DOCSLIB.ORG

HK3 Overexpression Associated with Epithelial-Mesenchymal Transition in Colorectal Cancer Elena A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
HK3 Overexpression Associated with Epithelial-Mesenchymal Transition in Colorectal Cancer Elena A Pudova et al. BMC Genomics 2018, 19(Suppl 3):113 DOI 10.1186/s12864-018-4477-4 RESEARCH Open Access HK3 overexpression associated with epithelial-mesenchymal transition in colorectal cancer Elena A. Pudova1†, Anna V. Kudryavtseva1,2†, Maria S. Fedorova1, Andrew R. Zaretsky3, Dmitry S. Shcherbo3, Elena N. Lukyanova1,4, Anatoly Y. Popov5, Asiya F. Sadritdinova1, Ivan S. Abramov1, Sergey L. Kharitonov1, George S. Krasnov1, Kseniya M. Klimina4, Nadezhda V. Koroban2, Nadezhda N. Volchenko2, Kirill M. Nyushko2, Nataliya V. Melnikova1, Maria A. Chernichenko2, Dmitry V. Sidorov2, Boris Y. Alekseev2, Marina V. Kiseleva2, Andrey D. Kaprin2, Alexey A. Dmitriev1 and Anastasiya V. Snezhkina1* From Belyaev Conference Novosibirsk, Russia. 07-10 August 2017 Abstract Background: Colorectal cancer (CRC) is a common cancer worldwide. The main cause of death in CRC includes tumor progression and metastasis. At molecular level, these processes may be triggered by epithelial-mesenchymal transition (EMT) and necessitates specific alterations in cell metabolism. Although several EMT-related metabolic changes have been described in CRC, the mechanism is still poorly understood. Results: Using CrossHub software, we analyzed RNA-Seq expression profile data of CRC derived from The Cancer Genome Atlas (TCGA) project. Correlation analysis between the change in the expression of genes involved in glycolysis and EMT was performed. We obtained the set of genes with significant correlation coefficients, which included 21 EMT-related genes and a single glycolytic gene, HK3. The mRNA level of these genes was measured in 78 paired colorectal cancer samples by quantitative polymerase chain reaction (qPCR). Upregulation of HK3 and deregulation of 11 genes (COL1A1, TWIST1, NFATC1, GLIPR2, SFPR1, FLNA, GREM1, SFRP2, ZEB2, SPP1, and RARRES1) involved in EMT were found. The results of correlation study showed that the expression of HK3 demonstrated a strong correlation with 7 of the 21 examined genes (ZEB2, GREM1, TGFB3, TGFB1, SNAI2, TWIST1, and COL1A1) in CRC. Conclusions: Upregulation of HK3 is associated with EMT in CRC and may be a crucial metabolic adaptation for rapid proliferation, survival, and metastases of CRC cells. Keywords: Warburg effect, Hexokinase, Glycolysis, Colorectal cancer, Epithelial-mesenchymal transition Background making it the third most common cancer and fourth In 2012, an estimated 1.36 million people were diag- most common cause of death worldwide [2]. nosed with colorectal cancer (CRC), including 746,300 The stage of CRC plays a significant role in survival of men and 614,300 women. The mortality rate of CRC is patients. More than 60% of patients are diagnosed at late reported to be approximately half of its global incidence. stage of CRC (III-IV) and approximately 25% of them In the same year, 694,000 people died from CRC [1], display metastatic disease [3, 4]. Development of new drugs and targeted therapies has dramatically improved the survival of these patients over the last decade [5]. * Correspondence: [email protected] †Equal contributors However, the survival outcome in patients with meta- 1Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, static or stage IV CRC still remains poor [6, 7]. For in- Moscow, Russia stance, the 5-year relative survival rate for patients with Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Pudova et al. BMC Genomics 2018, 19(Suppl 3):113 Page 6 of 141 metastatic CRC is about 11%, while that for patients invasion, and metastasis [32–34]. Increased glycolysis with stage III CRC ranges from 53% to 89% (https:// has been suggested as an essential component of the www.cancer.org). CRC is characterized by severe genetic malignant phenotype and hallmark of invasive cancers alterations, including microsatellite instability (MSI), epi- [35]. In CRC, redirection of glucose metabolism is pro- genetic changes such as DNA methylation (CpG Island moted by deregulation of key components involved in Methylator Phenotype [CIMP]), and chromosomal in- glucose transport (GLUT-1) [36], metabolism (hexoki- stability (CIN), which are associated with the develop- nases [HK1, HK2], pyruvate kinase M2 [PKM2], lac- ment of the disease and its aggressive behavior [8, 9]. tate dehydrogenase A [LDHA], aldolase A [ALDOA], Thus, identification of the distinct molecular genetic etc.) [37–39], as well as metabolic regulation [40–42]. changes related to CRC progression and metastasis is In addition, variation in the representation of alterna- extremely important. tive spliced transcripts related to energy metabolism A number of studies have demonstrated that seems to be associated with the prevalence of aerobic epithelial-mesenchymal transition (EMT) is involved in glycolysis in cancer cells [43, 44]. EMT in tumors re- CRC carcinogenesis and metastasis [10, 11]. EMT is the quires the distinct metabolic adaptations for survival, conversion of epithelial cells into cells with a mesenchy- rapid proliferation, and metastasis. However, meta- mal phenotype, which is accompanied by a decrease in bolic changes observed upon EMT induction are un- cell-cell cohesion and fundamental reorganization of the common for various cancer types [45–47]. Recent cytoskeleton. Consequences include enhanced migratory studies showed that the glycolytic enzymes aldolase B as well as invasive capacity and resistance to apoptosis (ALDOB), PKM2, and glyceraldehyde-3-phosphate de- [12, 13]. Based on the biological context, three types of hydrogenase (GAPDH) play a role in EMT and me- EMT have been described as follows: type I observed in tastasis in CRC [48, 49]. embryogenesis [14], type II involved in tissue repair and In this work, using CrossHub software we analyzed fibrosis [15], and type III seen in metastatic transform- RNA-Seq data from The Cancer Genome Atlas (TCGA) ation of cancer cells [16]. A hallmark feature of EMT is project to estimate the association between the expres- the downregulation of E-cadherin, a cell-cell adhesion sion of genes participating in EMT and glycolysis in molecule localized on the surface of epithelial cells [17]. CRC. Hexokinase 3 (HK3) was found to exhibit signifi- E-cadherin is a well-known tumor suppressor protein cant correlation with a set of genes involved in EMT. and loss of its expression in tumor cells is associated with Thus, we focused on the investigation of HK3 gene ex- increased tumor invasiveness and metastasis [18, 19]. In pression in CRC samples and its association with EMT. CRC, EMT is characterized by decreased E-cadherin ex- pression and nuclear accumulation of β-catenin, which is Methods an essential protein for correct positioning and function Bioinformatic analysis of one [20, 21]. Loss of epithelial and gain of dedifferen- Using CrossHub software [50], we have analyzed The Can- tiated mesenchyme-like phenotype enable CRC cells to cer Genome Atlas (TCGA, https://cancergenome.nih.gov) develop invasive and metastatic growth characteristics project RNA-Seq dataset derived from CRC. The dataset [22]. The switch from cytoplasmic to nuclear accumula- contained 287 tumor samples including 26 paired ones. tion of β-catenin is a central mechanism related to EMT The selection of genes participating in glycolysis and EMT in CRC [21]. This process may be mediated by the loss-of- was performed using Gene Ontology database and “glyco- function mutations in the adenomatous polyposis coli lytic process” and “epithelial to mesenchymal transition” as (APC) tumor suppressor gene or mutations that result in keywords. A set of 132 genes was selected for further β-catenin stabilization [23]. In the nucleus, β-catenin asso- analysis. ciates with DNA-binding proteins of the T-cell factor/ The correlation analysis between the expressions of lymphoid enhancer factor (TCF/Lef) family, leading to a target genes was performed using Spearman’s rank cor- constitutive activation of Wnt/β-catenin signaling target relation coefficients (rs). We carried out two tests: one genes, c-Myc [24]andCCND1 [25]. Moreover, β-catenin for paired samples and other for pool of tumor samples. triggers the expression of other genes such as MMP7 Spearman’s rank correlation coefficients were calculated [26, 27], FN [28 ], CD44 [29], and UPAR [30]involved between (1) fold change values, the ratio of CPM (counts in invasive cell growth. Except for this mechanism, per million) in tumor sample to CPM in conditional there are at least ten known signaling pathways and normal tissue, (paired samples) and (2) CPM values (pool many molecules associated with EMT in CRC [31]. of tumor samples). Before calculating correlation coeffi- Metabolic reprogramming characterized by upregu- cients, dropping points (no more than 5%) were elimi- lated glycolysis is another crucial feature of cancer. It nated using approximate generalized linear model. We provides cancer cells with energy and metabolites essen- focused on the genes
Load more

Recommended publications
  • PIM2-Mediated Phosphorylation of Hexokinase 2 Is Critical for Tumor Growth and Paclitaxel Resistance in Breast Cancer
    Oncogene (2018) 37:5997–6009 https://doi.org/10.1038/s41388-018-0386-x ARTICLE PIM2-mediated phosphorylation of hexokinase 2 is critical for tumor growth and paclitaxel resistance in breast cancer 1 1 1 1 1 2 2 3 Tingting Yang ● Chune Ren ● Pengyun Qiao ● Xue Han ● Li Wang ● Shijun Lv ● Yonghong Sun ● Zhijun Liu ● 3 1 Yu Du ● Zhenhai Yu Received: 3 December 2017 / Revised: 30 May 2018 / Accepted: 31 May 2018 / Published online: 9 July 2018 © The Author(s) 2018. This article is published with open access Abstract Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound to HK2 and phosphorylated HK2 on Thr473. Biochemical analyses demonstrated that phosphorylated HK2 Thr473 promoted its protein stability through the chaperone-mediated autophagy (CMA) pathway, and the levels of PIM2 and pThr473-HK2 proteins were positively correlated with each other in human breast cancer. Furthermore, phosphorylation of HK2 on Thr473 increased HK2 enzyme activity and glycolysis, and 1234567890();,: 1234567890();,: enhanced glucose starvation-induced autophagy. As a result, phosphorylated HK2 Thr473 promoted breast cancer cell growth in vitro and in vivo. Interestingly, PIM2 kinase inhibitor SMI-4a could abrogate the effects of phosphorylated HK2 Thr473 on paclitaxel resistance in vitro and in vivo. Taken together, our findings indicated that PIM2 was a novel regulator of HK2, and suggested a new strategy to treat breast cancer. Introduction ATP molecules.
    [Show full text]
  • Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis
    biology Review Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis Batoul Abi Zamer 1,2 , Wafaa Abumustafa 1,2, Mawieh Hamad 2,3 , Azzam A. Maghazachi 2,4 and Jibran Sualeh Muhammad 1,2,* 1 Department of Basic Medical Sciences, College of Medicine, University of Sharjah, Sharjah 27272, United Arab Emirates; [email protected] (B.A.Z.); [email protected] (W.A.) 2 Sharjah Institute for Medical Research, University of Sharjah, Sharjah 27272, United Arab Emirates; [email protected] (M.H.); [email protected] (A.A.M.) 3 Department of Medical Laboratory Sciences, College of Health Sciences, University of Sharjah, Sharjah 27272, United Arab Emirates 4 Department of Clinical Sciences, College of Medicine, University of Sharjah, Sharjah 27272, United Arab Emirates * Correspondence: [email protected]; Tel.: +971-6-5057293 Simple Summary: Colorectal cancer is one of the most leading causes of death worldwide. The Hallmark of colorectal cancer is the increase of glucose uptake and lactate production even in the presence of oxygen, a phenomenon known as the “Warburg effect”. This review summarizes the genetic mutations and epigenetic alterations, focusing on non-coding RNA associated with the oncogenes, tumor suppresser genes, and enzymes involved in the “Warburg effect”, in addition to Citation: Abi Zamer, B.; Abumustafa, their clinical impacts on colorectal cancer. This knowledge may open the door for novel therapeutic W.; Hamad, M.; Maghazachi, A.A.; approaches to target colorectal cancer. Muhammad, J.S. Genetic Mutations and Non-Coding RNA-Based Abstract: Colorectal cancer (CRC) development is a gradual process defined by the accumulation of Epigenetic Alterations Mediating the numerous genetic mutations and epigenetic alterations leading to the adenoma-carcinoma sequence.
    [Show full text]
  • Regulation of the C/Ebpα Signaling Pathway in Acute Myeloid Leukemia (Review)
    ONCOLOGY REPORTS 33: 2099-2106, 2015 Regulation of the C/EBPα signaling pathway in acute myeloid leukemia (Review) GUANHUA SONG1, LIn Wang2, Kehong BI3 and guosheng JIang1 1Department of hemato-oncology, Institute of Basic Medicine, shandong academy of Medical sciences, Key Laboratory for Modern Medicine and Technology of Shandong Province, Key Laboratory for Rare and Uncommon Diseases, Key Medical Laboratory for Tumor Immunology and Traditional Chinese Medicine Immunology of shandong Province, Jinan, Shandong 250062; 2Research Center for Medical Biotechnology, Shandong Academy of Medical Sciences, Jinan, Shandong 250062; 3Department of Hematology, Qianfoshan Mountain Hospital of Shandong University, Jinan, Shandong 250014, P.R. China Received December 2, 2014; Accepted January 26, 2015 DoI: 10.3892/or.2015.3848 Abstract. The transcription factor CCAAT/enhancer binding Contents protein α (C/EBPα), as a critical regulator of myeloid devel- opment, directs granulocyte and monocyte differentiation. 1. Introduction Various mechanisms have been identified to explain how 2. Function of C/EBPα in myeloid differentiation C/EBPα functions in patients with acute myeloid leukemia 3. Regulation of the C/EBPα signaling pathway (AML). C/EBPα expression is suppressed as a result of 4. Conclusion common leukemia-associated genetic and epigenetic altera- tions such as AML1-ETO, RARα-PLZF or gene promoter methylation. Recent data have shown that ubiquitination modi- 1. Introduction fication also contributes to its downregulation. In addition, 10-15% of patients with AML in an intermediate cytogenetic Acute myeloid leukemia (AML) is characterized by uncon- risk subgroup were characterized by mutations of the C/EBPα trolled proliferation of myeloid progenitors that exhibit a gene.
    [Show full text]
  • Reducing FASN Expression Sensitizes Acute Myeloid Leukemia Cells to Differentiation Therapy Magali Humbert , Kristina Seiler
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.29.924555; this version posted July 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reducing FASN expression sensitizes acute myeloid leukemia cells to differentiation therapy Magali Humbert1,2,#, Kristina Seiler1,3, Severin Mosimann1, Vreni Rentsch1, Sharon L. McKenna2,4, Mario P. Tschan1,2,3 1Institute of Pathology, Division of Experimental Pathology, University of Bern, Bern, Switzerland 2TRANSAUTOPHAGY: European network for multidisciplinary research and translation of autophagy knowledge, COST Action CA15138 3Graduate School for Cellular and Biomedical Sciences, University of Bern, Bern, Switzerland, 4Cancer Research, UCC, Western Gateway Building, University College Cork, Cork, Ireland. #Corresponding Author: Magali Humbert, Institute of Pathology, Division of Experimental Pathology, University of Bern, Murtenstrasse 31, CH-3008 Bern, Switzerland, E-mail: [email protected], Tel: +41 31 632 8788 Running Title: FASN impairs TFEB activity in AML Key words: FASN/AML/ATRA/TFEB/mTOR/autophagy bioRxiv preprint doi: https://doi.org/10.1101/2020.01.29.924555; this version posted July 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Fatty acid synthase (FASN) is the only human lipogenic enzyme available for de novo fatty acid synthesis and is often highly expressed in cancer cells.
    [Show full text]
  • (HK3) (NM 002115) Human Tagged ORF Clone – RC207021
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC207021 Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HK3 Synonyms: HKIII; HXK3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone – RC207021 ORF Nucleotide >RC207021 representing NM_002115 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCCATTGGGTCTTCAGGGTTGCGGCAGGGGGAAGAAACCCTGAGTTGCTCTGAGGAGGGCTTGC CCGGGCCCTCAGACAGCTCAGAGCTGGTGCAGGAGTGCCTGCAGCAGTTCAAGGTGACAAGGGCACAGCT ACAGCAGATCCAAGCCAGCCTCTTGGGTTCCATGGAGCAGGCGCTGAGGGGACAGGCCAGCCCTGCCCCT GCGGTCCGGATGCTGCCTACATACGTGGGGTCCACCCCACATGGCACTGAGCAAGGAGACTTCGTGGTGC TGGAGCTGGGGGCCACAGGGGCCTCACTGCGTGTTTTGTGGGTGACTCTAACTGGCATTGAGGGGCATAG GGTGGAGCCCAGAAGCCAGGAGTTTGTGATCCCCCAAGAGGTGATGCTGGGTGCTGGCCAGCAGCTCTTT GACTTTGCTGCCCACTGCCTGTCTGAGTTCCTGGATGCGCAGCCTGTGAACAAACAGGGTCTGCAGCTTG GCTTCAGCTTCTCTTTCCCTTGTCACCAGACGGGCTTGGACAGGAGCACCCTCATTTCCTGGACCAAAGG
    [Show full text]
  • Figure S1. GO Analysis of Genes in Glioblastoma Cases That Showed Positive and Negative Correlations with TCIRG1 in the GSE16011 Cohort
    Figure S1. GO analysis of genes in glioblastoma cases that showed positive and negative correlations with TCIRG1 in the GSE16011 cohort. (A‑C) GO‑BP, GO‑CC and GO‑MF terms of genes that showed positive correlations with TCIRG1, respec‑ tively. (D‑F) GO‑BP, GO‑CC and GO‑MF terms of genes that showed negative correlations with TCIRG1. Red nodes represent gene counts, and black bars represent negative 1og10 P‑values. TCIRG1, T cell immune regulator 1; GO, Gene Ontology; BP, biological process; CC, cellular component; MF, molecular function. Table SI. Genes correlated with T cell immune regulator 1. Gene Name Pearson's r ARPC1B Actin‑related protein 2/3 complex subunit 1B 0.756 IL4R Interleukin 4 receptor 0.695 PLAUR Plasminogen activator, urokinase receptor 0.693 IFI30 IFI30, lysosomal thiol reductase 0.675 TNFAIP3 TNF α‑induced protein 3 0.675 RBM47 RNA binding motif protein 47 0.666 TYMP Thymidine phosphorylase 0.665 CEBPB CCAAT/enhancer binding protein β 0.663 MVP Major vault protein 0.660 BCL3 B‑cell CLL/lymphoma 3 0.657 LILRB3 Leukocyte immunoglobulin‑like receptor B3 0.656 ELF4 E74 like ETS transcription factor 4 0.652 ITGA5 Integrin subunit α 5 0.651 SLAMF8 SLAM family member 8 0.647 PTPN6 Protein tyrosine phosphatase, non‑receptor type 6 0.641 RAB27A RAB27A, member RAS oncogene family 0.64 S100A11 S100 calcium binding protein A11 0.639 CAST Calpastatin 0.638 EHBP1L1 EH domain‑binding protein 1‑like 1 0.638 LILRB2 Leukocyte immunoglobulin‑like receptor B2 0.629 ALDH3B1 Aldehyde dehydrogenase 3 family member B1 0.626 GNA15 G protein
    [Show full text]
  • Cancer As a Metabolic Disease
    Merrimack College Merrimack ScholarWorks Honors Senior Capstone Projects Honors Program Spring 2017 Cancer as a Metabolic Disease Javaria Haseeb Merrimack College, [email protected] Follow this and additional works at: https://scholarworks.merrimack.edu/honors_capstones Part of the Cancer Biology Commons, Cells Commons, and the Nutritional and Metabolic Diseases Commons Recommended Citation Haseeb, Javaria, "Cancer as a Metabolic Disease" (2017). Honors Senior Capstone Projects. 27. https://scholarworks.merrimack.edu/honors_capstones/27 This Capstone - Open Access is brought to you for free and open access by the Honors Program at Merrimack ScholarWorks. It has been accepted for inclusion in Honors Senior Capstone Projects by an authorized administrator of Merrimack ScholarWorks. For more information, please contact [email protected]. 1 Cancer as a Metabolic Disease Javaria Haseeb Department of Biochemistry, Merrimack College, North Andover MA 01845, USA Abstract Despite decades of intensive scientific and medical efforts to develop efficient and effective treatments for cancer, it remains one of the prime causes of death today. For example, in 2016, there will be an estimated 1,685,210 new cases of cancer and 595,690 deaths due to cancer in the United States alone (National Cancer Institute). Worldwide in 2012, there were an estimated 14 million new cases of cancer and 8.2 million deaths due to cancer. In order to come up with better methods of detection and more successful modes of treatment, it is crucial that scientists understand the depth of not only what causes cancer but also what sustains it. This literature review examines cancer as a metabolic disease. More specifically, it summarizes carbohydrate metabolism and compares and contrasts the roles of the glucose transporter, the metabolic enzymes hexokinase, pyruvate kinase, citrate synthase, succinate dehydrogenase, cytochrome c oxidase, ATP synthase, and the tumor suppressor protein p53 in normal versus cancer cells.
    [Show full text]
  • [email protected] (800)
    Product Specification Sheet Recombinant Human Hexokinase 4 (HXK-4/HK4/Glucokinase) Cat. # HXKX45-R-10 Recombinant purified human HXK-4 protein SIZE: 10 ug Hexokinase catalyzes the first step of several metabolic pathways by HK4/glucokinase Human (465 aa; protein accession # converting D-hexose to D-hexose-6-P. Hexokinase is an allosteric P35557) Recombinant was expressed in E. coli as His-tag fusion enzyme inhibited by its products glucose-6-phosphate. At least 4 protein and purified (95%). Puriifed HK3 is a single, non- related hexokinase isoforms ( HXKI-III; HXK-IV also known as glycosylated protein of ~55 kDa. Glucokinase) have been cloned and characterized. Hexokinases (~100kDa for HXK1-III; HXKIV lacks the N-terminal domains and is Recombinant human HK4/HXK4 protein is supplied in 20mM Tris, ~50 kDa) are outer mitochondrial membrane proteins. The N- pH 8.0 in 10% Glycerol at 1 mg/ml (see lot specific concn on the terminus, containing the mitochondrial target sequence, and the C- vial). Store at -20oC for long term storage. A carrier protein (BSA or terminal has high sequence homology among various isoforms. The HSA) can be adeed at 0.1% to improve long term storage. catalytic activity is associated with the C-terminus and other regulatory functions are controlled by the N-terminus. HXK4 (mouse Stability: 6-12 months at –20oC or below. 465 aa, isoforms 1) isoforms are produced by use of alternative promoters. The use of alternative promoters apparently enables the o Shipping: 4 C for solutions and room temp for powder type IV hexokinase gene to be regulated by insulin in the liver and glucose in the beta cell.
    [Show full text]
  • Proteomic and Bioinformatics Analysis of Human Saliva for the Dental-Risk
    Open Life Sci. 2017; 12: 248–265 Research Article Galina Laputková*, Mária Bencková, Michal Alexovič, Vladimíra Schwartzová, Ivan Talian, Ján Sabo Proteomic and bioinformatics analysis of human saliva for the dental-risk assessment https://doi.org/10.1515/biol-2017-0030 revealed information about potential risk factors Received June 13, 2017; accepted July 24, 2017 associated with the development of caries-susceptibility and provides a better understanding of tooth protection Abstract: Background: Dental caries disease is a dynamic mechanisms. process with a multi-factorial etiology. It is manifested by demineralization of enamel followed by damage Keywords: saliva; proteins; caries-susceptible; caries- spreading into the tooth inner structure. Successful free; proteomic analysis; bioinformatics early diagnosis could identify caries-risk and improve dental screening, providing a baseline for evaluating personalized dental treatment and prevention strategies. Methodology: Salivary proteome of the whole 1 Introduction unstimulated saliva (WUS) samples was assessed in Dental caries, resulting in demineralization of the tooth caries-free and caries-susceptible individuals of older structure, is ranked among the most prevalent chronic adolescent age with permanent dentition using a diseases of people worldwide [1-3]. Although it is not a life- nano-HPLC and MALDI-TOF/TOF mass spectrometry. threatening disorder, it still represents a serious health Results: 554 proteins in the caries-free and 695 proteins in issue with a significant effect on general health and the caries-susceptible group were identified. Assessment quality of life [4,5]. using bioinformatics tools and Gene Ontology (GO) term A complex set of interactions between acid producing enrichment analysis revealed qualitative differences bacteria and fermentable carbohydrates contribute to between these two proteomes.
    [Show full text]
  • Alternate Metabolic Programs Define Regional Variation of Relevant Biological Features in Renal Cell Carcinoma Progression
    Published OnlineFirst January 19, 2016; DOI: 10.1158/1078-0432.CCR-15-2115 Personalized Medicine and Imaging Clinical Cancer Research Alternate Metabolic Programs Define Regional Variation of Relevant Biological Features in Renal Cell Carcinoma Progression Samira A. Brooks1,2, Amir H. Khandani3,4, Julia R. Fielding3, Weili Lin3, Tiffany Sills5, Yueh Lee3, Alexandra Arreola1, Mathew I. Milowsky1,5, Eric M. Wallen1,5, Michael E. Woods3, Angie B. Smith5, Mathew E. Nielsen5, Joel S. Parker1,6, David S. Lalush4,7, and W. Kimryn Rathmell1,5,6 Abstract Purpose: Clear cell renal cell carcinoma (ccRCC) has recently microvessel density, as well as for features closely linked to been redefined as a highly heterogeneous disease. In addition to metabolic processes, such as GLUT1 and FBP1. In addition, gene genetic heterogeneity, the tumor displays risk variability for signatures linked with disease risk (ccA and ccB) also demon- developing metastatic disease, therefore underscoring the urgent strated variable heterogeneity, with most tumors displaying a need for tissue-based prognostic strategies applicable to the clin- dominant panel of features across the sampled regions. Intrigu- ical setting. We have recently employed the novel PET/magnetic ingly, the ccA- and ccB-classified samples corresponded with resonance (MR) image modality to enrich our understanding of metabolic features and functional imaging levels. These correla- how tumor heterogeneity can relate to gene expression and tumor tions further linked a variety of metabolic pathways (i.e., the biology to assist in defining individualized treatment plans. pentose phosphate and mTOR pathways) with the more aggres- Experimental Design: ccRCC patients underwent PET/MR sive, and glucose avid ccB subtype.
    [Show full text]
  • Glucokinase Intrinsically Regulates Glucose Sensing and Glucagon
    www.nature.com/scientificreports OPEN Glucokinase intrinsically regulates glucose sensing and glucagon secretion in pancreatic alpha cells Tilo Moede1*, Barbara Leibiger1, Pilar Vaca Sanchez1, Elisabetta Daré1, Martin Köhler1, Thusitha P. Muhandiramlage1, Ingo B. Leibiger1,2 & Per‑Olof Berggren1,2 The secretion of glucagon by pancreatic alpha cells is regulated by a number of external and intrinsic factors. While the electrophysiological processes linking a lowering of glucose concentrations to an increased glucagon release are well characterized, the evidence for the identity and function of the glucose sensor is still incomplete. In the present study we aimed to address two unsolved problems: (1) do individual alpha cells have the intrinsic capability to regulate glucagon secretion by glucose, and (2) is glucokinase the alpha cell glucose sensor in this scenario. Single cell RT‑PCR was used to confrm that glucokinase is the main glucose‑phosphorylating enzyme expressed in rat pancreatic alpha cells. Modulation of glucokinase activity by pharmacological activators and inhibitors led to a lowering or an increase of the glucose threshold of glucagon release from single alpha cells, measured by TIRF microscopy, respectively. Knockdown of glucokinase expression resulted in a loss of glucose control of glucagon secretion. Taken together this study provides evidence for a crucial role of glucokinase in intrinsic glucose regulation of glucagon release in rat alpha cells. Secretion of the blood glucose elevating hormone glucagon by pancreatic alpha cells increases rapidly when blood glucose concentration drops. An increase in glucagon leads to stimulation of glucose production by the liver and thereby an increase in blood glucose levels 1,2.
    [Show full text]
  • Expression of Human Glandular Kallikrein, Hk2, in Mammalian Cells
    [CANCERRESEARCH56.5397-5402.December1,1996] Expression of Human Glandular Kallikrein, hK2, in Mammalian Cells Abhay Kumar, Amita S. Goel, Timothy M. Hill, Stephen D. Mikolajczyk, Lisa S. Millar, Kristine Kuus-Reichel, and MohammadS. Saedi' Hybritech Incorporated, San Diego. California 92196-9006 ABSTRACT regulated by androgens (12—14),and share 78% an sequence homol ogy (6, 15). Because of similarities between hK2 and PSA molecules, The human kallikrein family consists of three members, hKl, hK2, and it is speculated that measuring serum concentrations of hK2 may hK3 [prostate-specific antigen (PSA)J. PSA is a widely accepted marker enhance or complement the sensitivity of the PSA test for screening, for prostate cancer. The mRNAs for both hK2 and PSA are localized staging, and monitoring of pCa and may help distinguish between pCa predominantly to prostate epithelium and are regulated by androgens. In addition, hK2 has 78% amIno acid homology to PSA. Although similari and BPH. PSA is a chymotrypsin-like protease (16—19), whereas ties to PSA make hK2 a potential prostate cancer marker, they also protein modeling studies suggest that hK2 is a trypsin-like protease impede biochemical characterization of hK2 in those human tissues and (20, 2 1). This implies that the physiological role of hK2 in prostate is body fluids where PSA is abundant. To study the expression, biosynthesis, different from PSA. The lack of knowledge regarding the biosynthesis and processing ofhK2, recombinant hK2 was expressed in the adenovirus and protein processing of hK2 has impeded the understanding of its Induced Syrian hamster tumor cell line AV12-664 (AV12-hK2).
    [Show full text]