DOCSLIB.ORG

Loss of the Transcriptional Repressor Rev-Erbα Upregulates Metabolism

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Loss of the Transcriptional Repressor Rev-Erbα Upregulates Metabolism www.nature.com/scientificreports OPEN Loss of the transcriptional repressor Rev‑erbα upregulates metabolism and proliferation in cultured mouse embryonic fbroblasts Sean P. Gillis1,3, Hongwei Yao1,3, Salu Rizal1, Hajime Maeda1, Julia Chang1 & Phyllis A. Dennery1,2* The transcriptional repressor Rev‑erbα is known to down‑regulate fatty acid metabolism and gluconeogenesis gene expression. In animal models, disruption of Rev‑erbα results in global changes in exercise performance, oxidative capacity, and blood glucose levels. However, the complete extent to which Rev‑erbα‑mediated transcriptional repression of metabolism impacts cell function remains unknown. We hypothesized that loss of Rev‑erbα in a mouse embryonic fbroblast (MEF) model would result in global changes in metabolism. MEFs lacking Rev‑erbα exhibited a hypermetabolic phenotype, demonstrating increased levels of glycolysis and oxidative phosphorylation. Rev‑erbα deletion increased expression of hexokinase II, transketolase, and ribose‑5‑phosphate isomerase genes involved in glycolysis and the pentose phosphate pathway (PPP), and these efects were not mediated by the transcriptional activator BMAL1. Upregulation of oxidative phosphorylation was not accompanied by an increase in mitochondrial biogenesis or numbers. Rev‑erbα repressed proliferation via glycolysis, but not the PPP. When treated with H2O2, cell viability was reduced in Rev‑ erbα knockout MEFs, accompanied by increased ratio of oxidized/reduced NADPH, suggesting that perturbation of the PPP reduces capacity to mount an antioxidant defense. These fndings uncover novel mechanisms by which glycolysis and the PPP are modulated through Rev‑erbα, and provide new insights into how Rev‑erbα impacts proliferation. Abbreviations 2DG 2-Deoxy-glucose Aldoc Aldolase C DMPO 5,5-Dimethyl-1-pyrroline N-oxide HO-1 Heme oxygenase 1 KO Knockout MEF Mouse embryonic fbroblast NADPH Nicotinamide adenine dinucleotide phosphate PPP Pentose phosphate pathway OT Oxythiamine Pdhb Pyruvate dehydrogenase subunit beta e1 RORE ROR response element RPIA Ribose-5-phosphate isomerase SOD2 Manganese superoxide dismutase 2 Timm23 Translocase of inner mitochondrial membrane 23 TKT Transketolase 1Department of Molecular Biology, Cellular Biology, and Biochemistry, Brown University, 185 Meeting Street, Providence, RI 02912, USA. 2Department of Pediatrics, Warren Alpert Medical School of Brown University, 593 Eddy St Suite 125, Providence, RI 02903, USA. 3These authors contributed equally: Sean P. Gillis and Hongwei Yao. *email: [email protected] Scientifc Reports | (2021) 11:12356 | https://doi.org/10.1038/s41598-021-91516-5 1 Vol.:(0123456789) www.nature.com/scientificreports/ TOMM20 Translocase of outer mitochondrial membrane 20 WT Wild type Rev-erbα is a nuclear receptor and transcriptional repressor that forms a key component of the core circadian clock. Rev-erbα represses expression of Arntl, a gene encoding the transcriptional activator BMAL1 through competition for ROR response element (RORE) binding with the transcriptional activator RORα. Tus, Rev- erbα can infuence target gene expression through direct binding of ROREs and RevDR2 motifs or through its indirect efect on BMAL1/CLOCK transcriptional activation via E-Box elements 1–5. Tis transcription-translation factor feedback loop regulates expression of a signifcant portion of the genome. Amongst the processes that are controlled by this mechanism are metabolism, the oxidative stress response, and proliferation4,6. In hepatocytes, skeletal muscle cells, and fbroblasts, Rev-erbα infuences metabolic gene expression. Changes in expression of metabolic enzymes following Rev-erbα perturbation have been shown to impact several pro- cesses such as exercise performance and glucose levels7. In excised skeletal muscle, Rev-erbα levels are directly correlated with oxidative capacity, since stabilization of Rev-erbα increases oxygen consumption 8,9. However, the extent to which Rev-erbα impacts glycolysis, and whether the efect of Rev-erbα on expression of rate limit- ing glycolytic enzymes is conserved is unclear. Additionally, while datasets detailing transcriptional targets of Rev-erbα in skeletal muscle cells, hepatocytes, and fbroblasts have been developed, there remains a need for mechanistic studies to determine whether these changes have efects on essential cellular functions 10–12. Tis study utilized a mouse embryonic fbroblast (MEF) loss or gain of function model to examine the efect of Rev-erbα disruption on global metabolism. In the absence of Rev-erbα, cells demonstrated an increase in glycolysis, oxidative phosphorylation, proliferation, and vulnerability to oxidative stress. Tese phenotypes were accompanied by specifc upregulation of genes involved in glycolysis and the non-oxidative pentose phosphate pathway (PPP). Upregulated expression of these genes may provide a mechanistic basis for increased metabolism and proliferation resulting from perturbation of Rev-erbα. Results With Rev‑erbα disruption, MEFs demonstrate increased levels of glycolysis and oxidative phosphorylation. We previously demonstrated that mouse lung fbroblasts, which expressed a stabilized phosphomimetic form Rev-erbα resistant to proteasomal degradation (SD), are more resistant to nutrient dep- rivation due to increased oxidative phosphorylation (Oxphos)13. Tus, it was hypothesized that Rev-erbα dis- ruption would manifest the reverse phenotype, namely decreased Oxphos. To test this hypothesis, we utilized immortalized Rev-erbα wild type (WT) and knockout (KO) MEFs, as evidenced by Rev-erbα gene expression (Fig. 1A). We also verifed that Rev-erbα protein levels were not detected in Rev-erbα KO MEFs (Fig. 1B). Mito- chondrial stress tests were then performed using a XF24 Seahorse Analyzer. As shown in Fig. 1C, Rev-erbα KO MEFs demonstrated an increased basal oxygen consumption rate (OCR) compared to WT cells. To examine whether increased oxidative phosphorylation resulted in a bioenergetic shif away from glycolysis, glycolysis stress tests were performed to measure extracellular acidifcation (ECAR). Surprisingly, higher levels of basal glycolysis were observed in Rev-erbα KO MEFs compared to WT cells (Fig. 1D). To confrm the latter, glycolytic rate assays were also performed to remove the confounding efect of mitochondrial acidifcation derived from CO2 on extracellular acidifcation. Results were consistent with those of the glycolytic stress test, with Rev-erbα KO MEFs demonstrating increased basal and compensatory glycolysis compared to WT (Fig. 1E). Overall, the increased Oxphos and glycolysis in the MEF KO demonstrate that upon Rev-erbα disruption, there is global metabolic activation. Rev‑erbα KO MEFs do not exhibit increased mitochondrial mass or mtDNA biogenesis. In a Rev-erbα stabilized cell line, increased oxidative phosphorylation was associated with an increase in mitochon- drial area and biogenesis13. Additional studies in skeletal muscle also indicate that Rev-erbα overexpression can increase mitochondrial biogenesis8,9. To interrogate whether increased Oxphos in the Rev-erbα KO MEFs was associated with an increase in mitochondrial mass, expression of the protein translocase of inner mitochondrial membrane 23 (Timm23) was measured. Rev-erbα KO MEFs did not exhibit increased Timm23 gene expression relative to WT (Supplemental Fig. 1A). Levels of the protein translocase of outer mitochondrial membrane 20 (TOMM20) was also unchanged following Rev-erbα disruption (Supplemental Fig. 1B). In addition, we meas- ured mitochondrial DNA copy number, and quantifed the mtDNA/nDNA ratio by qPCR. As shown in Sup- plemental Fig. 1C and D, the Ct values of 16S, ND1 and HKII as well as ratio of 16S/HKII and ND1/HKII DNA were not altered in Rev-erbα KO MEFs compared to WT cells. Tese results suggest that the hypermetabolic state of Rev-erbα KO MEFs is not due to increased mitochondrial mass. Expression of glycolytic and non‑oxidative PPP enzymes is upregulated following Rev‑erbα disruption. To elucidate whether the loss of Rev-erbα mediated transcriptional repression of specifc genes regulating glycolysis, a glycolysis gene array was performed. Tis array included genes encoding enzymes involved in glycolysis, gluconeogenesis, and the PPP (Table 1). In Rev-erbα KO MEFs two of the genes most highly upregulated relative to WT were ribose-5-phosphate isomerase (RPIA) and transketolase (TKT) of the non-oxidative PPP. Tese are involved in the production of ribose-5 phosphate needed for nucleotide synthesis and the shuttling of metabolic intermediates for glycolysis, respectively14,15. Other targets upregulated upon Rev- erbα disruption included aldolase c, an isoform in the canonical glycolysis pathway 16,17, and pyruvate dehydro- genase subunit b e1 (pdhb1), one of the genes encoding a subunit of the pyruvate dehydrogenase complex 18,19 (Table 1). Quantitative polymerase chain reaction (qPCR) verifed that Rev-erbα KO MEFs had an approxi- mately two-fold increase in each gene (i.e., RPIA, TKT and pdhb1) compared to WT (Fig. 2). Serum starvation Scientifc Reports | (2021) 11:12356 | https://doi.org/10.1038/s41598-021-91516-5 2 Vol:.(1234567890) www.nature.com/scientificreports/ Figure 1. Global metabolism is increased upon loss of Rev-erbα. (A) Rev-erbα gene expression in Rev-erbα KO and WT MEFs. n.d. denotes not detected. (B) Western blot analysis to measure Rev-erbα protein levels in WT and Rev-erbα KO MEFs. β-actin was used as a loading control. Densitometry analysis of Rev-erbα levels afer normalization
Load more

Recommended publications
  • HK3 Overexpression Associated with Epithelial-Mesenchymal Transition in Colorectal Cancer Elena A
    Pudova et al. BMC Genomics 2018, 19(Suppl 3):113 DOI 10.1186/s12864-018-4477-4 RESEARCH Open Access HK3 overexpression associated with epithelial-mesenchymal transition in colorectal cancer Elena A. Pudova1†, Anna V. Kudryavtseva1,2†, Maria S. Fedorova1, Andrew R. Zaretsky3, Dmitry S. Shcherbo3, Elena N. Lukyanova1,4, Anatoly Y. Popov5, Asiya F. Sadritdinova1, Ivan S. Abramov1, Sergey L. Kharitonov1, George S. Krasnov1, Kseniya M. Klimina4, Nadezhda V. Koroban2, Nadezhda N. Volchenko2, Kirill M. Nyushko2, Nataliya V. Melnikova1, Maria A. Chernichenko2, Dmitry V. Sidorov2, Boris Y. Alekseev2, Marina V. Kiseleva2, Andrey D. Kaprin2, Alexey A. Dmitriev1 and Anastasiya V. Snezhkina1* From Belyaev Conference Novosibirsk, Russia. 07-10 August 2017 Abstract Background: Colorectal cancer (CRC) is a common cancer worldwide. The main cause of death in CRC includes tumor progression and metastasis. At molecular level, these processes may be triggered by epithelial-mesenchymal transition (EMT) and necessitates specific alterations in cell metabolism. Although several EMT-related metabolic changes have been described in CRC, the mechanism is still poorly understood. Results: Using CrossHub software, we analyzed RNA-Seq expression profile data of CRC derived from The Cancer Genome Atlas (TCGA) project. Correlation analysis between the change in the expression of genes involved in glycolysis and EMT was performed. We obtained the set of genes with significant correlation coefficients, which included 21 EMT-related genes and a single glycolytic gene, HK3. The mRNA level of these genes was measured in 78 paired colorectal cancer samples by quantitative polymerase chain reaction (qPCR). Upregulation of HK3 and deregulation of 11 genes (COL1A1, TWIST1, NFATC1, GLIPR2, SFPR1, FLNA, GREM1, SFRP2, ZEB2, SPP1, and RARRES1) involved in EMT were found.
    [Show full text]
  • Oxidative Stress Activates SIRT2 to Deacetylate and Stimulate Phosphoglycerate Mutase
    Published OnlineFirst May 1, 2014; DOI: 10.1158/0008-5472.CAN-13-3615 Cancer Tumor and Stem Cell Biology Research Oxidative Stress Activates SIRT2 to Deacetylate and Stimulate Phosphoglycerate Mutase Yanping Xu2,3, Fulong Li2,3, Lei Lv1,2, Tingting Li2,3, Xin Zhou2,3, Chu-Xia Deng4, Kun-Liang Guan1,2,5, Qun-Ying Lei1,2, and Yue Xiong1,2,6 Abstract Glycolytic enzyme phosphoglycerate mutase (PGAM) plays an important role in coordinating energy production with generation of reducing power and the biosynthesis of nucleotide precursors and amino acids. Inhibition of PGAM by small RNAi or small molecule attenuates cell proliferation and tumor growth. PGAM activity is commonly upregulated in tumor cells, but how PGAM activity is regulated in vivo remains poorly understood. Here we report that PGAM is acetylated at lysine 100 (K100), an active site residue that is invariably conserved from bacteria, to yeast, plant, and mammals. K100 acetylation is detected in fly, mouse, and human cells and in multiple tissues and decreases PGAM2 activity. The cytosolic protein deacetylase sirtuin 2 (SIRT2) deacetylates and activates PGAM2. Increased levels of reactive oxygen species stimulate PGAM2 deacetylation and activity by promoting its interaction with SIRT2. Substitution of endogenous PGAM2 with an acetylation mimetic mutant K100Q reduces cellular NADPH production and inhibits cell proliferation and tumor growth. These results reveal a mechanism of PGAM2 regulation and NADPH homeostasis in response to oxidative stress that impacts cell proliferation and tumor growth. Cancer Res; 74(13); 1–13. Ó2014 AACR. Introduction contains two PGAM genes, PGAM1 (also known as PGAM-B), Enhanced glycolysis, commonly referred to as the "Warburg which is expressed in brain and most other tissues, and PGAM2 effect" (1), is a distinctive and prominent feature of cancer cells.
    [Show full text]
  • PIM2-Mediated Phosphorylation of Hexokinase 2 Is Critical for Tumor Growth and Paclitaxel Resistance in Breast Cancer
    Oncogene (2018) 37:5997–6009 https://doi.org/10.1038/s41388-018-0386-x ARTICLE PIM2-mediated phosphorylation of hexokinase 2 is critical for tumor growth and paclitaxel resistance in breast cancer 1 1 1 1 1 2 2 3 Tingting Yang ● Chune Ren ● Pengyun Qiao ● Xue Han ● Li Wang ● Shijun Lv ● Yonghong Sun ● Zhijun Liu ● 3 1 Yu Du ● Zhenhai Yu Received: 3 December 2017 / Revised: 30 May 2018 / Accepted: 31 May 2018 / Published online: 9 July 2018 © The Author(s) 2018. This article is published with open access Abstract Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound to HK2 and phosphorylated HK2 on Thr473. Biochemical analyses demonstrated that phosphorylated HK2 Thr473 promoted its protein stability through the chaperone-mediated autophagy (CMA) pathway, and the levels of PIM2 and pThr473-HK2 proteins were positively correlated with each other in human breast cancer. Furthermore, phosphorylation of HK2 on Thr473 increased HK2 enzyme activity and glycolysis, and 1234567890();,: 1234567890();,: enhanced glucose starvation-induced autophagy. As a result, phosphorylated HK2 Thr473 promoted breast cancer cell growth in vitro and in vivo. Interestingly, PIM2 kinase inhibitor SMI-4a could abrogate the effects of phosphorylated HK2 Thr473 on paclitaxel resistance in vitro and in vivo. Taken together, our findings indicated that PIM2 was a novel regulator of HK2, and suggested a new strategy to treat breast cancer. Introduction ATP molecules.
    [Show full text]
  • Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis
    biology Review Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis Batoul Abi Zamer 1,2 , Wafaa Abumustafa 1,2, Mawieh Hamad 2,3 , Azzam A. Maghazachi 2,4 and Jibran Sualeh Muhammad 1,2,* 1 Department of Basic Medical Sciences, College of Medicine, University of Sharjah, Sharjah 27272, United Arab Emirates; [email protected] (B.A.Z.); [email protected] (W.A.) 2 Sharjah Institute for Medical Research, University of Sharjah, Sharjah 27272, United Arab Emirates; [email protected] (M.H.); [email protected] (A.A.M.) 3 Department of Medical Laboratory Sciences, College of Health Sciences, University of Sharjah, Sharjah 27272, United Arab Emirates 4 Department of Clinical Sciences, College of Medicine, University of Sharjah, Sharjah 27272, United Arab Emirates * Correspondence: [email protected]; Tel.: +971-6-5057293 Simple Summary: Colorectal cancer is one of the most leading causes of death worldwide. The Hallmark of colorectal cancer is the increase of glucose uptake and lactate production even in the presence of oxygen, a phenomenon known as the “Warburg effect”. This review summarizes the genetic mutations and epigenetic alterations, focusing on non-coding RNA associated with the oncogenes, tumor suppresser genes, and enzymes involved in the “Warburg effect”, in addition to Citation: Abi Zamer, B.; Abumustafa, their clinical impacts on colorectal cancer. This knowledge may open the door for novel therapeutic W.; Hamad, M.; Maghazachi, A.A.; approaches to target colorectal cancer. Muhammad, J.S. Genetic Mutations and Non-Coding RNA-Based Abstract: Colorectal cancer (CRC) development is a gradual process defined by the accumulation of Epigenetic Alterations Mediating the numerous genetic mutations and epigenetic alterations leading to the adenoma-carcinoma sequence.
    [Show full text]
  • Phosphoglycerate Mutase Deficiency
    Phosphoglycerate mutase deficiency Description Phosphoglycerate mutase deficiency is a disorder that primarily affects muscles used for movement (skeletal muscles). Beginning in childhood or adolescence, affected individuals experience muscle aches or cramping following strenuous physical activity. Some people with this condition also have recurrent episodes of myoglobinuria. Myoglobinuria occurs when muscle tissue breaks down abnormally and releases a protein called myoglobin, which is processed by the kidneys and released in the urine. If untreated, myoglobinuria can lead to kidney failure. In some cases of phosphoglycerate mutase deficiency, microscopic tube-shaped structures called tubular aggregates are seen in muscle fibers. It is unclear how tubular aggregates are associated with the signs and symptoms of the disorder. Frequency Phosphoglycerate mutase deficiency is a rare condition; about 15 affected people have been reported in the medical literature. Most affected individuals have been African American. Causes Phosphoglycerate mutase deficiency is caused by mutations in the PGAM2 gene. This gene provides instructions for making an enzyme called phosphoglycerate mutase, which is involved in a critical energy-producing process in cells known as glycolysis. During glycolysis, the simple sugar glucose is broken down to produce energy. The version of phosphoglycerate mutase produced from the PGAM2 gene is found primarily in skeletal muscle cells. Mutations in the PGAM2 gene greatly reduce the activity of phosphoglycerate mutase, which disrupts energy production in these cells. This defect underlies the muscle cramping and myoglobinuria that occur after strenuous exercise in affected individuals. Learn more about the gene associated with Phosphoglycerate mutase deficiency • PGAM2 Reprinted from MedlinePlus Genetics (https://medlineplus.gov/genetics/) 1 I nheritance This condition is inherited in an autosomal recessive pattern, which means both copies of the PGAM2 gene in each cell have mutations.
    [Show full text]
  • Glycolysis Supports Embryonic Muscle Growth by Promoting Myoblast Fusion
    Glycolysis supports embryonic muscle growth by promoting myoblast fusion Vanessa Tixiera, Laetitia Batailléa,1,2, Christelle Etardb,1, Teresa Jaglaa, Meltem Wegerb, Jean Philippe DaPontea, Uwe Strähleb, Thomas Dickmeisb, and Krzysztof Jaglaa,3 aUnité de Génétique, Reproduction et Développement, Institut National de la Santé et de la Recherche Médicale U1103, Centre National de la Recherche Scientifique Unité Mixte de Recherche 6293, University of Clermont-Ferrand, 63001 Clermont-Ferrand, France; and bInstitute of Toxicology and Genetics, Karlsruhe Institute of Technology, 76344 Eggenstein-Leopoldshafen, Germany Edited* by Margaret Buckingham, Pasteur Institute, Paris, France, and approved October 17, 2013 (received for review January 19, 2013) Muscles ensure locomotion behavior of invertebrate and verte- evidence that glycolytic genes are part of a metabolic switch that brate organisms. They are highly specialized and form using con- supports rapid developmental growth of Drosophila larvae. It served developmental programs. To identify new players in mus- is well known that a shift to aerobic glycolysis, known as the cle development we screened Drosophila and zebrafish gene Warburg effect, is commonly used by cancer cells (6), but also by expression databases for orthologous genes expressed in embry- rapidly proliferating normal cells (7, 8), to efficiently divert gly- onic muscles. We selected more than 100 candidates. Among them colytic intermediates (9) to the synthesis of the macromolecules is the glycolysis gene Pglym78/pgam2, the attenuated expression needed for cell growth. Glycolysis might, therefore, contribute of which results in the formation of thinner muscles in Drosophila to developmental processes characterized by bursts in cell pro- embryos. This phenotype is also observed in fast muscle fibers of liferation and/or by rapid growth.
    [Show full text]
  • Molecular Diagnosis of Glycogen Storage Disease and Disorders with Overlapping Clinical Symptoms by Massive Parallel Sequencing
    © American College of Medical Genetics and Genomics ORIGINAL RESEARCH ARTICLE Molecular diagnosis of glycogen storage disease and disorders with overlapping clinical symptoms by massive parallel sequencing Ana I Vega, PhD1,2,3, Celia Medrano, BSc1,2,3, Rosa Navarrete, BSc1,2,3, Lourdes R Desviat, PhD1,2,3, Begoña Merinero, PhD1,2,3, Pilar Rodríguez-Pombo, PhD1,2,3, Isidro Vitoria, MD, PhD4, Magdalena Ugarte, PhD1,2,3, Celia Pérez-Cerdá, PhD1,2,3 and Belen Pérez, PhD1,2,3 Purpose: Glycogen storage disease (GSD) is an umbrella term for a Results: Pathogenic mutations were detected in 23 patients. group of genetic disorders that involve the abnormal metabolism of ­Twenty-two mutations were recognized (mostly loss-of-function glycogen; to date, 23 types of GSD have been identified. The nonspe- mutations), including 11 that were novel in GSD-associated genes. In cific clinical presentation of GSD and the lack of specific biomarkers addition, CES detected five patients with mutations in ALDOB, LIPA, mean that Sanger sequencing is now widely relied on for making a NKX2-5, CPT2, or ANO5. Although these genes are not involved in diagnosis. However, this gene-by-gene sequencing technique is both GSD, they are associated with overlapping phenotypic characteristics laborious and costly, which is a consequence of the number of genes such as hepatic, muscular, and cardiac dysfunction. to be sequenced and the large size of some genes. Conclusions: These results show that next-generation sequenc- ing, in combination with the detection of biochemical and clinical Methods: This work reports the use of massive parallel sequencing hallmarks, provides an accurate, high-throughput means of making to diagnose patients at our laboratory in Spain using either a cus- genetic diagnoses of GSD and related diseases.
    [Show full text]
  • Regulation of the C/Ebpα Signaling Pathway in Acute Myeloid Leukemia (Review)
    ONCOLOGY REPORTS 33: 2099-2106, 2015 Regulation of the C/EBPα signaling pathway in acute myeloid leukemia (Review) GUANHUA SONG1, LIn Wang2, Kehong BI3 and guosheng JIang1 1Department of hemato-oncology, Institute of Basic Medicine, shandong academy of Medical sciences, Key Laboratory for Modern Medicine and Technology of Shandong Province, Key Laboratory for Rare and Uncommon Diseases, Key Medical Laboratory for Tumor Immunology and Traditional Chinese Medicine Immunology of shandong Province, Jinan, Shandong 250062; 2Research Center for Medical Biotechnology, Shandong Academy of Medical Sciences, Jinan, Shandong 250062; 3Department of Hematology, Qianfoshan Mountain Hospital of Shandong University, Jinan, Shandong 250014, P.R. China Received December 2, 2014; Accepted January 26, 2015 DoI: 10.3892/or.2015.3848 Abstract. The transcription factor CCAAT/enhancer binding Contents protein α (C/EBPα), as a critical regulator of myeloid devel- opment, directs granulocyte and monocyte differentiation. 1. Introduction Various mechanisms have been identified to explain how 2. Function of C/EBPα in myeloid differentiation C/EBPα functions in patients with acute myeloid leukemia 3. Regulation of the C/EBPα signaling pathway (AML). C/EBPα expression is suppressed as a result of 4. Conclusion common leukemia-associated genetic and epigenetic altera- tions such as AML1-ETO, RARα-PLZF or gene promoter methylation. Recent data have shown that ubiquitination modi- 1. Introduction fication also contributes to its downregulation. In addition, 10-15% of patients with AML in an intermediate cytogenetic Acute myeloid leukemia (AML) is characterized by uncon- risk subgroup were characterized by mutations of the C/EBPα trolled proliferation of myeloid progenitors that exhibit a gene.
    [Show full text]
  • Reducing FASN Expression Sensitizes Acute Myeloid Leukemia Cells to Differentiation Therapy Magali Humbert , Kristina Seiler
    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.29.924555; this version posted July 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reducing FASN expression sensitizes acute myeloid leukemia cells to differentiation therapy Magali Humbert1,2,#, Kristina Seiler1,3, Severin Mosimann1, Vreni Rentsch1, Sharon L. McKenna2,4, Mario P. Tschan1,2,3 1Institute of Pathology, Division of Experimental Pathology, University of Bern, Bern, Switzerland 2TRANSAUTOPHAGY: European network for multidisciplinary research and translation of autophagy knowledge, COST Action CA15138 3Graduate School for Cellular and Biomedical Sciences, University of Bern, Bern, Switzerland, 4Cancer Research, UCC, Western Gateway Building, University College Cork, Cork, Ireland. #Corresponding Author: Magali Humbert, Institute of Pathology, Division of Experimental Pathology, University of Bern, Murtenstrasse 31, CH-3008 Bern, Switzerland, E-mail: [email protected], Tel: +41 31 632 8788 Running Title: FASN impairs TFEB activity in AML Key words: FASN/AML/ATRA/TFEB/mTOR/autophagy bioRxiv preprint doi: https://doi.org/10.1101/2020.01.29.924555; this version posted July 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Fatty acid synthase (FASN) is the only human lipogenic enzyme available for de novo fatty acid synthesis and is often highly expressed in cancer cells.
    [Show full text]
  • (HK3) (NM 002115) Human Tagged ORF Clone – RC207021
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC207021 Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HK3 Synonyms: HKIII; HXK3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone – RC207021 ORF Nucleotide >RC207021 representing NM_002115 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCCATTGGGTCTTCAGGGTTGCGGCAGGGGGAAGAAACCCTGAGTTGCTCTGAGGAGGGCTTGC CCGGGCCCTCAGACAGCTCAGAGCTGGTGCAGGAGTGCCTGCAGCAGTTCAAGGTGACAAGGGCACAGCT ACAGCAGATCCAAGCCAGCCTCTTGGGTTCCATGGAGCAGGCGCTGAGGGGACAGGCCAGCCCTGCCCCT GCGGTCCGGATGCTGCCTACATACGTGGGGTCCACCCCACATGGCACTGAGCAAGGAGACTTCGTGGTGC TGGAGCTGGGGGCCACAGGGGCCTCACTGCGTGTTTTGTGGGTGACTCTAACTGGCATTGAGGGGCATAG GGTGGAGCCCAGAAGCCAGGAGTTTGTGATCCCCCAAGAGGTGATGCTGGGTGCTGGCCAGCAGCTCTTT GACTTTGCTGCCCACTGCCTGTCTGAGTTCCTGGATGCGCAGCCTGTGAACAAACAGGGTCTGCAGCTTG GCTTCAGCTTCTCTTTCCCTTGTCACCAGACGGGCTTGGACAGGAGCACCCTCATTTCCTGGACCAAAGG
    [Show full text]
  • Insulin/IGF1-PI3K-Dependent Nucleolar Localization of a Glycolytic
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 19 Insulin/IGF1-PI3K-dependent nucleolar localization of a glycolytic enzyme – phosphoglycerate mutase 2, is necessary for proper structure of nucleolus and RNA synthesis Agnieszka Gizak1, Marcin Grenda1, Piotr Mamczur1, Janusz Wisniewski1, Filip Sucharski2, Jerzy Silberring2, James A. McCubrey3, Jacek R. Wisniewski4 and Dariusz Rakus1 1 Department of Animal Molecular Physiology, Wroclaw University, Cybulskiego, Wroclaw, Poland 2 Department of Biochemistry and Neurobiology, Faculty of Materials Science and Ceramics, AGH University of Science and Technology, al. Mickiewicza, Kraków, Poland 3 Department of Microbiology and Immunology, Brody School of Medicine at East Carolina University Greenville, NC, USA 4 Biochemical Proteomics Group, Department of Proteomics and Signal Transduction, Max-Planck-Institute of Biochemistry, Am Klopferspitz, Martinsried, Germany Correspondence to: Agnieszka Gizak, email: [email protected] Keywords: squamous cell carcinoma, PGAM2, rRNA, ribosome assembly, multifunctional enzyme Received: February 25, 2015 Accepted: April 30, 2015 Published: May 08, 2015 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Phosphoglycerate mutase (PGAM), a conserved, glycolytic enzyme has been found in nucleoli of cancer cells. Here, we present evidence that accumulation of PGAM in the nucleolus is a universal phenomenon concerning not only neoplastically transformed but also non-malignant cells. Nucleolar localization of the enzyme is dependent on the presence of the PGAM2 (muscle) subunit and is regulated by insulin/ IGF-1–PI3K signaling pathway as well as drugs influencing ribosomal biogenesis.
    [Show full text]
  • Figure S1. GO Analysis of Genes in Glioblastoma Cases That Showed Positive and Negative Correlations with TCIRG1 in the GSE16011 Cohort
    Figure S1. GO analysis of genes in glioblastoma cases that showed positive and negative correlations with TCIRG1 in the GSE16011 cohort. (A‑C) GO‑BP, GO‑CC and GO‑MF terms of genes that showed positive correlations with TCIRG1, respec‑ tively. (D‑F) GO‑BP, GO‑CC and GO‑MF terms of genes that showed negative correlations with TCIRG1. Red nodes represent gene counts, and black bars represent negative 1og10 P‑values. TCIRG1, T cell immune regulator 1; GO, Gene Ontology; BP, biological process; CC, cellular component; MF, molecular function. Table SI. Genes correlated with T cell immune regulator 1. Gene Name Pearson's r ARPC1B Actin‑related protein 2/3 complex subunit 1B 0.756 IL4R Interleukin 4 receptor 0.695 PLAUR Plasminogen activator, urokinase receptor 0.693 IFI30 IFI30, lysosomal thiol reductase 0.675 TNFAIP3 TNF α‑induced protein 3 0.675 RBM47 RNA binding motif protein 47 0.666 TYMP Thymidine phosphorylase 0.665 CEBPB CCAAT/enhancer binding protein β 0.663 MVP Major vault protein 0.660 BCL3 B‑cell CLL/lymphoma 3 0.657 LILRB3 Leukocyte immunoglobulin‑like receptor B3 0.656 ELF4 E74 like ETS transcription factor 4 0.652 ITGA5 Integrin subunit α 5 0.651 SLAMF8 SLAM family member 8 0.647 PTPN6 Protein tyrosine phosphatase, non‑receptor type 6 0.641 RAB27A RAB27A, member RAS oncogene family 0.64 S100A11 S100 calcium binding protein A11 0.639 CAST Calpastatin 0.638 EHBP1L1 EH domain‑binding protein 1‑like 1 0.638 LILRB2 Leukocyte immunoglobulin‑like receptor B2 0.629 ALDH3B1 Aldehyde dehydrogenase 3 family member B1 0.626 GNA15 G protein
    [Show full text]