Regulation of the C/Ebpα Signaling Pathway in Acute Myeloid Leukemia (Review)

Total Page:16

File Type:pdf, Size:1020Kb

Load more

ONCOLOGY REPORTS 33: 2099-2106, 2015 Regulation of the C/EBPα signaling pathway in acute myeloid leukemia (Review) GUANHUA SONG1, LIn Wang2, Kehong BI3 and guosheng JIang1 1Department of hemato-oncology, Institute of Basic Medicine, shandong academy of Medical sciences, Key Laboratory for Modern Medicine and Technology of Shandong Province, Key Laboratory for Rare and Uncommon Diseases, Key Medical Laboratory for Tumor Immunology and Traditional Chinese Medicine Immunology of shandong Province, Jinan, Shandong 250062; 2Research Center for Medical Biotechnology, Shandong Academy of Medical Sciences, Jinan, Shandong 250062; 3Department of Hematology, Qianfoshan Mountain Hospital of Shandong University, Jinan, Shandong 250014, P.R. China Received December 2, 2014; Accepted January 26, 2015 DoI: 10.3892/or.2015.3848 Abstract. The transcription factor CCAAT/enhancer binding Contents protein α (C/EBPα), as a critical regulator of myeloid devel- opment, directs granulocyte and monocyte differentiation. 1. Introduction Various mechanisms have been identified to explain how 2. Function of C/EBPα in myeloid differentiation C/EBPα functions in patients with acute myeloid leukemia 3. Regulation of the C/EBPα signaling pathway (AML). C/EBPα expression is suppressed as a result of 4. Conclusion common leukemia-associated genetic and epigenetic altera- tions such as AML1-ETO, RARα-PLZF or gene promoter methylation. Recent data have shown that ubiquitination modi- 1. Introduction fication also contributes to its downregulation. In addition, 10-15% of patients with AML in an intermediate cytogenetic Acute myeloid leukemia (AML) is characterized by uncon- risk subgroup were characterized by mutations of the C/EBPα trolled proliferation of myeloid progenitors that exhibit a gene. As a transcription factor, C/EBPα can translocate into severe block in their ability to differentiate into mature the nucleus and further regulate a variety of genes directly or granulocytes or macrophages (1). The transcription factor indirectly, which are all key factors for cell differentiation. This CCAAT/enhancer binding protein α (C/EBPα) is a lineage- review summarizes recent reports concerning the dysregula- specific transcription factor in the hematopoietic system and is tion of C/EBPα expression at various levels in human AML. required for the formation of committed myeloid progenitors The currently available data are persuasive evidence suggesting from multipotent precursor cells by coupling the direct tran- that impaired abnormal C/EBPα expression contributes to the scriptional activation of myeloid-specific genes with the arrest development of AML, and restoration of C/EBPα expression of cell proliferation (2). as well as its function represents a promising target for novel C/EBPα is specifically expressed in granulocytes, therapeutic strategies in AML. monocytes and eosinophils (3), although it is also found in hepatocytes, adipocytes and type II pneumocytes (4). Previous studies have illustrated the function of C/EBPα in hematopoiesis by promoting granulocyte and monocyte differ- entiation (2,5,6). Studies have eported that C/EBPα expression is detectable at a low level in the hematopoietic stem cell (HSC) Correspondence to: Dr Kehong Bi, Department of Hematology, population, and its expression increases as these cells develop Qianfoshan Mountain Hospital of Shandong University, Jingshi into the common myeloid progenitor (CMP) and subsequently Road, Jinan, Shandong 250014, P.R. China the granulocyte-monocyte progenitor (GMP), while condi- E-mail: [email protected] tional C/EBPα deficiency in adult mice blocked the transition from CMP to GMP, resulting in reduced formation of both Dr guosheng Jiang, Department of hemato-oncology, Institute of Basic Medicine, Shandong Academy of Medical Sciences, 18877 granulocytes and monocytes (7). Non-conditional targeted Jingshi Road, Jinan, Shandong 250062, P.R. China disruption of C/EBPα was found to result in a selective block E-mail: [email protected] in early granulocyte maturation, and these mice died at birth due to severe hypoglycemia (8). Moreover, knock-in mice Key words: C/EBPα, leukemia, differentiation, granulocyte, with a targeted mutation in the C/EBPα basic region, which monocyte led to its dysfunction, predisposed the mice to a myelopro- liferative disorder (9). However, when expressed in 32Dcl3 2100 song et al: REGULaTION oF C/eBPα In aCuTe MYeLoID LEUKeMIa Figure 1. Structure of the two isoforms of C/EBPα. C/EBPα, CCAAT/enhancer binding protein α. cells, representative of granulocytic progenitors, exogenous studies have reported that C/EBPα heterodimerizes with AP-1 C/EBPα promoted granulopoiesis (10). These studies suggest proteins (C/EBPα:c-Jun or C/EBPα:-c-Fos) for preference in that C/EBPα is a critical regulator of myeloid development. In directing monopoiesis (17), whereas C/EBPα homodimers fact, growing evidence suggests that the function of C/EBPα is cooperate with NF-κB p50 to promote granulopoiesis (18). critically altered in subsets of AML patients based on various Regulation of macrophage and neutrophil cell fates may also factors. be altered by the relative PU.1:C/EBPα ratio (19). In this review, we summarized the fundamental role of C/EBPα in myeloid differentiation and the recently identified 3. Regulation of the C/EBPα signaling pathway mechanisms of its activity. As a critical factor involved in myeloid differentiation, the 2. Function of C/EBPα in myeloid differentiation function of C/EBPα must be tightly regulated to maintain the differentiation homeostasis. Detailed study of the regulation of C/EBPα is a member of the basic leucine zipper (bZIP) C/EBPα could also highlight the understanding of the patho- transcription factor family, of which several members are logical mechanisms of AML. also expressed in the myeloid lineage (e.g., C/EBPβ and C/EBPε) (2). In mammals, C/eBPα is a lineage-specific tran- Regulators targeting C/EBPα in myeloid differentiation and scription factor that is required for the formation of committed leukemogenesis. Many researches have focused on the factors myeloid progenitors from multipotent precursor cells. The regulating C/EBPα expression and its functions in leukemic C/EBPα molecule contains transactivation domains (TADs) diseases from different aspects, such as transcriptional at its n-terminus and a DNA-binding and dimerization bZIP repression by fusion genes, ubiquitination modification and structure at its C-terminus. Furthermore, C/EBPα is an intron- epigenetic regulation. less gene whose mRNA can be translated from two different Among the variant translocations in AML, the t(11:17) AUG codons giving rise to two distinct isoforms (p42 and p30). translocation is the most frequent, and renders resistance to p30 lacks two N-terminal transactivation domains that are all-trans retinoic acid (ATRA) treatment (20). After transloca- only present on p42 (11) (Fig. 1). Unless otherwise indicated, tion, RARα is fused to PLZF to produce two fusion proteins, C/EBPα represents the p42 isoform in the present review. promyelocytic eukemia zinc finger-retinoic acid receptor α To date, numerous studies have been reported regarding (PLZF-RARα) and RARα-PLZF, both of which participate the function of C/EBPα in AML. Firstly, genomic mutations in leukemia development (21). Among them, RARα-PLZF have been detected in the C/EBPα gene in ~5-14% of AML recruits HDAC1 and causes histone H3 deacetylation at patients (12,13). Among these mutations, N-terminal frame- C/EBPα target loci, thereby decreasing the expression of shift mutations prematurely truncate the full-length p42 form C/EBPα (Fig. 2). In line with this result, hDaC inhibitors were while preserving the p30 form, with the latter inhibiting the found to restore C/EBPα expression to a modest extent (22). remaining wild-type C/EBPα p42 protein in a dominant-nega- In addition to RaRα-PLZF, C/EBPα expression could also be tive manner (12). In addition, C-terminal in-frame insertions downregulated through direct transcriptional repression by the or deletions were found to disrupt the basic zipper region, thus fusion oncoprotein aML1-eTo (23). These findings provide critically affecting DNA binding (12,14), which was further molecular evidence for a mechanism through which fusion illustrated by reports that the critical basic region residues of proteins act as modifier oncogenes that subvert differentia- the C/EBPα protein-DNA interaction were identified by an tion in the granulocytic lineage by inhibiting the activity of X-ray structure assay (14). Although there is a predominant C/EBPα. C/EBPα mutation pattern in AML patients, the majority of epigenic modification is envisioned as an important epigen- AML patients always have more than one C/EBPα muta- etic mechanism that regulates the expression of myeloid-specific tion (13,15). In addition, reduced expression could disrupt the genes in the hematopoietic system during leukemogenesis (24). function of C/EBPα for normal hematopoiesis (16). A detailed Hypermethylation of the C/EBPα promoter was first reported study showed that deletion of the C/EBPα gene led to arrest at preferentially in AML-M2 patients (25). The methylation the CMP to GMP transition, thereby causing reduced forma- status of the C/EBPα gene in chronic myeloid leukemia (CML) tion of both granulocytes and monocytes (7). In addition, patients was also investigated, and the data suggested that ONCOLOGY REPORTS 33: 2099-2106, 2015 2101 for tumorigenesis. Notably, during this process, COP1, which contains
Recommended publications
  • HK3 Overexpression Associated with Epithelial-Mesenchymal Transition in Colorectal Cancer Elena A

    HK3 Overexpression Associated with Epithelial-Mesenchymal Transition in Colorectal Cancer Elena A

    Pudova et al. BMC Genomics 2018, 19(Suppl 3):113 DOI 10.1186/s12864-018-4477-4 RESEARCH Open Access HK3 overexpression associated with epithelial-mesenchymal transition in colorectal cancer Elena A. Pudova1†, Anna V. Kudryavtseva1,2†, Maria S. Fedorova1, Andrew R. Zaretsky3, Dmitry S. Shcherbo3, Elena N. Lukyanova1,4, Anatoly Y. Popov5, Asiya F. Sadritdinova1, Ivan S. Abramov1, Sergey L. Kharitonov1, George S. Krasnov1, Kseniya M. Klimina4, Nadezhda V. Koroban2, Nadezhda N. Volchenko2, Kirill M. Nyushko2, Nataliya V. Melnikova1, Maria A. Chernichenko2, Dmitry V. Sidorov2, Boris Y. Alekseev2, Marina V. Kiseleva2, Andrey D. Kaprin2, Alexey A. Dmitriev1 and Anastasiya V. Snezhkina1* From Belyaev Conference Novosibirsk, Russia. 07-10 August 2017 Abstract Background: Colorectal cancer (CRC) is a common cancer worldwide. The main cause of death in CRC includes tumor progression and metastasis. At molecular level, these processes may be triggered by epithelial-mesenchymal transition (EMT) and necessitates specific alterations in cell metabolism. Although several EMT-related metabolic changes have been described in CRC, the mechanism is still poorly understood. Results: Using CrossHub software, we analyzed RNA-Seq expression profile data of CRC derived from The Cancer Genome Atlas (TCGA) project. Correlation analysis between the change in the expression of genes involved in glycolysis and EMT was performed. We obtained the set of genes with significant correlation coefficients, which included 21 EMT-related genes and a single glycolytic gene, HK3. The mRNA level of these genes was measured in 78 paired colorectal cancer samples by quantitative polymerase chain reaction (qPCR). Upregulation of HK3 and deregulation of 11 genes (COL1A1, TWIST1, NFATC1, GLIPR2, SFPR1, FLNA, GREM1, SFRP2, ZEB2, SPP1, and RARRES1) involved in EMT were found.
  • PIM2-Mediated Phosphorylation of Hexokinase 2 Is Critical for Tumor Growth and Paclitaxel Resistance in Breast Cancer

    PIM2-Mediated Phosphorylation of Hexokinase 2 Is Critical for Tumor Growth and Paclitaxel Resistance in Breast Cancer

    Oncogene (2018) 37:5997–6009 https://doi.org/10.1038/s41388-018-0386-x ARTICLE PIM2-mediated phosphorylation of hexokinase 2 is critical for tumor growth and paclitaxel resistance in breast cancer 1 1 1 1 1 2 2 3 Tingting Yang ● Chune Ren ● Pengyun Qiao ● Xue Han ● Li Wang ● Shijun Lv ● Yonghong Sun ● Zhijun Liu ● 3 1 Yu Du ● Zhenhai Yu Received: 3 December 2017 / Revised: 30 May 2018 / Accepted: 31 May 2018 / Published online: 9 July 2018 © The Author(s) 2018. This article is published with open access Abstract Hexokinase-II (HK2) is a key enzyme involved in glycolysis, which is required for breast cancer progression. However, the underlying post-translational mechanisms of HK2 activity are poorly understood. Here, we showed that Proviral Insertion in Murine Lymphomas 2 (PIM2) directly bound to HK2 and phosphorylated HK2 on Thr473. Biochemical analyses demonstrated that phosphorylated HK2 Thr473 promoted its protein stability through the chaperone-mediated autophagy (CMA) pathway, and the levels of PIM2 and pThr473-HK2 proteins were positively correlated with each other in human breast cancer. Furthermore, phosphorylation of HK2 on Thr473 increased HK2 enzyme activity and glycolysis, and 1234567890();,: 1234567890();,: enhanced glucose starvation-induced autophagy. As a result, phosphorylated HK2 Thr473 promoted breast cancer cell growth in vitro and in vivo. Interestingly, PIM2 kinase inhibitor SMI-4a could abrogate the effects of phosphorylated HK2 Thr473 on paclitaxel resistance in vitro and in vivo. Taken together, our findings indicated that PIM2 was a novel regulator of HK2, and suggested a new strategy to treat breast cancer. Introduction ATP molecules.
  • C/Ebpα Is an Essential Collaborator in Hoxa9/Meis1-Mediated Leukemogenesis

    C/Ebpα Is an Essential Collaborator in Hoxa9/Meis1-Mediated Leukemogenesis

    C/EBPα is an essential collaborator in Hoxa9/Meis1-mediated leukemogenesis Cailin Collinsa, Jingya Wanga, Hongzhi Miaoa, Joel Bronsteina, Humaira Nawera, Tao Xua, Maria Figueroaa, Andrew G. Munteana, and Jay L. Hessa,b,1 aDepartment of Pathology, University of Michigan, Ann Arbor, MI 48109; and bIndiana University School of Medicine, Indianapolis, IN 46202 Edited* by Louis M. Staudt, National Institutes of Health, Bethesda, MD, and approved May 19, 2014 (received for review February 12, 2014) Homeobox A9 (HOXA9) is a homeodomain-containing transcrip- with Hoxa9. In addition, C/EBP recognition motifs are enriched tion factor that plays a key role in hematopoietic stem cell expan- at Hoxa9 binding sites. sion and is commonly deregulated in human acute leukemias. A C/EBPα is a basic leucine-zipper transcription factor that plays variety of upstream genetic alterations in acute myeloid leukemia a critical role in lineage commitment during hematopoietic dif- −/− (AML) lead to overexpression of HOXA9, almost always in associ- ferentiation (18). Whereas Cebpa mice show complete loss of ation with overexpression of its cofactor meis homeobox 1 (MEIS1). the granulocytic compartment, recent work shows that loss of α A wide range of data suggests that HOXA9 and MEIS1 play a syn- C/EBP in adult HSCs leads to both an increase in the number ergistic causative role in AML, although the molecular mechanisms of functional HSCs and an increase in their proliferative and leading to transformation by HOXA9 and MEIS1 remain elusive. In repopulating capacity (19, 20). Conversely, CEBPA overexpression can promote transdifferentiation of a variety of fibroblastic cells to this study, we identify CCAAT/enhancer binding protein alpha (C/ the myeloid lineage and can induce monocytic differentiation in EBPα) as a critical collaborator required for Hoxa9/Meis1-mediated α MLL-fusion protein-mediated leukemias (21, 22).
  • Test Summary Flyer-NGS Panels.Pub

    Test Summary Flyer-NGS Panels.Pub

    Cancer‐related Mutaon Analysis Next Generaon Gene Sequencing for Myeloid Tesng Assay Summary IU Health Molecular Pathology Laboratory now offers high throughput sequencing for hot spot mutations found in clinically relevant cancer genes. In addition to a general panel of 54 genes, selected panels have been developed for a more tai- lored application in specific cancers. Comparing to single gene assay, these panels offer a more comprehensive and eco- nomic way to assess prognosis and/or treatment options for cancer patients at the initial diagnosis or at the relapse. Orderable Name: Use IU Health Molecular Pathology requisition; Call 317.491.6417 for requisition. Panels include: AML Mutations by NGS ASXL1, CEBPA, DNMT3A, ETV6/TEL, FLT3, HRAS, IDH1, IDH2, KIT, KRAS, MLL, NPM1, NRAS, PHF6, RUNX1, TET2, TP53, WT1 MDS Mutations by NGS ASXL1, ATRX, BCOR, BCORL1, ETV6/TEL, DNMT3A, EZH2, GNAS, IDH1, IDH2, RUNX1, SF3B1, SRSF2, TET2, TP53, U2AF1, ZRSR2 CML Mutations by NGS ABL1 MPN Mutations by NGS ASXL1, BRAF, CALR, CSF3R, EZH2, IKZF1, JAK2, JAK3, KDM6A, KIT, MPL, PDGRA, SETBP1, TET2 CMML Mutations by NGS ASXL1, CBL, CBLB, CBLC, EZH2, RUNX1, TET2, TP53, SRSF2 JMML Mutations by NGS CBL, CBLB, CBLC, HRAS, KRAS, NRAS, PTPN11 ALL Mutations by NGS ABL1, CSF3R, FBXW7, IKZF1, JAK3, KDM6A, NOTCH1 CLL Mutations by NGS MYD88, NOTCH1, SF3B1, TP53 Lymphoma/Myeloma Mutations by NGS BRAF, CDKN2A, CSF3R, FBXW7, HRAS, KRAS, MYD88, NOTCH1, NRAS, SF3B1,TP53 Hematopoietic Neoplasms Mutations by NGS ABL1, ASXL1, ATRX, BCOR, BCORL1, BRAF, CALR, CBL, CBLB, CBLC,CDKN2A, CEBPA, CSF3R, CUX1, DNMT3A, ETV6/TEL, EZH2, FBXW7, FLT3, GATA1, GATA2, GNAS, HRAS, IDH1, IDH2, IKZF1,JAK2, JAK3, KDM6A, KIT, KRAS, MLL, MPL, MYD88, NOTCH1, NPM1, NRAS, PDGFRA, PHF6, PTEN, PTPN11, RAD21, RUNX1,SETBP1, SF3B1, SMC1A, SMC3, SRSF2, STAG2, TET2, TP53, U2AF1, WT1, ZRSR2 Clinical Utility: This test is useful for the assessment of prognosis and/or treatment options for cancer patients at the initial diagnosis or at the relapse.
  • Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis

    Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis

    biology Review Genetic Mutations and Non-Coding RNA-Based Epigenetic Alterations Mediating the Warburg Effect in Colorectal Carcinogenesis Batoul Abi Zamer 1,2 , Wafaa Abumustafa 1,2, Mawieh Hamad 2,3 , Azzam A. Maghazachi 2,4 and Jibran Sualeh Muhammad 1,2,* 1 Department of Basic Medical Sciences, College of Medicine, University of Sharjah, Sharjah 27272, United Arab Emirates; [email protected] (B.A.Z.); [email protected] (W.A.) 2 Sharjah Institute for Medical Research, University of Sharjah, Sharjah 27272, United Arab Emirates; [email protected] (M.H.); [email protected] (A.A.M.) 3 Department of Medical Laboratory Sciences, College of Health Sciences, University of Sharjah, Sharjah 27272, United Arab Emirates 4 Department of Clinical Sciences, College of Medicine, University of Sharjah, Sharjah 27272, United Arab Emirates * Correspondence: [email protected]; Tel.: +971-6-5057293 Simple Summary: Colorectal cancer is one of the most leading causes of death worldwide. The Hallmark of colorectal cancer is the increase of glucose uptake and lactate production even in the presence of oxygen, a phenomenon known as the “Warburg effect”. This review summarizes the genetic mutations and epigenetic alterations, focusing on non-coding RNA associated with the oncogenes, tumor suppresser genes, and enzymes involved in the “Warburg effect”, in addition to Citation: Abi Zamer, B.; Abumustafa, their clinical impacts on colorectal cancer. This knowledge may open the door for novel therapeutic W.; Hamad, M.; Maghazachi, A.A.; approaches to target colorectal cancer. Muhammad, J.S. Genetic Mutations and Non-Coding RNA-Based Abstract: Colorectal cancer (CRC) development is a gradual process defined by the accumulation of Epigenetic Alterations Mediating the numerous genetic mutations and epigenetic alterations leading to the adenoma-carcinoma sequence.
  • Table S1. Complete Gene Expression Data from Human Diabetes RT² Profiler™ PCR Array Receptors, Transporters & Channels* A

    Table S1. Complete Gene Expression Data from Human Diabetes RT² Profiler™ PCR Array Receptors, Transporters & Channels* A

    Table S1. Complete gene expression data from Human Diabetes RT² Profiler™ PCR Array Position Unigene GenBank Symbol Description FC Average Ct Receptors, Transporters & Channels* NGT GDM A01 Hs,5447 NM_000352 ABCC8 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 0.93 35.00 35.00 A04 0Hs,2549 NM_000025 ADRB3 Adrenergic, beta-3-, receptor 0.88 34.92 35.00 A07 Hs,1307 NM_000486 AQP2 Aquaporin 2 (collecting duct) 0.93 35.00 35.00 A09 30Hs,5117 NM_001123 CCR2 Chemokine (C-C motif) receptor 2 1.00 26.28 26.17 A10 94Hs,5916 396NM_006139 CD28 CD28 molecule 0.81 34.51 34.71 A11 29Hs,5126 NM_001712 CEACAM1 Carcinoembryonic antigen-related cell adhesion molecule 1 1.31 26.08 25.59 B01 82Hs,2478 NM_005214 CTLA4 (biliaryCytotoxic glycoprotein) T-lymphocyte -associated protein 4 0.53 30.90 31.71 B11 24Hs,208 NM_000160 GCGR Glucagon receptor 0.93 35.00 35.00 C01 Hs,3891 NM_002062 GLP1R Glucagon-like peptide 1 receptor 0.93 35.00 35.00 C07 03Hs,6434 NM_000201 ICAM1 Intercellular adhesion molecule 1 0.84 28.74 28.89 D02 47Hs,5134 NM_000418 IL4R Interleukin 4 receptor 0.64 34.22 34.75 D06 57Hs,4657 NM_000208 INSR Insulin receptor 0.93 35.00 35.00 E05 44Hs,4312 NM_006178 NSF N-ethylmaleimide-sensitive factor 0.48 28.42 29.37 F08 79Hs,2961 NM_004578 RAB4A RAB4A, member RAS oncogene family 0.88 20.55 20.63 F10 69Hs,7287 NM_000655 SELL Selectin L 0.97 23.89 23.83 F11 56Hs,3806 NM_001042 SLC2A4 Solute carrier family 2 (facilitated glucose transporter), member 4 0.77 34.72 35.00 F12 91Hs,5111 NM_003825 SNAP23 Synaptosomal-associated protein, 23kDa 3.90
  • Genetic Testing for Acute Myeloid Leukemia AHS-M2062

    Genetic Testing for Acute Myeloid Leukemia AHS-M2062

    Corporate Medical Policy Genetic Testing for Acute Myeloid Leukemia AHS-M2062 File Name: genetic_testing_for_acute_myeloid_leukemia Origination: 1/1/2019 Last CAP Review: 8/2021 Next CAP Review: 8/2022 Last Review: 8/2021 Description of Procedure or Service Acute myeloid leukemia (AML) is characterized by large numbers of abnormal, immature myeloid cells in the bone marrow and peripheral blood resulting from genetic changes in hematopoietic precursor cells which disrupt normal hematopoietic growth and differentiation (Stock, 2020). Related Policies: Genetic Cancer Susceptibility Using Next Generation Sequencing AHS-M2066 Molecular Panel Testing of Cancers to Identify Targeted Therapy AHS-M2109 Serum Tumor Markers for Malignancies AHS-G2124 Minimal Residual Disease (MRD) AHS- M2175 ***Note: This Medical Policy is complex and technical. For questions concerning the technical language and/or specific clinical indications for its use, please consult your physician. Policy BCBSNC will provide coverage for genetic testing for acute myeloid leukemia when it is determined to be medically necessary because the medical criteria and guidelines shown below are met. Benefits Application This medical policy relates only to the services or supplies described herein. Please refer to the Member's Benefit Booklet for availability of benefits. Member's benefits may vary according to benefit design; therefore member benefit language should be reviewed before applying the terms of this medical policy. When Genetic Testing for Acute Myeloid Leukemia is covered The use of genetic testing for acute myeloid leukemia is considered medically necessary for the following: A. Genetic testing for FLT3 internal tandem duplication and tyrosine kinase domain mutations (ITD and TKD), IDH1, IDH2, TET2, WT1, DNMT3A, ASXL1 and/or TP53 in adult and pediatric patients with suspected or confirmed AML of any type for prognostic and/or therapeutic purposes.
  • CEBPA Gene CCAAT Enhancer Binding Protein Alpha

    CEBPA Gene CCAAT Enhancer Binding Protein Alpha

    CEBPA gene CCAAT enhancer binding protein alpha Normal Function The CEBPA gene provides instructions for making a protein called CCAAT enhancer- binding protein alpha. This protein is a transcription factor, which means that it attaches ( binds) to specific regions of DNA and helps control the activity (expression) of certain genes. CCAAT enhancer-binding protein alpha is involved in the maturation ( differentiation) of certain blood cells. It is also believed to act as a tumor suppressor, which means that it is involved in cellular mechanisms that help prevent the cells from growing and dividing too rapidly or in an uncontrolled way. Health Conditions Related to Genetic Changes Familial acute myeloid leukemia with mutated CEBPA At least six mutations in the CEBPA gene have been identified in families with familial acute myeloid leukemia with mutated CEBPA, which is a form of a blood cancer known as acute myeloid leukemia. These inherited mutations are present throughout a person' s life in virtually every cell in the body. The mutations result in a shorter version of CCAAT enhancer-binding protein alpha. This shortened protein is produced from one copy of the CEBPA gene in each cell, and it is believed to interfere with the tumor suppressor function of the normal protein produced from the second copy of the gene. Absence of the tumor suppressor function of CCAAT enhancer-binding protein alpha is believed to disrupt the regulation of blood cell production, leading to the uncontrolled production of abnormal cells that occurs in acute myeloid leukemia. In addition to the inherited mutation in one copy of the CEBPA gene in each cell, most individuals with familial acute myeloid leukemia with mutated CEBPA also acquire a mutation in the second copy of the CEBPA gene.
  • Reducing FASN Expression Sensitizes Acute Myeloid Leukemia Cells to Differentiation Therapy Magali Humbert , Kristina Seiler

    Reducing FASN Expression Sensitizes Acute Myeloid Leukemia Cells to Differentiation Therapy Magali Humbert , Kristina Seiler

    bioRxiv preprint doi: https://doi.org/10.1101/2020.01.29.924555; this version posted July 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reducing FASN expression sensitizes acute myeloid leukemia cells to differentiation therapy Magali Humbert1,2,#, Kristina Seiler1,3, Severin Mosimann1, Vreni Rentsch1, Sharon L. McKenna2,4, Mario P. Tschan1,2,3 1Institute of Pathology, Division of Experimental Pathology, University of Bern, Bern, Switzerland 2TRANSAUTOPHAGY: European network for multidisciplinary research and translation of autophagy knowledge, COST Action CA15138 3Graduate School for Cellular and Biomedical Sciences, University of Bern, Bern, Switzerland, 4Cancer Research, UCC, Western Gateway Building, University College Cork, Cork, Ireland. #Corresponding Author: Magali Humbert, Institute of Pathology, Division of Experimental Pathology, University of Bern, Murtenstrasse 31, CH-3008 Bern, Switzerland, E-mail: [email protected], Tel: +41 31 632 8788 Running Title: FASN impairs TFEB activity in AML Key words: FASN/AML/ATRA/TFEB/mTOR/autophagy bioRxiv preprint doi: https://doi.org/10.1101/2020.01.29.924555; this version posted July 3, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Fatty acid synthase (FASN) is the only human lipogenic enzyme available for de novo fatty acid synthesis and is often highly expressed in cancer cells.
  • The Polymorphism Rs944289 Predisposes to Papillary Thyroid Carcinoma Through a Large Intergenic Noncoding RNA Gene of Tumor Suppressor Type

    The Polymorphism Rs944289 Predisposes to Papillary Thyroid Carcinoma Through a Large Intergenic Noncoding RNA Gene of Tumor Suppressor Type

    The polymorphism rs944289 predisposes to papillary thyroid carcinoma through a large intergenic noncoding RNA gene of tumor suppressor type Jaroslaw Jendrzejewskia, Huiling Hea, Hanna S. Radomskaa, Wei Lia, Jerneja Tomsica, Sandya Liyanarachchia, Ramana V. Davulurib, Rebecca Nagya, and Albert de la Chapellea,1 aHuman Cancer Genetics Program, Comprehensive Cancer Center, The Ohio State University, Columbus, OH 43210; and bMolecular and Cellular Oncogenesis Program, Center for Systems and Computational Biology, The Wistar Institute, Philadelphia, PA 19104 Contributed by Albert de la Chapelle, April 4, 2012 (sent for review February 20, 2012) A genome-wide association study of papillary thyroid carcinoma (GWAS) have addressed the predisposition to PTC (11–13). (PTC) pinpointed two independent SNPs (rs944289 and rs965513) Gudmundsson et al. (11) studied Icelandic PTC patients and located in regions containing no annotated genes (14q13.3 and controls, followed by validation in Spanish and US cases and 9q22.33, respectively). Here, we describe a unique, long, inter- controls. Two SNPs that showed highly significant association Papillary Thyroid genic, noncoding RNA gene (lincRNA) named with PTC were detected (rs965513 and rs944289). The variants Carcinoma Susceptibility Candidate 3 PTCSC3 ( ) located 3.2 kb were located in 9q22.33 and 14q13.3, respectively, and have been downstream of rs944289 at 14q.13.3 and the expression of which confirmed by other research groups (14, 15). As both SNPs were is strictly thyroid specific. By quantitative PCR, PTCSC3 expression − located in gene-poor regions, no immediate candidate genes was strongly down-regulated (P = 2.84 × 10 14) in thyroid tumor tissue of 46 PTC patients and the risk allele (T) was associated with presented themselves as being affected by or associated with the the strongest suppression (genotype [TT] (n = 21) vs.
  • (HK3) (NM 002115) Human Tagged ORF Clone – RC207021

    (HK3) (NM 002115) Human Tagged ORF Clone – RC207021

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC207021 Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HK3 Synonyms: HKIII; HXK3 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 Hexokinase Type III (HK3) (NM_002115) Human Tagged ORF Clone – RC207021 ORF Nucleotide >RC207021 representing NM_002115 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACTCCATTGGGTCTTCAGGGTTGCGGCAGGGGGAAGAAACCCTGAGTTGCTCTGAGGAGGGCTTGC CCGGGCCCTCAGACAGCTCAGAGCTGGTGCAGGAGTGCCTGCAGCAGTTCAAGGTGACAAGGGCACAGCT ACAGCAGATCCAAGCCAGCCTCTTGGGTTCCATGGAGCAGGCGCTGAGGGGACAGGCCAGCCCTGCCCCT GCGGTCCGGATGCTGCCTACATACGTGGGGTCCACCCCACATGGCACTGAGCAAGGAGACTTCGTGGTGC TGGAGCTGGGGGCCACAGGGGCCTCACTGCGTGTTTTGTGGGTGACTCTAACTGGCATTGAGGGGCATAG GGTGGAGCCCAGAAGCCAGGAGTTTGTGATCCCCCAAGAGGTGATGCTGGGTGCTGGCCAGCAGCTCTTT GACTTTGCTGCCCACTGCCTGTCTGAGTTCCTGGATGCGCAGCCTGTGAACAAACAGGGTCTGCAGCTTG GCTTCAGCTTCTCTTTCCCTTGTCACCAGACGGGCTTGGACAGGAGCACCCTCATTTCCTGGACCAAAGG
  • Identification of Microrna-Mrna Regulatory Networks and Pathways Related to Retinoblastoma Across Human and Mouse

    Identification of Microrna-Mrna Regulatory Networks and Pathways Related to Retinoblastoma Across Human and Mouse

    Int J Ophthalmol, Vol. 13, No. 4, Apr.18, 2020 www.ijo.cn Tel: 8629-82245172 8629-82210956 Email: [email protected] ·Basic Research· Identification of microRNA-mRNA regulatory networks and pathways related to retinoblastoma across human and mouse Rui Tian, He Zou, Lu-Fei Wang, Mei-Jiao Song, Lu Liu, Hui Zhang Department of Ophthalmology, the Second Hospital of Jilin INTRODUCTION University, Changchun 130000, Jilin Province, China etinoblastoma (RB) is a rare malignant retina tumor Correspondence to: Hui Zhang. Department of Ophthalmology, R in children. It initiates during foetal stage and is often the Second Hospital of Jilin University, No.218 Ziqiang Street, delay-diagnosed after birth or during the first few years Nan Guan District, Changchun 130000, Jilin Province, China. after birth. The common signs of RB includes leukocoria, [email protected] strabismus, glaucoma and inflammation[1-2]. The prognosis and Received: 2019-07-20 Accepted: 2020-02-19 survival of RB has been improved due to the improvement in diagnosis methods and treatment strategies, including Abstract chemotherapy regiments, magnetic resonance imaging and ● AIM: To explore the mRNA and pathways related to surgical therapy[1-3]. However, the etiology of RB is still now retinoblastoma (RB) genesis and development. clear till now. ● METHODS: Microarray datasets GSE29683 (human) The pathogenesis of RB involves RB tumor suppressor and GSE29685 (mouse) were downloaded from NCBI GEO gene biallelic mutation or inactivation and attendant loss of database. Homologous genes between the two species function of RB protein[1]. It is believed that the molecular were identified using WGCNA, followed by protein-protein features of a disease reflect its origin features and provide interaction (PPI) network construction and gene enrichment clues for treatment.