requirements to such an extent that no meaningful international search can be carried out, specifically: See Supplemental Box 3. I IClaims Nos: because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a) Box No. Ill Observations where unity of invention is lacking (Continuation of item 3 of first sheet) This International Searching Authority found multiple inventions in this international application, as follows: See Supplemental Box for Details As all required additional search fees were timely paid by the applicant, this international search report covers all searchable claims. As all searchable claims could be searched without effort justifying additional fees, this Authority did not invite payment of additional fees. As only some of the required additional search fees were timely paid by the applicant, this international search report covers only those claims for which fees were paid, specifically claims Nos.: No required additional search fees were timely paid by the applicant. Consequently, this international search report is restricted to the invention first mentioned in the claims; it is covered by claims Nos.: Remark on Protest The additional search fees were accompanied by the applicant's protest and, where applicable, the payment of a protest fee. The additional search fees were accompanied by the applicant's protest but the applicable protest fee was not paid within the time limit specified in the invitation. X INo protest accompanied the payment of additional search fees. Form PCT/ISA/210 (third sheet) (July 2009) Supplemental Box Continuation of Box II The claims do not comply with Rule 6.2(a) because they rely on references to the description and drawings. Continuation of: Box III The international Application does not comply with the requirement of unity of invention because it does not relate to one invention so linked as to form a single inventive concept. This authority has found that there are different inventions based on the following features that separate the claims into distinct groups: Invention 1: Claim 1-48 (in part) directed toward compounds of Formula (I) wherein 4 is either O, N or S; R3 is selected from Formula IV, V or VI; and R2 and R4 are not bonded together, compositions thereof and use in the treatment of bacterial infection. Invention 2 : Claims 1-48 (in part) directed toward compounds of Formula (I) wherein R4 is either O, N or S; R3 is selected from OCH2CH3, NH2, NHNH , substituted NH group; and R and R4 are not bonded together, compositions thereof and use in the treatment of bacterial infection. Invention 3 : Claims 1-48 (in part) directed toward compounds of Formula (I) wherein and R together form a pyrimidine, pyrazine or triazine ring; or wherein R and A together form a triazole. PCT Rule 13.2, first sentence, states that unity of invention is only fulfilled when there is a technical relationship among the claimed inventions involving one or more of the same or corresponding special technical features. PCT Rule 13.2, second sentence, defines a special technical feature as a feature which makes a contribution over the prior art. The compounds within the groups of inventions, as above, are all linked by the feature that they are all compounds of Formula (I) which are useful for the treatment of bacterial infections. However said feature cannot be a special technical feature for the requirements of unity of invention as it does not make a contribution over the prior art as they are already disclosed in D9. D9: WO 2008/014266 A2 (UNIVERSITY OF MARYLAND, BALTIMORE) 31 January 2008 D9 discloses compounds (see page 57, compounds 8 and 9; see page 28, compound 16- 19; Figure 2, compound 1) which fall within the scope Formula (I), compositions thereof and use in the treatment of bacterial infections, in particular Staphylococcus aureus. Therefore in view of D9 the groups of compounds, as above, do not contain a special technical feature which makes a contribution over the prior art and as such does not meet the requirements of unity aposteriori. It is considered that the search and examination for the additional inventions will require more than negligible additional search and examination effort over that of the first invention, and therefore an additional search fee is warranted. Form PCT/ISA/210 (Supplemental Box) (July 2009) Information on patent family members PCT/AU2014/000483 This Annex lists known patent family members relating to the patent documents cited in the above-mentioned international search report. The Australian Patent Office is in no way liable for these particulars which are merely given for the purpose of information. Patent Document/s Cited in Search Report Patent Family Member/s Publication Number Publication Date Publication Number Publication Date WO 2008/014266 A2 31 January 2008 AU 2007276763 A l 31 Jan 2008 AU 2007276763 B2 17 Mar 2011 CA 2658877 A l 31 Jan 2008 EP 2046122 A2 15 Apr 2009 US 2010081661 A l 0 1 Apr 2010 US 8450368 B2 28 May 2013 US 2009/0285772 A l 19 November 2009 US 7939546 B2 10 May 201 1 Due to data integration issues this family listing may not include 0 digit Australian applications filed since May 2001 . Form PCT/ISA/21 0 (Family Annex)(July 2009) Information on patent family members PCT/AU2014/000483 This Annex lists known patent family members relating to the patent documents cited in the above-mentioned international search report. The Australian Patent Office is in no way liable for these particulars which are merely given for the purpose of information. Patent Document/s Cited in Search Report Patent Family Member/s Publication Number Publication Date Publication Number Publication Date CA 266463 1 A l 17 Apr 2008 CN 101535295 A 16 Sep 2009 CN 101 889008 A 17 Nov 2010 EP 2078008 A2 15 Jul 2009 EP 2174938 A l 14 Apr 2010 EP 2205586 A l 14 Jul 2010 JP 2010506856 A 04 Mar 2010 JP 201 1500591 A 06 Jan 201 1 KR 20090089854 A 24 Aug 2009 TW 2009271 13 A 0 1 Jul 2009 US 2009099106 A l 16 Apr 2009 US 7790746 B2 07 Sep 2010 US 20081758 14 A l 24 Jul 2008 US 2010129320 A l 27 May 2010 US 201 1256092 A l 20 Oct 2 11 WO 2008046085 A2 17 Apr 2008 WO 2009049132 A l 16 Apr 2009 End of Annex Due to data integration issues this family listing may not include 10 digit Australian applications filed since May 2001 . Form PCT/ISA/21 0 (Family Annex)(July 2009)