Network-Based Metabolic Characterization of Renal Cell Carcinoma Nishtha Pandey1, Vinay Lanke1,2 & P
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Aspartate Aminotransferase (AST, GOT), Human Liver
BioVision 05/18 For research use only Aspartate Aminotransferase (AST, GOT), Human Liver CATALOG NO: P1299-100 1 units RELATED PRODUCTS: ALTERNATE NAMES: Aspartate Transaminase, Glutamate Oxaloacetate, AST, GOT, Aspartate Aminotransferase (AST) (Mouse) ELISA Kit (Cat. No. E4320) sGOT, AspAT, ASAT, serum glutamic oxaloacetic transaminase, AAT Aspartate Aminotransferase (AST) (Human) ELISA Kit (Cat. No. E4319) Aspartate Aminotransferase (AST) (Rat) ELISA Kit (Cat. No. E4321) SOURCE: Human Liver Aspartate Aminotransferase (AST or SGOT) Activity Colorimetric Assay Kit (Cat. PURITY: Purified No. K753) Anti-GOT2 Antibody (cat. No. A1273) MOL. WEIGHT: ~92 kDa Anti-GOT1 Antibody (Cat. No. A1272) FORM: Lyophilized GOT2, human recombinant (Cat. No. 7809) GOT1, human recombinant (Cat. No. 7808) STORAGE CONDITIONS: Store at -20°C. Avoid repeated freezing and thawing cycles. BIOLOGICAL ACTIVITY: ≥ 1 U/mg (Dimension® Clinical Chemistry System) UNIT DEFINITATION: One unit will catalyze the transamination of one micromole of L- aspartate to alpha-ketoglutarate forming L-glutamate and oxaloacetate per minute at 37°C and pH 7.8.Measured at 340 nm as one equimolar amount of NAD produced by a coupled reaction. RECONSTITUTION: > 1 mg/mL in tris buffered saline, 1% BSA, pH 8.0. AST/SGOT is found in many tissues throughout the body, including DESCRIPTION: the liver, heart, muscles, kidney, and brain. If any of these organs or tissues is affected by disease or injury, AST is released into the bloodstream. This means that AST isn't as specific an indicator of liver damage as ALT (also known as alanine aminotransferase, another type of enzyme found almost entirely in the liver). The ratio of AST and ALT levels are commonly used as biomarkers for liver health. -
Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis. -
A Review on Agmatinase Inhibitors
www.ijcrt.org © 2020 IJCRT | Volume 8, Issue 12 December 2020 | ISSN: 2320-2882 A review on Agmatinase inhibitors 1Sunnica Biswas, 2Mr. R. T. Lohiya, 3Dr. Milind Umekar *1&2 Department Of Pharmaceutical Chemistry Smt. Kishoriti Bhoyar College of Pharmacy, Kamptee, Dst. Nagpur, 441002 Abstract : Agmatine is the product of arginine decarboxylation and can be hydrolyzed by agmatinase to putrescine, the precursor for biosynthesis of higher polyamines, spermidine, and spermine. Besides being an intermediate in polyamine metabolism, recent findings indicate that agmatine may play important regulatory roles in mammals. Agmatine, 4-aminobutyl guanidine, has recently been found in various mammalian organs and is thought to act as a neurotransmitter or neuromodulatory agent. The present study is to do a review on agmatine and its synthesized analogues till now for agmatinase inhibitory action. Agmatinase is a binuclear manganese metalloenzyme and belongs to the ureohydrolase superfamily that includes arginase, formiminoglutamase, and proclavaminate amidinohydrolase. Compared with a wealth of structural information available for arginases, no three dimensional structure of agmatinase has been reported. Agmatinase is an enzyme which blocks the mammalian agmatine which is ultimately responsible for the agmatine degradation in the body. Agmatinase is an enzyme which regulates the half life of agmatine in the brain. Hence a selective inhibitor of brain agmatinase is required. Several derivatives of agmatine are synthesized previously for agmatinase inhibitory activity but none of them showed selective inhibition. PZC (Piperazinecarboxamidine) is a derivative of agmatine or guanidine is expected to show selective inhibition of human agmatinase. A detailed review is carried out in order to understand the agmatinase inhibitor. -
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Screening of a Composite Library of Clinically Used Drugs and Well
HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Pharmacol Manuscript Author Res. Author Manuscript Author manuscript; available in PMC 2017 November 01. Published in final edited form as: Pharmacol Res. 2016 November ; 113(Pt A): 18–37. doi:10.1016/j.phrs.2016.08.016. Screening of a composite library of clinically used drugs and well-characterized pharmacological compounds for cystathionine β-synthase inhibition identifies benserazide as a drug potentially suitable for repurposing for the experimental therapy of colon cancer Nadiya Druzhynaa, Bartosz Szczesnya, Gabor Olaha, Katalin Módisa,b, Antonia Asimakopoulouc,d, Athanasia Pavlidoue, Petra Szoleczkya, Domokos Geröa, Kazunori Yanagia, Gabor Töröa, Isabel López-Garcíaa, Vassilios Myrianthopoulose, Emmanuel Mikrose, John R. Zatarainb, Celia Chaob, Andreas Papapetropoulosd,e, Mark R. Hellmichb,f, and Csaba Szaboa,f,* aDepartment of Anesthesiology, The University of Texas Medical Branch, Galveston, TX, USA bDepartment of Surgery, The University of Texas Medical Branch, Galveston, TX, USA cLaboratory of Molecular Pharmacology, Department of Pharmacy, University of Patras, Greece dCenter of Clinical, Experimental Surgery & Translational Research, Biomedical Research Foundation of the Academy of Athens, Greece eNational and Kapodistrian University of Athens, School of Pharmacy, Athens, Greece fCBS Therapeutics Inc., Galveston, TX, USA Abstract Cystathionine-β-synthase (CBS) has been recently identified as a drug target for several forms of cancer. Currently no -
Ornithine Aminotransferase, an Important Glutamate-Metabolizing Enzyme at the Crossroads of Multiple Metabolic Pathways
biology Review Ornithine Aminotransferase, an Important Glutamate-Metabolizing Enzyme at the Crossroads of Multiple Metabolic Pathways Antonin Ginguay 1,2, Luc Cynober 1,2,*, Emmanuel Curis 3,4,5,6 and Ioannis Nicolis 3,7 1 Clinical Chemistry, Cochin Hospital, GH HUPC, AP-HP, 75014 Paris, France; [email protected] 2 Laboratory of Biological Nutrition, EA 4466 PRETRAM, Faculté de Pharmacie, Université Paris Descartes, 75006 Paris, France 3 Laboratoire de biomathématiques, plateau iB2, Faculté de Pharmacie, Université Paris Descartes, 75006 Paris, France; [email protected] (E.C.); [email protected] (I.N.) 4 UMR 1144, INSERM, Université Paris Descartes, 75006 Paris, France 5 UMR 1144, Université Paris Descartes, 75006 Paris, France 6 Service de biostatistiques et d’informatique médicales, hôpital Saint-Louis, Assistance publique-hôpitaux de Paris, 75010 Paris, France 7 EA 4064 “Épidémiologie environnementale: Impact sanitaire des pollutions”, Faculté de Pharmacie, Université Paris Descartes, 75006 Paris, France * Correspondence: [email protected]; Tel.: +33-158-411-599 Academic Editors: Arthur J.L. Cooper and Thomas M. Jeitner Received: 26 October 2016; Accepted: 24 February 2017; Published: 6 March 2017 Abstract: Ornithine δ-aminotransferase (OAT, E.C. 2.6.1.13) catalyzes the transfer of the δ-amino group from ornithine (Orn) to α-ketoglutarate (aKG), yielding glutamate-5-semialdehyde and glutamate (Glu), and vice versa. In mammals, OAT is a mitochondrial enzyme, mainly located in the liver, intestine, brain, and kidney. In general, OAT serves to form glutamate from ornithine, with the notable exception of the intestine, where citrulline (Cit) or arginine (Arg) are end products. -
Agmatinase Sirna (H): Sc-60060
SANTA CRUZ BIOTECHNOLOGY, INC. Agmatinase siRNA (h): sc-60060 BACKGROUND STORAGE AND RESUSPENSION Agmatinase (also known as agmatine ureohydrolase) results from the decar- Store lyophilized siRNA duplex at -20° C with desiccant. Stable for at least boxylation of L-arginine by arginine decarboxylase to form a metabolic inter- one year from the date of shipment. Once resuspended, store at -20° C, mediate in the biosynthesis of putresine and higher polyamines (spermidine avoid contact with RNAses and repeated freeze thaw cycles. and spermine). Agmatinase has been shown to play a role in several important Resuspend lyophilized siRNA duplex in 330 µl of the RNAse-free water biochemical processes in humans, ranging from effects on the central nervous provided. Resuspension of the siRNA duplex in 330 µl of RNAse-free water system to cell proliferation in cancer and viral replication. Agmatinase cat- makes a 10 µM solution in a 10 µM Tris-HCl, pH 8.0, 20 mM NaCl, 1 mM alyzes the hydrolysis of agmatine to putresine and urea and is a major target EDTA buffered solution. for drug therapy. Human Agmatinase retains about 30% identity to bacterial agmatinases and less than 20% identity to mammalian arginases. Residues APPLICATIONS required for binding of Mn2+ at the active site in bacterial Agmatinase and other members of the arginase superfamily are fully conserved in human Agmatinase siRNA (h) is recommended for the inhibition of Agmatinase Agmatinase. Agmatinase mRNA is most abundant in human liver and kidney, expression in human cells. but is also expressed in several other tissues, including skeletal muscle and brain. -
Asparaginase and Glutaminase Activities of Micro-Organisms
Journal of General MicrobiologjI (1973),76,85-99 85 Printed in Great Britain Asparaginase and Glutaminase Activities of Micro-organisms By A. IMADA, S. IGARASI, K. NAKAHAMA AND M. ISONO Microbiological Research Laboratories, Central Research Dillision, Takeda Chemical Industries, JlisB, Osaka, Japan (Received 14 September 1972; revised 28 November 1972) SUMMARY L-Asparaginase and L-glutaminase activities were detected in many micro- organisms and the distribution of these activities was found to be related to the classification of micro-organisms. Among 464 bacteria, the activities occurred in many Gram-negative bacteria and in a few Gram-positive bacteria. Most members of the family Enterobacteri- aceae possessed L-asparaginase. L-Asparaginase and L-glutaminase occurred together in a large proportion of pseudomonads. Among Gram-positive bacteria many strains of Bacillus pumilus showed strong L-asparaginase activity. Amidase activities were also observed in several strains in other families. L-Asparaginase activity was not detected in culture filtrates of 261 strains of species of the genera Streptomyces and Nocardia, but L-asparaginase and L- glutaminase were detected when these organisms were sonicated. The amidase activities in culture filtrates of 4158 fungal strains were tested. All the strains of Fusarium species formed L-asparaginase. Organisms of the genera Hjyomyces and Nectria, which are regarded as the perfect stage of the genus Fusarium, also formed L-asparaginase. Several Penicillium species formed L-asparaginase. Two organisms of the family Moniliaceae formed L-glutaminase together with L-asparaginase, and a few ascomycetous fungi formed L-asparaginase or L-glutaminase. Among I 326 yeasts, L-asparaginase or L-glutaminase occurred frequently in certain serological groups of yeasts : VI (Hansenula) group, Cryptococcus group and Rhodotorula group. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Supplementary Materials
1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No. -
Type of the Paper (Article
Supplementary Material A Proteomics Study on the Mechanism of Nutmeg-induced Hepatotoxicity Wei Xia 1, †, Zhipeng Cao 1, †, Xiaoyu Zhang 1 and Lina Gao 1,* 1 School of Forensic Medicine, China Medical University, Shenyang 110122, P. R. China; lessen- [email protected] (W.X.); [email protected] (Z.C.); [email protected] (X.Z.) † The authors contributed equally to this work. * Correspondence: [email protected] Figure S1. Table S1. Peptide fraction separation liquid chromatography elution gradient table. Time (min) Flow rate (mL/min) Mobile phase A (%) Mobile phase B (%) 0 1 97 3 10 1 95 5 30 1 80 20 48 1 60 40 50 1 50 50 53 1 30 70 54 1 0 100 1 Table 2. Liquid chromatography elution gradient table. Time (min) Flow rate (nL/min) Mobile phase A (%) Mobile phase B (%) 0 600 94 6 2 600 83 17 82 600 60 40 84 600 50 50 85 600 45 55 90 600 0 100 Table S3. The analysis parameter of Proteome Discoverer 2.2. Item Value Type of Quantification Reporter Quantification (TMT) Enzyme Trypsin Max.Missed Cleavage Sites 2 Precursor Mass Tolerance 10 ppm Fragment Mass Tolerance 0.02 Da Dynamic Modification Oxidation/+15.995 Da (M) and TMT /+229.163 Da (K,Y) N-Terminal Modification Acetyl/+42.011 Da (N-Terminal) and TMT /+229.163 Da (N-Terminal) Static Modification Carbamidomethyl/+57.021 Da (C) 2 Table S4. The DEPs between the low-dose group and the control group. Protein Gene Fold Change P value Trend mRNA H2-K1 0.380 0.010 down Glutamine synthetase 0.426 0.022 down Annexin Anxa6 0.447 0.032 down mRNA H2-D1 0.467 0.002 down Ribokinase Rbks 0.487 0.000 -
CDH12 Cadherin 12, Type 2 N-Cadherin 2 RPL5 Ribosomal
5 6 6 5 . 4 2 1 1 1 2 4 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 A A A A A A A A A A A A A A A A A A A A C C C C C C C C C C C C C C C C C C C C R R R R R R R R R R R R R R R R R R R R B , B B B B B B B B B B B B B B B B B B B , 9 , , , , 4 , , 3 0 , , , , , , , , 6 2 , , 5 , 0 8 6 4 , 7 5 7 0 2 8 9 1 3 3 3 1 1 7 5 0 4 1 4 0 7 1 0 2 0 6 7 8 0 2 5 7 8 0 3 8 5 4 9 0 1 0 8 8 3 5 6 7 4 7 9 5 2 1 1 8 2 2 1 7 9 6 2 1 7 1 1 0 4 5 3 5 8 9 1 0 0 4 2 5 0 8 1 4 1 6 9 0 0 6 3 6 9 1 0 9 0 3 8 1 3 5 6 3 6 0 4 2 6 1 0 1 2 1 9 9 7 9 5 7 1 5 8 9 8 8 2 1 9 9 1 1 1 9 6 9 8 9 7 8 4 5 8 8 6 4 8 1 1 2 8 6 2 7 9 8 3 5 4 3 2 1 7 9 5 3 1 3 2 1 2 9 5 1 1 1 1 1 1 5 9 5 3 2 6 3 4 1 3 1 1 4 1 4 1 7 1 3 4 3 2 7 6 4 2 7 2 1 2 1 5 1 6 3 5 6 1 3 6 4 7 1 6 5 1 1 4 1 6 1 7 6 4 7 e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p p m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m