Dogwood Anthracnose Caused by Discula Destructiva on Cornus Spp

Dogwood Anthracnose Caused by Discula destructiva on Cornus spp. in Canada

Mihaela Stanescu

A Thesis presented to The University of Guelph

In partial fulfilment of requirements for the degree of Master of Science in Environmental Biology

Guelph, Ontario, Canada

DOGWOOD ANTHRACNOSE CAUSED BY DISCULA DESTRUCTIVA ON CORNUS SPP. IN CANADA

Mihaela Stanescu, Advisor: University of Guelph, 2013 Professor T. Hsiang

The most important fungal disease of dogwoods in North America is anthracnose caused by Discula destructiva. This disease affects Cornus florida (flowering dogwood), C. nuttallii (Pacific dogwood), and C. kousa (kousa dogwood). It has not been well studied in Ontario nor anywhere in Canada. In this study, over 2,500 fungal isolates were obtained from symptomatic samples of C. alba, C. alternifolia, C. amomum, C. kousa, C. florida, C. nuttallii, C. racemosa and C. sericea. To help distinguish between foliar symptoms of different etiologies, a “Dogwood Disease Symptom Guide” was produced. Isolates were divided into 13 fungal morphotypes, of which D. destructiva accounted for 39% of all isolates. Pathogenicity testing of Discula destructiva on C. florida satisfied Koch’s postulates, and this fungus was confirmed as the causal agent of dogwood anthracnose in southwestern Ontario (C. florida) and southwestern British Columbia (C. nuttallii). Wounds and leaf trichomes may provide a point of entry and help the pathogen survive endophytically without producing symptoms on “non-host” plants such as oak, maple and pear. The pathogen was found to survive for over 12 weeks at -20 °C, and the optimal growth temperature was found to be between 20-25 °C, but temperatures as high as 30 °C inhibited the growth, and the fungus died after one week incubation at 40 °C. The finding of only one mating type within D. destructiva populations (122 isolates) explains the lack of sexual reproduction of this fungus in North America, and along with the SSR results, reconfirms the low genetic variability within its populations. ACKNOWLEDGEMENTS

I would like to thank my advisor, Dr. Tom Hsiang for giving me the opportunity to obtain my MSc. He helped me not only with his knowledge, guidance and expertise, but also with his encouragements and his constant trust in my ability to complete this project, although at times I wavered. I am also thankful to the other members in the Advisory Committee, Dr. John McLaughlin and Dr. Richard Wilson, for their knowledge and competent advice. I am thankful to the Ontario Ministry of Natural Resources who funded this research. The input of collaborators who helped with sample collection, and the support of nurseries which donated plant material, are also much appreciated. I am also thankful to the lab technician Angie Darbison, who started this project and helped with the DNA extraction of the first Discula destructiva isolate obtained in our lab, for the purpose of genome sequencing. I am very grateful to my lab mates, who with their advice and friendly attitude made my life at the lab a lot easier. Especially I would like to thank Amy Shi and Linda Jewell, for helping me get through the hard times at the beginning of my graduate studies, and also for their constant advice. I am also grateful to my family and friends for their encouragements. Finally, I would like to thank my husband, Adrian, for his unconditional love and priceless support which helped me bring this project to an end.

iii

TABLE OF CONTENTS ACKNOWLEDGEMENTS...... iii TABLE OF CONTENTS...... iv LIST OF TABLES...... viii LIST OF FIGURES...... x LIST OF APPENDICES...... xiii LIST OF ABBREVIATIONS AND ACRONYMS...... xiv Chapter One: Literature Review...... 1 1.1 Introduction...... 1 1.2 Dogwood (Cornus) species...... 2 1.3 Major fungal diseases of dogwoods...... 8 1.3.1 Spot anthracnose caused by Elsinoe corni...... 8 1.3.2 Septoria leaf spot caused by Septoria cornicola...... 8 1.3.3 Limb dieback caused by Colletotrichum gloeosporioides and C. acutatum...... 9 1.3.4 Powdery mildew caused by Microsphaera penicillata and Phillactinia guttata ... 10 1.3.5 Dogwood anthracnose caused by Discula destructiva...... 10 1.3.5.1 Disease history and distribution...... 10 1.3.5.2 Symptoms...... 12 1.3.5.3 Morphology and reproduction of Discula destructiva ...... 14 1.3.5.4 Population structure and origin of Discula destructiva...... 15 1.3.5.5 Infection process...... 17 1.4 Hypothesis and objectives...... 19 Chapter Two: The Causal Agent of Dogwood Anthracnose...... 33 2.1 Introduction ...... 33 2.1.1 Morphological identification of fungal isolates ...... 33 2.1.2 Molecular identification of fungal isolates...... 34 2.1.3 Dogwood diseases ...... 35 2.1.4 Objectives...... 36 2.2 Materials and methods...... 37 2.2.1 Sample collection...... 37 2.2.2 Media preparation...... 37

2.2.3 Fungal isolation from symptomatic dogwood tissues...... 38 2.2.4 Identification of fungal isolates with morphological techniques...... 38 2.2.5 DNA extraction...... 39 2.2.6 Sequencing the genome of Discula destructiva...... 40 2.2.7 Specific primer design and selection...... 40 2.2.8 PCR amplification...... 43 2.2.9 Sequencing of PCR products and result analysis ...... 43 2.2.10 Pathogenicity testing ...... 44 2.3 Results...... 45 2.3.1 Symptomatic samples of dogwood...... 45 2.3.2 Morphological characteristics of fungal isolates...... 47 2.3.3 Molecular identification of morphotypes...... 49 2.3.4 Genome sequencing and assembly...... 50 2.3.5 Primer amplification...... 50 2.3.5.1 Testing specific primers...... 51 2.3.5.2 Amplification results with the specific primers...... 53 2.3.6 Testing the pathogenicity of Discula destructiva ...... 53 2.4 Discussion...... 54 Chapter Three: Biological Characteristics, Pathogenicity and Genetic Variation in Discula destructiva...... 73 3.1 Introduction...... 73 3.1.1 Growth and survival of Discula destructiva...... 74 3.1.2 Infection process of Discula destructiva...... 75 3.1.3 Host range of Discula destructiva...... 76 3.1.4 Mating type genes...... 77 3.1.5 Genetic variation in Discula destructiva...... 78 3.1.6 Objectives...... 80 3.2 Materials and methods ...... 80 3.2.1 Plants and fungal isolates...... 80 3.2.2 Growth rates of D. destructiva isolates...... 81 3.2.3 Survival of D. destructiva inoculum...... 82

3.2.4 Pathogenicity tests ...... 83 3.2.4.1 The infection process on Cornus florida ...... 83 3.2.4.2 Pathogenicity tests on other Cornus spp. and woody plants...... 84 3.2.5 DNA extraction and SSR primer design...... 86 3.2.6 PCR amplification for ISSR and SSR...... 86 3.2.7 SSR data analysis...... 88 3.2.8 Screening for mating types in D. destructiva...... 88 3.3 Results...... 89 3.3.1 Dogwood anthracnose incidence in Canada...... 89 3.3.2 Temperature effects on Discula destructiva ...... 90 3.3.2.1 Optimum growth temperature ...... 90 3.3.2.2 Survival of Discula destructiva inoculum at different temperatures...... 90 3.3.3 Disease development during inoculation progress...... 91 3.3.3.1 The infection process on Cornus florida...... 91 3.3.3.2 Pathogenicity of Discula destructiva on other Cornus spp. or woody plants ...... 93 3.3.4 Genetic variation in Discula destructiva...... 95 3.3.5 Mating types in Discula destructiva...... 96 3.4 Discussion...... 96 3.4.1 Dogwood anthracnose incidence in Canada...... 97 3.4.2 Contrasting Discula destructiva isolates from Ontario and from British Columbia ...... 98 3.4.3 Inoculum sources and the infection process of Discula destructiva on Cornus florida ...... 99 3.4.4 Disease cycle of dogwood anthracnose...... 100 3.4.5 Pathogenicity of Discula destructiva on other Cornus spp. and woody plants...... 102 3.4.6 Genetic variation and mating types in Discula destructiva...... 103 3.4.7 Overall conclusions on biological characteristics, pathogenicity and genetic variation in Discula destructiva...... 104 Chapter Four: General Discussion and Conclusions...... 128 References...... 135

Appendices ...... 148

vii

LIST OF TABLES

Table 1.1 List of ornamental dogwoods (Cornus spp.) and the occurrence of anthracnose in natural settings. 21

Table 2.1 List of collaborators with affiliations, collection locations and dates. 60

Table 2.3 Fungal genomes used in this study, with file data, file size, and source. 62

Table 2.4 Amplification results of Discula destructiva (DD) specific primers ddg485 and ddITS with DNA from related species, other dogwood pathogens or fungi associated with dogwood leaves. 63

Table 3.1 SSR primers tested in this study, which were developed based on the predicted genes of the assembled genome of Discula destructiva. Assembly and gene prediction were done by T. Hsiang. 105

Table 3.2 Cornus species naturally occurring in Canadian flora, affected by dogwood anthracnose in natural settings or used in artificial inoculations in this study. 106

Table 3.3 Locations with Cornus florida in southwestern Ontario, which were sampled for dogwood anthracnose between 2010-2012, with dates of collection and processing results. 107

Table 3.4 Locations in southwestern British Columbia, sampled for dogwood anthracnose in 2011 and 2012, with dates of collection and processing results. 108

Table 3.6 Mean necrosis (%) on detached leaves of seven Cornus spp. (C. alba ‘BY’ = C. alba ‘Bud’s Yellow’ and C. kousa ‘C’ = C. kousa ‘Chinensis’) inoculated either by incubation on sporulating colonies of Discula destructiva on media – repeated three times, or by spraying with a spore suspension (106 spores /mL) from isolate 10192 from Ontario (ON) or isolate 12180 from British Columbia (B.C.). 110

Table 3.7 Mean re-isolation (%) of Discula destructiva from detached leaves of seven Cornus spp. (C. alba ‘BY’ = C. alba ‘Bud’s Yellow’ and C. kousa ‘C’ = C. kousa ‘Chinensis’) inoculated either by incubation on sporulating colonies on media – repeated three times, or by spraying with a spore suspension (106 spores /mL) from isolate 10192 from Ontario (ON) or isolate 12180 from British Columbia (B.C.). 111

viii

Table 3.8 Mean necrosis (%) on detached leaves of Acer platanoides, Quercus rubra and Pyrus sp. inoculated either by incubation on sporulating colonies of Discula destructiva on media, or by spraying with a spore suspension (106 spores /mL). 112

Table 3.9 Mean re-isolation (%) of Discula destructiva from detached leaves of Acer platanoides, Quercus rubra and Pyrus sp. inoculated either by incubation on sporulating colonies of Discula destructiva on media, or by spraying with a spore suspension (106 spores /mL). 113

LIST OF FIGURES

Figure 1.1 Phylogenetic tree of Cornus species. The most parsimonious tree for Cornus was redrawn from Xiang et al. (2006), who used maximum parsimony (MP) analysis of combined morphology-matK-ITS-rbcL-26S rDNA sequences. Underlined species were added based on a classification by Murrell (1993), and species in bold were used in this study. 22

Figure 1.2 Native distribution of Cornus florida in North America. 23

Figure 1.3 Native distribution of Cornus florida in Canada, with sites documented before 1975, (white circles), between 1975 – 1994 (half white-half black circles), and between 1995 – 2005 (black circles) (COSEWIC, 2007). 24

Figure 1.4 Native distribution of Cornus nuttallii in North America. 25

Figure 1.5 Geographical distribution of dogwood anthracnose in the United States and western Canada in 1994. Solid colored areas on the eastern half show the range of flowering dogwood, while solid colored areas in the west show the range of Pacific dogwood. Individual counties are colored to show the occurrence of dogwood anthracnose. Disease range is given by county in the United States. In Canada, Pacific dogwood is affected throughout its range (reproduced from Daughtrey et al., 1996, pp.353). 26

Figure 1.6 Geographical distribution of dogwood anthracnose in C. florida populations in the United States in 2011. Individual counties are colored to show the occurrence of dogwood anthracnose. (USDA website, accessed December 2013 http://www.fs.fed.us/foresthealth/technology/pdfs/PestRanges_da.pdf). 27

Figure 1.7 Leaf spot and blotch on Cornus florida leaves, due to dogwood anthracnose. 28

Figure 1.8 Leaf blight on Cornus nuttallii leaves due to dogwood anthracnose. 29

Figure 1.9 Association of conidiomata of Discula destructiva with trichomes on leaves of Cornus florida. (a) healthy trichomes; (b-d) subcuticular acervular conidiomata growing under trichomes of Cornus florida. Size bars represent 50 µm. 30

Figure 1.10 Conidia of Discula destructiva. Size bar represents 10 µm. 31

Figure 1.11 Germinated conidia of Discula destructiva at three days after inoculation of a Cornus florida leaf disc, forming hypha (HY) (a), and penetrating directly the cuticle (C) and cell walls (CW) of Cornus florida leaf epidermis (E – epidermal cell), without formation of an appressorium (b). Size bars represent 2 µm. 32

Figure 2.1 Leaves Cornus florida with symptoms of dogwood anthracnose. Sample collected from Norfolk County, Ontario in 2012. 64

Figure 2.2 Twig of Cornus nuttallii with flower bracts and leaves affected by dogwood anthracnose. Sample collected from Victoria Island, British Columbia in 2012. 65 x

Figure 2.3 Leaf of Cornus nuttallii with many irregular, different sized spots of dogwood anthracnose. Sample collected from Capilano Golf Course, Vancouver Island, British Columbia in 2012. 66

Figure 2.4 Thirteen morphotypes of fungi associated with symptomatic leaves of dogwood, grown on potato dextrose agar (or malt extract agar for the last morphotype) at 25 °C for 4 – 30 days (4 months for the last morphotype): (a) white-grey ; (b) grey; (c) red-grey; (d) grey- granular; (e) white-granular; (f) beige; (g) yellow-orange; (h) brown; (i) white-fuzzy. 67-68

Figure 2.5 Different isolates of Discula destructiva grown on PDA plates at 25 °C: (a) colony emerging from an infected leaf-piece 3 days after culturing on PDA; (b) colony 14 days after sub-culturing; (c) and (d) colonies 21 days after sub-culturing. 69

Figure 2.6 Discula destructiva: (a) abundant globular conidiomata on a 4 week colony on amended media; (b) conidia. Size bar represents 10 µm. 70

Figure 2.7 Acervuli of Discula destructiva formed on necrotic tissue of Cornus florida leaves 15 days after inoculation with a 107 spores/mL spore suspension. Association of acervuli with leaf trichomes is a characteristic of D. destructiva according to Redlin (1992). Size bar represents 150 µm. 71

Figure 2.8 Symptoms of dogwood anthracnose on Cornus florida plants inoculated with spore suspensions of Discula destructiva, 27 days after inoculation: (a) completely blighted leaves in the lower part of the plant; (2) incipient necrosis on leaves. 72

Figure 3.1 Inter-SSR PCR: A simple primer targeting a (CA)n repeat, anchored either at the 3’ (light arrows) or at the 5’ (dark arrows) of the repeat, is used to amplify genomic sequences flanked by two inversely oriented (CA)n elements. 114

Figure 3.2 Screw-cap test tubes filled with PDA were used for the temperature growth test for Discula destructiva. An inoculated plug from an actively growing culture was placed at the mouth of each tube, and then caps were attached loosely and sealed with parafilm. 115

Figure 3.3 Sites in southwestern Ontario sampled for dogwood anthracnose from 2010 to 2012. 116

Figure 3.4 Sites in southwestern British Columbia sampled for dogwood anthracnose in 2011 and 2012. All sites were found positive for dogwood anthracnose. 117

Figure 3.5 Mean growth rate per isolate by temperature. Measurements were made biweekly for 31 days at 0, 2 and 4 °C and weekly for 6, 10, 15, 20, 25 and 30 °C. Isolates were obtained from Cornus florida in Ontario (ON) and from C. nuttallii in British Columbia (BC). 118

Figure 3.6 Conidial germination of Discula destructiva at (a) 24 h and (b) 48 h on water agar. Size bars represent 10 µm. 119

Figure 3.7 Hyphae of Discula destructiva associated with host trichomes upon spore germination on detached leaves of Cornus florida at two days after inoculation: (a) on non-wounded leaf area and (b) on wounded leaf area. Size bars represent 50 µm. 120

Figure 3.8 Spore germination on (a) non-wounded and (b) wounded leaf surface of Cornus florida at 3 days after inoculation with a spore suspension of Discula destructiva. Size bar represents 50 µm. 121

Figure 3.9 Fungal growth of Discula destructiva associated with host trichomes on (a) non- wounded and (b) wounded leaf areas of C. florida, at eight days after inoculation. Acervulus primordia can be seen associated with trichome (b). Size bars represent 50 µm. 122

Figure 3.10 Acervuli of Discula destructiva formed on wounded areas on leaves of (A) Acer platanoides, (B) Quercus rubra and (C) Pyrus sp. at 14 d after incubation on sporulating colonies of D. destructiva on medium. Images on the left show non-wounded, asymptomatic leaf tissue, images in the middle and on the right show acervuli formed on wounded leaf tissue, visualized with light coming from below (middle) or from above (right) the leaf. Size bars represent 150 µm. 123

Figure 3.11 Bacteria colonizing a leaf trichome of Cornus florida. Size bar represents 5 µm. 124

Figure 3.12 Difference between spore germination and mycelial growth of Discula destructiva on non-wounded (left column) and wounded (right column) areas of inoculated leaves of Cornus spp.: (A) C. alba ‘Bud’s yellow’, (B) C. amomum, (C) C. alternifolia. Size bars reprezent 50 µm. 125-126

Figure 3.13 UPGMA dendrogram of 36 isolates of Discula destructiva from Ontario (ON) and British Columbia (BC), based on two SSR primer pairs (SSR2) and (SSR3). The scale is based on Nei and Li's coefficient of similarity. 127

xii

LIST OF APPENDICES

Appendix 2.1: The Perl script used to parse the BLAST results. 148

Appendix 2.2: List of dogwood samples with collection dates, collection locations, and processing results. Samples which produced Discula destructiva were marked with “+”. 150

Appendix 2.3: Dogwood Disease Symptom Guide 157

Appendix 2.4: ITS regions of nine different morphotypes of fungi collected from symptomatic samples of dogwood. Nucleotides written with lower case letters were corrected manually after visualization using Chromas Lite. 174

Appendix 3.1: An example of SAS statements used to analyze mycelial growth data of Discula destructiva. 177

Appendix 3.2: An example of SAS statements used to analyze disease ratings data of Discula destructiva on Cornus spp. and other woody species. 178

xiii

LIST OF ABBREVIATIONS AND ACRONYMS

AFLP: Amplified Fragment Length Polymorphism B.C.: British Columbia BLAST: Basic Local Alignment Search Tool BLASTN: Basic Local Alignment Search Tool (nucleotides vs. nucleotides) BLASTP: Basic Local Alignment Search Tool (proteins vs. proteins) BLASTX: Basic Local Alignment Search Tool (translated nucleotides vs. proteins) bp: base pair(s) C: Centigrade CA: California cm: centimeter d: day DAI: Days After Inoculation dNTP: deoxyribonuleotide triphosphate dsRNA: double stranded RNA e-value: expectation value Et-Br: Ethidium-Bromide F: forward GA: Georgia ISSR: Inter Simple Sequence Repeat ITS: Internal Transcribed Spacer h: hour (s) Inc.: Incorporation kb: kilobase(s) L: Liter(s) LSD: Lab Services Division LSU: Large Subunit M: Molar m: meter(s) MAT: Mating Type MD: Maryland MEA: Malt Extract Agar min: minute(s) mol: mole mRNA: messenger RNA N/A: Not Available NCBI: National Center for Biotechnology Information NIH: National Institutes of Health NJ: New Jersey NY: New York OMNR: Ontario Ministry of Natural Resources ON: Ontario PCR: Polymerase Chain Reaction PDA: Potato Dextrose Agar R: reverse

xiv

RAPD: Random Amplification of Polymorphic DNA rDNA: ribosomal DNA RPB1: RNA polymerase 2, largest subunit RPB2: RNA polymerase 2, second largest subunit s: second(s) SSR: Simple Sequence Repeat SSU: Small Subunit U.K.: United Kingdom UPGMA: Unweighted Pair Group Method with Arithmetic Mean USA: United States of America UV: Ultra violet WA: water agar wk: week

Chapter One: Literature Review 1.1 Introduction Native to North America, Europe and Asia, with a few species in South America and Africa (Eyde, 1988), the plants in the genus Cornus, commonly referred to as dogwoods, are important in forest ecosystems and also have economic value as ornamental landscape plantings. Most dogwoods are shrubs or small trees, and a few species are herbaceous perennials. The major ecological roles are to provide food and habitat for wildlife (Blair, 1982; Rossell et al., 2001), participate in recycling soil nutrients, especially calcium (Holzmueller et al., 2010), and protect against erosion of slopes and shores (Blair, 1982; Holzmueller et al., 2010). The ornamental value of most dogwood species is given by their berries and fall colors or by their red or yellow bark, adding color to the frozen winter landscape (Cappiello and Shadow, 2005; Holzmueller et al., 2006). The three dogwood species, Cornus florida (flowering dogwood), C. kousa (kousa dogwood), and C. nuttallii (Pacific dogwood) have small inflorescences surrounded by large, white- or pink-colored bracts, making them highly appreciated ornamental trees. Cornus florida and C. nuttallii are native to North America and have cultural value. In many U.S. states, flowering dogwood is considered a cultural icon and its blooming is celebrated in spring festivals. The Pacific dogwood blossom is the floral emblem of British Columbia. For these reasons, any disease associated with these plants arouses interest from the public as well as from the scientific community (Chellemi and Britton, 1992; Holzmueller et al., 2006). Dogwoods are susceptible to fungal diseases of different etiologies which produce spots and blights on flowers and leaves, cankers and dieback on twigs and branches, root rots and powdery mildews (Daughtrey and Hagan, 2001). Diseases lower the esthetic value and fruit production, and the most severe of them can kill the whole plant. The most devastating fungal disease of dogwood is dogwood anthracnose, caused by Discula destructiva Redlin, an introduced pathogen (Trigiano et al., 1995). In natural settings, this disease has been observed to affect C. florida (Hibben and Daughtrey, 1988) and C. nuttallii (Byther and Davidson, 1979), but C. kousa was also reported as susceptible (Daughtrey and Hibben, 1994; Holdenrieder and Sieber, 2007). It is a relatively new disease, first reported in the United States in the mid 1970’s (Byther and Davidson, 1979). In Canada, dogwood anthracnose was first reported in British Columbia in 1983 (Salogga and Ammirati, 1983) and in Ontario in 1998 (Davis, 2001). Massive mortality in eastern U.S. populations of flowering dogwood was attributed to this disease

(Mielke and Langdon, 1986). Over 85% loss was reported in various areas in eastern U.S. between 1977 and 1988 (Anagnostakis and Ward, 1996; Sherald et al., 1996). In Ontario, over 80% decline due to dogwood anthracnose was reported for two plots of C. florida in Norfolk County, between 1995-2005 (COSEWIC, 2007). Dogwood anthracnose was reported also on the North American dogwoods raised in Europe. In the U.K. the disease was reported in 1995 (EPPO, 2013), in Germany in 2002 (Stinzing and Lang, 2003), in Italy in 2003 (Tantardini et al., 2004), and in Switzerland in 2006 (Holdenrieder and Sieber, 2007). A list of the most common dogwood species, as well as their susceptibility to dogwood anthracnose, is presented in Table 1.1. Most research on dogwood anthracnose has been done in the U.S., focusing on disease severity or genetic polymorphism of D. destructiva populations in this area. Some of the studies made in the U.S. also included isolates from British Columbia (Trigiano et. al, 1995; Caetano- Anolles et al., 1996; Yao et al., 1997), but there are no research reports on dogwood anthracnose in Ontario. The present study aimed to identify the causal agents of foliar symptoms of dogwoods in Ontario, as well as to evaluate the incidence of dogwood anthracnose in Ontario and British Columbia. Furthermore, the population structure of the dogwood anthracnose fungus in Ontario was assessed, and the pathogenicity of D. destructiva on other species of Cornus and other plants was tested.

1.2 Dogwood (Cornus) species Dogwoods are widely distributed in a variety of environments, from the subtropical, temperate and boreal regions of the Northern Hemisphere to the Andean Mountains of South America and the mountains of tropical Africa. The greatest species diversity occurs in eastern Asia and eastern North America (Xiang et al., 1996). The diversity of growth habits, as well as the various fruit shapes and colors found within Cornus explain the highly debated taxonomy and nomenclature of this group of plants (Cappiello and Shadow, 2005). Despite these differences, the species within Cornus present high uniformity in floral structures and leaf morphology (Murrell, 1993). Although Cornus is usually viewed as a monophyletic group based on morphology, the taxonomic relationships within the genus have been debated for over a century, at least since 1910 (Xiang et al., 2006). Former classifications did not recognize the unity of Cornus, but

2 segregated this group into multiple genera, as mentioned by Hardin and Murrell (1997). One of the older classifications (Hara, 1948) grouped the big-bracted dogwoods of North America with simple fruit, and the big-bracted dogwoods of Asia with compound fruit, into one genus, Benthamidia (Murrell, 1993), and the two types of dogwoods were viewed as sections of this genus. For this reason Cornus kousa, C. florida and C. nuttallii used to be called Benthamidia kousa, B. florida or B. nuttallii. Although the nomenclature has changed, these species are still referred to as Benthamidia today, especially in Japan. Later, Cornus was found to be a monophyletic group (Ferguson, 1966), and different classifications have recognized between eight and ten subgenera within it. Recent molecular-based phylogeny acknowledges four major groups in this genus, totalizing ten subgenera and 58 species (Xiang et al., 2006). One major classification criterion for Cornus according to Eyde (1988) is fruit color, dividing the genus into two groups, also known as “evolutionary lines”: red line and blue/white line. Other morphological features confirmed the major dichotomy by fruit color and provided the basis for further division within the two major groups. Based on inflorescence, the “red line” is divided into cornelian cherries (with inconspicuous inflorescences) and showy-bracted dogwoods (with inflorescences subtended by four big, highly attractive bracts). The cornelian cherries are represented by Cornus mas in Europe, C. chinensis and C. officinalis in Asia, and C. sessilis in the Californian Mountains, all of which range from deciduous shrubs to small trees (Eyde, 1988; Fan and Xiang, 2001). Other members of the cornelian cherries group are two species of relatively large, tropical evergreen trees such as C. volkensii in Africa and C. eydeana in SW Asia (Xiang et al., 2005). The showy-bracted group of dogwoods in the red line also has two subgroups of its own, such as the dwarf cornels and the big-bracted dogwoods. The dwarf cornels are herbaceous perennials with woody rhizomes inside the soil and herbaceous, annual aerial parts, and prefer high northern latitudes. There are four known species of dwarf cornels: C. canadensis, C. suecica, C intermedia and C. x unalaschkensis (Eyde, 1988; Calder and Taylor, 1965). The last one was thought to be a hybrid of the first two (Hall and Sibley, 1976), although subsequent studies treated C. unalaschkensis as a separate species (Murrell, 1994). The taxonomic treatment of C. intermedia has been also debated. Farr (1904) treated it as a variety of C. canadensis, Lepage (1958) view it as a hybrid between C. canadensis and C. suecica, while Calder and Taylor (1965) treated C. intermedia as a separate species, based on morphology and geographic

3 distribution. In the U.S. Department of Agriculture database (USDA, 2013) C. intermedia is a hybrid. The big-bracted dogwoods are: Cornus capitata and C. kousa of eastern Asia, C. florida of eastern North America, C. nuttallii of western North America, and Cornus disciflora – a mountainous tree of the North American tropics (Eyde, 1988). The “blue/white line” refers to dogwoods with blue or white fruit and comprises 45-50 species, depending on the taxonomic treatment considered. The following representatives of the “blue/white line” are native to North America: C. alternifolia, C. amomum, C. asperifolia, C. drummondii, C. excelsa, C. foemina (synonyms C. racemosa in Northern North America and C. stricta in the Southern part), C. glabrata, C. greenei, C. microcarpa, C. priceae, C. pubescens (synonym C. occidentalis), C. purpusii, C. rugosa, and C. sericea (synonym C. stolonifera) (Eyde, 1988; USDA, 2013). A classification developed by Murrell (1996), based on morphological traits such as inflorescence, fruit shape and color, fruit stone, leaves, growth habit and chromosome number, recognized ten subgenera within Cornus: Afrocrania, Arctocrania, Cornus, Cynoxylon, Discocrania, Kraniopsis, Mesomora, Sinocornus, Syncarpea and Yinquania (Figure 1.1). Molecular studies (Xiang et. al., 1996 and 1998; Fan and Xiang, 2001; Xiang et. al., 2006) have confirmed the monophyly of eight out of ten subgenera and grouped the ten subgenera into four major clades, corresponding to the four morphological groups described above. The first of the four major clades is the blue- or white-fruited dogwoods (BW) with the following subgenera: Yinquania, Kraniopsis and Mesomora. The generic names Swida or Svida have also been used to describe all blue-line dogwoods (Hutchinson, 1967; Eyde, 1987). Two morphological traits have split the blue/white-fruited dogwoods into subgenera: flower bracts – either permanent, as in Yinquania and Mesomora, or caducous, as in Kraniopsis, and leaves – either opposite, as in Yinquania and Kraniopsis, or alternate, as in Mesomora. Flower bracts of all blue/white-fruited dogwoods are very small or disappear early in flower development, and for this reason, until 1993, the group had been wrongly thought to be ebracteate (Murrell, 1993). However, the position of bracts, either at the base of inflorescence branches as in Yinquania, or displaced distal from the inflorescence branches as in Kraniopsis and Mesomora, also have taxonomic value (Murrell, 1993). The second major clade of dogwoods is the group of cornelian cherries (CC) and it includes the subgenera Afrocrania, Cornus and Sinocornus. These sections comprise dogwoods

4 with big, red fruit and inflorescences as umbellate cymes, subtended by four non-showy bracts, placed terminally in Cornus or axillary in Sinocornus (Fan and Xiang, 2001). There are two morphological traits that have placed the single species of Afrocrania in one separate subgenus of the cornelian-cherries group; the pollen type, unique within the genus Cornus, and the fact that it is a dioecious species. The third major group within the genus Cornus is the big-bracted dogwoods (BB), with the subgenera Syncarpea, Cynoxylon and Discocrania. These subgenera comprise dogwoods with capitulate cymes, subtended by four showy bracts in Syncarpea and Cynoxylon, or by four early deciduous bracts in Discocrania (Fan and Xiang, 2001). The main trait that separates Syncarpea, which includes C. kousa, from Cynoxylon, which includes C. florida and C. nuttallii, is the fruit. Syncarpea has fused fruits, while Cynoxylon has separate fruits (Fan and Xiang, 2001). The three subgenera of the BB group of dogwoods have been found to form a terminal clade by many researchers (Adams, 1949; Eyde, 1988; Murrell, 1993; Xiang et al., 1996), based on morphological and molecular analyses. To further emphasize the close kinship between Syncarpea and Cynoxylon, C. nuttallii was regarded by Murrell and Hardin (Murrell, 1993; Hardin and Murrell, 1997) as a transition species between the two subgenera, although it is usually placed within Cynoxylon along with C. florida (Xiang et al., 2006). The affiliation of C. nuttallii to Cynoxylon is sustained by the presence of the same type of iridoid metabolite as in C. florida, and by the fact that fruits are not completely fused. However, the fruit of C. nuttallii is not a typical simple fruit, but rather the fruits derive from inflorescences that are tightly grouped on an elongate receptacle, suggesting a transition to the fused fruit of Syncarpea. Also, the bracts of C. nuttallii cover the flower only partially during the winter, which is another characteristic of Syncarpea (Murrell, 1993; Hardin and Murrell, 1997). The fourth major group is the dwarf dogwoods (DW) with subgenus Arctocrania, also known as Chamaepericlymenum in older classifications (Pojarkova, 1950; Hutchinson, 1967). Dogwoods in this group also have red fruits, but inflorescences are small cymes subtended by four small, showy bracts (Fan and Xiang, 2001), and all three species of Arctocrania are rhizomatous plants growing in the circumboreal region (Xiang et al., 2005). A classification of Cornus, as well as the relationships within this genus is presented in Figure 1.1. Other classifications, based on foliar micromorphology, acknowledge the taxonomic value of trichomes (Murrell, 1993; Hardin and Murrell, 1997) which within the genus Cornus are

5 unicellular, with different shapes or symmetries and often covered with crystals of calcium carbonate. This is an unusual compound for vascular plants and based on this feature, eight subgenera were included in Cornus (Hardin and Murrell, 1997). Dogwoods are popular ornamental plants, but in folk medicine, dogwood bark, wood, flowers, fruits and seeds have many practical uses. Dogwood bark, especially root bark is known for its medicinal properties when used as powder, infusion or decoction, being used as tonic, astringent, and fever releaser (Cappiello and Shadow, 2005). It is also used for treating the fever episodes associated with malaria, although recent studies have shown that the antiparasitical compounds in C. florida do not have direct antiplasmodial activity in vivo (Graziose et al., 2012). The early colonists of North America peeled off the bark from young dogwood twigs and used them to brush their teeth (Cappiello and Shadow, 2005). C. florida flowers were used in infusions by the native nations of North America to treat colic, and the fruit of C. canadensis was dried and used as an alternative carbohydrate source during the winter (Cappiello and Shadow, 2005). The fruits of all dogwood species are edible, but are unpleasant for human consumption due to their acidic taste and large fruit-stones. The wood of larger stemmed dogwood plants like C. florida is considered to be tough and shock-resistant and it has been used to make shuttles, spindles, cotton reels, tool handles, cogs and hubs of wheels (Dallimore, 1915). According to the United States Department of Agriculture (USDA, 2013), there are 14 Cornus representatives in the Canadian flora (Table 1.1), but only two of these species are affected by dogwood anthracnose in nature: C. florida and C. nuttallii (Hibben and Daughtrey, 1988; Byther and Davidson, 1979). It is interesting that the only native species susceptible to dogwood anthracnose are also closely related, being the only two representatives of subgenus Cynoxylon, as described above (Figure 1.1). The traits that differentiate C. nuttallii from C. florida are traits that place C. nuttallii closer to C. kousa (Murrell, 1993; Hardin and Murrell, 1997), and this last species has been found to be susceptible to dogwood anthracnose under natural inoculation conditions (Daughtrey and Hibben, 1994). C. florida (flowering dogwood) is a small to medium-sized tree, which can grow up to 10 m in height, with opposite leaves and rough bark. The most noticeable feature is the presence of 4-6 large, showy, petal-like white bracts that surround small clusters of flowers (Bickerton and Thompson-Black, 2010). C. florida used to be one of the most common understory trees in eastern North America and it is also a very popular ornamental tree, with at least 135 cultivars

(Cappiello and Shadow, 2005; Holzmueller et al., 2006). The native distribution of this species ranges from southwestern Ontario to northern Florida (Bickerton and Thompson-Black, 2010) (Figure 1.2 and Figure 1.3). C. nuttallii (Pacific dogwood) is the closest relative of C. florida in North America, related at the subgenus level (Xiang et al., 2006), and is also easy to identify during the flowering period, due to the attractive floral bracts occurring in groups of 4 or 6 around inflorescences. The natural range of this species is from southwestern British Columbia to southern California (Little, 1976), and it is also a highly appreciated ornamental tree (Figure 1.4). C. kousa (also known as Benthamidia kousa, common name – kousa dogwood, or C. kousa ‘Chinensis’ – Chinese dogwood) is a deciduous tree, 8-12 m high, native to eastern Asia. It is also highly prized as an ornamental due to the four large white bracts, surrounding the dense cymes of inconspicuous flowers. Unlike C. florida and C. nuttallii, leaves of C. kousa are elliptical, and flower bracts have pointy tips (Cappiello and Shadow, 2005). When C. kousa was grown close to diseased C. florida specimens in North America or in Europe, it was susceptible to dogwood anthracnose (Brown et al., 1996; Holdenrieder and Sieber, 2007). However, studies by Brown et al. (1992) and Holmes and Hibben (1989), found C. kousa to be relatively resistant, compared to C. florida, while the cultivar C. kousa ‘Chinensis’ has been found to be more susceptible to dogwood anthracnose than C. kousa and even more than C. florida (Brown et al., 1996). C. kousa belongs to the subgenus Syncarpea, which is closely related to Cynoxylon, the subgenus of C. florida and C. nuttallii, and both subgenera belong to the “big-bracted” group of dogwoods (Xiang et al., 2006). The close genetic relationship between C. florida, C. nuttallii and C. kousa, as shown in Figure 1.1, could help explain the susceptibility of these species to dogwood anthracnose. However, multiple attempts to find D. destructiva on C. kousa in Japan have been unsuccessful (N. Zhang and T. Hsiang, personal communication, 2013). Most of the agents causing diseases on dogwood plants are fungi, producing spots and blights on flowers and leaves, cankers and dieback on twigs and branches, root rots and powdery mildews (Daughtrey and Hagan, 2001). The most common fungal diseases reported on dogwoods are: Septoria leaf spot caused by Septoria cornicola, spot anthracnose caused by Elsinoe corni, limb dieback caused by Colletotrichum gloeosporioides or C. acutatum, powdery mildew caused by Microsphaera penicillata or Phillactinia guttata, and dogwood anthracnose caused by Discula destructiva (Daughtrey and Hagan, 2001). This introductory chapter will

7 review these diseases, with an emphasis on dogwood anthracnose.

1.3 Major fungal diseases of dogwoods Numerous species of fungi of different taxonomic origin have been identified as inhabiting the underground and aerial parts of dogwood plants and producing rot (root, crown and or stem), canker (stem or twig), leaf spot and leaf blight, anthracnose, powdery mildew, rust and mosaic symptoms (Lambe and Justis, 1978; Farr et al., 1989; QSPP, 2003). This section will deal with only the most commonly isolated symptom-associated fungi on dogwood leaves. Dogwood anthracnose symptoms are frequently mistakenly diagnosed as spot anthracnose, Septoria leaf spot or Colletotrichum blight, thus the following information offers the means to distinguish dogwood anthracnose from other similar diseases.

1.3.1 Spot anthracnose caused by Elsinoe corni Elsinoe corni is an ascomycetous plant pathogen, with Sphaceloma as the conidial stage (Byther and Davidson, 1979). The disease caused by this fungus is called “spot anthracnose” and was first reported in the United States in 1948 by Jenkins and Bitancourt (Jenkins et al., 1953), a few decades before the outbreak of “dogwood anthracnose” produced by Discula destructiva. The disease appears in early spring (Anderson et al., 1994) and the symptoms are characteristic and easily identifiable as many small (1-2 mm diameter) necrotic spots on all aerial parts of the plant, from bracts, leaves, petioles and fruits to twigs. As opposed to the irregular, large dogwood anthracnose lesions, the spots produced by E. corni are very abundant, even up to 100 per leaf and even if they coalesce, the lesion diameters are still only a few mm. They are reddish at first, and then become dark brown and their centers dry out and fall out, giving the leaf a shot hole appearance. Heavy infections occur in springs with extended wet weather and this may result in malformed leaves (Alfieri, 1970; Lambe and Justis, 1978).

1.3.2 Septoria leaf spot caused by Septoria cornicola Septoria cornicola causes Septoria leaf spot. The necrotic spots are larger than those found in spot anthracnose (2-3 mm diameter or more if spots coalesce) and are more evident on the adaxial leaf surface due to a bright purple border (Neely and Nolte, 1989) which may cause

8 them to be confused with dogwood anthracnose spots, which also have a purple border (Anderson et al., 1994). As opposed to dogwood anthracnose which appears early in the spring, Septoria leaf spot appears in the summer or fall and does not lead to branch die back (Neely and Nolte, 1989), since only foliar tissue is affected. Septoria leaf spot affects almost all Cornus spp. and can cause premature defoliation (Neely and Nolte, 1989), but this fungus rarely affects the health of its host, even when many leaves become heavily spotted (Jenkins et al., 1953). Other species of Septoria have been found to selectively infect particular species of Cornus and their names reflect the name of the host. These species are: S. canadensis (on Cornus canadensis), Septoria cornimaris (on C. mas), S. cornina (cosmopolitan, as S. cornicola), and S. floridae (on C. florida). Lesions and conidiomata of these species are generally similar (Farr, 1991).

1.3.3 Limb dieback caused by Colletotrichum gloeosporioides and C. acutatum Anthracnose caused by Colletotrichum gloeosporioides (or Glomerella cingulata) was reported in 1965 (Toole and Filer, 1965) and was also mentioned as a disease of flowering dogwood (C. florida) and stiff dogwood (C. stricta ) by Farr et al. in 1989. In the early 1990’s, a related fungus, Colletotrichum acutatum (or Glomerella acutata) was reported as the causal agent of an anthracnose disease of flowering dogwood (Chellemi et al., 1993) and then again later (Strandberg and Chellemi, 2002). The symptoms produced by C. acutatum have been described as similar to dogwood anthracnose by Redlin (1991) and Anderson et al. (1994). Shi et al. (2008) stated that it is difficult to distinguish C. acutatum from C. gloeosporioides based on symptoms or colony morphology, since these pathogens are closely related and produce similar lesions on host tissues and similar colonies on media. They provided a molecular method for identification (Shi et al., 2008).

1.3.4 Powdery mildew caused by Microsphaera penicillata and Phyllactinia guttata Powdery mildew is considered by some researchers to be one of the most economically important fungal diseases of flowering dogwood, since it causes severe leaf deformation and defoliation on C. florida (Hartman, 1998). In Connecticut this disease is thought to be even more dangerous than dogwood anthracnose (Smith, 1998). Microsphaera penicillata, also known as M. pulchra or Erysiphe pulchra, and Phyllactinia guttata, also known as P. corylea, have been associated with powdery mildew on dogwood (Klein et al., 1998; Braun and Takamatsu, 2013). One or both fungal species were found to produce powdery mildew on numerous native or introduced dogwood species and cultivars (Farr et al., 1989). The most evident symptom is that all aerial organs of affected plants become covered in a white-pulverulent matrix which is the fungal mycelium, usually growing superficially on the host (Bushnell and Allen, 1962). All powdery mildew fungi are obligate parasites (Agrios, 2005), and although the host is not killed by the fungus, severe infection can decrease photosynthesis (Agrios, 2005) and reduce accumulation of organic and inorganic substances (Yarwood and Jacobson, 1955) which can debilitate the host.

1.3.5 Dogwood anthracnose caused by Discula destructiva 1.3.5.1 Disease history and distribution The first symptoms of dogwood anthracnose were observed in 1976 by Byther and Davidson on a symptomatic sample of Pacific dogwood (C. nuttallii) collected from the Vancouver, Washington, area (Byther and Davidson, 1979). Then in the following years, they saw similar symptoms on Pacific dogwood in Seattle and other western Washington areas. By 1978, at least 60% of the trees in the Seattle area showed symptoms, and the disease was named dogwood anthracnose or leaf blotch in an article by Byther and Davidson published in 1979. In about the same period of time, a “mysterious” disease was observed on flowering dogwood (C. florida) in southeastern New York and southwestern Connecticut and reported in a “New York Times” article published by Pirone in 1980. Symptoms on flowering dogwood were later found to be similar to those on Pacific dogwood (Hibben and Daughtrey, 1988). Efforts to identify the causal agent of dogwood anthracnose were first reported in 1979 when the anthracnose of Pacific dogwood (C. nuttallii) was described and named by Byther and Davidson (1979), and continued until 1991 when the pathogen was identified and described by

Redlin (1991). Initially, it was thought that the pathogen on Pacific dogwood (C. nuttallii) was different than that on flowering dogwood (C. florida L.). Gloeosporium corni (Byther and Davidson, 1979) or Gloeosporium sp. (Funk, 1985) and then Discula sp. (Salogga, 1982) were identified as the etiological agents of dogwood anthracnose on the west coast, while Colletotrichum gloeosporioides (Pirone, 1980) and then Discula sp. (Daughtrey and Hibben, 1983) were tentatively identified as the causal agents infecting C. florida on the east coast. Hibben and Daughtrey (1988) concluded that the disease was the same on both dogwood species and caused by one pathogen, Discula sp., which later was identified as Discula destructiva by Redlin (1991). The possible range of dogwood anthracnose in Canada is limited by the host occurrence. According to COSEWIC (2007) C. florida is found only in the extreme southwest Ontario, isolated populations being scattered throughout an area of approximately 22,500 km2 (Figure 1.3). The native range of C. nuttallii in Canada is only in southwest British Columbia, in an area of approximately 30,000 km2 (Figure 1.4). Disease incidence in Canada was first reported for Pacific dogwood in 1996, on a map by Daughtrey et al. (1996) (Figure 1.5). In this study it has been stated that the disease affected all sites of Pacific dogwoods in British Columbia. Disease incidence on flowering dogwood in Ontario has been assessed by the Committee on the Status of Endangered Wildlife in Canada (COSEWIC, 2007) based on samples collected in 2004 and 2005. A total of eight counties and regions with C. florida populations were assessed for dogwood anthracnose and the disease was confirmed in Essex, Middlesex and Norfolk Counties and in Niagara Region. Samples collected from Halton Region and Chatham-Kent County showed conspicuous symptoms of dogwood anthracnose, although disease presence was not confirmed, while Hamilton and Elgin Counties were symptom and disease-free (COSEWIC, 2007). In the United States, dogwood anthracnose distribution has been thoroughly documented. The most recent disease assessment made on flowering dogwood was from 2011 (Figure 1.6), and was published on the website of the United States Department of Agriculture Forest Service (USDA, 2013). Comparing the situation recorded in eastern U.S. in 1994 with the situation in 2011 for the same region, it is apparent that mostly the same states were affected in both assessments, except for Missouri where the positive sites reported in 1994 had been associated with importation of out-of-state nursery stock (Daughtrey et al., 1996). The assessment made in 2011 revealed that this state was free from disease. Out of 32 U.S. states where C. florida grows

11 naturally (USDA, 2013), 24 states were positive for dogwood anthracnose in both assessments. However, the disease was reported in more counties in 2011 than in 1994. The northern part of the U.S. range of flowering dogwood seemed to be more affected than the southern part, and this is consistent with the findings that disease severity is enhanced by cooler, wet weather (Chellemi et al., 1992). Regarding the situation on Pacific dogwood, the only assessment is the one reported by Daughtrey et al. in 1996. The reduced research activity and public concern on this species could be due to a lesser utilization of Pacific dogwood as an ornamental on the west coast than flowering dogwood on the east coast (Daughtrey et al., 1996). Recently, dogwood anthracnose has been reported also in Europe, mostly on C. florida and C. nuttallii imported from the U.S., but there is one instance where an imported C. kousa specimen growing next to an infected C. florida, also became infected (Holdenrieder and Sieber, 2007). The first report of dogwood anthracnose in Europe was made in 1995 in the United Kingdom, on C. florida trees imported from the U.S. (EPPO, 2013). In 2002 the disease appeared in Germany on C. florida (Stinzing and Lang, 2003), and in 2003 in Italy on C. florida and C. nuttallii (Tantardini et al., 2004). In Switzerland dogwood anthracnose was reported in 2006 on C. florida, although similar symptoms had been noticed on flowering dogwood a few years before (Holdenrieder and Sieber, 2007). Seven sites with C. florida have been checked in Switzerland and all were found positive for dogwood anthracnose, and the disease was found to affect also C. nuttallii and one specimen of C. kousa in a botanical garden. None of the native European dogwoods (C. sanguinea and C. mas) were found to be affected in the field, although artificial inoculations conducted by Holdenrieder and Sieber (2007) showed successful infection.

1.3.5.2 Symptoms Dogwood anthracnose symptoms consist mainly of leaf spots and leaf blight leading to defoliation (Byther and Davidson, 1979). In severe infections the fungus manages to progress to twigs and branches, causing dieback and cankers (Hibben and Daughtrey, 1988). Usually the disease begins in the lower part of the canopy, as a result of the fungal spores being vectored by rain splash (Hibben and Daughtrey, 1988). When lower branches are severely affected, they lose their leaves and die, and for this reason the disease has been previously called “lower branch dieback” (Daughtrey and Hibben, 1983). Early in the spring, small brown necrotic spots with purple margins appear on bracts and newly formed leaves. Later in the season, spots may

12 coalesce, forming blotches (Figure 1.7), or leaves can be completely blighted (Figure 1.8); it has been observed that the first pair of leaves usually becomes blighted, especially if wet weather prevails, while successive leaves on the same shoot present only spots and blotches (Hibben and Daughtrey, 1988). When spot centers disintegrate, shot holes may appear (Daughtrey and Hagan, 2001). Discula destructiva is known to progress through vascular tissues, via petioles, extending to twigs where it causes twig dieback and shepherds crook (Walkinshaw and Anderson, 1991). Blighted leaves attached to dead twigs usually don’t abscise in the fall, remaining attached throughout winter (Hibben and Daughtrey, 1988). From twigs, the fungus progresses to branches, causing branch dieback and as a result, new epicormic sprouts proliferate the following year (Hibben and Daughtrey, 1988; Walkinshaw and Anderson, 1991). These tender, succulent sprouts are easily infected the following spring, thus allowing the pathogen a route to the main stem, resulting in cankers. Multiple cankers may kill the entire tree within one to five years depending on age, size, vigor and environment (Chellemi and Britton, 1992). The fungal fruiting bodies (acervuli) containing spores (conidia) can be seen as tiny brown dots on the abaxial part of necrotic spots or blotches (Byther and Davidson, 1979). The acervuli formed on infected leaves are 30-135 µm wide and usually associated with leaf trichomes, characteristic for D. destructiva (Redlin, 1991). Where trichomes were not seen associated with conidiomata, it was believed that they had fallen off (Redlin, 1992) (Figure 1.9). Environmental conditions such as moisture and shade can favour the pathogen and as a result, foliar symptoms may have different appearances depending on weather (Parham and Windham, 1992). Thus, under favorable disease conditions, such as prolonged wet, cloudy periods, D. destructiva produces leaf blight, initiated at leaf tip and expanding along the midvein into the twig. But in dry, hot weather, dogwood anthracnose symptoms appear as irregular, light brown spots with reddish-brown borders. For trees growing in exposed landscape plantings, the symptoms are more severe in the lower canopy. Understory dogwoods, which have shaded canopies and thinner leaves, are more likely to be uniformly affected (Daughtrey et al., 1996). Stress factors such as drought and winter injury may weaken trees and increase disease severity (Mielke and Daughtrey, 2011). The infection cycle can go on throughout the growing season when environmental conditions are conducive to disease. In years with dry summers, only one cycle of infection has

13 been reported, such as in Connecticut (Britton, 1993), while secondary infections may occur when wet weather is prevalent (Britton, 1993; Hibben and Daughtrey, 1988). Disease dispersal over small distances is thought to be via rain splash and wind, since the spores of D. destructiva are released in a mucilaginous matrix (Daughtrey and Hibben, 1994). Over long distances, birds and mammals are potential carriers of conidia, since the fungus has been successfully isolated from fruit and seed of infected dogwoods (Britton et al., 1993). Viable D. destructiva spores were found in the frass of the convergent lady beetle, Hippodamia convergens (Coleoptera: Coccinellidae), which has been used as a model insect by Hed et al. (1999) to demonstrate that insects associated with diseased dogwoods in the field can disseminate spores of D. destructiva in dogwood populations. This insect carried viable spores both internally and externally up to 16 days after exposure to inoculum (Colby et al., 1995).

1.3.5.3 Morphology and reproduction of Discula destructiva The causal agent of dogwood anthracnose is a filamentous, ascomycetous fungus in class Sordariomycetes, order Diaporthales, family Gnomoniaceae, described and named as Discula destructiva by Redlin in 1991. The affiliation with Diaporthales is suggested by the conidial state of this fungus (Redlin, 1991), and has been confirmed molecularly (Zhang and Blackwell, 2001). In culture on potato dextrose agar (PDA) or malt extract agar (MEA), D. destructiva produces white-grey colonies, becoming darker with age to brown or green. The overall appearance of the colony is appressed with a granular look due to tufted growth (Redlin, 1991). In comparison to other fungal species, it grows slowly on PDA at room temperature (approx. 8 mm per day) and produces zonate rings, with undulate margins (McElreath 1993). The colony surface may present black spots 100-200 µm in diameter, which are dried droplets of exudate (Redlin, 1991). On the back side of plates, white crystals up to 1mm diameter are visible and these crystals can dissolve in 3% KOH (Redlin, 1991). Discula destructiva rarely sporulates on regular media, such as PDA, but it has been found to sporulate abundantly on media amended with ground leaves of dogwood, maple or oak (McElreath and Tainter, 1993) or on oatmeal agar (Redlin, 1991). In culture, conidiomata are orange or brown-black, depending on the media, with a globular shape, 150-300 µm in diameter, scattered on the outer portions of the mycelia (Hibben and Daughtrey, 1988). On host tissues, acervular conidiomata develop under the cuticle on necrotic lesions, mostly on abaxial leaf

14 surfaces, producing hemispheric swellings, frequently associated with trichomes (Redlin, 1992). Upon abaxial cuticle rupture, single-celled conidia are released in cirrhi or slimy masses. Conidia are transparent, ellipsoid-fusiform, 6-12 x 2.5-4 µm, with polar oil droplets (Redlin, 1991). Electron microscopy pictures by Redlin (1992) showing these morphological features are shown in Figure 1.9, and spores are presented in a light microscope image in Figure 1.10. Sexual reproduction in fungi usually takes place between sexually compatible strains, named mating types, which have genetic determinants. Fungi requiring a partner to reproduce sexually are heterothallic (self-sterile), but there are fungal species that do not require a mating partner and these are called homothallic (self-fertile). The two alternate mating types are determined by sequences present at the same homologous loci named “idiomorphs” rather than “allele”, since these sequences have no allelic relationship to one another (Coppin et al., 1997; Kronstad and Staben, 1997). The main role of the mating types is to control the recognition mechanisms which lead to fertilization. Fertilization in fungi implies the fusion of a male element that can donate a nucleus with a cell of the female organ which can accept this nucleus (Coppin et al., 1997). The sexual stage of a fungus is called the teleomorph, while the asexual stage is called the anamorph (Hennebert and Weresub, 1977), and these traditionally are associated with different Latin names. However, these terms have been superseded in the latest rules of nomenclature regarding fungi which prescribe a single name for each fungus (Hawksworth et al., 2011). Discula destructiva has been found to reproduce only asexually (Redlin, 1991; Rossman et al., 2007). A teleomorph for this fungus has not been found, in spite of many efforts to find the putative gnomoniaceous perithecia in plant litter under infected trees or to induce a sexual stage in laboratory (Redlin, 1991). A screening for the presence of mating type genes within D. destructiva populations could give insights into the possible sexual reproduction of this fungus in local populations.

1.3.5.4 Population structure and origin of Discula destructiva Numerous studies have been made regarding the genetics of D. destructiva populations. Most of these studies tested only isolates from the U.S., either from the east coast (McElreath et al., 1994; Yao et al., 1994.; Caetano-Anolles et al., 2001) or from both east and west coasts (Rong et al., 2001; Zhang and Blackwell, 2001), and a few studies included also isolates from

British Columbia (Trigiano et al., 1995; Caetano-Anolles et al., 1996; Yao et al., 1997). To our knowledge no research has been done on Ontario populations of D. destructiva. The methods used in the above mentioned studies included one of the following techniques: presence of double stranded RNA (dsRNA), DNA amplification fingerprinting (DAF) or arbitrary signatures from amplification profiles (ASAP). One common finding in all of these studies was that D. destructiva populations are highly homogeneous, the level of uniformity being higher than in other asexual reproducing fungi, suggesting a recent introduction in North America. Discula destructiva populations causing disease in eastern U.S. were found to be different than those on the west coast of North America, suggesting a separate origin for the isolates on the two coasts (Caetano-Anolles et al., 1996). Eastern American populations were also different among each other. Zhang and Blackwell (2001) discovered 20 genotypes among 72 D. destructiva isolates obtained from both costs of the U.S., and 17 of these genotypes were from eastern isolates, while only three genotypes came from western isolates. However, no significant changes were observed in the polymorphism of the eastern populations during a period of nine years from 1990 to 1999 (Zhang and Blackwell, 2001). This suggests that several different clonal genotypes may have been introduced into the eastern USA and spread, rather than variation being a result of possible sexual reproduction. Rong et al. (2001) has found high diversity of dsRNA viruses within strains of D. destructiva. The sudden appearance and high severity of this disease led Hibben and Daughtrey (1988) to speculate that this fungus was a mild native pathogen which became extremely virulent under favorable abiotic factors. But the outbreak of dogwood anthracnose near international ports, such as New York and Vancouver, supported the notion that this fungus was imported via nursery stock (Hibben and Daughtrey, 1988; Redlin, 1991). Since molecular studies have found low levels of genetic diversity within D. destructiva populations in North America, the exotic origin of this pathogen and its recent introduction to North America are more likely (Trigiano et al., 1995). It is believed that Asia might be the place of origin for this fungus, because dogwood anthracnose has not been reported as a problem in this region, despite the high diversity of native Cornus species especially in eastern Asia (Xiang et al., 1996), and the kousa dogwood, C. kousa has been found to be relatively resistant to this disease (Brown et al., 1992; Holmes and Hibben, 1989).

Since no research has been done on Ontario populations of D. destructiva, it would be of interest to assess the genetic variability of this fungus in Ontario. The genomic sequence of isolates of this fungus became available during the course of this study, so they were used to derive SSR markers and test on collected isolates to assess genetic variation. The presence of different mating type idiomorphs were as well tested based on the primers derived from genome sequence data.

1.3.5.5 Infection process Attempts to explain the phenomena involved in the infection process of D. destructiva on C. florida have been made since the description of the fungus in 1991 (Redlin, 1991and 1992) until 2011 when Cheng et al. provided a detailed study on the events of D. destructiva infection. Different methodologies and tissues have been used by different authors. The plant material used was represented by dogwood seedlings (Walkinshaw and Anderson, 1991; Brown et al., 1996), whole leaves (Brown et al., 1994b; Ament et al., 1998) or leaf discs (Redlin, 1991 and 1992; Cheng et al., 2011), while the inoculum was represented by mycelial plugs (Redlin, 1991 and 1992) or spore suspensions (Walkinshaw and Anderson, 1991; Brown et al., 1994b; Ament et al., 1998; Cheng et al., 2011). One pre-requisite for successful infection throughout these studies was the presence of wounds on tissues prior to inoculation, since non-wounded tissues appeared to be resistant to infection (Walkinshaw and Anderson, 1991; Redlin, 1992; Brown et al., 1994b). Wounding of leaf tissue has been achieved by treatment with diluted hydrochloric acid, by pressing with a heated metal rod or by poking with insect pins. Brown et al. (1994b) used unwounded, detached leaf-pairs inoculated with a spore suspension and stated that no direct penetration nor penetration via stomata, nor any type of successful entry of the pathogen into host cells was observed, but that germ tubes were found to be consistently associated with leaf trichomes. The authors explained this association by inferring the existence of host leachates at the base of trichomes, which might promote spore germination and fungal growth, but no penetration was observed. However Cheng et al. (2011), who used pin-wounded leaf-discs, said that germ tubes could enter leaf cells directly, without appressoria, and did not note penetration through wounds or stomata.

The role of plant-released nutrients for spore germination is well known (Dickinson, 2003). Cheng et al. (2011) did not mention any association of hyphae with trichomes before penetration. The only mention of fungal tissue associating with leaf trichomes was in relation to the formation of sporulation structures at eight days after inoculation (DAI) (Cheng et al., 2011), and this is consistent with the findings of Redlin (1991, 1992) on the association of conidiomata of D. destructiva with host trichomes. Beside the existence of wounds, the second important factor for successful infection with D. destructiva was moisture. It has been shown that moisture is vital for spore germination (Agrios, 2005). A study made by Ament et al. (1998) demonstrated that dogwood anthracnose symptoms on artificially inoculated C. florida plants were more severe when plants had been incubated in plastic bags for seven days than for shorter incubation times. To ensure humidity, the studies above incubated plants in plastic bags for 24 hours or more, or when detached leaves were used, the Petri plates were sealed with double parafilm layers. Direct penetration by germ tubes occurred at 3 DAI, without appressorium formation or through wounds or natural openings (Graham et al., 1991; Cheng et al., 2011) (Figure 1.11). One study found extracellular cellulases, hemicellulases, pectinases, lipases and polyphenol oxydase in the growth medium of D. destructiva, but the fungus was not able to degrade native cellulose and starch (Trigiano et al., 1993). Artificial inoculations revealed that after penetration, the fungus invades various leaf tissues, causing necrosis of both photosynthetic and vascular cells; necrosis appears also in tissues with few visible hyphae, suggesting the existence of a mycotoxin released by the pathogen (Walkinshaw and Anderson, 1991). Four toxins have been isolated from culture filtrates of D. destructiva isolates recovered from infected dogwoods: 4-hydroxy-3- (3’-methyl-2’-butenyl) benzoic acid, 4-hydroxybenzoic acid, (+)-6-hydroxymellein and (−)- isosclerone (Venkatasubbaiah and Chilton, 1991). These toxins are thought to be responsible for dogwood anthracnose-like symptoms on seedlings and detached leaves treated with purified culture filtrates of D. destructiva (Wedge et al., 1999), as well as of chloroplast damage and tissue disintegration observed by Cheng et al. (2011) in the pathogenesis of D. destructiva. Before sporulation, hyphae accumulated near epidermal cells (Walkinshaw and Anderson, 1991; Cheng et al., 2011) and usually under trichomes (Redlin, 1992; Cheng et al., 2011). Sporulation has been observed 14 or 20 DAI (Walkinshaw and Anderson, 1991; Cheng et al., 2011) and the

18 association of acervuli with host trichomes is characteristic for D. destructiva, but unknown for other Discula spp. and is considered unusual for coelomyceleous fungi (Redlin, 1992).

1.4 Hypotheses and objectives 1) Hypothesis: Discula destructiva is the cause of dogwood anthracnose symptoms in Canada. Background: Discula destructiva has been found to be the causal agent of dogwood anthracnose in the United States and western Canada and it has caused massive mortality of Cornus florida populations in eastern U.S. in late 1970’s and late 1980’s. However the causal agent of dogwood anthracnose in Ontario needs to be confirmed. Objectives: Associate symptoms on dogwood leaves with fungal species isolated from symptomatic samples and confirm the causal agent of dogwood anthracnose in Ontario and British Columbia as Discula destructiva. Then characterize the pathogen and assess disease incidence in Canada.

2) Hypothesis: dogwood anthracnose is found only on Cornus florida and C. nuttallii. Background: Although the genus Cornus comprises over 50 species, dogwood anthracnose has been found to affect only Cornus florida and C. nuttallii in nature. Artificial inoculations could reveal the degree of susceptibility to Discula destructiva isolates from Ontario for other Cornus species grown in Ontario. As well, inoculation studies with other plant genera may show whether the fungus can survive on those tissues. Objective: Assess the host range of dogwood anthracnose on native and introduced species such as: Cornus alba ‘Bud’s Yellow’, C. amomum, C. alternifolia, C. kousa ‘Chinensis’, C. florida, C. racemosa, C. rugosa, C. sericea. As well, diverse forest tree species such as oak, maple and pear were also tested for susceptibility.

3) Hypothesis: Discula destructiva was recently introduced into Canada, and hence populations have low genetic diversity. Background: Numerous studies made on D. destructiva populations from the United States and isolates from western Canada have revealed low genetic variation within these populations. These findings have been interpreted as supporting the hypothesis that D. destructiva was introduced relatively recently and that the populations have not had time to evolve. No genetic

19 studies have been done on Ontario populations of this fungus. Objective: Assess genetic variation of the dogwood anthracnose fungus in Ontario and British Columbia.

4) Hypothesis: Discula destructiva reproduces asexually in Ontario populations. Background: Since the genetic polymorphism of D. destructiva populations is low, and no sexual stage has been found for this fungus, it has been inferred that it reproduces only asexually in North America. However, mating type genes have not been investigated for this species, and should be assessed for isolates obtained from Ontario and British Columbia. Genome sequencing data can be used to develop conserved primers for detecting mating type genes in a wide range of isolates. Objective: Assess the incidence of mating type genes in Ontario and B.C. isolates of Discula destructiva.

Table 1.1 List of ornamental dogwoods (Cornus spp.) and infection by Discula destructiva in natural settings (Daughtrey and Hibben, 1994; Cappiello and Shadow, 2005; USDA, 2013). Native to Natural Cornus species Common name Canada infection C. alba Tartarian dogwood C. alternifolia pagoda dogwood x C. amomum silky dogwood C. angustata evergreen Chinese dogwood C. asperifolia rough leaf dogwood C. australis - C. bretschneideri - C. canadensis bunchberry, dwarf cornel x C. capitata evergreen Himalayan dogwood C. chinensis - C. controversa giant dogwood C. drummondii rough-leaved dogwood x C. glabrata brown dogwood C. florida flowering dogwood x x C. kousa kousa dogwood x C. macrophylla bigleaf dogwood C. mas cornelian cherry dogwood C. nuttallii Pacific dogwood x x C. obliqua - x C. oblonga - C. officinalis Japanese cornel dogwood C. paucinervis - C. pumila - C. racemosa gray dogwood x C. rugosa round/ rough leaved dogwood x C. sanguinea blood twig, common dogwood C. sessilis black fruited dogwood C. sericea red osier dogwood x C. suecica bunchberry, dwarf cornel x C. intermedia (canadensis x - x suecica) C. acadiensis (alternifolia x - x sericea) C. slavinii (rugosa x sericea) - x C. unalaschkensis western cordilleran bunchberry x C. walteri Walter dogwood

MP Tree Species Subgenera Genera Morphological (Xiang et al., 2006) (Xiang et. al., 2006) (Hara, 1948; groups Hutchinson, 1967) (Fan and Xiang, 2001) C. oblonga C. peruviana Yinquania C. alba C. amomum C. racemosa Kraniopsis Svida (Swida) blue/white C. rugosa C. sericea C. alternifolia C. controversa Mesomora C. kousa C. hongkongensis C. multinervosa Syncarpea C. capitata Dendrobenthamia Benthamidia big-bracted C. disciflora Discocrania C. florida Cynoxylon Cynoxylon C. nuttallii C. canadensis Arctocrania Chamaepericlymenum dwarf cornels C. suecica C. volkensii Afrocrania Afrocrania C. sessilis cornelian C. mas Cornus cherries Cornus C. eydeana C. chinensis Sinocornus

Figure 1.2 Native distribution of Cornus florida in North America (Little, 1971).

Figure 1.4 Native distribution of Cornus nuttallii in North America (Little, 1976).

Figure 1.6 Geographical distribution of dogwood anthracnose in C. florida populations in the United States in 2011. Individual counties are colored to show the occurrence of dogwood anthracnose (USDA website, accessed December 2013 http://www.fs.fed.us/foresthealth/technology/pdfs/PestRanges_da.pdf).

Figure 1.7 Leaf spot and blotch on Cornus florida leaves, due to dogwood anthracnose.

Figure 1.8 Leaf blight on Cornus nuttallii leaves due to dogwood anthracnose.

Figure 1.10 Conidia of Discula destructiva. Size bar represents 10 µm.

Chapter Two: The Causal Agent of Dogwood Anthracnose 2.1 Introduction In a report published in 2011 by The Committee on the Status of Endangered Wildlife in Canada titled “Canadian Wildlife Species at Risk”, and based on an assessment made in 2007, the flowering dogwood (Cornus florida) was ranked as an “endangered species” (COSEWIC, 2011). According to the same publication, the term “endangered” was defined as a wildlife species facing imminent extirpation or extinction. This situation was attributed to the disease dogwood anthracnose, caused by the fungus Discula destructiva (COSEWIC, 2007). Cornus florida is native to eastern North America and the northern limit of this species occurs on a narrow band in southwestern Ontario (Soper and Heimburger, 1982). The disease was first reported in Ontario in 1998 in Norfolk County (Davis, 2001), which has the second largest population of C. florida in Ontario, after Niagara Region (COSEWIC, 2007). A mortality rate of over 80% was recorded from 1995 to 2005 in Norfolk County (COSEWIC, 2007). There have been no studies on the biology of D. destructiva in Ontario, and the present work aimed to test the pathogenicity of D. destructiva on C. florida using Koch’s postulates. Koch’s postulates refer to a set of four rules, formulated in the late 1800s by Robert Koch, a German physician, to demonstrate a causal relationship between a microorganism and a disease, and are described as follows: (1) The organism must be associated in a pathological relationship to the disease and its symptoms; (2) The organism must be isolated and obtained in pure culture; (3) Inoculation of the host with the organism from the pure culture must reproduce the disease; and (4) The organism must be recovered once again from symptomatic tissues of the host (Koch, 1884). In addition to testing pathogenicity, the causal agent was further examined using both traditional morphological methods and newer molecular methods of identification. Another aim of this work was to design primers which would amplify specifically D. destructiva, as a reliable tool for detecting the presence of the dogwood anthracnose fungus inside symptomatic tissue.

2.1.1 Morphological identification of fungal isolates The traditional way to identify fungi is morphologically, based on macroscopic and microscopic features, such as colony appearance, color, texture, scent, hyphal structure, spores, before a confirmed annotation of a fungal DNA sequence (Webster and Weber, 2007). Morphological characters can be useful in fungi at higher taxonomic levels, but at lower

33 taxonomic levels fungi tend to have few distinguishing morphological characteristics and these may be similar between genetically diverse species (Njambere et al., 2010). Certain taxa have a limited number of distinctive morphological features (Hillis and Dixon, 1991). One solution is to examine the traits found at microscopic level, but it would only add a limited set of morphological information for taxa such as fungi which show limited morphological differentiation. Furthermore, the skills for morphological identification are becoming rarer and however can no longer sustain the fine taxonomic requirements provided only by molecular means.

2.1.2 Molecular identification of fungal isolates Molecular identification methods generally provide a higher level of resolution than the traditional morphological methods, and have become increasingly prominent. Accurate fungal identification is important not only for plant disease management, but also for the proper selection of resistance genes in plant breeding (Njambere et al., 2010). Since its discovery by K. Mullis (Mullis and Faloona, 1987) the polymerase chain reaction (PCR) has been found extremely useful to distinguish organisms because DNA fragments amplified from specific genes or regions can be separated by electrophoresis and show specific bands (Scow et al., 2001). The method of DNA sequencing established by Sanger et al. (1977) is still used for conventional sequencing of PCR products. There are several regions of DNA that have been commonly used for fungal identification including the following: translation elongation factor 1 alpha (EF1-α) (Roger et al., 1999), which is involved in mRNA translation; RNA polymerase2, largest subunit (RPB1) and RNA polymerase 2, second largest subunit (RPB2) (Liu et al., 1999), which are needed for mRNA transcription; and beta-tubulin (Thon and Royse, 1999), a cytoskeletal scaffolding protein. The most commonly used genomic region and the sequence targeted as a DNA fingerprint, is the internal transcribed spacer (ITS) found in the ribosomal DNA (rDNA) region of eukaryotes (Schoch et al., 2012). Forward (ITS1) and reverse (ITS4) primers were developed by White et al. (1990) and target the fungal DNA region between the 18S and 28S genes of the multicopy ribosomal genes. After amplifying and sequencing with both forward and reverse primers, the consensus sequence can be obtained. The sequencing results are usually compared against large

34 depositories such as GenBank, which is the genetic sequence database of the U.S. Government National Institutes of Health (NIH) containing DNA sequences submitted by scientists from all over the world. The Basic Local Alignment Search Tool (BLAST) (Altschul et al., 1997) is used to find and compare sequence similarity (blast.ncbi.nlm.nih.gov/Blast.cgi). By using BLAST, fungal species can often be at least roughly identified through comparisons with other fungal sequences if that species is properly represented in GenBank. For more precise identification, matching sequences should be downloaded and subject to analysis with various phylogenetic software, to more precisely examine similarities and relationships. When the aim is to detect a particular fungus in crude extracts of symptomatic plant tissues, specific primers can be used. These primers ensure the amplification of only the target sequence of the target organism. This technique was initially employed for the diagnosis of human diseases (Olerup and Zetterquist, 1992) and is now commonly used in phytopathology as a rapid method for identifying fungal pathogens in symptomatic samples (Zhang et al., 2011). One of the objectives of this work was to develop a specific and sensitive detection method for D. destructiva.

2.1.3 Dogwood diseases Dogwoods can be affected by diseases of different etiologies such as fungal, bacterial and viral or by insect pests. Most of the pathogens infecting Cornus sp. are fungi. Numerous fungal species have been identified as inhabiting the underground and aerial parts of dogwood plants and producing root, crown and stem rots, stem and twig canker, leaf spots and leaf blight, anthracnose, powdery mildew, rust and mosaic (Lambe and Justis, 1978; Farr et al., 1989; QSPP, 2003). The most common fungal diseases which can affect most dogwood species are as follows: spot anthracnose caused by Elsinoe corni, Septoria leaf spot caused by Septoria cornicola, anthracnose caused by Colletotrichum gloeosporioides or C. acutatum and powdery mildews caused by Microsphaera penicillata or Phyllactinia guttata (Daughtrey and Hagan, 2001). The most severe of the above mentioned diseases is anthracnose produced by Colletotrichum gloeosporioides or C. acutatum, since they can cause trunk and stem cankers which may kill the entire plant (Strandberg and Chellemi, 2002). But the disease responsible for the most severe losses in native dogwood populations in North America is dogwood anthracnose,

35 caused by D. destructiva, however under natural conditions it has been found to infect only C. florida, C. kousa, C. kousa ‘Chinensis’ and C. nuttallii (Daughtrey and Hibben, 1994). More than 85% of the U.S. populations of flowering dogwood in Connecticut and Maryland were decimated by dogwood anthracnose in the last two decades of the twentieth century (Anagnostakis and Ward, 1996 and Sherald et al., 1996). Subsequent studies showed a decrease in the damage caused by this disease such as 20% mortality in 2000 in Virginia (Carr and Banas, 2000). The disease peak in the late 1970’s to the 1980’s may be linked with environmental conditions which may have weakened the host, such as drought or acidic rainfall (Erbaugh et al., 1995; Brown et al., 1994a), as well as microclimate factors conducive to infection, such as high tree density, low evaporative potential, or sites with high elevation (Chellemi and Britton, 1992; Chellemi et al., 1992). There may also have been the possibility of shifts in the host populations or changes in the pathogen populations, but such alterations have not been documented. Other pathogens causing disease on dogwoods include the bacterial species Xylella fastidiosa which produces bacterial leaf scorch, usually when plants are weakened due to drought (Fulcher and Bowers, 2013), and one viral species, Dogwood Mosaic Virus, reported by the Quebec Society for the Protection of Plants (2003). Dogwood leaves and twigs can also be damaged by insects such as: the dogwood borer, Synanthedon scitula (Order Lepidoptera), the dogwood twig borer, Oberea tripunctata (Order Coleoptera), the flatheaded borers Chrysobothris azurea or Agrilus cephalicus, the twig girdler Oncideres cingulata, the scurfy scale Chinonaspis litneri, midge larvae Resseliella clavula and Parallelodiplosis subtruncata (McLemore, 1990; Bartlett, 2011).

2.1.4 Objectives Foliar symptoms produced by Discula destructiva have been easily confused with necrotic spots caused by other fungal pathogens. For example, a purple ring on leaves of C. alternifolia, and sometimes on C. amomum and C. florida, has been commonly referred to as anthracnose. Thus, the primary objective of this study was to identify fungi associated with symptomatic samples of dogwood using morphological and molecular techniques, and to demonstrate the pathogenicity of D. destructiva as the causal agent dogwood anthracnose. To reach these goals, the following objectives were set:

1) To assess the frequency of isolation of particular morphotypes or preliminarily identified species and write a “Dogwood Disease Symptom Guide”, to address practical needs of nursery and forestry professionals for identification of dogwood symptoms. 2) To identify the causal agents of dogwood foliar symptoms in Ontario and other parts of Canada. 3) To assess the pathogenicity of D. destructiva on C. florida. 4) To develop specific primers to detect the presence of D. destructiva in crude DNA extracts from symptomatic leaves.

2.2 Materials and methods 2.2.1 Sample collection Symptomatic samples of dogwood were collected from southwestern Ontario and southwestern British Columbia from 2010 to 2013. Most of the samples were submitted by cooperators from the Ontario Ministry of Natural Resources (OMNR) and from other collaborators in British Columbia and a few samples were collected from the Guelph Arboretum and other locations in Guelph (Table 2.1). Samples were collected monthly from diseased trees across Ontario and British Columbia. Initially the locations were random, but starting with the second growth season, collection focused on areas in Ontario that had been found positive for dogwood anthracnose in the previous year, and only a few new locations were sampled. Each sample set could contain up to 16 samples, consisting of symptomatic leaves and sometimes flowers, twigs and fruit, collected from one particular location at one sampling date. Plant identification was made morphologically by the collectors and confirmed in the lab also by morphology. To obtain healthy dogwood tissues for testing Koch’s postulates and assessing the infection process, symptomless tissues were collected from dogwood plants donated by nurseries that had been placed either in the University of Guelph greenhouse, or planted in the field at the Guelph Turf Grass Institute in Guelph, Ontario.

2.2.2 Media preparation Fungi were grown on 2% potato dextrose agar (PDA, Dickinson and Company, MD, USA). To suppress the growth of bacteria, PDA was amended with the antibiotics tetracycline (100 μg/mL final concentration) and streptomycin (100 μg/mL final concentration). Antibiotics

37 were added to PDA when the temperature was approximately 50 to 60 °C to avoid deactivation of the antibiotics. Each 9-cm-diameter Petri plate was filled with 15 mL PDA. A working stock of fungal isolates was kept on PDA plates at 4 °C, and for long-term storage, PDA plugs in water at 4 °C and frozen mycelium at -20 °C were prepared. To enhance growth of slow-growing isolates, 2% malt extract agar (MEA) (Dickinson and Company, MD, USA) was used. To enhance sporulation, two types of media were used: one was prepared with water agar supplemented with dogwood leaves and the other media was prepared with oatmeal agar. The dogwood leaf agar was prepared by adding 40 g of freshly collected, dried, finely ground leaf tissue to one liter of water agar (WA) (McElreath and Tainter, 1993). The oatmeal agar was prepared as follows: 100 g oatmeal was soaked in 500 mL water heated to 70 °C and the mixture was maintained at 60 °C for an hour. The mixture was filtered through gauze and the liquid squeezed out, and the initial volume was restored by adding water. And then 17 g of agar were melted in 500 mL water and mixed thoroughly with the 500 mL oatmeal liquid extract, and autoclaved at 121 °C for 15 minutes.

2.2.3 Fungal isolation from symptomatic dogwood tissues To isolate fungi from symptomatic tissues, necrotic areas were cut into pieces less than 5 mm2 and dipped in ethanol 70% for 30 s and then in sodium hypochlorite 1% for another 30 s, followed by two rinses in autoclaved deionized water. Four pieces were cultured in each 9-cm- diameter Petri plate containing antibiotic-amended PDA. The plates were incubated at 25 °C and observed daily for fungal growth up to 14 d. Colony types were grouped into morphotypes on the basis of colour and crude cultural characteristics (e.g. shiny, stringy, floccose). Representatives of each morphotype were subcultured and grown on PDA and later identified morphologically or molecularly. Some fungal species are extremely slow-growing on media and hard to isolate by surface sterilization of plant material, because they can become outgrown by other species co-inhabiting the plant tissue. In this situation, leaves or twig segments with necrotic lesions and evident fungal sporulation structures were placed in wet-chambers to enhance spore production. A wet- chamber was prepared by using two sheets of autoclaved filter paper on both the dish and the cover of a 9-cm-diameter Petri plate, and then moistening the filter paper with 1.5 mL of autoclaved deionized water. The plates were wrapped with two layers of parafilm, and incubated

38 inside plastic boxes to maintain humidity. The plant tissues inside the wet-chamber were checked for the presence of spores after three days and then daily for up to 14 days. For infected tissues which produced obvious sporulating structures such as pink, white, brown sporodochia or brown pycnidia, 100 μL of water were placed on the sporulating structures and a pipette tip was used to gently mix the oozing spores with the added water. An aliquot of 1 μL was retrieved and added to 100 μL water in a 1.5 mL tube and gently finger vortexed. A haemocytometer was used to measure the spore concentration and it was then adjusted to 103 spores/mL. A 100 μL aliquot was taken and spread over the surface of a of a fresh PDA plate using a surface-sterilized L-shaped glass rod. After 24 h, the plates were microscopically examined at 400× to look for the presence of isolated spores or colonies. Single spores were transferred with a sterilized glass needle onto fresh PDA, and subcultured again after a few days.

2.2.4 Identification of fungal isolates with morphological techniques Representatives of different morphotypes were grown on fresh PDA and incubated at room temperature. Fungal colour and colony texture were observed daily until the plates were fully covered. After that, features of the fungal cultures were observed weekly up to six months. Mycelial structures and spores were observed with light microscopy at 400×. Dimensions of hyphae and spores were recorded from three samples per isolate. Pictures were taken by digital camera at 400× magnification, and 1600 by 1200 resolution, and descriptions of each isolate were compared using fungal diagnostic keys, such as that of Barnett and Hunter (1972).

2.2.5 DNA extraction DNA was extracted following Edwards et al. (1991) with some modifications (Huang et al., 2001). To obtain fungal tissue, the target fungal isolates were cultured for one week to two months (depending on species) at 25 °C on 2% PDA plates overlaid with autoclaved cellulose membrane sheets (Flexel Inc., Atlanta, GA, US) following Hsiang and Wu (2000). The highest DNA concentrations for D. destructiva were obtained when the mycelium was two months old. Before this time, the mycelia were wet and foamy when ground, making the tissue- homogenizing step of the method difficult. In order to have available mycelium for DNA extraction and thus reduce the waiting time required for growing D. destructiva on cellulose PDA, mycelium from each isolate was harvested and stored in Eppendorf tubes at -20 °C. The

DNA concentration of D. destructiva, however, was much lower (by ~ 50%) when extracted from frozen mycelium as compared to fresh mycelium. Most fungal species used in this study were suitable for DNA extraction after one week of growth at 25 °C. Septoria cornicola, however, was the slowest growing species used in this study and it only fully covered a plate after four months of growth on WA amended with dogwood leaves. To hasten mycelial growth on cellulose membranes, multiple points of inoculation for all isolates were used. This enabled more thorough coverage of the cellulose surface with spores and fragments of hyphae, and mycelium harvest was performed after two months, when the colony had reached a proper thickness. The extracted DNA was stored at -20 °C.

2.2.6 Sequencing the genome of Discula destructiva The genome sequence of D. destructiva isolate 10115 was obtained in the T. Hsiang laboratory. First, the mycelium of fungal hyphae was grown on cellophane over PDA, and 500 mg mycelium was used for DNA extraction with Qiagen DNeasy Plant Mini Kit (Qiagen Inc., Mississauga, ON, Canada). And then 1 µg of genomic DNA was sent for sequencing at the University Health Network Gene Profiling Facility, Princess Margaret Hospital, Toronto, which used the Illumina GAIIx platform with half a lane of 100 bp paired-end reads of 500 bp fragments. And then the sequenced reads were assembled locally by T. Hsiang using SOAPdenovo 1.04 and GAPCLOSER 1.10 (Beijing Genomics Institute, http://soap.genomics.org.cn/soapdenovo.html). The genes were predicted by T. Hsiang from the assembly using Augustus 2.6.1 (http://bioinf.uni-greifswald.de/augustus) based on gene models from the related Sordariomycete, Fusarium graminearum.

2.2.7 Specific primer design and selection For the purpose of identifying and confirming D. destructiva as the causal agent of dogwood anthracnose in Canada, several primer sets were designed and used: primers for the elongation factor-1-alpha gene (EF1a), specific primers developed either based on the ITS region or after comparative genomics analysis, and primers derived from the mating type gene sequences. The primers designed based on the elongation factor gene were used for testing the genomic DNA template for suitability for PCR, since the gene encoding the elongation factor is

40 present in a genome as a single copy only. Obtaining an amplification product with EF1a primers, should mean that the DNA template had suitable quantity and quality for single-copy gene amplification. To design primers for the EF1a gene of D. destructiva, the predicted gene set of D. destructiva isolate 10115 was set up as a BLAST database, and several EF1a genes from GenBank were compared against it, using BLASTP. The nucleotide sequence of the putative EF1a gene (g4701) from the assembled genome was subjected to a comparison against the GenBank database, using the Basic Local Alignment Tool (BLAST) on NCBI website. The matching EF1a sequences of the following five fungal species were obtained: Cryphonectria sp. (Diaporthales), Cryptodiaporthe sp. (Diaporthales), Plagostoma sp. (Diaporthales), Pleospora sp. (Pleosporales) and Podospora sp. (Sordariales). The five sequences were then aligned with the EF1a sequence of D. destructiva (class Sordariomycetes, order Diaporthales, family Gnomoniaceae) from the assembled genome, using MUSCLE 3.6 (Edgar, 2004) and CLUSTAL X 1.83 (Thompson et al., 1997). Primers were designed based on the most conserved regions. The software “Gene Runner” 3.03 (Hastings Software, Inc. Hastings, NY) was used to obtain the reverse complement and verify whether the selected primer-pair met the requirements in terms of melting temperature, percentage of guanine and cytosine, and secondary structures. To obtain MAT primers, the target genes were searched for in the predicted genome of D. destructiva isolate 10115 by following the same steps as described above for the EF1a primers. Several MAT1-1 and MAT1-2 genes were compared against the predicted gene set of D. destructiva (BLASTP) to reveal whether this isolate had either MAT1-1 or MAT1-2 idiomorphs, or both. The putative MAT gene found had the nucleotide sequence compared against GenBank NR with BLASTN, and the top matching sequences were as follows: Aspergillus sp. (Eurotiales), Chaetomium sp. (Sordariales), Magnaporthe sp. (Magnaporthales), Myceliophthora sp. (Sordariales), Neurospora sp. (Sordariales), Podospora sp. (Sordariales), Sordaria sp. (Sordariales), Thielavia sp. (Sordariales), Verticillium sp. (Glomerellales). These MAT sequences were obtained and then aligned using CLUSTAL for the purpose of selecting potential priming sites. To select appropriate priming sites and check the selected primer pairs for PCR suitability, the software “Gene Runner” was used. Specific primers were needed to identify D. destructiva isolates from other fungal isolates that shared similar morphology, and to detect the presence of the dogwood anthracnose fungus in

41 crude extracts of symptomatic plant tissue. The first approach was a comparative genomic analysis to identify potentially unique genes in D. destructiva which could provide specific primers that would not amplify DNA of other species. For this purpose, the predicted genome of D. destructiva isolate 10115 (12,357 genes) was compared against the genomes of five related species (Cryphonectria parasitica – Diaporthales, Acremonium alcalophilum – Glomerellales, Fusarium graminearum – Hypocreales, Magnaporthe oryzae – Magnaporthales, Neurospora crassa – Sordariales) to find DNA sequences that belonged only to the target species (Table 2.3). FASTA headers of the sequence files were then formatted as "gnl|database|identifier” following the guidelines in the BLAST documentation to prepare them for formatting as BLAST databases using formatdb.exe which is part of the StandAlone BLAST package (ftp://ftp.ncbi.nlm.nih.gov/blast/). BLAST databases were generated from each of the genomes and compared following Hsiang and Baillie (2005). BLASTN was used to compare the predicted genes of D. destructiva against the five other fungal genomes. The BLAST result was then parsed with a Perl parsing script (Appendix 2.1). Genes that had no matches among the five related species were retrieved from the predicted gene set of D. destructiva and were compared against GenBank using BLASTX, to see if there were potential matches in the large database. Genes that had matches were eliminated from the list of potentially unique genes for D. destructiva. In the remaining list, only sequences longer than 800 bp were selected for potential primer design. Specific primers were primarily needed to detect the presence of small quantities of genomic D. destructiva DNA in crude extracts of symptomatic plant tissue. To address this need, the second approach was to test a multicopy sequence that has been commonly used as a source of specific primers, such as the ITS. The sequence for this region was obtained from two D. destructiva isolates (isolates 10115 and 11110) and the mismatching nucleotides were corrected manually after visualization using Chromas Lite 2.0 (Technelysium Ltd. Tewantin, Queensland, Australia). The ITS sequences of the two D. destructiva isolates were compared against the GenBank NR database with BLASTN, to find closely related species. Six species were selected as closely related to D. destructiva (all were from Gnomoniaceae, maximum identity 95-90%): Apiognomonia errabunda, Cryptodiaporthe pulchella, Plagiostoma sp., Diplodina acerina, Gnomonia gnomon and Discula quercina. Other ITS sequences of fungal isolates obtained in our lab from processing the dogwood sample collection, and which were found to be related to D.

42 destructiva, were also added to the list: Discula quercina (isolates 11167 and 11168, <90% of the ITS sequence was identical to D. destructiva ITS), Pleuroceras tenellum (isolate 11164, 94% of the ITS sequence was identical to D. destructiva ITS). These 11 sequences (nine sequences of species related to D. destructiva and two D. destructiva ITS sequences) were aligned with CLUSTALX and primers were designed on D. destructiva regions that were least conserved with the other sequences.

2.2.8 PCR amplification Approximately 1 ng of DNA was used in each 15-μl PCR reaction which contained 1x PCR buffer (50 mM Tris - HCl, pH 8.5); 2.5 mM MgSO4; 0.2 mM dNTP; 0.5 μM of each primer separately; and 0.6 U Tsg DNA polymerase (Bio Basic Inc., Markham, ON, Canada). Thermal cycling conditions were similar for all primers, except for the annealing temperature which could be different for each primer set depending on their theoretical melting temperature. Amplification conditions were as follows: initial denaturation at 94°C for 3 min, followed by 35 cycles of 94°C for 30 s, one minute annealing time at 55°C for primers ITS1 & ITS4 and ddITS_F16 & ddITS_R359, 57 °C for ddg485_f31 & ddg485_r1416, and 66 ºC for ddmat2_f1429 & ddmat2_R2513, followed by elongation at 72 °C for one min, and a final extension at 72 °C for 10 min. Amplified products were subjected to electrophoresis through 1.0% agarose gels (Bio Basic Inc., Markham, ON, Canada), and then stained with ethidium bromide, and visualized with a UV transilluminator.

2.2.9 Sequencing of PCR products The primers used for testing DNA from fungi associated with symptoms on dogwood leaves were primers ITS1 (5’-TCCGTAGGTGAACCTGCGG) and reverse primer ITS4 (5’- TCCTCCGCTTATTGATATGC). Genomic DNA from each of the target isolates was amplified with the ITS primers and the PCR products were submitted for sequencing at the Lab Services Division of the University of Guelph. Sequencing results were received as two types of files: SEQ text files and chromatogram files. The SEQ file was reformatted as FASTA, and unknown 'N' bases were deleted from the beginning and end of each sequence. The unknown bases in the middle of sequences were clarified by more closely examining the peaks in the chromatogram file with Chromas Lite 2.0, or retained as ‘N’ when they could not be corrected. Sequencing

43 results were compared against the GenBank NR database with BLASTN. The match with the highest score (e-values below 10-150) and with annotated genus and species were selected as potential matches for each sequence.

2.2.10 Pathogenicity testing The potential of D. destructiva to induce disease on C. florida was assessed on detached leaves and potted plants. Healthy field-grown dogwood leaves were collected from plants at the Guelph Turfgrass Institute and the Guelph Arboretum and surface sterilized with sodium hypochlorite 1% and rinsed with autoclaved deionized water. Petri plates were lined with 9-cm- diameter filter paper and moistened with 1.5 mL of autoclaved deionized water. Leaves were placed onto the wet filter paper in Petri plates, abaxial or adaxial side up. Wounding of the leaf epidermis was achieved by gently scratching the leaves with a flamed needle. One, two or three 2-cm-diameter wounded areas were created on each leaf, depending on leaf size. Healthy nursery-grown potted C. florida plants, 15-20 cm tall, with leaf-buds just starting to grow, were used for testing Koch’s postulates. Three types of inoculum were used on detached leaves: mycelial plugs, sporulating colonies and spore suspensions, while leaves of potted plants were inoculated with spore suspensions. Since D. destructiva does not sporulate readily on PDA, the earliest pathogenicity tests were done with mycelial plugs. A 5-mm diameter mycelial plug from a 3-wk-old culture was placed on top of each detached dogwood leaf, on either wounded or unwounded epidermis of adaxial or abaxial surface. For inoculum in the form of entire sporulating colonies on media, leaves were placed directly on the colony surface and incubated for three or seven days, removed from colonies and incubated on wet filter paper until symptoms appeared. For conidial inoculum, spores were obtained from D. destructiva colonies cultured on oatmeal agar, or on water agar amended with ground dogwood leaves. Three concentrations of 4 6 7 7 spore suspensions were tested: 10 , 10 and 10 spores/mL, and a concentration of 10 spores/mL was selected. The inoculum was applied with a small finger pump sprayer which released an aliquot of 0.16 mL at each spray and three sprays were needed to cover the leaf surface completely. The moisture necessary for spore germination was maintained by applying two sprays of autoclaved deionized water on leaves every 2-3 days, using a finger pump sprayer. The symptoms or signs were observed daily. After 21-27 d, if the symptoms or signs of dogwood

44 anthracnose were observed on the inoculated leaves, attempts were made to re-isolate the fungus and compare it to the original isolate. For pathogen re-isolation purposes, the symptomatic leaf tissue was cut off and trimmed into 5 x 3 mm pieces, and then dipped in ethanol 70% for 30s and in sodium hypochlorite 1% for 10 min to rule out the possibility of inoculum surviving surface sterilization. Leaf pieces were rinsed twice with autoclaved water and cultured on PDA. Asymptomatic tissue was subject to processing for the purpose of pathogen re-isolation also. Potted C. florida plants were sprayed with a 107 spores/mL spore suspension. After inoculation, plants were enclosed in plastic bags for seven days to ensure the moisture necessary for spore germination, and placed outside, in a shaded area, in early May. Three days after the first inoculation, plants were sprayed again, bagged and placed outside again. Wounds were made on some of the newly formed leaves one day after the second inoculation, by poking with a flamed needle. Supplementary wounding may have occurred during the following days, since severe cold wind opened the bags and plants became exposed to freezing rain and hail. Plants were monitored daily and symptoms occurred after 17d from inoculation. Pathogen re-isolation methods were similar to those employed for inoculated detached leaves. Sodium hypochlorite immersion time was 10 min for completely blighted leaves and only 30 s for spotted leaves.

2.3 Results 2.3.1 Symptomatic samples of dogwood Symptomatic samples of dogwood consisting primarily of leaves, but sometimes also inflorescences, twigs and fruit were collected from various areas in Ontario and British Columbia. A list of all samples with information on: dogwood species, collection sites, collection dates, processing dates, and fungal species obtained after processing is presented in Appendix 2.2. A total of 243 samples were processed, and samples included the following dogwood species: C. florida (73%), C. nuttallii (22%), C. alba (0.5%), C. alternifolia (2%), C. amomum (0.5%), C. kousa (0.5%), C. racemosa (0.5%) and C. sericea (1%). Since sample collection focused especially on leaves with symptoms of dogwood anthracnose, 45% of the samples had symptoms. Discula destructiva was found on 93% of the symptomatic samples of C. florida and C. nuttallii, but not on samples of other Cornus spp. The symptoms looked fairly different on the two hosts: irregular brown spots with purple margins, different in size and shape on leaves of C. florida, and brown-rusty blotches, sometimes covering

45 the entire leaf on C. nuttallii (Figure 2.1 and Figure 2.2). At only one sampling site in British Columbia (B.C.) (Capilano Golf Course), C. nuttallii presented many round, different-sized brown spots with purple margins, similar to those found on C. florida (Figure 2.3). It has been shown by Parham and Windham (1992) that symptoms may have different appearances when formed in different weather conditions. Symptoms forming on trees growing in open sunlight appear as irregular brown spots with purple margins, while leaf blight is more common to occur on shaded trees or where prolonged wet, cloudy periods exist. Another difference between samples from B.C. and samples from Ontario was that B.C. samples produced D. destructiva more readily than Ontario samples. Sometimes acervuli were present on the necrotic lesions as brown or black dots, about 50 µm in diameter, mostly on the abaxial leaf surface and rarely on the adaxial surface. Flowers collected from diseased specimens of C. nuttallii were either underdeveloped, or had one or more bracts completely blighted. The fungus was not isolated from symptomatic flowers of C. florida. On both Ontario and B.C. samples, D. destructiva was noticeable on infected twigs as numerous acervuli that looked like black dots. Sometimes, twigs were partially or completely wilted. Symptoms of dogwood anthracnose on fruits consisted of necrosis on the fruit surface. Fruit samples came only from Ontario. Other fungal species which were isolated from symptomatic dogwood leaf samples are listed in Appendix 2.3. Some of the fungal species in the appendix came from lesions with characteristic symptoms. Botryosphaeria dothidea was found only on one sample of C. alternifolia with purple blotches on the distal part of the leaf (Appendix 2.3 – Figure 2). Lesions on leaves of C. florida, which seemed similar to those produced by D. destructiva produced Discula quercina (Appendix 2.3 – Figure 5), or Pleuroceras tenellum (Appendix 2.3 – Figure 15). Usually the three species were not isolated together from the same sample, except for one situation when both D. destructiva and D. quercina were obtained from the same C. florida sample collected early October in 2012 (Appendix 2.2). Elsinoe corni is said to be associated with punctiform necrotic spots on leaves of different species of dogwood (Appendix 2.3 – Figure 8), however multiple attempts of isolating the fungus either by culturing on PDA, or by wet- chamber technique, were unsuccessful. Symptoms which consistently lead to isolating species of Colletotrichum appeared similar to those caused by D. destructiva. However, the lesions produced by Colletotrichum sp. had light brown, yellowish or greyish-white centers (Appendix

2.3 – Figure 3), rather than brown, as characteristic for leaf spots produced by D. destructiva (Appendix 2.3 – Figure 4). Colletotrichum sp. has been isolated from more than 50% of the samples. Septoria cornicola infects any type of dogwood and produces round, 3-5-mm diameter spots with purple margins and lesions on the same leaf are about the same size (Appendix 2.3 – Figure 16). As opposed to dogwood anthracnose symptoms, which occur early in the spring, Septoria spots appear in late summer or early fall. The other species presented in Appendix 2.3 were isolated from lesions which did not have a consistent appearance, or from leaves with no particular symptoms. This situation could be attributed to the saprophytic nature of many of these species (e.g. Epicoccum nigrum) or endophytic fungi which did not always induce symptoms (e.g. Alternaria alternata, Dothiorella gregaria, Melanconium oblongum, Pestalotiopsis sp., Pilidium sp., or Phomopsis sp.). The most commonly isolated fungal species were Alternaria alternata, Dothiorella gregaria, Epicoccum nigrum and Phomopsis sp., which were found in over 50% of all samples, while D. destructiva was found in 42% of all samples. One particular foliar symptom which appeared as a purple ring in midsummer on leaves of C. alternifolia and sometimes on C. amomum and C. florida, has been commonly referred to as anthracnose. Initially the purple ring had a green or yellowish green center which later turned into a perfectly round brown spot and cracks appeared in the center (Appendix 2.3 – Figure 11). The fungal species isolated from this type of symptom were not consistent, and later on the causing agent was found to be an insect larva. The insect was identified as Parallelodiplosis subtruncata by Dr. Stephen A. Marshall, taxonomic entomologist at the University of Guelph.

2.3.2 Morphological characteristics of fungal isolates Over 2500 fungal isolates were obtained from processing 243 symptomatic samples of dogwood and these colonies were grouped into 13 morphotypes (Table 2.2). The cultural characteristics of these morphotypes on PDA (or MEA for the last morphotype) at 25°C were as follows: white-green; grey; red-grey; white-granular; white with salmon dots; beige; yellow- orange; brown; white fuzzy; beige with salmon dots; white fuzzy with rings; brown- beige; dark brown (Figure 2.4). Some common ubiquitous fungi and contaminants were not considered as dogwood-associated fungi, including species of Penicillium, Aspergillus and yeasts.

The most common fungal isolate was the white-granular type (39%), followed by the white-green fungus (28% of all morphotypes). The morphotype for the white fuzzy with rings fungus was present in 15% of all isolates, the beige fungus was present in 8% of the morphotypes, and the red-grey fungus represented 7% of all isolates. The yellow-orange morphotype represented 1% of the total fungal morphotypes isolated from dogwood leaves. Each of the remaining morphotypes had less than 1% representation in the total fungal isolates. Each of the 13 fungal morphotypes, as well as other dogwood disease-causing agents, is listed in the “Dogwood Disease Symptom Guide” found on Appendix 2.3. The white-granular morphotype produced colonies which during the first 10 d of growth were white and as colonies grew, they became grey, and then greenish brown and eventually dark brown or black (Figure 2.5). This morphotype was slower growing than most of the other morphotypes (approximately 10 mm per day), the colonies had undulate margins and appressed mycelium with zonate growth patterns, and dense growth gave the colony a granular appearance. Black dots appeared after 3 wk on the colony surface of some of the isolates, which were dried droplets of liquid. The reverse of the plate was dark and white crystals were visible on the back of the plates of colonies older than two months. This morphotype rarely produced spores on PDA, but on amended media prepared with ground dogwood leaves, abundant globose conidiomata formed after one month (Figure 2.6). Representative isolates from the 13 morphotypes of fungi were observed with microscopy. The white-green fungus formed colonies with a suede appearance due to aerial mycelium and had multicelled, ovoid conidia, 5-12 x 20-30 µm in size. The grey fungus had a fuzzy appearance due to fluffy aerial mycelium, but no conidia were found in culture. The red- grey fungus had grayish to rose colonies with oblong conidia, 12 × 4 μm. The white-granular fungus had appressed colonies with sparse aerial mycelium which gave a granular appearance to the colony and conidia were unicellular, elliptical, with polar oil droplets and 7-12 x 2.5-3.5 µm in size (Figure 2.6). The fungus that appeared as white with salmon dots had growth rings and numerous salmon-colored conidiomata in the center of the colony. Conidia were unicellular, elliptical, with polar oil droplets and 7-12 x 2.5-3.5 µm in size, similar to the previous morphotype. The beige fungus formed appressed, beige colonies on PDA, with a brownish center; it sporulates well on SNA media and spores are unicellular, translucent, ovoid or round and 3 x 1.5 μm in size. The yellow-orange fungus had brown, multicelled conidia, 15 - 25 μm in

48 diameter. The brown fungus formed appressed colonies with serrate margins and the edge of the colony was dark brown and sunken into the media, while the colony center was light brown; spores were unicellular, with one rounded end and one acuminate end, 7 x 2.5 µm in size. The white fuzzy morphotype formed numerous black sclerotia after one month on PDA and the spores were five-celled, with three central cells dark brown, and with apical appendages; one conidium was 20 x 3 µm in size. The beige with salmon dots fungus formed colonies that were beige colored at first, but after one week salmon colored conidiomata covered the older parts of the colony; the spores were hyaline and falcate with acute apices, 6 × 1.5 μm in size. The white fuzzy with rings fungus had unicellular, ovoid conidia, 2.5 x 0.5 μm in size. The brown-beige fungus had appressed brownish colonies with aerial mycelium grown in zonate rings, beige colored; no spores were identified on PDA colonies. The dark brown fungus was extremely slow growing, reaching only 3 cm in diameter in one month on PDA or MA and spores were hyaline, 1-7 septate, slightly curved and 35.5 x 3.5 μm in size.

2.3.3 Molecular identification of morphotypes Three of the 13 above-mentioned morphotypes had previously been isolated in our lab and identified molecularly, and when the same species were isolated from dogwood, only morphology was used for identification. The species identified based on morphology of colony and spores were: Alternaria alternata Fr. (the white-green morphotype), Colletotrichum gloeosporioides (Penz.) Penz. & Sacc. (the red-grey morphotype), Dothiorella gregaria Sacc. (the beige morphotype) and Epicoccum nigrum Link. (the yellow-orange morphotype). The remaining nine morphotypes of fungi were subjected to DNA sequencing of the ITS regions to confirm identity. Based on the sequencing results, the grey morphotype had 99% identity with Botryosphaeria dothidea (JX096631.1). The white-granular fungus had 100% top match with Discula destructiva (AF429748.1). The white fungus with salmon dots had 98% identity with Discula quercina (GQ452265.1). The brown fungus had 91% identity with Melanconium oblongum (JF920156.1). The white fuzzy morphotype had 99% identity with Pestalotiopsis vismiae (EF419938.1). The beige with salmon dots fungus had 97% identity with Pilidium concavum (JQ995228.1). The white fuzzy with rings fungus had 98% top match with Phomopsis sp. (GU066614.1). The brown-beige fungus had 99% identity with Pleuroceras

49 tenellum (EU199199.1). The dark brown fungus had 98% top match with Septoria cornicola (DQ019385.1). Sequencing results are presented in Appendix 2.4.

2.3.4 Genome sequencing and assembly From the genome sequencing facility, 14 million 100 bp paired-end reads were received. The data was processed by T. Hsiang who generated a total assembly size of 47 Mb with an N50 value of 36 kb, resulting from 60x coverage. The gene prediction resulted in 12,357 genes. The assembled genome was used to find the elongation factor gene and the mating type gene to develop primers and to find genes “unique” to D. destructiva for use as specific markers. The genome assembly was also used for developing SSR primers which were studied in Chapter 3.

2.3.5 Primer amplification Several attempts were made to design primers from the elongation factor 1 alpha gene of D. destructiva, and the pair selected was as follows: forward primer EF1a_F63 (5’- GCCATTCTCATCATTGCC-3’) and reverse primer EF1a_R978 5’- CCTCAACACACATGGGCT-3’. The estimated length of the PCR-product was approximately 900 bp and this primer pair was also used to test the quality of the DNA template and its suitability for PCR. To obtain MAT primers for D. destructiva, putative mating type genes were searched in the predicted gene-set of D. destructiva, using known MAT1-1 and MAT1-2 genes of other fungi as templates. The results showed weak non-homologous matches with MAT1-1 (e-value < 0.26), while MAT1-2 matches had e-values < e-12 from several sequences of different fungi. Discula destructiva gene number g10904 was selected as a putative MAT1-2 gene and used for designing primers. The forward primer was chosen 1000 bp into the 2522 bp gene, and the reverse primer was chosen at the very 3' end, giving an amplification product of ~1000 bp. The MAT2 primers obtained for D. destructiva were: forward primer ddmat2_f1429 (5'- CTGCTGCTCGAGTACGATGTGC-3') and reverse primer ddmat2_R2513 (5'- AGGTCGGCGTAGCGGCGGAT-3'). The PCR-product estimated length was over 1,000 bp. The selective MAT2 primers (ddmat2_f1429 & ddmat2_r2513) were found useful to identify non- D. destructiva isolates. The DNA of two putative D. destructiva isolates gave smearing or smaller products (250 bp instead of the expected 1,100 bp), and later these two isolates were

50 identified as Discula quercina and Pleuroceras tenellum. To obtain specific primers based on comparative genomics, over 3,400 D. destructiva DNA sequences were found to have no match among five related species. These sequences were compared against GenBank and a list of 288 sequences was obtained, which were unique to D. destructiva and absent in other available fungal sequences in the GenBank database. For primer design, only sequences longer than 800 bp were used, thus the number of sequences was reduced to 93. Six primer sets were selected and compared against the same fungal genomes used in the first step of the process, to find the set that is the least conserved. After the comparison, the specific primer pair chosen was: forward primer ddg485_f31 (5’- CATCTTCTCCTGAACATTTCG-3’) and reverse primer ddg485_r1416 (5’- AATAAAGCGACGCGTAGAGG-3’). The PCR-product estimated length was over 1300 bp. The specific primers based on comparative genomics (ddg485_f31 & ddg485_r1416) were found to amplify only high quality D. destructiva DNA and not crude extracts from symptomatic leaves. Since one of the purposes for designing specific primers was to directly identify D. destructiva in symptomatic leaf extracts, none of the primers based on “unique genes’ were able to reach this aim. To overcome this, specific primers were designed based on the ITS region of D. destructiva and the following set was chosen: forward primer ddITS_f16 (5’- AGAAACCCATTGTGAATC-3’) and reverse primer ddITS_r359 (5’- TCCAACACCAAAGCTGAG-3’). The estimated length of the PCR-product was over 340 bp. This primer set was found to amplify low amounts of D. destructiva DNA in symptomatic leaf extracts.

2.3.5.1 Testing specific primers To find the level of specificity provided by the primers, as well as the lowest concentration of D. destructiva DNA needed for amplification or to check other PCR conditions, the specific primers were subject to a series of tests, as follows: (1) Specificity test – to find the conditions to amplify only D. destructiva DNA; (2) Sensitivity test – to find the lowest concentration of D. destructiva DNA amplified by the specific primers, and (3) Spiked samples test – to check how the presence of Cornus sp. DNA in the PCR mix influences the amplification results between D. destructiva DNA and specific primers. 1. Specificity test – genomic DNA from ten species related to D. destructiva or

51 commonly isolated from dogwood leaves was used in PCR to test the specificity of primer set ddg485_f31 & ddg485_r1416. In addition to these fungal species, another three species were used to test the specificity of primer set ddITS_f16 & ddITS_r359 (Table 2.4). DNA of one D. destructiva isolate was used as positive control. The specificity test revealed that when the annealing temperature was between 55 – 58 °C the primer set ddg485 amplified DNA of: Acremonium sp., Pestalotiopsis cocculi and Pleuroceras tenellum with multiple bands, and D. destructiva DNA with one clear band of the expected size. Only D. destructiva DNA was amplified when the annealing temperature (Ta) was 59 °C. The melting temperature for primer set ddg485 was 63 °C. The primer set ddITS had a melting temperature of 55 °C and it was found to amplify specifically only at Ta = 57 °C. Unspecific amplification occurred below this temperature, when weak bands of the expected size were obtained for Colletotrichum acutatum and Pleuroceras tenellum. 2. Sensitivity test – both primer sets were tested for the ability to amplify D. destructiva DNA in crude extracts of symptomatic leaves and only ddITS set was found to detect the pathogen in leaf extracts. The ddITS primer set was further tested for the ability to amplify low concentration of DNA template and was found to amplify as little as 0.001 ng/µL of D. destructiva DNA extracted from fungal mycelium. The annealing temperature was Ta = 55 °C and the band was weak, but visible. 3. Spiked samples test – since one of the purposes for having specific primers was to help identify D. destructiva in infected plant tissue, the potential effect of C. florida DNA on the PCR result was assessed. It has been found that the presence of C. florida DNA does not influence the PCR amplification of D. destructiva DNA when the fungal DNA template has a concentration of minimum 0.01 ng/µL. For very low concentrations of D. destructiva DNA template (0.001 ng/µL) plus 1 ng/µL C. florida DNA present in the PCR mix, the band obtained was stronger than when only D. destructiva DNA of the same concentration was used. This could be due to the endophytes inhabiting the leaf. However, 1 ng/µL C. florida DNA alone did not amplify with the specific D. destructiva primes.

2.3.5.2. Amplification results with specific primers The main purpose for the use of specific primers was to confirm the identity of putative D. destructiva isolates. For this aim, the ddg485 primer pair was used, and 122 of 129 fungal isolates were confirmed as D. destructiva. The remaining seven isolates were identified as Discula quercina, Melanconium oblongum or Pleuroceras tenellum, using ITS sequencing for identification. The second purpose for having specific primers was to facilitate rapid diagnosis of dogwood anthracnose in symptomatic samples. For this aim, the specific primer-set ddITS significantly reduced the amount of time necessary for diagnosing dogwood anthracnose, from a minimum 10 days, to 8 hours.

2.3.6 Testing the pathogenicity of Discula destructiva Since D. destructiva does not sporulate readily on PDA, the first inoculation attempt was made with agar plugs placed on wounded and unwounded areas of detached C. florida leaves and incubated for 24, 48 or 72 hours. No symptoms were obtained with this method and no D. destructiva has been re-isolated from inoculated leaves. When the inoculation method was incubating dogwood leaves directly on sporulating D. destructiva colonies on media for seven days or three days, symptoms as brown, necrotic lesions appeared after three days in both instances. Symptoms were visible first in wounded areas and later in other areas which had not been purposely wounded before, such as the petiole area. At 7 days after inoculation (DAI) the necrosis covered between 10-20% of leaf surface and at 15 DAI some of the leaves were completely necrotic and covered in brown spots, which were the fungal sporulating structures or acervuli (Figure 2.7). The fungus has been re-isolated from necrotic areas at a rate of 100%, as well as from asymptomatic areas at a rate of 92%. When detached C. florida leaves were sprayed with a 107 spores/mL spore suspension, symptoms appeared at 5 DAI as brown necrosis in wounded areas, and by 15 DAI the entire leaf surface had decayed and was covered with fungal acervuli as brown dots (Figure 2.7). Pathogen re-isolation attempts had a 53% rate for D. destructiva re-isolation from necrotic tissue and 41% D. destructiva re-isolation from asymptomatic tissue. Potted C. florida plants, inoculated with a 107 spores/mL spore suspension, presented punctiform purple spots on leaves at 17 DAI, and the wounds had purple margins. By 24 DAI some of the oldest leaves were completely blighted and had acervuli. Some of the apical buds

53 were also blighted, while some of the newer leaves had typical dogwood anthracnose spots and other leaves were apparently healthy (Figure 2.8). Re-isolation of D. destructiva was achieved at a rate of 92% from completely blighted leaves and 15-25% from spotted leaves and blighted apical buds, while 0% D. destructiva was obtained from asymptomatic leaves. Asymptomatic leaves from healthy, uninoculated plants were also processed and 0% D. destructiva was obtained.

2.4 Discussion Discula destructiva was identified as the causing agent of dogwood anthracnose in 1991 by Redlin, after more than a decade from the first report of a disease of flowering and Pacific dogwood at the end of 1970’s. In Ontario, the disease was first reported in 1998 by Davis (2001), and was thought to be very critical for the survival of C. florida populations; but the extent of the disease was unknown. In 2011 the flowering dogwood (C. florida) was ranked as an “endangered species” by the Committee on the Status of Endangered Wildlife in Canada, based on an assessment made in 2007 (COSEWIC Assessment and Status Report for C. florida, 2007). The aim of this study was to identify the causal agent of dogwood anthracnose in Ontario and British Columbia and to associate foliar symptoms with other fungal species isolated from dogwoods. From 2010 to 2013, a total of 243 samples collected from southwestern Ontario and southwestern British Columbia were processed. Since the study was focused on dogwood anthracnose which affects primarily C. florida and C. nuttallii in the field, most of the samples came from these two species, but there were a few samples (1-2%) of other dogwood species, such as: C. alternifolia, C. amomum, C. kousa, C. racemosa and C. sericea. Approximately 45% of the samples presented the target symptoms for dogwood anthracnose: irregular, brown spots with purple margins. After processing, D. destructiva was isolated from most of these samples (93%). Positive samples came only from C. florida and C. nuttallii, which was in agreement with previous findings (Hibben and Daughtrey, 1988; Redlin, 1991), that in natural settings, dogwood anthracnose is found only in these two species. The following differences were observed in this study between samples of C. nuttallii and samples of C. florida: C. nuttallii samples presented a higher severity of dogwood anthracnose symptoms and produced D. destructiva more readily than C. florida samples. To our knowledge there are no records of differences in disease severity on the two hosts. Future work with dogwood anthracnose should

54 be done with C. nuttallii since the fungus causes much more obvious symptoms in this species. Another important objective was to associate foliar symptoms of dogwood with fungal species. After processing the samples, 13 more commonly isolated fungal morphotypes were retained, and a “Dogwood Disease Symptom Guide” was written. The following foliar symptoms were consistently associated with certain fungal species: brown or black spots without a clear margin were produced by Alternaria alternata; purple spots with light brown or greyish-white centers were produced by Colletotrichum sp.; numerous round spots with purple margins, approximately 5 mm in diameter, were produced by Septoria cornicola. Purple blotches on one sample of C. alternifolia produced exclusively colonies of Botryosphaeria dothidea. However, three fungal species other than D. destructiva were obtained from symptoms that were characteristic for dogwood anthracnose: Discula quercina, Melanconium oblongum, and Pleuroceras tenellum. All of these three fungal species are related to D. destructiva and belong to class Sordariomycetes, order Diaporthales. Other fungal species isolated from symptomatic dogwood leaves could not be related to particular symptoms, such as: Dothiorella gregaria, Epicoccum nigrum, Pestalotiopsis vismiae, Phomopsis sp., and Pilidium concavum. A foliar symptom as a purple ring was very common in Guelph area in midsummer on leaves of C. alternifolia, C. amomum and C. florida, and initially it looked as a purple circle, more visible on the upper leaf surface, delimitating green tissue within the circle boundaries. As the spot grew older, the tissue within the ring became necrotic, and this brown circular spot has been commonly referred to as anthracnose. Numerous attempts to isolate the causal agent of the purple ring symptom lead to obtaining various fungal species, but inconsistently. After a more thorough examination, it has been found that each of the newly formed purple rings had a small swelling in the green area within the ring, which was visible only on the lower leaf surface. The swelling was found to be caused by an insect larva, identified as Parallelodiplosis subtruncata by Dr. Stephen A. Marshall, taxonomic entomologist at the University of Guelph. The “Dogwood Disease Symptom Guide” could help nursery growers and forest professionals to better distinguish between foliar symptoms caused by D. destructiva and similar leaf spots produced by other fungal pathogens or insects. Many of the fungal species isolated in this study have also been associated with dogwood symptoms by Farr et al. (1989). The following species were associated with leaf spots of dogwood for the first time in this study: Discula quercina, Dothiorella gregaria, Epicoccum nigrum, Melanconium oblongum,

Pestalotiopsis vismiae, Pilidium concavum, and Pleuroceras tenellum. The fungus Elsinoe corni was previously associated with spot anthracnose on dogwood leaves, petioles and bracts (Jenkins et al., 1953; Lambe and Justis, 1978), but the isolation of E. corni from symptomatic samples in this study was unsuccessful. The morphology of the white granular fungus was similar to previous descriptions of D. destructiva, the causal agent of dogwood anthracnose (Redlin, 1991), and molecular identification by ITS revealed 100% identity with the target species. This fungus rarely produced spores when cultured on PDA, but when grown on cellulose membranes overlaid on PDA, it produced spores, although not as abundantly as on amended media. The hard surface of the cellulose membrane could simulate the leaf surface and induce fungal sporulation, suggesting that D. destructiva may show a thigmotropic response. Another plausible explanation for sporulation on PDA overlaid with cellulose membranes is that the membrane acts like a barrier, limiting the type and amount of nutrients available to the fungus, and sporulation could be promoted by the lack of certain nutrients. When D. destructiva was isolated from samples of C. florida, many of the fungal species mentioned above were obtained together with the dogwood anthracnose-fungus from the same necrotic spot, and sometimes with higher percentages than D. destructiva. One of these fungal species was Alternaria alternata, which was isolated from most C. florida samples. However, symptomatic samples of C. nuttallii produced D. destructiva very readily, and little or no contamination was observed. The only noticeable contamination was with unabscised leaves or litter samples of C. nuttallii, when yeast colonies were obtained together with D. destructiva colonies. This again shows that the two hosts may provide different conditions for D. destructiva, and further investigations with C. nuttallii might give an insight on the mechanisms involved. The ability of D. destructiva to induce disease on C. florida was tested in this study, using artificial inoculations with detached leaves and potted plants. Previous studies have found that despite the severe outcome of dogwood anthracnose on natural setting of C. florida in the U.S., certain pre-requisites had to be fulfilled for artificial inoculations of D. destructiva to be successful (Walkinshaw and Anderson, 1991; Brown et al. 1994b). The pre-conditions were represented by wounding of plant tissues before inoculation, and providing high humidity after inoculation. This study also found these pre-requisites to be critical for successful infection with

D. destructiva. Other important factors for successful infection in this study were found to be the type and concentration of inoculum. Thus, inoculum represented by mycelial pugs was found to be ineffective, as well as spore suspensions with concentrations less than 106 spores/mL, while spore suspensions with concentration of 106 spores/mL or higher, as well as sporulating colonies of D. destructiva on media were always effective. However, Cheng et al. (2011) was able to infect wounded leaf discs of C. florida with a spore suspension of 104 spores/mL, and Redlin (1992) obtained successful infections of wounded leaf discs using mycelial plugs as inoculum. On detached leaves, symptoms were visible first in wounded areas and for overwhelming inoculum (colonies) necrosis appeared also in other areas which had not been purposely wounded before, or started off from the petiole. Since wounds have been shown to be critical for successful infection of D. destructiva on C. florida (Redlin, 1992, Cheng et al., 2011) it can be assumed that necrosis which appeared in other areas than the purposely wounded sites, were a result of injuries by other means (possibly due to the disinfecting agents used for surface sterilization of leaves prior to inoculation, or petioles being injured by handling with the tweezers). Symptoms occurred after approximately one week and consisted mostly in brown necrosis not bound by a clear margin and starting off in wounded areas. After two weeks some of the leaves were completely necrotic and covered in acervuli, as brown dots. When potted plants of C. florida, with leaves just beginning to grow, were inoculated with a spore suspension of D. destructiva, the first leaf pairs to mature became blighted and then fell off, while subsequent leaves growing on the same plant presented only necrotic spots. This observation is consistent with the findings of Hibben and Daughtrey (1988). The spots became irregular, brown with purple or brown margins, which was consistent with the typical dogwood anthracnose symptoms described in literature and observed in our symptomatic samples (Byther and Davidson, 1979; Hibben and Daughtrey, 1988). The pathogen was successfully re-isolated from symptomatic leaf-tissue of both detached leaves and potted plants, thus satisfying Koch’s postulates and confirming the presence of the dogwood anthracnose fungus in Ontario and B.C. as previously stated by Davis (2001) and Salogga and Ammirati (1983). Another interesting difference between the results obtained with detached leaves and whole plants was that D. destructiva was re-isolated at high rates from symptomless detached leaves, while asymptomatic leaves of potted plants produced no fungal colonies. Two possible explanations could be inferred: 1) either the colonies of D. destructiva which grew from

57 asymptomatic detached leaves came from inoculum that survived in the stable and humid environment provided by the Petri dishes, while on potted plants placed outside, the inoculum has been washed away by rain, or 2) detached leaves lacked the natural defense mechanisms which were active in leaves of potted plants, thus the fungus was able to live endophytically without producing symptoms. Since pathogen re-isolation was attempted by using harsh surface sterilization, the possibility of inoculum surviving on the leaf surface is low. More likely is that on unwounded detached leaves, the pathogen managed to break plant defense mechanisms which were active on living plants. Since it has been shown previously (Graham, et al., 1991, Cheng et al., 2011) that germinated conidia and hyphae do not use wounds to enter host tissues, one possibility may be that on non-wounded leaves, the fungus may use the trichomes as entry points, since the association of germinated conidia and hyphae with trichomes has been reported before (Brown et al., 1994b) and has also been observed in this study. Tests using wounded and non-wounded detached leaves and potted plants in a controlled environment could shed light on the ability of D. destructiva to live endophytically, since by this means the disease could be easily spread through nursery stock. (Results of such tests are presented in Chapter 3). To facilitate identification of non-D. destructiva isolates, selective and specific primers were used. Primers designed based on the mating type genes of D. destructiva, with the initial purpose of testing for the presence of mating type genes within the D. destructiva population, were found to be effective also as selective primers, when the DNA of two putative D. destructiva isolates gave smearing or smaller products and later were identified as D. quercina and Pleuroceras tenellum. Zhang et al. (2011) developed a TaqMan real time PCR method for detection of D. destructiva in symptomatic plant tissues, but as stated by the authors, the main limitations of this method were the relative high cost compared to conventional PCR and the lower detection throughput compared to DNA diagnostic array techniques. In order to provide a rapid and reliable molecular method for identifying the dogwood anthracnose fungus directly from crude extracts of symptomatic leaves, specific primers were designed based on genes “unique” to D. destructiva using comparative genomics. One of the specific primers pair used in this study was developed based on the gene g485 in the predicted gene set of D. destructiva, and was called ddg485. This primer pair was found useful for identifying D. destructiva isolates, but not useful for detecting the fungus in crude extracts of symptomatic leaves, since it only produced amplification results when the DNA template

58 concentration was minimum 1 ng/µL. Finally, specific primers were from ITS sequences and these should be able to detect 0.01 ng/µL of D. destructiva DNA from pure culture extracts. Such molecular tools would help reduce the amount of time and work needed to diagnose a symptomatic sample, from 10 days to 8 hours, facilitating disease management and studies of dogwood anthracnose.

Table 2.1 List of collaborators with affiliations, collection locations and dates. Collaborator, position, affiliations Location, Year Cleland, Eric, Land Stewardship Coordinator, Min. Agriculture and Food ON 2010 Giroux, Paul, Forester, Essex Region Conservation Authority ON 2012 Jean, Ian, Forestry and Stewardship Specialist, Min. Natural Resources ON 2011 Kope, Harry, Provincial Forest Pathologist, B.C. Ministry of Forests BC 2011, 2012 van Laeken, Morgan, Forest Technician, Min. Natural Resources ON 2011 Lidster, Rebecca, Forest Health Technical Specialist, Min. Natural Resources ON 2010, 2011, 2012 Newton, Mike, Assistant Golf Course Superintendent, Capilano Golf Course BC 2012, 2013

Table 2.2 Number and frequency of morphotypes recorded based on 2503 fungal isolates associated with symptomatic samples of dogwood. Species from the thirteen major morphotypes were identified with morphological and molecular biological techniques. Frequency of isolation Fungal species Cultural morphology* Number Percentage Alternaria alternata white-green 700 28.0 Botryosphaeria dothidea grey 3 0.1 Colletotrichum gloeosporioides red-grey 175 7.0 Discula destructiva white-granular 975 39.0 Discula quercina white with salmon dots 13 0.5 Dothiorella gregaria beige 200 8.0 Epicoccum nigrum yellow-orange 25 1.0 Melanconium oblongum brown 13 0.5 Pestalotiopsis vismiae white fuzzy 3 0.1 Pilidium concavum beige with salmon dots 3 0.1 Phomopsis sp. white fuzzy with rings 375 15.0 Pleuroceras tenellum brown-beige 15 0.6 Septoria cornicola dark brown 3 0.1 Total 2503 100 * Fungal isolates were grown on potato dextrose agar (except for Septoria cornicola which was grown on malt extract agar), at 25 °C. Full Petri plate coverage was reached after 4-30 days (except for Septoria cornicola which covered the plate after 4 months).

Table 2.3 Fungal genomes used in comparative genomics in this study, with file data, file size, and source. Species File date File size Genome source Acremonium alcalophilum 2012/01/16 32.7 Mb http://genome.jgi.doe.gov/Acral2/Acral2.info.html Cryphonectria parasitica 2012/01/16 26.7 Mb http://genome.jgi.doe.gov/Crypa2/Crypa2.download.ftp.html Discula destructiva 2011 47.2 Mb Contact Tom Hsiang for availability Fusarium graminearum 2012/01/16 36.6 Mb www.broad.mit.edu/annotation/fungi/fusarium/ Magnaporthe oryzae 2012/01/16 39.3 Mb www.broad.mit.edu/annotation/fungi/magnaporthe/ Neurospora crassa 2012/01/16 39.0 Mb www.broad.mit.edu/annotation/fungi/neurospora/

Table 2.4 Amplification results of Discula destructiva (DD) specific primers ddg485 and ddITS with DNA from related species, other dogwood pathogens or fungi associated with dogwood leaves. PCR results with specific primers Significance of fungal species Fungal species for the specificity test ddg485 ddITS Acremonium sp. Related to DD +* - Alternaria sp. Associated with dogwood leaves - - Chryphonectria parasitica Related to DD - - Colletotrichum acutatum Associated with dogwood leaves - + C. gloeosporioides Associated with dogwood leaves NA - Discula quercina Related to DD NA - Epicoccum nigrum Associated with dogwood leaves - - Fusarium graminearum Related to DD - - Monilinia fructicola Related to a pathogen of dogwood - - Pestalotiopsis cocculi Related to a pathogen of dogwood + - Phomopsis cotoneasti Related to a pathogen of dogwood NA - Pleuroceras tenellum Associated with dogwood leaves + + Venturia inaequalis Related to a pathogen of dogwood - - * positive amplification results are shown by “+” and refer to unspecific amplification (multiple bands or weak bands of the expected size) which occurred between 55-58 °C for primer set ddg485 and below 57 °C for primer set ddITS. Lack of amplification is shown by “-“.

Figure 2.1 Leaves of Cornus florida with symptoms of dogwood anthracnose. Sample collected from Norfolk County, Ontario in 2012.

Figure 2.2 Twig of Cornus nuttallii with flower bracts and leaves affected by dogwood anthracnose. Sample collected from Victoria, Vancouver Island, British Columbia in 2012.

Figure 2.3 Leaf of Cornus nuttallii with many irregular, different sized spots of dogwood anthracnose. Sample collected from Capilano Golf Course, Vancouver Island, British Columbia in 2012.

Figure 2.4 (continued) Thirteen morphotypes of fungi associated with symptomatic leaves of dogwood, grown on potato dextrose agar (or malt extract agar for the last morphotype) at 25 °C for 4 – 30 days (4 months for the last morphotype): (j) beige with salmon dots; (k) white fuzzy with rings; (l) brown-beige; (m) dark-brown.

Figure 2.6 Discula destructiva: (a) abundant globular conidiomata on a 4 week colony on amended media; (b) conidia. Size bar represents 10 µm.

Chapter Three: Biological Characteristics, Pathogenicity and Genetic Variation in Discula destructiva 3.1 Introduction Discula destructiva is the causal agent of dogwood anthracnose in Ontario and British Columbia. There are more than fifty dogwood (Cornus) species in the world and 14 of them grow natively in Canada (USDA, 2013), but only two of the native Canadian dogwoods have been found susceptible to dogwood anthracnose in nature: flowering dogwood (C. florida) and Pacific dogwood (C. nuttallii) (Hibben and Daughtrey, 1988; Byther and Davidson, 1979). Cornus florida grows in eastern North America, including southwestern Ontario, while C. nuttallii grows on the west coast of North America, including most part of southwestern British Columbia. The disease was first reported in North America in the mid 1970’s in the United States (Byther and Davidson, 1979) and later in the mid 1980’s in Canada (Salogga and Ammirati, 1983). Dogwood anthracnose has also been reported in Europe. The disease appeared in the United Kingdom in 1995 (EPPO, 2013), in Germany in 2002 (Stinzing and Lang, 2003), in Italy in 2003 (Tantardini et al., 2004) and in Switzerland in 2006 (Holdenrieder and Sieber, 2007). The host plants infected in Europe were C. florida and C. nuttallii imported from the U.S., and in one case a C. kousa specimen in a botanical garden in Switzerland had dogwood anthracnose. Dogwood anthracnose produces similar symptoms on both C. florida and C. nuttallii, however this disease is rarely associated with tree mortality in C. nuttallii (Redlin, 1991), while C. florida populations have reportedly suffered extensive damage due to dogwood anthracnose in natural forests as well as in landscape plantings (Anagnostakis and Ward, 1996; Sherald et al., 1996). For this reason, and because a major portion of the natural range of C. florida is in the U.S., most of the studies concerning dogwood anthracnose have been done in the U.S. on D. destructiva isolated from C. florida. Some of these studies also included isolates from British Columbia, but no published research is available dealing with Ontario populations of D. destructiva. The only mention of dogwood anthracnose in natural settings in British Columbia was made in 1996 (Daughtrey et al., 1996), while disease incidence in Ontario was assessed in 2007 (COSEWIC, 2007). However, many characteristics of D. destructiva have not been well studied, such as the survival of inoculum, the pathogenicity on other host plants and the mating types present within its populations.

3.1.1 Growth and survival of Discula destructiva Biological features, such as the optimal growth temperature of D. destructiva, were determined by Salogga (1982) for D. destructiva isolated from C. nuttallii, but they have not been examined for isolates from Ontario. However, the growth characteristics of this fungal species on host tissues and on agar media have been described in several studies (Hibben and Daughtrey, 1988; Brown et al., 1990; Redlin, 1991 and 1992). Plant tissues infected with D. destructiva become necrotic, with abundant fungal fruiting bodies (acervuli) forming below the host cuticle (Redlin, 1991). Acervuli develop under leaf trichomes, even on autoclaved leaves (Cheng et al., 2011), and the association of acervuli with trichomes has diagnostic value, since it is unique within Discula spp. and rare among other coelomycetous fungi (Redlin, 1992). The teleomorph of D. destructiva has not been found, either in nature or on media (Salogga, 1982; Redlin, 1991; Daughtrey and Hibben, 1994), but the perfect stage of other Discula spp. was found to be in the genus Apiognomonia (Trigiano et al., 1995) in the family Gnomoniaceae, order Diaporthales, and class Sordariomycetes. Upon cuticle rupture, conidia embedded in a mucilaginous matrix are released, and spore dissemination is thought to be via rain, wind, insects and small birds and mammals (Britton et al., 1993; Daughtrey and Hibben, 1994; Colby et al., 1995; Hed et al., 1999). Since symptoms affect all aerial parts of the tree (Daughtrey et al., 1996), and conidiomata of D. destructiva were found associated with the fruit and seeds of infected dogwoods (Britton et al., 1993), the inoculum sources are varied. After the convergent lady beetle was exposed to spores of D. destructiva, viable conidia were found after four days in the frass pellets (Hed et al., 1999) and after16 days on the external body surface of this insect (Colby et al., 1995). However, the primary inoculum is thought to be from lesions of attached infected leaves, overwintering on trees (Hibben and Daughtrey, 1988). On potato dextrose agar (PDA), D. destructiva produces slow-growing, appressed colonies, initially whitish, turning grey-green to brown or black with age. Different isolates may have slightly different colors than others, and the zonate patterns may be more or less visible. Sometimes different growth sectors on the same colony may have different pigmentation, morphology or growth rate, and these differences have been associated with the presence or absence of double stranded RNA (dsRNA) (McElreath and Tainter, 1994). Salogga (1982) found that D. destructiva from C. nuttallii had optimal growth temperatures between 21-24 °C and no growth occurred at 27 °C. The most appropriate medium

74 for growing D. destructiva was found to be water agar (WA) supplemented with ground leaves of dogwood, maple or oak (McElreath and Tainter, 1993). On such media, the colonies grew more uniformly and the aerial mycelium was more developed than on PDA. For sporulation, WA with oak leaves was found to be an excellent medium, and development of conidiomata was greater in intermittent light than in complete dark (McElreath and Tainter, 1993). Conidia survived well in high humidity and when air temperature was below 32 °C (Hudler, 1985), while the highest rate of germination was between 20-24 °C (Britton, 1989). The optimal temperature for growth and sporulation of D. destructiva was between 21-24 °C (McElreath and Tainter, 1993). These reports regarding temperature requirements for growth of D. destructiva, and that spore survival is enhanced in humid environments, are consistent with the findings of Chellemi et al. (1992) and Erbaugh et al. (1995), that disease severity is higher on north-facing slopes or shaded plants, where humidity is high and temperatures are moderate. Since weather in southwestern Ontario is known to be dryer and with greater temperature amplitudes than the wet, mild weather of southwestern British Columbia, it would be interesting to see whether D. destructiva isolates from the two Canadian provinces have different temperature requirements for growth.

3.1.2 Infection process of Discula destructiva Many studies have found a close relationship between environmental factors and the severity of dogwood anthracnose (Britton, 1989; Chellemi and Britton, 1992; Chellemi et al., 1992; Mielke and Daughtrey, 2011), suggesting that the pathogenicity of D. destructiva depends on many variables. It has been shown that the severe losses in C. florida populations in eastern U.S. resulted from factors that weakened the host, such as drought and sudden temperature changes (Hudler, 1985), and factors that enhanced fungal growth, such as wet, cool weather following drought periods (Hibben and Daughtrey, 1988). Acidic rainfall has also been found to predispose the host to dogwood anthracnose (Walkinshaw and Anderson, 1991; Anderson et al., 1993), since acid pre-treatment of leaves caused injuries of cuticle and trichomes (Brown et al, 1994a). Artificial inoculation studies have encountered difficulties in achieving successful infections with D. destructiva on C. florida, which contrasted with the severity of leaf infection and the rapid disease spread observed in nature (Walkinshaw and Anderson, 1991; Brown et al.

1994b). It has been found that wounding of plant tissue prior to inoculation, as well as supplying high humidity post inoculation, significantly enhanced infection (Walkinshaw and Anderson, 1991; Redlin, 1992; Brown et al. 1994b), however, germinated conidia and hyphae did not enter host tissues through wounds or stomata (Graham, et al., 1991, Cheng et al., 2011). Where no wounds were present, germinated spores and hyphae were consistently associated with leaf trichomes, suggesting that nutrients may be released at trichome base (Brown et al. 1994b). Further study of the infection process of D. destructiva on wounded versus non-wounded plant tissue is needed, to better understand the role of wounds in disease development. Cheng et al. (2011) described the infection process of D. destructiva and showed that leaf penetration occurs three days after inoculation (DAI) and that germ tubes enter host cuticle and epidermis directly, without appressorium formation or through openings such as stomata and wounds. The only mention of hyphae-trichome association made by Cheng et al. (2011) was related to the formation of fungal sporulating structures, when hyphae accumulated near epidermal cells under trichomes. Sporulation occurred after 14 or 20 DAI (Walkinshaw and Anderson, 1991; Cheng et al., 2011) and the association of spore-producing bodies with host trichomes is thought to be characteristic for D. destructiva (Redlin, 1992). Hyphae have been found to associate with vascular tissues (Walkinshaw and Anderson 1991; Walkinshaw, 1992) and hyphal growth in the host was preceded by necrosis of leaf cells, indicating toxic or enzymatic activity (Walkinshaw and Anderson, 1991). Venkatasubbaiah and Chilton (1991) isolated four toxins from culture filtrates of Discula isolates, and Wedge et al. (1999) observed that foliar symptoms characteristic for dogwood anthracnose were common on seedlings and detached leaves treated with purified culture filtrates.

3.1.3. Host range of Discula destructiva The reported natural host range of D. destructiva includes: C. florida, C. nuttallii, C. kousa and C. kousa ‘Chinensis’ (Daughtrey and Hibben, 1994; Holdenrieder and Sieber, 2007). Furthermore, the susceptibility of other Cornus species and cultivars has been assessed in several studies, under natural conditions (Sherald et al., 1994; Brown et al., 1996) or after artificial inoculation (Holdenrieder and Sieber, 2007). Although each of the two studies with natural inoculations used different species of dogwood, some species were common in both studies. The results were roughly consistent in the two studies, but C. sericea and C. sericea ‘Flaviramea’

76 were found to be resistant to dogwood anthracnose by Sherald et al. (1994), while Brown et al. (1996) found them susceptible. Other dogwoods found susceptible by Brown et al. (1996) were: C. alba ‘Elegantissima’, C. alba ‘Bloodgood’, C. controversa, C. kousa ‘Chinensis’, C. sericea ‘Isanti’, and C. sericea ‘Kelseyi’, but these cultivars were not tested by Sherald et al. (1994). Artificial inoculations showed the native European dogwoods C. sanguinea and C. mas to be susceptible to dogwood anthracnose, although the disease has not been reported from these species in nature (Holdenrieder and Sieber, 2007). To better understand the host range of D. destructiva in Ontario, symptomatic samples of different native dogwood species need to be assessed for the presence of the dogwood anthracnose fungus. Furthermore, artificial inoculations in controlled environments would help test the degree of susceptibility of other Cornus species or cultivars to D. destructiva.

3.1.4 Mating type genes Sexual reproduction in fungi usually requires the presence of two sexually compatible strains, named mating types, which are genetically determined. Fungi requiring a partner to sexually reproduce are heterothallic (self-sterile), but there are fungal species that do not require a mating partner and these are called homothallic (self-fertile) (Carlile, 1986). Fertilization in fungi implies the fusion of a male element that can donate a nucleus to a recipient female equivalent which can accept this nucleus, followed by nuclear fusion (karyogamy) and meiosis (Coppin et al., 1997; Lee et al., 2010). The sexual stage of a fungus is called the “teleomorph”, while the asexual stage is called the “anamorph” (Hennebert and Weresub, 1977). Discula destructiva has been found to reproduce exclusively asexually (Redlin, 1991; Rossman et al., 2007) and a teleomorph of this fungus is not known. In ascomycetes in general, the two alternate mating types are determined by sequences present on chromosomes at the same homologous loci named “idiomorphs” rather than “allele”, since these sequences have no allelic relationship to one another (Coppin et al., 1997; Kronstad and Staben, 1997). The locus where a mating type gene was found was called MAT1, and then the two idiomorph sequences were named MAT1-1 and MAT1-2, respectively (Turgeon, 1998). The mating type genes encode transcription factors which control sexual development and reproduction (Coppin et al., 1997; Debuchy and Turgeon, 2006).

For finding MAT genes in fungal genomes, several techniques have been employed, consisting either in probing genomic DNA with known MAT sequences from other species (Picard et al., 1991), or in amplifying genomic DNA with primers developed from more or less conserved regions of the MAT genes, using multiplex PCR (Paoletti et al., 2005). When the predicted genomic sequence of a fungal species is available, it can be screened for the presence of mating type genes using known similar sequences in a BLAST comparison. Then the MAT gene(s) found in the genome can be used for designing primers to help screening other isolates of the same species. The detection of mating types in a population gives insight into the possibility for sexual reproduction in that population, especially if ratios of mating types approach 50:50.

3.1.5 Genetic variation in Discula destructiva Understanding the structure of fungal populations gives insight into the mechanisms which generate genetic variation in these populations (Correll and Gordon, 1999). “Genetic structure” refers to the degree of genetic variation within a population, as well as to the distribution of variation within and between populations (McDonald, 1997). The genetics of fungal populations reveal their history and ability to evolve, thus helping phytopathologists to develop effective control strategies. The higher the level of genetic variation, the higher is the adaptability of that population. Changes in gene frequencies and composition of a population are affected by the following forces: natural selection, mutation, sexual reproduction, population size, migration and genetic drift (McDonald, 1997). Several methods have been employed over time to screen heterogeneity in fungal populations. For D. destructiva, the following techniques have been used: presence of double stranded RNA (dsRNA) (McElreath et al., 1994; Yao et al., 1994 and 1997), DNA amplification fingerprinting (DAF) (Trigiano et al., 1995) or arbitrary signatures from amplification profiles (ASAP) (Caetano-Anolles et al., 1996). One common finding for such studies has been that D. destructiva populations are homogeneous, although possible polymorphisms may exist between eastern and western populations of the fungus. Another method for determining the level of diversity within a population would be to amplify genomic DNA with genetic markers such as ISSR (Inter-Simple Sequence Repeats) or SSR (Simple Sequence Repeats or microsatellites). The genomes of all eukaryotic organisms are scattered with sequences where one or more nucleotides are tandemly repeated. Sometimes the

78 repeat units or motifs have hundreds or thousands of base pairs, but only repeated motifs of one to six bases have been called microsatellites or simple sequence repeats (SSRs) (Ellegren, 2004). Most microsatellite sequences are found in non-coding DNA, evolve independently, have high mutation rates, and a high degree of length polymorphism (Tautz, 1989; Ellegren, 2004). For these reasons, microsatellites have been employed in assessing genetic variation of natural populations since the early 1990’s (Schlotteröer et al., 1991; Ellegren, 1991), and a decade later this method was used to analyse plant pathogen populations (Knapova and Gisi, 2002; Kaye et al., 2003; Guérin et al., 2004). Molecular markers can be developed based on microsatellite regions of DNA using two approaches, leading to obtaining ISSR or SSR markers. The ISSR technique was developed in 1994 (Zietkiewicz et al., 1994), and is a PCR- based method involving random primers with two, three or four nucleotides in multiple tandem repeats, complementary to the microsatellite sequence. Only one primer is used at a time, to amplify the unique DNA sequence between two neighboring microsatellites (Figure 3.1). In order to increase the level of specificity, random nucleotide “anchors” can be attached to the 3’- or 5’- ends of ISSR primers, thus reducing the number of matching genomic loci (Zietkiewicz et al., 1994). ISSR can provide highly polymorphic patterns without requiring previous information on genomic sequences, and it is also economical and easy to employ (Bornet and Branchard, 2001). SSR markers refer to primers designed based on the DNA sequences flanking microsatellite regions (Glenn and Schable, 2005). They specifically amplify these microsatellite loci, and for their development, prior knowledge of the DNA sequence is required. Two major approaches have been generally used for isolating SSR loci: screening of previously published sequences (Kaye et al., 2003; Lees et al., 2006), or construction and screening of genomic DNA libraries enriched for SSR loci (Kaye et al., 2003; Glenn and Schable, 2005; Lees et al., 2006). In studies on Aspergillus fumigatus (Bart-Delabesse et al., 2001) and Saccharomyces cerevisiae (Perez et al., 2001), microsatellite markers have been found to be superior to other marker types (Kaye et al., 2003) such as restriction fragment length polymorphism (RFLP), cleaved amplified polymorphic sequences (CAPS), and random amplification of polymorphic DNA (RAPD). Furthermore, the advantages of using SSR over ISSR markers for screening population structure is given by the higher level of specificity in amplification of SSR primers, which makes them ideal co-dominant markers (Lees et al., 2006). One possible disadvantage of

79 using SSR data may occur in assessing genetic distances between populations or species, due to the complex evolutionary process of microsatellites, which may result in difficulties in translating estimates of genetic distance into absolute timescales (Ellegren, 2004).

3.1.6 Objectives Some characteristics of D. destructiva have not been well studied, such as the survival of inoculum under different temperatures, and genetic variation within Ontario populations of D. destructiva. As well, the pathogenicity of the fungus, its host range and the infection process have not been examined for Ontario isolates or on Ontario host species. Sexual structures have not been observed for this fungus in any part of its distribution worldwide, and an examination of the presence of mating types within Ontario isolates may reveal whether they have the potential to reproduce sexually. A study of the genetic variation within Ontario populations will also shed light on whether reproduction is mostly asexual. The purpose of this research was to better characterize the pathogen D. destructiva which causes dogwood anthracnose, to test susceptibility of other Cornus spp. and woody plants to this disease and to assess the incidence of dogwood anthracnose in Canada. To reach these goals, the following objectives were set: 1) To assess the growth rate of multiple isolates of D. destructiva at different temperatures. 2) To test the survival of D. destructiva inoculum under different temperatures. 3) To assess the host range of D. destructiva based on field samples and artificial inoculations. 4) To assess the incidence of dogwood anthracnose in Canada. 5) To assess the types and frequency of mating type genes in D. destructiva. 6) To examine the genetic variation of D. destructiva by SSR.

3.2 Materials and methods 3.2.1 Plants and fungal isolates Healthy potted dogwood plants, 30 to 130-cm-tall, were obtained from nurseries in Ontario and used in inoculation experiments either as whole plants or detached leaves (Table 3.2). Nine dogwood species or cultivars were used in artificial inoculation tests: Cornus alba ‘Bud’s Yellow’, Cornus alba ‘Ivory Halo’, C. alternifolia, C. amomum, C. florida (grown from landrace seeds from the University of Guelph Arboretum), C. kousa ‘Chinensis’, C. racemosa,

C. rugosa, C. sericea. Some of the small plants in 3-inch pots were replanted in 8-inch and 12- inch pots with Sunshine mix #1 (SunGro Horticulture Ltd., Seba Beach, AB, Canada), while larger dogwoods were planted in the field at the Guelph Turf Grass Institute. All repotted dogwood plants were placed outside, in a relatively shaded area during the summer, and watered when necessary. In mid-August, the plants were moved to a 25 °C room under a 12 h light/8 h darkness photoperiod and watered twice a week. To ensure the physiological dormancy period, in late fall plants were covered in dark plastic bags, loosely closed and kept in a vernalization room at 4 °C and watered once a month. Then, in late winter plants were brought out of dormancy by keeping them in incubators where temperature and light were gradually increased up to 20 °C and 16/24 h light. When new leaves started to emerge, the plants were moved into a greenhouse and then outside, in early summer. In addition, the pathogenicity of Discula destructiva was tested on detached leaves of three woody species unrelated to Cornus spp. such as Acer platanoides, Pyrus sp. and Quercus rubra. Only apparently healthy plant tissues were used in inoculation tests. Symptomatic samples of dogwood were collected from various locations in Ontario and B.C., from 2010 to 2013, with most samples collected in 2011 and 2012. A list of all locations and dates is presented in Appendix 2.2. Most samples were of C. florida and C. nuttallii, but a few samples were collected from C. alba, C. alternifolia, C. amomum, C. racemosa and C. sericea. Disease sample description is presented in section 2.3.1, while the isolation procedure and the single spore isolation method are explained in section 2.2.3

3.2.2 Growth rates of Discula destructiva isolates Mycelial growth of eight D. destructiva isolates obtained from Ontario and British Columbia was evaluated at nine temperatures. Screw-cap test tubes (21 × 150 mm) containing 5 mL of PDA were autoclaved and set horizontally to ensure that PDA filled the entire side of a tube but without protruding from the opening, which would have enhanced contamination (Figure 3.2). Agar plugs, 5 mm in diameter, were taken from actively growing colonies on PDA and transferred at to the mouth of each tube. Tube caps were attached loosely and sealed with parafilm, to ensure the necessary amount of air and prevent contamination. Inoculated tubes were incubated at room temperature for three days to allow the fungal colonies to establish growth, and then placed in incubators at 0, 2, 4, 6, 10, 15, 20, 25 and 30 °C. Four replicate tubes were

81 made for each isolate and the experiment was repeated twice. Measurements were made for 31 days, biweekly for 0, 2 and 4 °C and weekly for 6, 10, 15, 20, 25 and 30 °C. Growth rate was calculated by subtracting the initial growth recorded at day 3 (before tubes were incubated), from the highest growth recorded at each temperature (before growth values reached a plateau). The highest growth value was reached at different days depending on temperature: day 5 for 30 °C, day 17 for 6, 10, 15, 20 and 25 °C, and day 31 for 0, 2 and 4 °C. Growth rates were then subjected to analysis of variance with SAS PROC GLM (SAS Institute, Cary, NC, USA). When significant treatment effects were found, means were separated by the test of least significant difference (LSD; p = 0.05). An example of the SAS statements can be found in Appendix 3.1.

3.2.3 Survival of Discula destructiva inoculum To assess survival of D. destructiva inoculum, the inoculum types considered were represented by infected leaves overwintering on trees or in litter, symptomatic leaf samples stored at 4 °C for up to one year, and mycelium stored at extremely cold or hot temperatures. Dogwood litter samples were collected from C. nuttallii in British Columbia at two weeks intervals from late January to mid-March. Hanging, marcescent leaves which had been overwintering on trees were collected in late April from C. nuttallii in British Columbia. Litter samples and marcescent infected leaves were processed following the procedure described in Chapter 2, section 2.2.3. Symptomatic dogwood samples, collected from Ontario and British Columbia as described in Chapter 2, section 2.2.1 were processed upon receipt as mentioned above. Then, samples were stored at 4 °C for seven months to one year and processed a second time, after the storage period, following the same protocol as the first time. Mycelia harvested from sporulating colonies growing on PDA overlaid with autoclaved cellulose membrane sheets as described in Chapter 2, section 2.2.5, were incubated in Eppendorf tubes at -20 °C or at +40, 50 and 60 °C. Then, survival of mycelium was assessed weekly by culturing it on PDA.

3.2.4 Pathogenicity tests 3.2.4.1 The infection process on Cornus florida To assess the germination rate of D. destructiva spores, 4-wk-old cultures which had formed abundant conidiomata after growing on amended media as described in section 2.2.2, were used to prepare spore suspensions. An aliquot of 100 μL of 103 spores/mL spore suspension was evenly spread out on water agar. To obtain a thin and translucent medium for observing spore germination, 10 mL of autoclaved 1% water agar were used per 9-cm-diameter Petri plate, to form a layer less than 2 mm deep. A 1 cm x 1 cm square of inoculated water agar was cut and analysed microscopically 16, 24 and 48 h after inoculation. To assess the infection process of D. destructiva on plant tissues, healthy, detached leaves of C. florida were used. Leaf surfaces were disinfested in preparation for inoculation by submerging in ethanol 70% for a few seconds, then in sodium hypochlorite 1% for 30 s, followed by two rinses in autoclaved deionized water. Leaves were then placed adaxial surface up in Petri plates lined with a piece of sterilized 9-cm-diameter filter paper (Qualitative P5, Fisher Scientific, Pittsburgh, USA). An aliquot of 2 mL of autoclaved deionized water was added to the filter paper to maintain high humidity needed for infection. Wounds were made on the leaf surface by gently scratching the epidermis with a flamed needle, making multiple scratches in a 1 cm2 area and no more than three such wounded areas per leaf. Each leaf was inoculated by spraying with 0.45 mL of a 106 spores/mL spore suspension of D. destructiva. After inoculation, plates were sealed with parafilm and placed at 25 °C, under indirect light, with a 16 h light and 8 h darkness photoperiod. To maintain humidity, the leaves were sprayed with autoclaved deionised water every 3-4 d. The spore germination rate on inoculated leaves was checked daily up to 3 d, and details of the germination and infection process were recorded up to 21 d. To evaluate spore germination rates on leaf surface, three randomly chosen inoculated leaves were sampled daily for three days. Two 1 x 0.5 cm pieces were cut from each leaf, one from the wounded area and one from the non-wounded area. Each leaf piece was placed inside an Eppendorf tube with 100 µL autoclaved deionised water and vortexed at 25 Hertz. Then, 10 µL of water were recovered from the tube and placed on a haemocytometer, and germinated conidia were observed under the microscope at x 400 magnification. A conidium was considered germinated when the germination tube was more than half the spore length.

Samples were taken from wounded and non-wounded areas of inoculated leaves up to 15 days after inoculation (DAI), trimmed into 1 cm x 0.5 cm pieces and analysed microscopically. Preparation of leaf samples for microscopy was done by placing the leaf pieces in acetic alcohol (25% glacial acetic acid, 75% ethanol) for 48 h to clear the chlorophyll (Busch and Walker, 1958; Lubani and Linn, 1962). The acetic alcohol was removed after 24 h and replaced with a fresh solution for another 24 h. Cleared leaf pieces were then placed on a glass slide with the adaxial surface up in drops of 0.05% trypan blue (w/v) in lactophenol (20% phenol, 20% lactic acid, 40% glycerine and 20% water) for 24 - 48 h. After 48 h, leaves were mounted on glass slides in drops of lactophenol. To determine whether virulence differed between D. destructiva isolates from Ontario and isolates from British Columbia, two different isolates were used in the pathogenicity assays: isolate 10192 from Ontario and isolate 12180 from British Columbia. The experiment was repeated twice.

3.2.4.2 Pathogenicity tests on other Cornus spp. and woody plants Since natural infections have been observed only in C. florida, C. nuttallii, C. kousa and C. kousa ‘Chinensis’ (Daughtrey and Hibben, 1994), other Cornus species and cultivars, as well as other tree species, were used in artificial inoculations to assess their susceptibility to the disease caused by D. destructiva. To test susceptibility, detached leaves or leaves on plants growing in the field or inside the greenhouse were used. Detached leaves of the following dogwood species and cultivars have been tested: C. alba ‘Bud’s Yellow’, C. amomum, C. alternifolia, C. kousa ‘Chinensis’, C. racemosa, C. sericea. Leaves of C. florida were used as positive controls. Non-inoculated leaves were used as negative controls, and incubated on fresh media or sprayed with water. To evaluate the susceptibility of other plant species to dogwood anthracnose, detached leaves from the non-Cornus, woody species Acer platanoides. (Norway maple), Pyrus sp. (wild pear) and Quercus rubra (red oak) were included in the study. Leaves were surface disinfested with ethanol 70% and sodium hypochlorite 1%, rinsed with water and placed adaxial surface up in Petri plates lined with filter paper moistened with 2 mL autoclaved water. Portions of the epidermis were wounded by scratching with a flamed needle, making numerous scratches in a 1 cm2 area, and no more than three such wounded areas per leaf. Two types of inoculum were

84 used: spore suspensions (106 spores /mL) from either isolate 10192 from Ontario or isolate 12180 from British Columbia, and sporulating D. destructiva colonies on solid medium. Spore suspensions were applied by spraying an aliquot of 0.45 mL on each leaf. On sporulating colonies on solid medium, leaves were placed adaxial surface down and incubated for three days, then removed and placed in Petri dishes with moistened filter paper prepared as above. As negative controls, uninoculated leaves of all species used were either incubated on Petri plates with fresh medium, or sprayed with autoclaved deionized water. All leaves were checked visually daily for up to 21 DAI, and modifications recorded. To assess disease development events, fragments of inoculated leaf tissue were sampled at 2 DAI, 8 DAI and 14 DAI and prepared for microscopy as described above (see section 3.2.4.1). Pathogen re-isolation attempts were done at 14 DAI. Artificial inoculation tests made by incubation on sporulating colonies on media were repeated three times, while inoculations with spore suspensions were repeated twice for each of the two fungal isolates used. Field-grown dogwood plants (C. alba ‘Ivory Halo’, C. amomum, C. alternifolia, C. racemosa, C. rugosa and C. sericea) and greenhouse-grown dogwood plants (C. alternifolia, C. amomum, C. florida, C. rugosa and C. sericea) were used in inoculation tests when foliage was fully grown. Four leaves on each plant were wounded by scratching with a needle. Wounded leaves, as well as non-wounded apical leaves were then inoculated by spraying with a spore suspension (106 spores/mL prepared from spores of isolate 10192) until runoff. No cover was applied on inoculated leaves of field-growing plants, due to the risk of overheating, but inoculated leaves of greenhouse plants were covered with transparent zip bags for 7 d. As negative controls, wounded or non-wounded leaves on each plant were sprayed with water. Greenhouse C. florida was used as positive control for inoculation tests with dogwoods growing in greenhouse, but no field-growing C. florida plants were available. Inoculation was repeated after 3 d and plants were examined daily for symptom development. Pathogen re-isolation was attempted after three weeks from inoculation. Susceptibility on both detached leaves and leaves on plants was rated as symptom production, and the percentage of leaf tissue affected by necrosis was estimated visually. Since necrosis can often be associated with a wide variety of fungal pathogens, two criteria were considered as indicators of necrosis being produced by D. destructiva: presence of D. destructiva acervuli on areas of necrosis, and re-isolation of D. destructiva from symptomatic tissue.

Re-isolation of D. destructiva was attempted from symptomatic leaf areas or, where no symptoms developed, from wounded areas. The re-isolation method was as follows: symptomatic tissue was cut off and trimmed into 5 x 3 mm pieces, then submerged in ethanol 70% for 30 s and in sodium hypochlorite 1% for 10 min, followed by two rinses in autoclaved deionized water and cultured on PDA. After one week, colonies of D. destructiva were counted to determine pathogen re-isolation rates. Disease ratings were subjected to analysis of variance with SAS PROC GLM (SAS Institute, Cary, NC, USA). When significant treatment effects were found, means were separated by the test of least significant difference (LSD; p = 0.05). An example of the SAS statements can be found in Appendix 3.2.

3.2.5 DNA extraction and SSR primer design For DNA extraction, D. destructiva isolates from Ontario and British Columbia were grown on PDA overlaid with autoclaved cellophane, to allow easy harvesting of mycelium. DNA extractions were performed twice for each isolate used and the protocol followed Edwards et al. (1991) as mentioned in Section 2.2.5. To develop primers based on the SSR loci of D. destructiva, the genome of one D. destructiva isolate was sequenced and genes predicted as described in sections 2.2.6 and 2.3.4. SSR primers were designed using the default settings of program QDD2 (Meglecz et al., 2010). Ten primer sets with penalty values below seven and a difference in Tm of less than 0.5 °C were selected randomly for synthesis and testing. The SSR primers were synthesized by Laboratory Services at the University of Guelph. Primers used in the study are listed in Table 3.1.

3.2.6 PCR amplification for ISSR and SSR ISSR and SSR primers were used to test study genetic variation of D. destructiva. Preliminary tests were done by checking 16 randomly chosen ISSR primers on four isolates of D. destructiva (two from Ontario and two from British Columbia). ISSR reactions were done in total volume of 20 µL, containing: 10x DNA Tsg polymerase buffer, Mg SO4 20mM, 10 μM of each dNTP, 25 μM of primer and 0.5 units of Tsg DNA polymerase (Bio Basic, Markham, ON, Canada) and 1-10 ng template DNA. DNA amplification was done in a thermal cycler (MyCycler Thermal Cycler System #170-9703, Bio-Rad, USA), with an initial denaturation step

86 of 94 °C for 3 min, followed by 45 cycles of 94 °C for 30 s, annealing at primer-dependent temperature for 45 s, elongation at 72 °C for 1.5 min, and a final extension at 72 °C for 10 min. Ten pairs of SSR primers (Table 3.1), developed from the predicted genome sequence of one D. destructiva isolate, were initially tested on four D. destructiva isolates of different origins to find those primer pairs that would produce polymorphic band patterns. Each amplification reaction was carried out in total volume of 15 µL, containing: 1x PCR buffer (50 mM Tris - HCl, pH 8.5); 3.7 mM MgSO4; 0.2 mM dNTP; 0.5 μM of each primer separately; 0.6 U Tsg DNA polymerase (Bio Basic Inc., Markham, ON, Canada); and 1 ng genomic DNA. PCR conditions were optimized by testing different concentrations of Mg2+ from 2.5 mM to 5 mM per reaction, different annealing temperatures, from 50 °C to 55 °C (for primer melting temperatures between 61-64 °C), or by increasing the elongation time from 1.5 min to 4 min. Clear bands were obtained for Mg2+ concentrations of 3.7 mM MgSO4 per reaction, annealing temperature of 50 °C and 4 min elongation time. The MyCycler thermal cycler was used and PCR conditions were as follows: initial denaturation step at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, annealing at 50 °C for one min, elongation at 72 °C for one min, followed by a final extension at 72 °C for 10 min. DNA amplification products obtained with ISSR or SSR primers were then separated in 1.2% agarose gels (UltraPureTM, Invitrogen, Carlsbad, CA, USA). PCR products (5 μL) were mixed with 1 μL of 6× loading dye (R0611, Fermentas, Pittsburgh, PA, USA). An aliquot of 6 μL DNA marker (GeneRuler 10 kb DNA ladder, Bio Basic Inc., Markham, ON, Canada) was used to measure band sizes. Electrophoresis was done at 50 V in a Mupid 2-plus electrophoretical chamber (Helixx Technologies Inc., Toronto, ON, Canada). Gels were stained with an ethidium bromide (EtBr) solution at a concentration of 2 - 4 μg/mL for 5 min. If the gels were overexposed to EtBr, they were distained in tap water for 5 to 10 min. DNA band visualization was done with an ultraviolet (UV) transilluminator from Syngene (Synoptics, Cambridge, Cambridgeshire, U.K.). To examine the results, a GBC video camera CCTV (South Hackensack, NJ, USA) was used. To record the results, an attached video-copy processor P67U (Mitsubishi Electric, Cypress, CA, USA) was used to print hard copy of images. To save an electronic version of images, a desktop computer with attached frame-grabber card (Integral Technologies, Indianapolis, IN, USA) was used to retain black and white jpeg files (resolution 800 × 600). Each of the isolates used in SSR tests were subject to two DNA extractions and

SSR-PCR tests were repeated twice for each DNA extraction.

3.2.7 SSR data analysis Thirty-six D. destructiva isolates were analyzed with the selected SSR primers. After separating amplification products on gels, the gel images were recorded and scored for the presence or absence of bands. Only the most intense bands were scored, assuming positional homology. The analysis considered only fragments that were reproducible in at least two replicate PCR reactions and reproducible using different DNA extractions from the same isolates. The computer program WinDist (Yap and Nelson, 1996) was used to compute genetic distances, based on the Dice similarity coefficient, where distance = 1-2nxy/(nx+ny), where nxy represents the shared bands, and nx and ny represent the number of bands in population x and population y, respectively (Nei and Li, 1979). The Dice similarity coefficient is commonly used to assess binary data (Fuentes et al., 1999). The program Phylip 3.5 (Felsenstein, 1989) was used to generate a lower-triangular matrix and to construct a dendrogram with Unweighted Pair Group Method with Arithmetic Mean (UPGMA). The program TreeView 1.6.6 (Page, 1996) was used to visualize the UPGMA dendrogram and present the results.

3.2.8 Screening for mating types in D. destructiva To assess the presence of mating-type genes in D. destructiva genome, genomic DNA of isolates obtained from various locations in Ontario and British Columbia was amplified with MAT primers. Primers were designed based on the gene MAT1-2 found in the predicted genome of one D. destructiva isolate. The full methodology and results for MAT-primers design were described in sections 2.2.7 and 2.3.5 of this study. The primers used for screening D. destructiva isolates for the presence of mating-type genes flanked a region of over 1,000 base pairs and were as follows: forward primer ddmat2_f1429: (5'-CTGCTGCTCGAGTACGATGTGC-3') and reverse primer ddmat2_R2513: (5'-AGGTCGGCGTAGCGGCGGAT-3'). PCR was run in 15-μl reaction volume containing: 1x PCR buffer (50 mM Tris - HCl, pH 8.5), 2.5 mM MgSO4, 0.2 mM dNTP, 0.5 μM of each primer, 0.6 U Tsg DNA polymerase (Bio Basic, Markham, ON, Canada) and approximately 1ng genomic DNA. Thermal cycling conditions were: initial denaturation step at 94 °C for 3 min, followed by 35 cycles of 94 °C for 30 s, annealing at 66 °C for one min, elongation at 72 °C for one min, followed by a final

88 extension at 72 °C for 10 min. Amplified products were then subjected to electrophoresis through 1.0% agarose gels (Invitrogen, Burlington, Canada), and then stained with ethidium bromide, and visualized with a UV transilluminator. Obtaining one clear band of the expected size signified that the isolate tested had the MAT1-2 gene, while a negative result meant either that the isolate had the other idiomorph, or that the DNA template was poor and amplification did not occur. To rule out the possibility of lack of band due to lack of amplification, isolates that gave negative results with the MAT primers were also tested with the EF1a primers. The methods and results for designing EF1a primers were presented in sections 2.2.7 and 2.3.5. The gene encoding the elongation factor 1 alpha is found in only one copy in the genome, as is either one of the mating-type idiomorphs, thus a positive PCR result with EF1a primers, but negative with MAT primers showed that lack of amplification was due to lack of target gene and not due to poor DNA template.

3.3 Results 3.3.1 Dogwood anthracnose incidence in Canada Symptomatic samples of C. alba, C. alternifolia, C. amomum, C. florida, C. nuttallii, and C. sericea were collected from various locations in Canada between 2010-2012, and three samples of C. kousa and one of C. florida were received from Sapporo, Japan. Discula destructiva was found only on C. florida and C. nuttallii collected in Canada. C. florida samples were collected from 30 sites across southwestern Ontario, scattered in five counties and one region (Table 3.3). The areas sampled were: Essex County, Middlesex County, Norfolk County, Oxford County, Wellington County, and Niagara Region. Some of the sites have been sampled more than once over the mentioned period of time, and a total of 80 symptomatic samples were gathered. Upon sample processing, if at least one out of multiple samples collected from one site was found positive for dogwood anthracnose, the site was considered positive for disease presence. Out of the total 30 sites tested across southwestern Ontario, 14 were positive for dogwood anthracnose and were located in regions with native populations of C. florida. Oxford and Wellington counties were free of dogwood anthracnose (Figure 3.3). Symptomatic samples of C. nuttallii were collected in 2011 and 2012 from 12 sites in southwestern British Columbia, located in Vancouver, Victoria and Hornby Island (Table 3.4), totaling 54 samples. All samples from these sites were positive for dogwood anthracnose. A map

89 with the locations sampled is presented in Figure 3.4. It has been noticed that symptom severity on B.C. samples was more severe than on samples collected from Ontario, and also D. destructiva has been isolated with higher rates from B.C. samples than from Ontario samples.

3.3.2 Temperature effects on Discula destructiva 3.3.2.1. Optimum growth temperature To determine the optimal growth temperature for D. destructiva, five isolates from Ontario (11121, 12295, 12306, 12312 and 12486) and three isolates from British Columbia (11132, 12205 and 12302) were grown at nine different temperatures (0, 2, 4, 6, 10, 15, 20, 25 and 30 °C). The mycelial growth measurements used in the analysis were as follows: at 0, 2 and 4 °C, mycelium growth by day 31 was used; at 30 °C, mycelium growth by day 5 was used; at 6, 10, 15, 20 and 25 °C, mycelium growth by day 17 was used in the analysis. Differences in mycelial growth rates were observed among various temperatures (p<0.0001) and also among isolates at each temperature, but the general temperature requirements were similar among isolates. At 30 °C, growth was recorded only with two isolates (one from Ontario and one from B.C.) up to day 5 after incubation, but no growth occurred after day 5. However, at 0 °C growth was recorded with all isolates, and the overall mean growth was approximately 2 mm after 31 days. The highest growth rates were recorded at 20 °C and 25 °C. Although there were significant differences in mycelial growth among isolates at each temperature, no significant differences were found in the pattern of temperature requirements for Ontario isolates versus B.C. isolates (Figure 3.5).

3.3.2.2 Survival of Discula destructiva inoculum at different temperatures Several types of inoculum were assessed for viability under different conditions: infected leaves overwintering on trees or in litter, symptomatic leaf samples stored at 4°C for up to one year, and mycelium stored at extremely cold (-20 °C) or hot temperatures (60 °C). Leaves that had overwintered hanging on trees, and were collected and processed in late April, were found to have 90% viability rate for D. destructiva. However, when leaves that had been overwintering in litter were processed, viability rates decreased from 40% in litter samples collected and processed in late January, to less than 2% in subsequent samples collected and processed in February and March. A common characteristic noticed after processing both hanging leaves and

90 litter samples was a high contamination with yeasts. Survival of D. destructiva in symptomatic samples stored at 4 °C for a period of seven months to one year decreased drastically in samples of C. florida from Ontario (Table 3.5). Of four samples tested, only one still had viable fungus, and the isolation rate for this sample after 10 months of storage was 12%, while the initial isolation rate had been 23%. All four C. nuttallii samples from British Columbia, however, still had viable fungus, and after seven months of storage at 4 °C the isolation rates were between 24-57%, while upon receipt all B.C. samples had 100% isolation rate for D. destructiva (Table 3.5). A common characteristic of all symptomatic samples of C. nuttallii within our collection was that D. destructiva was isolated with very high rates upon receipt; often 100% of the necrotic leaf pieces cultured on PDA produced the fungus, but the overall mean re-isolation rate for all C. nuttallii samples was 65%. Symptomatic samples of C. florida had significantly lower isolation rates for D. destructiva (30%). Another common characteristic of symptomatic samples of C. nuttallii is a lack of contamination with other fungal species. The only instance when C. nuttallii samples were contaminated with yeasts was with old, symptomatic tissues overwintered on trees or in litter. However, C. florida samples with dogwood anthracnose, often produced not only D. destructiva colonies, but also other fungal species at high rates (Appendix 2.2). Survival rates obtained with mycelium of D. destructiva incubated in Eppendorf tubes at -20 °C or at 40, 50 and 60 °C showed that the fungus prefers low rather than high temperatures. After 12 wk at -20 °C, 90% of the mycelium was still viable, while after incubation at 40 °C, only 10% of the cultures survived for one week, and no survival was recorded at higher temperatures.

3.3.3 Disease development during inoculation progress 3.3.3.1 The infection process on Cornus florida Spore germination was assessed on water agar (WA) as well as on inoculated leaves. Spores were considered germinated when germ tubes reached at least half the spore length. On WA, at 16 h after inoculation 27% of spores had germinated, at 24 h 45%, and at 48 h after inoculation, approximately all conidia (93%) were germinated. Germination tubes emerged either from a single end, or from both ends of spores; in some cases three germ tubes grew from the same spore (Figure 3.6, b). On inoculated leaves, spore germination rates differed on non-

91 wounded versus wounded leaf areas. Microscopically, at one day after inoculation (DAI) there were no differences between spore germination on non-wounded versus wounded leaf areas. Some of the conidia started producing germ tubes, and most spores, either germinated or not, were found to be associated with leaf trichomes. At 2 DAI most of the spores on wounded areas had germinated and were exclusively associated with trichomes. On non-wounded areas only some of the spores had germinated, and they were also exclusively associated with trichomes (Figure 3.7). At 3 DAI, approximately 30% of spores had germinated on non-wounded areas, while on wounded areas most conidia had germinated and started growing hyphae (Figure 3.8). Hyphal growth on wounded areas was mostly associated with trichomes, however hyphae were also found on the epidermal surface. On non-wounded areas, no significant differences were noticed from observations made on previous day, germinated spores being exclusively associated with trichomes. From 4 DAI to 7 DAI, hyphae on wounded areas continued to grow, producing a net which covered the epidermis and concentrated around trichomes. At 8 DAI, acervuli primordia formed on wounded areas and were always associated with trichomes; on non-wounded leaf areas, sparse hyphal growth occurred only associated with trichomes. Ungerminated spores and spores which had germ tube primordia formed could be still found on epidermis (Figure 3.9). Fully developed acervuli of D. destructiva were found on wounded areas at 14 DAI (Figure 2.7), while on non-wounded areas, no signs or symptoms appeared. In the pathogenicity assays, one D. destructiva isolate from Ontario (isolate 10192) and one from B.C. (isolate 12180) were used, to determine whether isolates from different geographical regions would produce different results. There were no significant differences between the two isolates, in terms of amount of necrosis produced on C. florida leaves. However, pathogen re-isolation attempts showed mean re-isolation rates of 91% from leaves inoculated with isolate 10192 from Ontario, and 27% from leaves inoculated with the isolate 12180 from B.C. (Table 3.6 and Table 3.7).

3.3.3.2 Pathogenicity of Discula destructiva on other Cornus spp. or woody plants To assess whether dogwood anthracnose can affect other plant species then C. florida, detached leaves of six species of Cornus (C. alba ‘Bud’s Yellow’, C. amomum, C. alternifolia, C. kousa ‘Chinensis’, C. racemosa and C. sericea) and also leaves of Acer platanoides, Quercus rubra and Pyrus sp. were inoculated either by incubating on sporulating colonies of D. destructiva on solid medium, or by spraying with spore suspensions. When exposed to high inoculum pressure, such as sporulating colonies on media, all leaves tested, regardless of species, developed necrosis associated with acervuli of D. destructiva. Necrosis began in wounded areas or sometimes from the cut petiole, as early as three days post inoculation, but never in non-wounded areas. From wounds or petiole, necrosis extended to surrounding tissue, and acervuli were visible on necrotic tissue of all species tested at 14 DAI. Symptom severity differed among species. On leaves of C. florida and C. kousa ‘Chinensis’ necrosis extended rapidly from wounds and/or petiole and by 14 DAI covered 40-45% of leaf surface, while on any of the other Cornus spp., as well as on leaves of Acer platanoides, Quercus rubra and Pyrus sp. necrosis was confined to the wounded areas (Table 3.6 and Table 3.8, Figure 3.10). When detached leaves were inoculated with a spore suspension from Ontario isolate 10192, necrosis formed on wounded areas of most Cornus spp. used, except for C. amomum. Leaves of C. florida and C. kousa ‘Chinensis’ had the highest severity of symptoms. When detached leaves were inoculated with a spore suspension from B.C. isolate 12180, necrosis formed only on leaves of C. florida and C. kousa ‘Chinensis’. The PDA plates not amended with antibiotics that were sprayed with each of the inocula to assess spore germination, revealed that inoculum of B.C. isolate 12180 was contaminated with bacteria. On leaves sprayed with the contaminated inoculum, bacteria were found to associate with trichomes (Figure 3.11). On leaves of Acer platanoides, Quercus rubra and Pyrus sp., inoculations with spore suspensions from both Ontario and B.C. isolates did not produce symptoms. Discula destructiva was re-isolated at high rates from the necrotic leaf tissue, regardless of plant species tested. As expected, the highest re-isolation rates were obtained from symptomatic leaf tissues of C. florida and C. kousa ‘Chinensis’, since these species had also the highest severity of necrosis. Interestingly, the pathogen was re-isolated at high rates from leaves with low extent of necrosis. A few examples are as follows: 64% or 52% mean re-isolation rates from C. sericea leaves which presented only 7% or 6% mean necrosis, and 40% or 32% mean re-

93 isolation rates from leaves of C. alba ‘Bud’s Yellow’ which had only 8% or 5% mean necrosis (Table 3.6 and Table 3.7). The only situation when inoculation was not conducive to necrosis and D. destructiva was not re-isolated from the asymptomatic wounded areas, was with detached leaves of C. amomum inoculated with spore suspensions. The pathogen was also re-isolated from asymptomatic wounded leaf areas of Acer platanoides, Quercus rubra and Pyrus sp. inoculated with spore suspensions. Microscopically, the sequence of events involved in disease development on all Cornus spp. tested was similar to what was described for C. florida in the previous section. Spores germinated on all dogwood leaves, and significant differences were observed in spore germination and hyphal growth on wounded versus non-wounded leaf areas (Figure 3.12). After 8 d from inoculation with a spore suspension, all spores had germinated and a net of hyphae had formed on wounded leaf areas of all Cornus species, while on non-wounded tissue, spores had barely started to grow germ tubes and non-germinated spores could also be observed. Association of germinated spores or hyphae with trichomes was common for all Cornus spp. tested, especially on non-wounded areas. Necrosis and acervuli of D. destructiva formed only on wounded areas. Acervuli primordia were found as early as 9 DAI on wounded areas of C. alternifolia, while on the other Cornus spp. tested, acervuli primordia formed at 12 to 14 DAI. No necrosis or acervuli formed on detached leaves of C. amomum. Dogwood plants growing either in the field (C. alba ‘Ivory Halo’, C. alternifolia, C. amomum, C. racemosa, C. rugosa and C. sericea) or under greenhouse conditions (C. alternifolia, C. amomum, C. florida, C. racemosa, C. rugosa and C. sericea) were used in inoculation tests as whole plants. No symptoms developed on inoculated leaves of any of the field-growing Cornus plants, and pathogen re-isolation attempts from asymptomatic tissues showed 14% re-isolation rate only from wounded leaf areas of C. alternifolia. Among the greenhouse-growing Cornus spp. dogwood anthracnose symptoms appeared only on inoculated leaves of C. florida, either wounded or non-wounded. On wounded leaves, necrosis began from wounded areas and extended rapidly to surrounding tissue, and by 14 DAI the leaves were half blighted and covered with acervuli of D. destructiva. On unwounded leaves of C. florida necrotic spots were visible at 14 DAI. The pathogen was re-isolated from all symptomatic leaf pieces of C. florida cultured on PDA. Inoculated leaves on potted C. alternifolia, C. amomum, C. rugosa and C. sericea plants

94 showed no symptoms. However, 70-90% of asymptomatic wounded areas of inoculated leaves of all above mentioned species produced D. destructiva after 3 wk from inoculation. The same re- isolation rates were obtained after 10 wk from inoculation, although no symptoms occurred. One inoculated, wounded leaf of C. rugosa was accidentally detached from plant at 3 DAI and incubated inside a zip-bag in conditions similar to those used with inoculations of detached leaves. Necrosis and acervuli of D. destructiva formed on the wounded areas of this detached leaf, while leaves that remained attached to the plant did not produce symptoms. To see whether removing the leaves from plants would produce different pathogenicity results compared to leaves on plants, at 8 wk from inoculation, the remaining asymptomatic wounded inoculated leaves of potted dogwoods were removed from plants and incubated on wet filter paper, in conditions similar to those described for detached leaves. Necrosis and acervuli were visible 14 d after leaves had been removed from plants.

3.3.4 Genetic variation in Discula destructiva To assess the genetic variation of Discula destructiva, 16 ISSR primers and 10 pairs of SSR primers were preliminarily tested with four isolates. None of the ISSR primers provided reliable polymorphic results. Out of the ten pairs of SSR primers, only two produced clear banding patterns and were used in this study. The SSR primer pairs used were: pair SSR2 – forward (5’-AGCGGCATTGCAAGATAGAC-3’) and reverse (5’- ATAGGCTGCATGTTTCGAGC-3’), and pair SSR3 – forward (5’- GCAGTCTCTGAGGAGGACGA-3’) and reverse (5’-TAGTGAGTCGTTGGACGGG-3’). From among 122 isolates of D. destructiva, 36 were chosen for genetic variation screening, based on the following criteria: 1) isolates from different lesions on the same leaf; 2) isolates from different leaves on the same tree, collected at the same time; 3) isolates from the same tree, collected at intervals of approximately one month; 4) isolates from the same tree, obtained from leaves overwintering hanging on tree and from newly formed leaves; 5) isolates used in the temperature effects test. The purposes of the above mentioned criteria in selecting D. destructiva isolates for the genetic variation test was to detect whether genetic polymorphisms occur between isolates obtained from different distances in space and in time, and to connect putative growth patterns with genetic polymorphisms. Some of the selected groups of isolates were either from Ontario or B.C., while the last group, which was also used in the temperature

95 effects tests, contained isolates from both provinces. A total of 330 fragments were generated with primer pair SSR2, and 259 fragments with primer pair SSR3. All isolates tested with SSR2 gave 8 bands, while with SSR3 all isolates produced 7 bands. Most fragments produced with both primer pairs were in a size range from 150 to 2,000 bp. The largest fragment size was 3 kb and was obtained with SSR2. The data were recorded in binary format and analyzed with Windist to produce a genetic distance matrix. This matrix was used in Phylip to obtain an UPGMA dendrogram which was visualized using TreeView (Figure 3.13). The dendrogram showed that most of D. destructiva isolates tested had low genetic variation, with genetic similarity close to 100%. With SSR2, all isolates had the same banding patterns, while with SSR3, most B.C. isolates, except one (isolated from Capilano Golf Course), differed from Ontario isolates by one band of 2 kb.

3.3.5 Mating types in Discula destructiva

Genomic DNA from all 122 isolates of Discula destructiva was amplified with the MAT2 primers designed based on the mating type gene MAT1-2 found in the predicted genome of one of the isolates. The primers were: forward primer – ddmat2_f1429: (5'- CTGCTGCTCGAGTACGATGTGC-3') and reverse primer – ddmat2_R2513: (5'- AGGTCGGCGTAGCGGCGGAT-3'). In all instances, a clear band of the expected size (over 1,000 bp) was obtained, showing that all 122 D. destructiva in our collection had only one of the mating type idiomorphs, which was the gene MAT1-2.

3.4 Discussion Since the outbreak of dogwood anthracnose around New York and Washington areas in the mid 1970’s, this disease and the causal agent Discula destructiva have been studied intensively in U.S. However, no studies were done on the dogwood anthracnose fungus in Canada. The present study aimed to give an outlook over the incidence of dogwood anthracnose in Ontario and British Columbia (B.C.), and to better understand some of the biological characteristics of Discula destructiva isolates from both Canadian provinces.

3.4.1 Dogwood anthracnose incidence in Canada The first report of dogwood anthracnose in Canada was made in 1983 by Salogga and Ammirati (1983), referring to south B.C., and by 1996 numerous sites with C. nuttallii were affected by the disease (Daughtrey et al., 1996). Later in 1998, the disease was reported in Ontario, Norfolk County, by Davis (2001). An assessment made in 2004-2005 on dogwood anthracnose incidence in Ontario showed that the disease was present in Essex, Middlesex and Norfolk Counties, as well as in many locations at Niagara Region. Samples collected from Fireman’s Park in Niagara Region, presented dogwood anthracnose symptoms, but the disease could not be confirmed for this particular location (COSEWIC, 2007). To assess disease incidence in Canada, samples consisting of leaves, twigs and fruit with symptoms of dogwood anthracnose were collected from trees of C. florida in southwestern Ontario, and of C. nuttallii in southwestern B.C. Sampling sites in Ontario were located in areas where C. florida populations grow naturally, scattered across Essex County, Middlesex County, Norfolk County and the Niagara Region (Fireman’s Park). The counties with the most numerous populations of C. florida, according to a survey done in 2005 by COSEWIC (Figure 1.3), were: Essex, Norfolk and the Niagara Region. No natural growing populations of C. florida have been reported in Oxford or Wellington counties (COSEWIC, 2007), but samples were collected from cultivated flowering dogwoods at local arboretums in Oxford and Wellington. In this study, all sites with C. florida populations growing naturally were found positive for dogwood anthracnose, including Fireman’s Park in Niagara Region, while the specimens tested in Oxford and Wellington counties were healthy. Symptomatic samples of C. nuttallii were collected from sites located in Vancouver, Victoria and Hornby Island, usually from cultivated specimens and only on Hornby Island sites were located in natural forest areas. All B.C. sites tested were positive for dogwood anthracnose. In addition, symptom severity on B.C. samples was much greater than on samples collected from Ontario. Furthermore, isolation rates of D. destructiva from C. nuttallii samples were twice as high as the rates from C. florida samples. This research demonstrates that D. destructiva is widespread in southern Ontario where C. florida is found, while in B.C. the dogwood anthracnose fungus was found on both forest and cultivated specimens of C. nuttallii, suggesting that dogwood anthracnose might be more severe in B.C. However, previous observations indicated differences in disease response between the two host species, with tree mortality reportedly associated with infected C. florida, but rarely

97 with C. nuttallii (Redlin, 1991). Davis (2001) reported a 46% mortality rate from a plot of 70 C. florida trees in Norfolk, Ontario, over a period of five years from 1995 to 2000, due to dogwood anthracnose. Salogga and Ammirati (1982) reported that C. nuttallii trees with 2-3 year old infections presented severe dieback of lower branches dieback and even stem dieback, but did not mention tree mortality due to dogwood anthracnose. This may suggest that diseased C. florida die within a few years, while infected C. nuttallii survive and symptom severity on infected trees increases over time, since inoculum survives in unabscised leaves (Daughtrey and Hibben, 1994) and possibly in woody tissues, explaining the wide incidence of dogwood anthracnose in B.C. and the high severity of symptoms on C. nuttallii. Furthermore in this study D. destructiva has been found to survive better in stored symptomatic tissues of C. nuttallii than in C. florida, suggesting that there might be differences in susceptibility and tolerance to disease between the two hosts. This deserves further study.

3.4.2 Contrasting Discula destructiva isolates from Ontario and British Columbia To assess growth differences between D. destructiva isolates obtained from Ontario and from B.C., mycelium growth at different temperatures was assessed using representative isolates from both Canadian provinces. Although there were significant differences in mycelial growth among isolates at each temperature, the overall pattern of temperature requirements was similar for Ontario and B.C. isolates. All isolates had the optimum growth rates between 20-25 °C; at 0 °C the growth was extremely slow, however a 2 mm overall mean growth was recorded after 31 d, while at 30 °C all isolates stopped growing after 5 d. These findings are in agreement with the findings of Salogga (1982) that D. destructiva isolated from C. nuttallii in B.C. had the optimum growth at 21-24 °C and no growth occurred at 27 °C. The average growth on potato dextrose agar (PDA) at room temperature for isolates obtained from C. florida on eastern U.S. was found to be approximately 8 mm per day (McElreath and Tainter, 1983). The overall mean growth for all isolates tested in the present study was approximately 10 mm per day at 20-25 °C, which is in close agreement with previous findings. No significant growth differences were found between isolates from Ontario versus B.C. This confirms the uniformity of D. destructiva populations detected by SSR in this study, emphasizing once more the recent introduction of limited genotypes of D. destructiva into North America, and again supports the exotic origin of dogwood

98 anthracnose (Trigiano et al., 1995). To determine whether isolates from different geographical regions would produce different results with the pathogenicity assays, one D. destructiva isolate from Ontario (isolate 10192) and one from B.C. (isolate 12180) were used. The amount of necrosis produced by the two isolates on C. florida leaves did not differ significantly. However, the pathogen was re- isolated with higher rates from leaves inoculated with the Ontario isolate (91%), than from leaves inoculated with the B.C. isolate (27%) suggesting a possible host preference of D. destructiva isolates, depending on their origin. To further examine this, artificial inoculations using C. nuttallii and other D. destructiva isolates of different origins might be useful.

3.4.3 Inoculum sources and the infection process of Discula destructiva on Cornus florida The primary inoculum source was thought to be the unabscised infected leaves, overwintering on trees (Daughtrey and Hibben, 1994) and the present study confirmed marcescent leaves as an important source of inoculum. Mycelium of D. destructiva incubated at extreme cold or extreme hot, reconfirms that the fungus prefers low rather than high temperatures, and suggests the possibility of D. destructiva growing in woody tissues during the winter, while the plant is dormant. Previous studies on the infection process of D. destructiva on C. florida used different inoculation methods and tissues, but one pre-requisite for successful infection throughout these studies was the presence of wounds on tissues prior to inoculation (Brown et al., 1996; Ament et al., 1998; Cheng et al., 2011), while non-wounded leaves appeared to be resistant to infection (Walkinshaw and Anderson, 1991; Redlin, 1992 and Brown et al. 1994b). Brown et al. (1994b) used unwounded, detached leaf-pairs inoculated with a spore suspension and stated that that germ tubes were found to be consistently associated with leaf trichomes, although no direct penetration nor penetration via stomata, nor any type of successful entry of the pathogen into host cells was observed. This observation has led Brown et al. (1994b) to suspect that host leachates may exist at trichome base. This study has found that spore germination rates were higher on wounded leaf areas compared to non-wounded leaf areas. At 3 days after inoculation (DAI), most conidia on wounded areas had germinated and started growing hyphae, while only 30% of spores had germinated on non-wounded areas. A common characteristic of both wounded and non-wounded areas was the association of germinated spores with leaf trichomes.

On wounded areas, hyphal growth occurred also on the epidermal surface between trichomes, while on non wounded areas spore germination and hyphal growth were exclusively associated with trichomes. This may indicate that the role of wounds is to provide the fungal spores with nutrients necessary for germination and initial mycelium growth, and where wounds are not present, germ tubes associate with trichomes for nutrients. In a few situations the inoculum was accidentally contaminated with bacteria, which were also found to associate with trichomes, emphasizing the possibility of host nutrients being released in these areas (Figure 3.11). In this study, the presence of fungal growth on epidermal surfaces that was not associated with trichomes at 3 DAI may suggest that by this time hyphae entered host tissues, as described by Cheng et al. (2011). As previously found (Cheng et al., 2011), no appressoria were observed with germinated spores. Necrosis always started off in wounded areas or from the cut petiole, extending to surrounding tissue, and sporulating structures were always associated with trichomes. Acervuli formed only on necrotic tissue, while on non-wounded leaf areas, sparse hyphal growth occurred only associated with trichomes. Cheng et al. (2011) mentioned fungal tissue associating with leaf trichomes only in relationship with the formation of sporulation structures, and this is consistent with the findings of Redlin (1991, 1992) on the association of conidiomata of D. destructiva with host trichomes. Fully developed acervuli of D. destructiva were found at 14 DAI, while on non-wounded areas, no signs or symptoms appeared.

3.4.4 Disease cycle of dogwood anthracnose This hypothetical disease cycle is based on evidence gathered in this thesis on the biology of the pathogen, and on observations on the disease in the field and in the lab. Sections with experimental support are indicated by the corresponding section number or published references. The disease cycle of D. destructiva on C. florida begins in the spring when the temperature starts to rise above 10 °C (considering the temperature requirements of D. destructiva, Figure 3.5) and wet conditions are predominant (required for most external fungal growth). Conidiomata (acervuli) formed during the previous growing season on unabscised leaves and dead twigs are still viable over winter (section 2.3.1), and can start oozing out spores in a mucilaginous matrix (Hibben and Daughtrey, 1988). Spores are spread to nearby new tissues mainly by rain (Daughtrey and Hibben, 1994). For longer distances, birds and insects and have been reported as carriers of viable spores of D. destructiva (Britton et al., 1993; Colby et al.,

100

1995; Hed et al., 1999). Early spring frost, insects or acidic rainfall may wound the host, thus enabling D. destructiva spores to germinate and begin infection, since wounds are a pre-requisite for infection on C. florida (section 3.1.2). However on non-wounded leaves, spores can germinate when close to leaf trichomes (3.3.3.1). Incipient fungal growth was frequently observed in association with trichomes which may provide nutrients for spore germination and possibly an entry point into the host (section 2.3.6). Under optimal conditions for disease development (such as detached leaves incubated at 25°C with 100% moisture), necrosis can be observed 5 days after inoculation, and acervuli would fully cover leaves by 2 weeks after inoculation (section 2.3.6). On leaves attached to plants but also incubated under optimal conditions for disease development (25°C, 100% moisture), necrotic spots appeared at 17 days after inoculation, and by 4 weeks from inoculation the oldest leaves were completely blighted and covered in acervuli. Subsequent leaves on the same shoot had isolated brown spots with purple margins, and sparse acervuli could be observed with some of the necrotic spots (section 2.3.6). Field evidence of the earliest symptomatic samples of C. florida in Ontario were from June and rarely from May (Table 3.3), suggesting that at least several weeks of incubation occur between infection and symptom expression. A similar observation was made in the assessment on C. florida populations in Ontario made by COSEWIC (2007), where it was stated that symptoms of dogwood anthracnose are not visible until mid-summer. On field samples from Ontario, acervuli on necrotic spots were seen usually on samples collected in June and July. It is possible that more than one disease cycle may occur in a growing season, if wet weather prevails (Hibben and Daughtrey, 1988), but the spores are thin-walled and unlikely to survive extended periods (Figure 1.10). The latest diseased sample of C. florida in this study was collected in October (Table 3.3) showing necrosis but no acervuli, but it is possible that symptoms on this sample had formed at earlier during the growing season. The dogwood anthracnose fungus was reported to grow through the xylem/phloem, progressing from leaves to twigs and branches (Hibben and Daughtrey, 1988), and twig dieback occurs mostly during the dormant season (Daughtrey et al., 1996). In this study it was found that D. destructiva can survive for prolonged periods of time at -20 °C and grow at 0 °C, supporting the possibility of the fungus surviving and possibly growing inside infected plants during the winter. The fungus survives through winter in infected woody tissues (section 2.3.1) and possibly

101 on marcescent infected leaves as it does on C. nuttallii (3.3.2.2).

3.4.5 Pathogenicity of Discula destructiva on other Cornus spp. and woody plants Natural infections have been observed only in C. florida, C. nuttallii, C. kousa and C. kousa ‘Chinensis’ (Daughtrey and Hibben, 1994; Holdenrieder and Sieber, 2007), but studies where inoculations were done naturally (Sherald et al., 1994; Brown et al., 1996) or artificially (Holdenrieder and Sieber, 2007) aimed to determine the susceptibility of other Cornus species and cultivars to dogwood anthracnose. Under natural inoculations, C. sericea and C. sericea ‘Flaviramea’ were found to be resistant by Sherald et al. (1994), but susceptible by Brown et al. (1996). The native European dogwoods C. sanguinea and C. mas were susceptible under artificial inoculations (Holdenrieder and Sieber, 2007). The present study used detached leaves of six species of Cornus (C. alba ‘Bud’s Yellow’, C. amomum, C. alternifolia, C. kousa, C. racemosa and C. sericea) and also leaves of Acer platanoides, Quercus rubra and Pyrus sp. to test susceptibility to dogwood anthracnose. Severity of necrosis was related to the type of inoculum. When exposed to high inoculum pressure, such as sporulating colonies on media, all leaves tested, from either Cornus or non-Cornus species, developed necrosis associated with acervuli of D. destructiva and the pathogen was re-isolated at high rates. However, different results were obtained with spore suspensions. Isolate 10192 from Ontario produced necrosis and acervuli on detached leaves of most Cornus species tested, excepting C. amomum, while spore suspensions from isolate 12180 from B.C. produced symptoms and signs only on C. florida and C. kousa ‘Chinensis’. Discula destructiva was re- isolated from all necrotic areas. Further studies using different isolates from Ontario and B.C. may be needed to assess the apparent preference of Ontario isolates of D. destructiva for C. alternifolia, C. florida, C. racemosa and C. sericea. There is a possibility that the lack of successful infection of the B.C. isolate on other Cornus spp. than the usual hosts may have been caused by the bacterial contamination of inoculum. This situation emphasizes once more the high degree of susceptibility of C. florida and C. kousa ‘Chinensis’. On leaves of Acer platanoides, Quercus rubra and Pyrus sp. no symptoms occurred upon inoculation with spore suspensions, but D. destructiva was re-isolated from asymptomatic wounded leaf areas, suggesting that the fungus may survive endophytically in wounded leaf tissues of other woody species. When artificial inoculations were made on leaves of potted dogwoods growing under

102 greenhouse conditions, symptoms formed only on C. florida. However the pathogen was re- isolated at high rates from asymptomatic wounded areas of all Cornus spp. tested, including C. amomum. It is unlikely that inoculum on leaf surfaces survived surface sterilization procedures, since leaf pieces were subjected to a harsh surface disinfestation method prior to culturing on PDA (section 3.2.4.2) and very similar re-isolation rates (> 70%) were obtained at subsequent processing by the same method – after 3 wk and after 10 wk from inoculation. Since D. destructiva was repeatedly re-isolated from asymptomatic wounded leaf tissues of inoculated plants growing either under field of greenhouse conditions, the possibility of this fungus surviving endophytically in leaves of other Cornus spp., without producing symptoms, should be considered. In addition, the finding that D. destructiva can produce successful infection and sporulation on detached leaves of other Cornus spp., could help speculate on the possibility of asymptomatic leaves becoming source of inoculum upon falling off. This observation suggests that the disease may spread through asymptomatic nursery stock.

3.4.6 Genetic variation and mating types in Discula destructiva The genetics of D. destructiva populations have been assessed in several studies, but none used microsatellite areas of DNA. In this study, SSR analysis results were consistent with previous findings regarding the homogeneity of D. destructiva populations and that possible polymorphisms can be detected between isolates obtained from Ontario versus isolates from B.C. (Trigiano et al., 1995; Caetano-Anolles et al., 1996; Yao et al., 1997; Rong et al., 2001; Zhang and Blackwell, 2001). The low genetic polymorphism in D. destructiva has been explained by the recent introduction in North America of the fungus, and the lack of sexual reproduction (Redlin, 1991; Trigiano et al., 1995; Rossman et al., 2007). A screening for the presence of mating type genes within D. destructiva populations revealed that all of the 122 isolates from both Ontario and B.C. had the MAT1-2 idiomorph, reinforcing previous conclusions that D. destructiva reproduces exclusively asexually in North America.

103

3.4.7 Overall conclusions on biological characteristics, pathogenicity and genetic variation in Discula destructiva Based on the differences found between symptom severity in samples of C. nuttallii and C. florida, and based on disease incidence among sites tested for dogwood anthracnose in B.C. and in Ontario, disease is more severe in C. nuttallii than in C. florida. This may be a result of the two hosts responding differently to disease, and a greater tolerance of C. nuttallii for anthracnose. Tree mortality has been rarely associated with diseased C. nuttallii, despite the severe dieback of branches and stem, thus the fungus might produce more abundant symptoms, while C. florida trees die within a few years after infection with D. destructiva. Furthermore, in this study D. destructiva has been found to grow even at 0 °C, suggesting that the pathogen is able to grow in infected woody tissues during plant dormancy periods, and the wet, mild weather on the west coast may be also responsible for the higher severity of symptoms and the wider disease incidence among C. nuttallii than C. florida. It is unlikely that the above mentioned differences are determined by differences in the biology and pathogenicity of fungal isolates on the west coast compared to isolates in the east, since this study has confirmed again the homogeneity of D. destructiva populations, with results from growth and pathogenicity tests, as well as genetic variation assessments by SSR. Although on C. florida the pathogenicity results were similar with both the isolate from B.C. and the isolate from Ontario, when other Cornus spp. were tested for susceptibility to dogwood anthracnose, the Ontario isolate was apparently more virulent than the B.C. isolate and deserves further study. Pathogenicity tests conducted with different species of Cornus, either as detached leaves or whole plants, as well as tests with detached leaves of Acer platanoides, Quercus rubra and Pyrus sp. revealed that D. destructiva is able to live endophytically in all wounded leaves tested, but fungal sporulation occurred only on detached leaves. This is important to consider when dealing with the management of dogwood anthracnose spread, since asymptomatic wounded leaves of many dogwood species, as well as of maple, oak and pear may harbour the fungus and then become inoculum sources upon falling off, when the pathogen is able resume growth and sporulation. To understand the differences between the two hosts, further studies with C. nuttallii and other D. destructiva isolates from wider geographical regions are needed.

104

Table 3.1 SSR primers tested in this study, which were developed based on the predicted genes of the assembled genome of Discula destructiva. Assembly and gene prediction were done by T. Hsiang. Primer name Primer pair sequences (F=forward primer; R=reverse primer) SSR1 F- GAAACTGGCAGACAGAGGGA; R- CGCCGGGTATCTTGTGTTAC SSR2 F- AGCGGCATTGCAAGATAGAC; R- ATAGGCTGCATGTTTCGAGC SSR3 F- GCAGTCTCTGAGGAGGACGA; R- CTAGTGAGTCGTTGGACGGG SSR4 F- CATTCGCTGCGAGAAAGAA; R- GCTCGGAAACAAACAAGGAA SSR5 F- CCAAGGAACTCTCACCATCG; R- TAGTGAGGGTGTCGGAAGGA SSR6 F- CCGCATCTGCATATCAATCA; R- CACACTCACTCGACTGTGCC SSR7 F- CCGCATCTGCATATCAATCA; R- TCAGTCAAGCACGGTCAGAA SSR8 F- ATATCGAACCGGGTGAGGAT; R- AGAGCAACTCCATCGAGCAC SSR9 F-CGGTACACAACCACACGCTA; R-CGCAAATATGCAAGGGTCTC SSR10 F- ATGGAGGTTAGCCACACGAA; R- CCTGTACGATGACCTGCACA

105

Table 3.2 Cornus species naturally occurring in Canadian flora, affected by dogwood anthracnose in natural settings or used in artificial inoculations in this study. Native to Used in artificial inoculations Species Canada Natural infections in this study C. alba ‘Buds Yellow’ x C. alba ‘Ivory Halo’ x C. alternifolia x (USDA, 2013) x C. amomum x C. canadensis x (USDA, 2013) C. drummondii x (USDA, 2013) C. florida x (USDA, 2013) x (Daughtrey and Hibben, x 1994) C. kousa x (Daughtrey and Hibben, 1994; Holdenrieder and Sieber, 2007) C. kousa ‘Chinensis’ x (Daughtrey and Hibben, x 1994) C. nuttallii x (USDA, 2013) x (Daughtrey and Hibben, 1994) C. obliqua x (USDA, 2013) C. racemosa x (USDA, 2013) x C. rugosa x (USDA, 2013) x C. sericea x (USDA, 2013) x C. suecica x (USDA, 2013) C. x intermedia x (USDA, 2013) (canadensis x suecica) C. x acadiensis x (USDA, 2013) (alternifolia x sericea) C. x slavinii (rugosa x (USDA, 2013) x sericea) C. unalaschkensis x (USDA, 2013)

106

Table 3.3 Locations with Cornus florida in southwestern Ontario, which were sampled for dogwood anthracnose between 2010-2012, with dates of collection and processing results (x = positive, • = negative). Collection dates 2010 2011 2012 Collection locations May June July Aug May June July Aug Sep Oct Apr May June July Aug Sep Oct Essex County: x 1832 Road 5, Wheatly Middlesex County: Skunk’s Misery x • x Sylvan x Wardsville (2 sites) • Norfolk County: HWY 24 x x x Charlotteville Road 1 x • • Charlotteville Road 5 • Charlotteville Road 10 • • Charlotteville West • • • Concession Road 4 • Concession Road 5 x x x Concession Road 6 x • • • • Concession Road 8 x x x • x • • Concession Road 10 • HWY 24 and East 1/4 Lane • • • x x x x x Evergreen Cemetery • • • Forestry Farm Road 6 • Hazen Road • • • Long Point • • • • Norfolk Street • • • • • • Oakwood Cemetery x x • Pinegrove Road Delhi • • • Port Rowan x St. John’s Street x • • • • West Quarter Lane • • Woodlot x • • Oxford County: The Leslie Dixon • Arboretum Wellington County: The Guelph Arboretum • • • • Niagara Region: Niagara Falls Fireman’s • • • • x x Park

107

Table 3.4 Locations in southwestern British Columbia, sampled for dogwood anthracnose in 2011 and 2012, with dates of collection and processing results (x = positive, • = negative). Collection dates 2011 2012 Collection locations July April May June July August September October Vancouver City: University of B.C. x Capilano Golf Course x x x x x Victoria: Jedburgh Road x Bourchier Street (4 x x x x x x sites) Sooke Road (3 sites) x x x x x Ross Bay Cemetery Hornby Island: x x x x x x 49°33’N124°39’W x

108

Table 3.5 Survival rates of Discula destructiva in four symptomatic samples of Cornus florida from Ontario (A-D) and four symptomatic samples of Cornus nuttallii from British Columbia (A-D) upon receipt and after a storage period. % viability Storage period % viability Sample Received upon receipt (months) after storage Ontario-A 2011/07 60 12 0 Ontario-B 2011/07 14 7 0 Ontario-C 2011/08 23 10 12 Ontario-D 2011/08 25 9 0 Ontario average 35 9.5 4 British Columbia-A 2011/07 100 7 24 British Columbia-B 2011/07 100 7 29 British Columbia-C 2011/07 100 7 57 British Columbia-D 2011/07 100 7 38 British Columbia average 100 7 37

109

Table 3.6 Mean necrosis* (%) on detached leaves of seven Cornus spp. (C. alba ‘BY’ = C. alba ‘Bud’s Yellow’ and C. kousa ‘C’ = C. kousa ‘Chinensis’) inoculated either by incubation on sporulating colonies of Discula destructiva on media – repeated three times, or by spraying with a spore suspension (106 spores /mL) from isolate 10192 from Ontario (ON) or isolate 12180 from British Columbia (B.C.). Mean necrosis1 (%) at 14 d post inoculation with different inocula DD colonies on solid Spore suspension from Spore suspension from Species medium isolate #10192 (ON) isolate #12180 (B.C.) C. alba ‘BY’ 8 b 5 c 0 b C. alternifolia N/A 13 bc 0 b C. amomum 14 b 0 c 0 b C. florida 45 a 28 a 25 a C. kousa ‘C’ 40 a 22 ab 39 a C. racemosa 10 b 10 bc 0 b C. sericea 7 b 6 c 0 b LSD (p=0.05) 19 13 20 Overall Means2 21 a 12 ab 10 b *Necrosis was considered as produced by D. destructiva only if associated with acervuli of D. destructiva. 1 Species means in each column followed by a letter in common are not significantly different at p=0.05, and the least significant difference (LSD) value is presented below them 2 For the row labelled "Overall Means", the comparison is within the row, and where these overall means are followed by a letter in common, they are not significantly different at p=0.05 N/A = data not available

110

Table 3.7 Mean re-isolation* (%) of Discula destructiva from detached leaves of seven Cornus spp. (C. alba ‘BY’ = C. alba ‘Bud’s Yellow’ and C. kousa ‘C’ = C. kousa ‘Chinensis’) inoculated either by incubation on sporulating colonies on media – repeated three times, or by spraying with a spore suspension (106 spores /mL) from isolate 10192 from Ontario (ON) or isolate 12180 from British Columbia (B.C.). Mean re-isolation1 (%) at 14 d post inoculation with different inocula DD colonies on solid Spore suspension from Spore suspension from Species medium isolate #10192 (ON) isolate #12180 (B.C.) C. alba ‘BY’ 40 b 32 bc 0 b C. alternifolia N/A 79 ab 0 b C. amomum 33 b 0 c 0 b C. florida 93 a 91 a 27 b C. kousa ‘C’ 66 ab 81 ab 98 a C. racemosa 39 b 46 abc 0 b C. sericea 64 b 52 abc 0 b LSD (p=0.05) 50 56 43 Overall Means2 56 a 54 a 19 b *Re-isolation was done from symptomatic tissue or, where no symptoms developed, from wounded areas, using ethanol 70% (30 s) and sodium hypochlorite 1% (10 m) 1 Species means in each column followed by a letter in common are not significantly different at p=0.05, and the least significant difference (LSD) value is presented below them 2 For the row labelled "Overall Means", the comparison is within the row, and where these overall means are followed by a letter in common, they are not significantly different at p=0.05 N/A = data not available

111

Table 3.8 Mean necrosis* (%) on detached leaves of Acer platanoides, Quercus rubra and Pyrus sp. inoculated either by incubation on sporulating colonies of Discula destructiva on media, or by spraying with a spore suspension (106 spores /mL). Mean necrosis1 (%) at 14 d post inoculation with different inocula Species DD colonies on solid medium Spore suspension Acer platanoides 15 a 0 a Quercus rubra 29 a 0 a Pyrus sp. 19 a 0 a LSD (p=0.05) 14 0 Overall means2 21 a 0 b *Necrosis was considered as produced by D. destructiva only if associated with acervuli of D. destructiva. 1 Species means in each column followed by a letter in common are not significantly different at p=0.05, and the least significant difference (LSD) value is presented below them 2 For the row labelled "Overall Means", the comparison is within the row, and where these overall means are followed by a letter in common, they are not significantly different at p=0.05

112

Table 3.9 Mean re-isolation* (%) of Discula destructiva from detached leaves of Acer platanoides, Quercus rubra and Pyrus sp. inoculated either by incubation on sporulating colonies of Discula destructiva on media, or by spraying with a spore suspension (106 spores /mL). Mean re-isolation1 (%) at 14 d post inoculation with different inocula Species DD colonies on solid medium Spore suspension Acer platanoides 79 a 12 b Quercus rubra 82 a 17 b Pyrus sp. 95 a 77 a LSD (p=0.05) 52 45 Overall means2 85 a 35 b *Re-isolation was done from symptomatic tissue or, where no symptoms developed, from wounded areas, using ethanol 70% (30 s) and sodium hypochlorite 1% (10 m) 1 Species means in each column followed by a letter in common are not significantly different at p=0.05, and the least significant difference (LSD) value is presented below them 2 For the row labelled "Overall Means", the comparison is within the row, and where these overall means are followed by a letter in common, they are not significantly different at p=0.05

113

INTER-SSR PCR

NNNN(CA)n (CA)nNN CA repeat

NNNNNNNNCACACACACACACACANNNNNNNNNNNNNNTGTGTGTGTGTGTGTGTGTGTGTNNNNNN genomic NNNNNNACACACACACACACACACACACANNNNNNNNNNNNNNTGTGTGTGTGTGTGTGNNNNNNNN DNA CA repeat (CA)nNN NNNN(CA)n

PCR product 3’-anchored primer

PCR product 5’-anchored primer

114

115

Southern Ontario

Lake Wellington Huron Lake Ontario

Michigan State Oxford Middlesex Niagara Norfolk Region New York State

Essex Lake Erie

100 km

Positive sites for isolation of dogwood anthracnose fungus Negative sites for isolation of dogwood anthracnose fungus

Figure 3.3 Sites in southwestern Ontario sampled for dogwood anthracnose from 2010 to 2012.

116

Figure 3.4 Sites in southwestern British Columbia sampled for dogwood anthracnose in 2011 and 2012. All sites were found positive for dogwood anthracnose.

117

118

Figure 3.6 Conidial germination of Discula destructiva at (a) 24 h and (b) 48 h on water agar. Size bars represent 10 µm.

119

120

Figure 3.8 Spore germination on (a) non-wounded and (b) wounded leaf surface of Cornus florida at 3 days after inoculation with a spore suspension of Discula destructiva. Size bar represents 50 µm.

121

122

123

Figure 3.11 Bacteria colonizing a leaf trichome of Cornus florida. Size bar represents 5 µm.

124

125

Figure 3.12 (continued) Difference between spore germination and mycelial growth of Discula destructiva on non-wounded (left column) and wounded (right column) areas of inoculated leaves of Cornus spp.: (D) C. kousa ‘Chinensis’, (E) C. racemosa, (F) C. sericea. Size bars reprezent 50 µm.

126

127

Chapter Four: General Discussion and Conclusions Dogwoods are plants with a wide variety of growth habits, from herbaceous perennials to shrubs and small trees, and a few species are evergreen. There are over 50 species of dogwoods comprised under the genus Cornus (Xiang et al., 2006), and fourteen of these species are native to Canada (USDA, 2013). Dogwoods are an important part of the forest ecosystem and are also widely used as ornamental plants. The most common diseases of dogwoods cause foliar symptoms and are produced by fungal pathogens such as: Colletotrichum gloeosporioides and C. acutatum (causing limb dieback), Elsinoe corni (causing spot anthracnose), Microsphaera penicillata and Phyllactinia guttata (causing powdery mildew) and Septoria cornicola (causing Septoria leaf spot). These diseases lower the economical value of ornamental dogwoods, and rarely can kill the plants. A disease of Pacific and flowering dogwood (C. nuttallii and C. florida) was reported in western and eastern U.S. at the end of 1970’s and it was found to be caused by a species of Discula and named dogwood anthracnose (Hibben and Daughtrey, 1988). A complete identification and description of the causal agent of dogwood anthracnose was provided by Redlin (1991), who named the pathogen Discula destructiva. Dogwood anthracnose caused extensive damage to C. florida populations in U.S. (Anagnostakis and Ward, 1996; Sherald et al., 1996) and Ontario (COSEWIC, 2007), but the disease was rarely associated with tree mortality in C. nuttallii (Redlin, 1991). Since foliar symptoms of dogwood anthracnose have been easily mistaken with symptoms of limb dieback caused by Colletotrichum sp. (Redlin, 1991; Anderson et al., 1994) or of Septoria leaf spot caused by S. cornicola (Anderson et al., 1994), this study aimed to associate fungal species with foliar symptoms of dogwood and produce a “Dogwood Disease Symptom Guide” for practical use. To accurately identify the causal agents, morphological and molecular biological techniques were use to associate 13 different morphotypes of fungi with symptomatic samples of dogwood. Among these, D. destructiva was found to be the most commonly isolated, and Koch’s postulates were successfully fulfilled, confirming that D. destructiva is the causal agent of dogwood anthracnose on C. florida in Ontario. Among the morphotypes isolated in this study from symptomatic dogwood leaves, some of the fungal species have previously been associated with dogwood symptoms by Farr et al., (1989) including: Alternaria alternata, Botryosphaeria dothidea, Colletotrichum sp., Elsinoe

128 corni, Phomopsis sp., Septoria cornicola. The following were not listed by Farr et al. (1989): Discula quercina, Dothiorella gregaria, Epicoccum nigrum, Melanconium oblongum, Pestalotiopsis vismiae, Pilidium concavum, and Pleuroceras tenellum. But these fungal species could not be related to particular foliar symptoms, except for D. quercina, M. oblongum and P. tenellum which were isolated from leaves of C. florida (D. quercina and P. tenellum ) or C. nuttallii (M. oblongum) with symptoms similar to those produced by dogwood anthracnose. A particular foliar symptom that presented as a purple ring was very common in this area on leaves of C. alternifolia, C. amomum and C. florida. This particular symptom appeared in midsummer and initially looked as a purple circle, more visible on the upper leaf surface, delimitating green tissue within the circle boundaries. As the spot grew older, the tissue within the ring became necrotic and often fell out. This brown circular spot symptom has been associated with dogwood anthracnose. Numerous attempts to isolate the causal agent of the purple ring symptom lead to obtaining various fungal species, but inconsistently. After a more thorough examination, it has been found that each of the newly formed purple rings had a small swelling in the green area within the ring, which was visible only on the lower leaf surface. The swelling was found to be caused by an insect larva, identified as Parallelodiplosis subtruncata by Dr. Stephen A. Marshall, taxonomic entomologist at the University of Guelph. The “Dogwood Disease Symptom Guide” may be useful to nursery growers and forestry professionals to better distinguish between foliar symptoms caused by D. destructiva and similar leaf spots produced by other fungal pathogens or insects. It is one of the practical achievements of this work. Another purpose of this study was to provide a rapid and reliable molecular method for identifying D. destructiva directly from crude extracts of symptomatic leaves. Such a molecular tool would help reduce the amount of time needed to obtain a result from processing a sample, from 10 days to 8 hours. For this aim, specific primers were designed based on the most conserved regions of the ITS sequence of D. destructiva. This method was found to be highly sensitive, since the presence of only 0.01 ng/µL of D. destructiva DNA from pure culture extracts produced on agarose gel a visible band of the expected size. Along with the “Dogwood Disease Symptom Guide”, the specific primers are useful tools for the study of dogwood anthracnose.

129

In Canada, dogwood anthracnose was first reported in 1983 in British Columbia on C. nuttallii (Salogga and Ammirati, 1983), and in 1996, various locations with naturally growing Pacific dogwood were found positive (Daughtrey et al., 1996). This study tested 10 sites with planted C. nuttallii located in urban settings near Vancouver and Victoria, British Columbia, and two forested sites near Victoria and on Hornby Island, British Columbia. Samples were collected over two growing seasons, from 2011 to 2012 and all sites were found positive for isolation of dogwood anthracnose fungus. In Ontario, the disease was first reported in 1998 on a sample of C. florida from a forest in Norfolk County, although symptoms might have been present earlier (Davis, 2001). Davis (2001) reported 46% mortality due to dogwood anthracnose on a plot of 70 trees over a period of five years, from 1995 to 2000. Later on, an assessment made in 2007 by The Committee on the Status of Endangered Wildlife in Canada enlisted C. florida as “endangered species” due to dogwood anthracnose (COSEWIC, 2007). In this study, 30 sites with naturally growing or planted C. florida, located across southwestern Ontario, were tested from 2010 to 2012. Most sites were located in forested areas, such as in Niagara Region and Essex, Middlesex, and Norfolk Counties, but collections were made also from cultivated specimens outside the natural range of C. florida, such as in Oxford and Wellington Counties. Fourteen sites out of 30 were found positive for isolation of dogwood anthracnose fungus and all were located in regions with native populations of C. florida, showing that disease is found in Ontario in areas with high density of host populations. Symptomatic samples of C. nuttallii differed from C. florida samples regarding symptom severity, isolation results and viability of D. destructiva in stored samples. On leaves of C. nuttallii symptoms usually consisted in blotches, whereas on C. florida leaves, isolated spots were more common. It has been shown that symptom appearance in dogwood anthracnose depends on the weather, since blotches form in wet conditions, while spots form in dry conditions (Parham and Windham, 1992). It could suggest that the differences in symptoms may be caused by the different weather patterns in the two regions, since humid and warm weather is prevalent on the west coast, while in southwestern Ontario the weather is drier and colder. The mild weather of southwestern B.C. may also allow the pathogen to grow during the winter, when the plant is dormant, since D. destructiva can grow at 0 °C, thus explaining the high symptom severity on C. nuttallii samples, but there is likely also a host effect. Previous studies have shown that the two hosts respond differently to dogwood anthracnose, since stem cankers and tree

130 mortality are associated with C. florida rather than C. nuttallii (Salogga, 1982). Canker formation in dogwood anthracnose has been related to the fungus associating with vascular tissues (Walkinshaw and Anderson, 1991), and this may suggest that in C. florida the fungus is able to grow inside the plant and produce extensive damage. C. nuttallii appears to have a greater tolerance for D. destructiva which causes mainly foliar symptoms, but for specimens with 2-3 years old infections, severe dieback can occur (Salogga and Ammirati, 1983). Upon processing, samples of C. nuttallii produced D. destructiva more readily, with isolation rates double the rates obtained from C. florida, and with very little contamination with other fungal species. In addition, after prolonged storage at 4 °C, all C. nuttallii samples still had viable fungus, while only one out of four C. florida samples had viable D. destructiva. To see whether these differences were generated by biological differences in D. destructiva isolates obtained from different geographical regions, this study used isolates from both Canadian provinces to test temperature growth requirements, pathogenicity on C. florida and genetic polymorphism. Since all tests revealed a high level of uniformity between isolates from B.C. and isolates from Ontario, the differences in symptom severity, isolation results and pathogen viability between the two types of samples could be more likely related to host differences. To our knowledge there are no documented records of differences in disease severity on the two hosts. To understand the differences between the two hosts, further studies with C. nuttallii and other D. destructiva isolates from wider geographical regions are needed. Although on C. florida the pathogenicity results were similar with both the isolate from B.C. and the isolate from Ontario, when other Cornus spp. were tested for susceptibility to dogwood anthracnose, the Ontario isolate was apparently more virulent than the B.C. isolate and this aspect deserves further study. Pathogenicity tests conducted with different species of Cornus, either as detached leaves or whole plants, as well as tests with detached leaves of Acer platanoides, Quercus rubra and Pyrus sp. revealed that D. destructiva is able to live endophytically in all wounded leaves tested. On leaves of maple, oak and pear, the fungus produced acervuli only when the inoculum pressure was very high (sporulating colonies on media), yet fungal sporulation occurred on all detached dogwood leaves inoculated with spore suspensions. This is important to consider when dealing with the management of dogwood anthracnose spread, since asymptomatic wounded leaves of many dogwood species may harbour the fungus and then become inoculum sources upon falling off, when the pathogen is able

131 resume growth and sporulation. Although artificial inoculations revealed that D. destructiva can survive endophytically in living leaves of other Cornus spp. without producing symptoms, samples of other dogwood species collected from Ontario and processed in this study were found to be negative for D. destructiva. One reason might be that collection sites were not located near infected C. florida trees. It would be interesting to see whether other dogwoods and woody plants growing near severely infected C. florida trees might harbor the dogwood anthracnose fungus asymptomatically. After D. destructiva was found on diseased C. florida and C. kousa imported from North America and cultivated in Europe, Holdenrieder and Sieber (2007) tested other species of dogwood in the vicinity of those locations, but found them negative for D. destructiva. The reported host range of dogwood anthracnose in natural settings includes three dogwood species and one cultivar: C. florida, C. kousa, C. kousa ‘Chinensis’ and C. nuttallii (Daughtrey and Hibben, 1994). In this study the disease was found on symptomatic samples collected from C. florida and C. nuttallii, while three C. kousa samples from Japan were negative for D. destructiva. Interestingly these three host species are closely related to each other and all belong to the big-bracted group of dogwoods (Xiang et al., 2006, Figure 1.1). To our knowledge no studies have linked host genetic relatedness with susceptibility to dogwood anthracnose. Further research on susceptibility with host species closely related to the known hosts such as C. multinervosa, C. capitata, and C. disciflora, could be useful for verifying this hypothesis and finding the inherent features which provide susceptibility or resistance to dogwood anthracnose. Previous studies have found that despite the reported high severity of dogwood anthracnose on C. florida populations in U.S., certain pre-requisites had to be fulfilled for artificial inoculations of D. destructiva to produce successful infections on C. florida (Walkinshaw and Anderson, 1991; Brown et al. 1994b). These pre-conditions were represented by wounding of plant tissue before inoculation, and providing high humidity after inoculation. When non-wounded, detached leaves were inoculated in this study, no symptoms developed, while for high concentrations of inoculum, necrosis began from the cut petiole. But it has been shown (Graham, et al., 1991, Cheng et al., 2011) that germinated conidia and hyphae did not use wounds to enter host tissues, suggesting that it was unlikely for the petiole of detached leaves to have provided a port of entry for the pathogen. From this study it appears that wounds may provide germinated spores with nutrients necessary for initial mycelial growth and penetration.

132

A similar suggestion was made by Brown et al. (1994b), who noticed that germinated conidia associated with host trichomes on non-wounded leaves, inferring the presence of host leachates at trichome base, although no penetration was observed. Inoculum type and concentration were found to be other critical factors for successful infections in this study. Thus, inoculum represented by mycelial pugs was found to be ineffective, as well as spore suspensions with concentrations less than 106 spores/mL. When potted plants of C. florida, with leaves just beginning to grow, were inoculated with a spore suspension of D. destructiva, the first leves to mature became blighted and then fell off, while subsequent leaves growing on the same plant presented only necrotic spots. This observation is consistent with the findings of Hibben and Daughtrey (1988). The exotic origin of D. destructiva and its recent introduction in North America have been speculated upon in numerous studies based on the homogeneity of D. destructiva populations and the lack of sexual reproduction (Redlin, 1991; Trigiano et al., 1995; Rossman et al., 2007). Possible polymorphisms have been detected between isolates obtained from the east coast versus isolates from the west (Trigiano et al., 1995; Caetano-Anolles et al., 1996; Yao et al., 1997; Rong et al., 2001; Zhang and Blackwell, 2001). In this study, the results with SSR analysis confirmed once more the findings of previous research regarding the population genetics of D. destructiva with respect to low diversity. Furthermore, a screening for the presence of mating type genes within D. destructiva populations revealed that all of the 122 isolates from both Ontario and B.C. had the MAT1-2 idiomorph, reinforcing and elucidating previous conclusions that D. destructiva reproduces exclusively asexually in North America. This study confirmed D. destructiva as the causal agent of dogwood anthracnose in Ontario and B.C., and characterized the pathogen through a series of tests, such as growth tests, pathogenicity assays, and genetic assessments, including a screening for the presence of mating type genes in D. destructiva populations. The fungal populations presented a high level of genotypic and phenotypic homogeneity. This study reconfirmed the hypothesis of a recent introduction in North America of a small number of D. destructiva isolates by finding only one of the two mating types within the collection of 122 fungal isolates from both Canadian provinces. This study found that dogwood anthracnose affected only C. florida and C. nuttallii in the field, and differences in disease severity on the two hosts have been documented. Other Cornus

133 spp. and other woody plant species might help spread the disease, since the fungus was found to survive endophytically in artificially inoculated, wounded leaves, and sporulation occurred on detached leaves of species including maple, oak and pear. Results from this study connected dogwood anthracnose susceptibility to host relatedness and speculatively, all of the genus Benthamidia (big-bracted dogwoods) may be susceptible. Two practical achievements of this study were as follows: a “Dogwood Disease Symptom Guide” for distinguishing dogwood anthracnose from other foliar diseases, and the specific primers for detecting D. destructiva directly from DNA extracts of symptomatic tissues. Further studies should test the pathogenicity of D. destructiva on C. nuttallii and on species closely related to C. nuttallii and C. florida, such as C. multinervosa, C. capitata, and C. disciflora, to give an insight on the features that might provide susceptibility or resistance to dogwood anthracnose. To understand the differences between the two hosts, further studies with C. nuttallii and other D. destructiva isolates from wider geographical regions are needed. To find whether other Cornus spp. and woody plants can help spread dogwood anthracnose by harboring the fungus asymptomatically, testing of such species in the proximity of severely infected C. florida and C. nuttallii in natural or nursery settings would be useful.

134

References

Adams, J. E. (1949). Studies of the comparative anatomy of Cornaceae. Journal of the Elisha Mitchell Scientific Society, 65: 218-244.

Agrios, G. N. (2005). Plant Pathology. 5th eds. (pp. 77-106). Elsevier Academic Press, San Diego, U.S.A.

Alfieri, S. A. (1970). Spot anthracnose on flowering dogwood. Florida Department of Agriculture and Consumer Services. Plant Pathology Circular, 98: 2 pp.

Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research, 25: 3389-3402.

Ament, M. H., Auge, R. M., Grand, L. F., and Windhams, M. T. (1998). An inoculation technique for dogwood anthracnose. Phytopathology, 68: 782-790.

Anagnostakis, S. L., and Ward, J. S. (1996). The status of flowering dogwood in five long-term forest plots in Connecticut. Plant Disease, 80: 1403-1405.

Anderson, R. L., Berrang, P., Knighten, J., Lawton, K. A., and Britton, K. O. (1993). Pretreating dogwood seedlings with simulated acidic precipitation increases dogwood anthracnose symptoms in greenhouse-laboratory trials. Canadian Journal of Forest Research, 23: 55-58.

Anderson R. L., Knighten, J. L., Windham, M., Langdon, K., Hendrix, F., and Roncadori, R. (1994). Dogwood anthracnose and its spread in the south. U.S. Department of Agriculture, Forest Service, Southern Region.

Barnett, H.L. and Hunter, B.B. (1972). Illustrated genera of imperfect fungi. 225 pp. Minneapolis: Burgess Publishing Company.

Bartlett, T. (2011). BugGuide.Net. http://bugguide.net/node/view/560722

Bart-Delabesse, E., Sarfati, J., Debeaupuis, J. P., van Leeuwen, W., van Belkum, A., Bretagne, S., and Latge, J. P. (2001). Comparison of restriction fragment length polymorphism, microsatellite length polymorphism, and random amplification of polymorphic DNA analyses for fingerprinting Aspergillus fumigatus isolates. Journal of Clinical Microbiology, 39: 2683- 2686.

Bickerton, H. and Thompson-Black, M. (2010). Recovery strategy for the eastern flowering dogwood (Cornus florida) in Ontario. Ontario Recovery Strategy Series (vi + 21 pp.). Prepared for the Ontario Ministry of Natural Resources, Peterborough, Ontario.

Blair, R.M. (1982). Growth and nonstructural carbohydrate content of southern browse species as influenced by light intensity. Journal of Range Management, 35: 756–760.

135

Bornet, B., and Branchard, M. (2001). Nonanchored inter simple sequence repeat (ISSR) markers: reproducible and specific tools for genome fingerprinting. Plant Molecular Biology Reporter, 19: 209-215.

Braun, U., and Takamatsu, S. (2013). Phylogeny of Erysiphe, Microsphaera, Uncinula (Erysipheae) and Cystotheca, Podosphaera, Sphaerotheca (Cystotheceae) inferred from rDNA ITS sequences – some taxonomic consequences. Schlechtendalia, 4: 1-33.

Britton, K. O. (1989). Temperature, pH, and free water effects on in vitro germination of conidia of a Discula sp. isolated from dogwood anthracnose. Phytopathology, 79: 1203.

Britton, K. O. (1993). Anthracnose infection of dogwood seedlings exposed to natural inoculum in western North Carolina. Plant Disease, 77: 34-37.

Britton, K. O., Roncadori, R. W., and Hendrix, F. F. (1993). Isolation of Discula destructiva and other fungi from seeds of dogwood trees. Plant Disease, 77: 1026-1028.

Brown, D.A, Trigiano, R. N., and Windham, M. T. (1990). Biology of the dogwood anthracnose fungus, Discula sp. In: Proceedings 23rd Annual Term. Nursery Short Course, Feb 14-16. (pp. 254-260). Nashville, Tennessee.

Brown, D. A., Windham, M., T., and Trigiano, R. N. (1992). Anthracnose resistance among Cornus species. Phytopathology, 82: 1116 (Abstr.).

Brown, D. A., Windham, M. T., and Trigiano, R. N. (1996). Resistance to dogwood anthracnose among Cornus species. Journal of Arboriculture, 22: 83-86.

Brown, D. A., Windham, M. T., Anderson, R. L., and Trigiano, R. N. (1994a). Influence of simulated acid rain on the flowering dogwood (Cornus florida) leaf surface. Canadian Journal of Forest Research, 24: 1058-1062.

Brown, D. A., Windham, M. T., and Graham, E. T. (1994b). The association of Discula destructiva (Red.) hyphae with Cornus florida (L.) trichomes. Journal of Phytopathology, 140: 312-318.

Busch, L.V, and Walker, J.C. (1958). Studies of cucumber anthracnose. Phytopathology, 48: 302-304.

Bushnell, W. R., and Allen, P. J. (1962). Induction of disease symptoms in barley by powdery mildew. Plant Physiology, 37: 50.

Byther, R. S., and Davidson Jr., R. M. (1979). Dogwood anthracnose. Ornamentals Northwest Archives, 3: 20-21.

136

Caetano‐Anollés, G., Trigiano, R. N., and Windham, M. T. (1996). Sequence signatures from DNA amplification fingerprints reveal fine population structure of the dogwood pathogen Discula destructiva. FEMS Microbiology Letters, 145: 377-383.

Caetano-Anollés, G., Trigiano, R. N., and Windham, M. T. (2001). Patterns of evolution in Discula fungi and the origin of dogwood anthracnose in North America, studied using arbitrarily amplified and ribosomal DNA. Current Genetics, 39: 346-354.

Calder, J. A., and Taylor, R. L. (1965). New taxa and nomenclatural changes with respect to the flora of the Queen Charlotte Islands, British Columbia. Canadian Journal of Botany, 43: 1387- 1400.

Cappiello, P., and Shadow, D. (2005). Dogwoods: the genus Cornus (224 pp.). Timber Press, Portland, Oregon, U.S.A

Carlile, M. J. (1986). Genetic exchange and gene flow: their promotion and prevention. pp 203- 214 in: Evolutionary biology of the fungi. Edited by Rayner, A. D. M., Braisier C. M., and Moore D. New York, Cambridge University Press.

Carr, D. E., and Banas, L. E. (2000). Dogwood anthracnose (Discula destructiva): effects of and consequences for host (Cornus florida) demography. The American Midland Naturalist, 143: 169-177.

Chellemi, D. O., and Britton, K. O. (1992). Influence of canopy microclimate on incidence and severity of dogwood anthracnose. Canadian Journal of Botany, 70: 1093-1096.

Chellemi, D. O., Knox, G., and Palm, M. E. (1993). Limb dieback of flowering dogwood caused by Colletotrichum acutatum. Plant Disease, 77: 100 (Abstr.).

Chellemi, D. O., Britton, K. O., and Swank, W. T. (1992) Influence of site factors on dogwood anthracnose in the Nantahala mountain range of western North Carolina. Plant Disease, 76: 915- 918.

Cheng, Q., Windham, A. S., Klingeman, W. E., Sakhanokho, H. F., Saxton, A. M., Li, Y., and Windham, M. T. (2011). Histological investigation of infection processes of Discula destructiva on leaves of Cornus florida. Canadian Journal of Plant Pathology, 33: 525-531.

Colby, D. M., Windham, M. T., and Grant, J. F. (1995). Hippodamia convergens (Coleoptera: Coccinellidae) dissemination of dogwood anthracnose fungus (Melanconiales: Melanconeacae). Environmental Entomology, 24: 1075-1079.

Committee on the Status of Endangered Wildlife in Canada, COSEWIC (2007). COSEWIC assessment and status report on the eastern flowering dogwood Cornus florida in Canada. http://www.registrelep-sararegistry.gc.ca/sar/assessment/status_e.cfm

137

Committee on the Status of Endangered Wildlife in Canada, COSEWIC (2011). Canadian Wildlife Species at Risk. http://www.cosewic.gc.ca/eng/sct0/rpt/csar_e_2013.pdf

Coppin, E., Debuchy, R., Arnaise, S., and Picard, M. (1997). Mating types and sexual development in filamentous ascomycetes. Microbiology and Molecular Biology Reviews, 61: 411-428.

Correll, J. C., and Gordon, T. R. (1999). Population structure of Ascomycetes and Deuteromycetes. What we have learned from case studies. pp. 225-228 in: Structure and dynamics of fungal populations. Edited by Worrall, J. J. Kluwer Academic Publisher, Dordecht, The Netherlands.

Dallimore, W. (1915). The uses of Cornus wood. Bulletin of miscellaneous information (Royal Gardens, Kew), 179-181.

Daughtrey, M. L., and Hagan, A. K. (2001). Dogwood diseases. pp. 124-132 in: Diseases of woody ornamentals and trees in nurseries. Edited by Jones, R. K., and Benson, D. M. American Phytopathological Society Press, St. Paul, U.S.A.

Daughtrey, M. L., and Hibben, C. R. (1983). Lower branch dieback, a new disease of northeastern dogwoods. Phytopathology, 73: 159-164.

Daughtrey, M. L., and Hibben, C. R. (1994). Dogwood anthracnose: a new disease threatens two native Cornus species. Annual Review of Phytopathology, 32: 61-73.

Daughtrey, M. L., Hibben, C. R., Britton, K. O., Windham, M. T., and Redlin, S. C. (1996). Dogwood anthracnose: understanding a disease new to North America. Plant Disease, 80: 349- 358.

Davis, C. N. (2001) Dogwood anthracnose (Discula destructiva) in Ontario. Frontline Express, Bulletin No. 1. Canadian Forest Service, Great Lakes Forestry Centre.

Debuchy, R., and Turgeon, B. G. (2006). Mating-type structure, evolution, and function in Euascomycetes. pp. 293-323 in: Growth, differentiation and sexuality. Edited by Esser, K., Kües, U., and Fischer, R. Springer, Berlin, Heidelberg, New York.

Dickinson, M. (2003). Molecular plant pathology (pp. 34-35). Bios Scientific Publishers, Taylor and Francis Group, New York and London.

Edgar, R. (2004). MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 3: 1792-1797.

Edwards, K., Johnstone, C. and Thompson, C. (1991). A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Research 19: 1349.

Ellegren, H. (1991). DNA typing of museum birds. Nature, 354: 113.

138

Ellegren, H. (2004). Microsatellites: simple sequences with complex evolution. Nature Reviews Genetics, 5: 435-445.

Erbaugh, D. K., Windham, M. T., Stodola, A. J., and Augk, S. R. M. (1995). Light intensity and drought stress as predisposition factors for dogwood anthracnose. Journal of Environmental Horticulture, 13: 186-189.

European and Mediterranean Plant Protection Organization, EPPO (2013). http://www.eppo.int/QUARANTINE/Alert_List/fungi/DISCDE.htm?utm_source=www.eppo.org &utm_medium=int_redirect

Eyde, R. H. (1987). The case for keeping Cornus in the broad Linnaean sense. Systematic Botany, 12: 505-518.

Eyde, R. H. (1988). Comprehending Cornus: puzzles and progress in the systematics of the dogwoods, The Botanical Review, 5: 234-351.

Fan, C., and Xiang, Q., Y. (2001). Phylogenetic relationships within Cornus (Cornaceae) based on 26S rDNA sequences. American Journal of Botany, 88: 1131-1138.

Farr, D. F. (1991). Septoria species on Cornus. Mycologia, 83: 611-623.

Farr, E., M. (1904). Notes on some interesting British Columbian plants. Contribution from the Botanical Laboratory of the University of Pennsylvania, 2: 417-425.

Farr, D. F., Bills, G. F., Chamuris, G. P., and Rossman, A. Y. (1989). Fungi on plants and plant products in the United States (pp. 142-145). American Phytopathological Society Press, St. Paul, U.S.A.

Felsenstein, J. (1989). PHYLIP - Phylogeny inference package (Version 3.2). Cladistics, 5: 164- 166.

Ferguson, I. K. (1966). Notes on the nomenclature of Cornus. Journal of the Arnold Arboretum, 47: 100-105.

Fuentes, J.L., Escobar, F., Alvarez, A., Gallego, G., Duque, M.C., Ferrer, M., Deus, J.E. and Tohme, J.M. (1999). Analyses of genetic diversity in Cuban rice varieties using isozyme, RAPD and AFLP markers. Euphytica, 109: 107-115.

Fulcher, A., and Bowers, H. (2013). W289-B IPM Quick Facts Series: Bacterial Leaf Scorch, University of Tennessee Extension Publications. http://trace.tennessee.edu/utk_agexdise/80

Funk, A. (1985). Foliar fungi of western trees (pp. 45-47). Canadian Forest Service, Pacific Forest Research Centre, Victoria, B.C., Canada.

139

Glenn, T. C., and Schable, N. A. (2005). Isolating microsatellite DNA loci. Methods in Enzymology, 395: 202-222.

Graham, E. T., Windham, M. T., Malueg, K. R., and Brown, D. A. (1991). A histological study of dogwood anthracnose pathogenesis. Phytopathology, 81: 1202-1203 (Abstr.).

Graziose, R., Rojas-Silva, P., Rathinasabapathy, T., Dekock, C., Grace, M. H., Poulev, A., Lila, M. A., Smith, P., and Raskin, I. (2012). Antiparasitic compounds from Cornus florida L. with activities against Plasmodium falciparum and Leishmania tarentolae. Journal of Ethnopharmacology, 142: 456-461.

Guérin, F., Franck, P., Loiseau, A., Devaux, M., and Le Cam, B. (2004). Isolation of 21 new polymorphic microsatellite loci in the phytopathogenic fungus Venturia inaequalis. Molecular Ecology Notes, 4: 268-270.

Hall, I. V., and Sibley, J. D. (1976). The biology of Canadian weeds: Cornus canadensis L. Canadian Journal of Plant Science, 56: 885-892.

Hara, H. (1948). The nomenclature of the flowering dogwood and its allies. Journal of the Arnold Arboretum, 29: 111-115.

Hardin, J. W., and Murrell, Z. E. (1997). Foliar micromorphology of Cornus. Journal of the Torrey Botanical Society, 124: 124-139.

Hartman, J. (1998). Effect of dogwood powdery mildew incidence on flower set. pp. 25-26 in: Proceedings of the Dogwood Workshop. NC, USA.

Hawksworth, D. L., Crous, P. W., Redhead, S. A., Reynolds, D. R., Samson, R. A., Seifert, K. A., Taylor, J. W., Wingfield, M. J. (2011). The Amsterdam declaration on fungal nomenclature. IMA Fungus, 2: 105-112.

Hed, B. E., Windham, M. T., and Grant, J. F. (1999). Survival of conidia of Discula destructiva in frass of the convergent lady beetle. Plant Disease, 83: 806-809.

Hennebert, G. L., and Weresub, L. K. (1977). Terms for states and forms of fungi, their names and types. Mycotaxon, 6: 207-211

Hibben, C. R., and Daughtrey, M. L. (1988). Dogwood anthracnose in northeastern United States. Plant Disease, 72: 199-203.

Hillis, D. M., and Dixon, M. (1991). Ribosomal DNA: molecular evolution and phylogenetic inference. The Quarterly Review of Biology, 66: 411-453.

140

Holdenrieder, O., and Sieber, T. N. (2007). First record of Discula destructiva in Switzerland and preliminary inoculation experiments on native European Cornus species. pp. 51-56 in: Alien invasive species and international trade. Edited by Evans, H., and Oszako, T. Warsaw, Poland.

Holmes, F. W., and Hibben, C. R. (1989). Field evidence confirms Cornus kousa dogwood's resistance to anthracnose. Journal of Arboriculture, 15:290-291.

Holzmueller, E. J., Jose, S., and Jenkins, M. A. (2010). Ecological consequences of an exotic fungal disease in eastern U.S. hardwood forests. Forest Ecology and Management, 25: 1347 1353.

Holzmueller, E.J., Jose, S., Jenkins, M.A., Camp, A., and Long, A.J. (2006). Dogwood anthracnose in eastern hardwood forests: What is known and what can be done? Journal of Forestry, 104: 21-26.

Hsiang, T., and Baillie, D. L. (2005). Comparison of the yeast proteome to other fungal genomes to find core fungal genes. Journal of Molecular Evolution, 60: 475-483.

Hsiang, T. and Wu, C. (2000). Genetic relationships of pathogenic Typhula species assessed by RAPD, ITS-RFLP and ITS sequencing. Mycological Research, 104: 16-22.

Huang, J., Hsieh, T.F, Chastagner, G.A. and Hsiang, T. (2001). Clonal and sexual propagation in Botrytis elliptica. Mycological Research, 105: 833-842.

Hudler, G. W. (1985). Thinking out loud... Origins of dogwood lower branch dieback. NY State Arborists Shade Tree Notes, 8: 1-2.

Hutchinson, J. (1967). The genera of flowering plants (Angiospermae). In: Dicotyledones Vol. 2: 41-48. Oxford University Press. Ely House, London.

Hutchinson, J. (1942). Neglected generic characters in the family Cornaceae. Annals of Botany, 6: 83-93.

Jenkins, A. E., Miller, J. H., and Hepting, G. H. (1953). Spot anthracnose and other leaf and petal spots of flowering dogwood. National Horticultural Magazine, 32: 57-69.

Kaye, C., Milazzo, J., Rozenfeld, S., Lebrun, M. H., and Tharreau, D. (2003). The development of simple sequence repeat markers for Magnaporthe grisea and their integration into an established genetic linkage map. Fungal Genetics and Biology, 40: 207-214.

Klein, L. A., Windham, M. T., and Trigiano, R. N. (1998). Natural occurrence of Microsphaera pulchra and Phyllactinia guttata on two Cornus species. Plant Disease, 82: 383-385.

Knapova, G., and Gisi, U. (2002). Phenotypic and genotypic structure of Phytophthora infestans populations on potato and tomato in France and Switzerland. Plant Pathology, 51: 641-653.

141

Koch, R. (1884). Die Aetiologie der Tuberkulose. Mittheilungen aus dem Kaiserlichen Gesundheitsamte, 2: 1-88.

Kronstad, J. W., and Staben, C. (1997). Mating type in filamentous fungi. Annual Review of Genetics, 31: 245-276.

Lambe, R. C., and Justis, S. F. (1978). Special: dogwood diseases. Ornamentals Northwest Archives, 2: 7-10. Virginia Polytechnic Institute and State University, Blacksburg, VA.

Lee, S. C., Ni, M., Li, W., Shertz, C., and Heitman, J. (2010). The evolution of sex: a perspective from the fungal kingdom. Microbiology and Molecular Biology Reviews, 74: 298-340.

Lees, A. K., Wattier, R., Shaw, D. S., Sullivan, L., Williams, N. A., and Cooke, D. E. L. (2006). Novel microsatellite markers for the analysis of Phytophthora infestans populations. Plant Pathology, 55: 311-319.

Lepage, E. (1958). Études sur quelques plantes Américaines. VII. Le Naturaliste Canadien, 85: 100-104.

Little, E. L. Jr. (1971). Atlas of United States trees. Volume 1. Conifers and important hardwoods. U.S. Department of Agriculture Miscellaneous publication 1146. 9 p., 200 maps.

Little, E. L. Jr. (1976) Atlas of United States trees. Volume 3. Minor western hardwoods. U.S. Department of Agriculture Miscellaneous Publication 1314. 13 p., 290 maps.

Liu, Y. J., Whelen, S., and Hall, B. D. (1999). Phylogenetic relationships among Ascomycetes: evidence from an RNA polymerse II subunit. Molecular Biology and Evolution, 16: 1799-1808.

Lubani, K.R. and Linn, N.B. (1962). Entrance and invasion of the asparagus plant by urediniospore germ tubes and hyphae of Puccinia asparagi. Phytopathology, 52: 115-119.

McDonald, B. A. (1997). The population genetics of fungi: tools and techniques. Phytopathology, 87: 448-453.

McElreath, S. D., and Tainter, F. H. (1993). A sporulation medium for Discula destructiva, the dogwood anthracnose fungus. Current Microbiology, 26: 117-121.

McElreath, S. D., Yao, J. M., Coker, P. S., and Tainter, F. H. (1994). Double-stranded RNA in isolates of Discula destructiva from the eastern United States. Current Microbiology, 29: 57-60.

McLemore, B. F. (1990). Cornus florida L. Flowering dogwood. Silvics of North America, 2: 278.

Meglécz, E., Costedoat, C., Dubut, V., Gilles, A., Malausa, T., Pech, N., and Martin, J. F. (2010). QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics, 26: 403-404.

142

Mielke, M. E., and Langdon, K. (1986). Dogwood anthracnose fungus threatens Catoctin Mountain Park. U.S. Department of the Interior, National Park Services, Park Science. Conservation Biology, 6: 6–8.

Mielke, M. E., and Daughtrey, M. L. (2011). How to identify and control dogwood anthracnose. NA-GR-18. Radnor, PA, U.S. Department of Agriculture, Forest Service, Northern Area State and Private Forestry. http://www.na.fs.fed.us/spfo/pubs/howtos/ht_dogwd/ht_dog.htm

Mullis, K. B., and Faloona, F. A. (1987). Specific synthesis of DNA in vitro via a polymerase- catalyzed chain reaction. Methods in Enzymology, 155: 335.

Murrell, Z. E. (1993). Phylogenetic relationships in Cornus (Cornaceae). Systematic Botany, 18: 469-495.

Murrell, Z. E. (1994). Dwarf dogwoods: intermediacy and the morphological landscape. Systematic Botany, 19: 539-556.

Murrell, Z. E. (1996). A new section of Cornus in South and Central America. Systematic Botany, 21: 273-288.

National Center for Biotechnology Information, NCBI (2013). http://www.ncbi.nlm.nih.gov/

Neely, D., and Nolte, D. S. (1989). Septoria leaf spot on dogwoods. Journal of Arboriculture, 15: 263-267.

Nei, M. and Li, W.H. (1979). Mathematical model for studying genetic variation in terms of restriction endonucleases. Proceedings of the National Academy of Sciences of the United States of America, 76: 5269-5273.

Njambere, E.N.N., Attanayake, R.N. and Chen, W.D. (2010). Applications of molecular markers and DNA sequences in identifying fungal pathogens of cool season grain legumes. pp. 79-91 in: Molecular identification of fungi. Edited by Gherbawy, Y., and Voigt, K. New York.

Olerup, O., and Zetterquist, H. (1992). HLA‐DR typing by PCR amplification with sequence‐specific primers (PCR‐SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor‐recipient matching in cadaveric transplantation. Tissue Antigens, 39: 225-235.

Page, R.D.M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences, 12: 357-358.

Paoletti, M., Rydholm, C., Schwier, E. U., Anderson, M. J., Szakacs, G., Lutzoni, F., Debeaupuis, J.-P., Latgé, J.-P., Denning, D. W., Dyer, P. S. (2005). Evidence for sexuality in the opportunistic fungal pathogen Aspergillus fumigatus. Current Biology, 15: 1242-1248.

143

Parham, J. M., and Windham, M. T. (1992). Effects of tree placement on dogwood anthracnose severity and lesion growth rates in urban landscapes and wooded areas. In: Sixth regional dogwood anthracnose workshop (42 pp.). Edited by Stipes, R. J. Virginia Tech, Blacksburgh, Virginia.

Pérez, M., Gallego, F. J., and Hidalgo, P. (2001). Evaluation of molecular techniques for the genetic characterization of Saccharomyces cerevisiae strains. FEMS Microbiology Letters, 205: 375-378.

Picard, M., Debuchy, R., and Coppin, E. (1991). Cloning the mating types of the heterothallic fungus Podospora anserina: developmental features of haploid transformants carrying both mating types. Genetics, 128: 539-547.

Pirone, P., P. (1980). Parasitic fungus affects region`s dogwood. New York Times, New York. Feb. 24: 34-37.

Pojarkova, A. (1950). De Systemate generis Linneani Cornus L. Botaniceskie Materialy Gerbarija Botaniceskogo Instituti imeni VL Komarova Akademii Nauk SSSR, 12: 164-180.

Quebec Society for the Protection of Plants, QSPP (2003). Names of plant diseases in Canada. 4th eds (p. 75). AGMV Marquis Imprimeurs Inc., Cap-Saint-Ignace, Quebec.

Redlin, S.C. (1991). Discula destructiva sp. nov., cause of dogwood anthracnose, Mycologia, 83: 633-642.

Redlin, S. C. (1992). Scanning electron microscopy of the conidioma of Discula destructiva (Coelomycetes). Mycologia, 84: 257-260.

Roger, A. J., Sandblom, O., Doolittle, W. F., and Philippe, H. (1999). An evaluation of elongation factor 1 alpha as a phylogenetic marker for eukaryotes. Molecular Biology and Evolution, 16: 218-233.

Rong, R., Rao, S., Scott, S. W., and Tainter, F. H. (2001). Common multiple dsRNAs are present in populations of the fungus Discula destructiva originating from widely separated geographic locations. Current Microbiology, 42: 144-148.

Rossell I. M., Rossell, C. R. Jr., and Hining K. J. (2001). Impacts of dogwood anthracnose (Discula destructiva Redlin) on the fruits of flowering dogwood (Cornus florida L.): implications for wildlife. American Midland Naturalist, 146: 379–387.

Rossman, A. Y., Farr, D. F., and Castlebury, L. A. (2007). A review of the phylogeny and biology of the Diaporthales. Mycoscience, 48: 135-144.

Salogga, D. S. (1982). Occurrence, symptoms and probable cause, Discula species associated with anthracnose of dogwood in the Pacific Northwest. Doctoral dissertation, MS Thesis. University of Washington, Seattle.

144

Salogga, D. S., and Ammirati, J. F. (1983). Discula species associated with anthracnose of dogwood in the Pacific Northwest. Plant Disease, 67: 290. (Abstr.).

Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, 74: 5463-5467.

Schlotteröer, C., Amos, B., and Tautz, D. (1991). Conservation of polymorphic simple sequence loci in cetacean species. Nature, 354: 63-65.

Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., Spouge, J. L., Levesque, C. A., Chen, W., and Fungal Barcoding consortium (2012). Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences, 109: 6241-6246.

Scow, K.M., Schwartz, E., Johnson, M.J. and Macalady, J.L., (2001). Microbial biodiversity, measurement of Encyclopedia of Biodiversity (pp. 177-190). San Diego: Academic Press.

Sherald, J. L., Stidham, T. M., and Roberts, L. E. (1994). Research reports evaluation of eight species of Cornus for resistance to dogwood anthracnose. Journal of Environmental Horticulture, 12: 61-64.

Sherald, J. L., Stidham, T. M., Hadidian, J. M., and Hoeldtke, J. E. (1996). Progression of the dogwood anthracnose epidemic and the status of flowering dogwood in Catoctin Mountain Park. Plant Disease, 80: 310-312.

Shi, A., Kantartzi, S. K., Mmbaga, M. T., Chen, P., Mrema, F., and Nnodu, E. (2008). PCR- based markers for detection of Colletotrichum acutatum and C. gloeosporioides in flowering dogwood (Cornus florida). Australasian Plant Pathology, 37: 65-68.

Smith, V., L. (1998). Dogwood anthracnose research update. In: Yankee nursery quarterly (pp. 73-76). http://www.hort.uconn.edu/IPM/nursery/htms/dwdanth.htm

Soper, J. H., and Heimburger, M. L. (1982). Shrubs of Ontario (xxxi + 495 pp.). Royal Ontario Museum, Toronto.

Stinzing, A., and Lang, K. J. (2003). Dogwood anthracnose. Erster Fund von Discula destructiva an Cornus florida in Deutschland. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes, 55: 1- 5.

Strandberg, J. O., and Chellemi, D. O. (2002). Limb dieback of flowering dogwood caused by Colletotrichum acutatum. Proceedings of the Florida State Horticultural Society, 115: 259-262.

Tantardini, A., Calvi, M., Cavagna, B., Zhang, N., and Geiser, D. (2004). First report in Italy of dogwood anthracnose on Cornus florida and Cornus nuttallii caused by Discula destructiva. Informatore Fitopatologico, 54: 44-47.

145

Tautz, D. (1989). Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Research, 17: 6463-6471.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25: 4876-4882.

Thon, M. R., and Royse, D. J. (1999). Partial β-tubulin gene sequences for evolutionary studies in the Basidiomycotina. Mycologia, 91: 468-474.

Toole E. R., and Filer T. H. (1965). Colletotrichum gloeosporioides on dogwood. Plant Disease reporter, 49: 351.

Trigiano, R. N., Caetano-Anollés, G., Bassam, B. J., and Windham, M. T. (1995). DNA amplification fingerprinting provides evidence that Discula destructiva, the cause of dogwood anthracnose in North America, is an introduced pathogen. Mycologia, 87: 490-500.

Trigiano, R. N., Gerhaty, N. E. A., and Windham, M. T. (1993). Extracellular enzymes of two fungi associated with dogwood anthracnose. Phytopathology, 83: 1410 (Abstr.).

Turgeon, B. G. (1998). Application of mating type gene technology to problems in fungal biology. Annual Review of Phytopathology, 36: 115-137.

United States Department of Agriculture, USDA (2013). http://plants.usda.gov/java/profile?symbol=cornu

Venkatasubbaiah, P., and Chilton,W.S. (1991). Toxins produced by the dogwood anthracnose fungus Discula sp. Journal of Natural Products, 54: 1293–1297.

Walkinshaw, C. H. (1992). Anatomy of dogwood flowers, leaves and twigs after infection by Discula destructiva Redlin. Phytopathology, 82: 1096.

Walkinshaw, C. H., and Anderson, R. L. (1991). Histology of Cornus florida L. leaves infected naturally and artificially by Discula sp., US Departament of Agriculture, Forest Service, Southeastern Forest Experiment Station: 360, 1-4.

Webster, J. and Weber, R.W.S. (2007). Introduction to fungi. Cambridge: Cambridge University Press.

Wedge, D. E., Riley, M. B., and Tainter, F. H. (1999). Phytotoxicity of Discula destructiva culture filtrates to Cornus spp. and the relationship to disease symptomatology. Plant Disease, 83: 377-380.

146

White, T.J., Bruns T., Lee, S. and Taylor, J. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. pp. 315-322 in: PCR Protocols, a Guide to Methods and Applications. Edited by Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J. New York, Academic Press.

Xiang, Q. Y., Brunsfeld, S. J., Soltis, D. E., and Soltis, P. S. (1996). Phylogenetic relationships in Cornus based on chloroplast DNA restriction sites: implications for biogeography and character evolution. Systematic otany, 21: 515-534.

Xiang, Q. Y. J., Manchester, S. R., Thomas, D. T., Zhang, W., & Fan, C. (2005). Phylogeny, biogeography, and molecular dating of cornelian cherries (Cornus, Cornaceae): tracking Tertiary plant migration. Evolution, 59: 1685-1700.

Xiang, Q. Y. J., Thomas, D. T., Zhang, W., Manchester, S. R., and Murrell, Z. (2006). Species level phylogeny of the genus Cornus (Cornaceae) based on molecular and morphological evidence – implications for taxonomy and Tertiary intercontinental migration. Taxon, 55: 9-30.

Yao, J. M., McElreath, S. D., and Tainter, F. H. (1994). Genetic relatedness among dsRNAs from different isolates of Discula destructiva. Current Microbiology, 29: 145-149.

Yao, J. M., McElreath, S. D., and Tainter, F. H. (1997). News and Notes: Double-Stranded RNA in Isolates of Discula destructiva from the Pacific Northwestern United States and British Columbia, Canada. Current Microbiology, 34: 67-69.

Yap, I. V., and Nelson, R. J. (1996). WINBOOT: a program for performing bootstrap analysis of binary data to determine the confidence limits of UPGMA-based dendrograms. International Rice Research Institute, Manila, Philippines, Discussion Paper Series, 14: 1-22.

Yarwood, C. E., and Jacobson, L. (1955). Accumulation of chemicals in diseased areas of leaves. Phytopathology, 45: 43-48.

Zhang, N., and Blackwell, M. (2001). Molecular phylogeny of dogwood anthracnose fungus (Discula destructiva) and the Diaporthales. Mycologia, 93: 355-365.

Zhang, N., Tantardini, A., Miller, S., Eng, A., and Salvatore, N. (2011). TaqMan real-time PCR method for detection of Discula destructiva that causes dogwood anthracnose in Europe and North America. European Journal of Plant Pathology, 130: 551-558.

Zietkiewicz, E., Rafalski, A., and Labuda, D. (1994). Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification. Genomics, 20: 176-183.

147

Appendices

Appendix 2.1

This is the Perl scri+pt used to parse the BLAST results: # FILENAME: split_parse.pl # DATE: 2003/6/23 # split a multi-record BLAST output file into individual records and parse it # use strict; # use warnings; # define variables and initialize my @line; my $line; my @record;

# read multi-record file into array as individual records # by resetting read-until = record-separator characters; $/="Query"; # This starts every BLAST record

@line = <> ;

# read in each record and split it by newline into an array foreach $line (@line) { @record = split (/\n/,$line);

# reset record separator character; $/="\n";

$matches=0; $expect=0; @hitname=1; @hitnames=1; @hitevals=1; foreach (@record) {

# Count hits by parsing out everything that looks like a summary line

if (/^(\w+\|\w*).+\d\s*$/) { # each line that contains | such as gb|BC0001 is found # but this is no good for blast results that don't contain "|"

@hitname = /^\w+\|(\S+)\b.+\d\s*$/mg; #matches lcl|102-R.pl and others after first | push (@hitnames,"@hitname,"); #places the hitnames into an array @hiteval = /^\w+\|\S+.+\s(\S{1,6}\ *)$/mg; #matches e-values push (@hitevals, "@hiteval,"); #places e-values into an array

148

$matches = $matches + 1;

}

# Read query if (/^Query=\s*(.+)$/) { #$query_dest = $1; $query = $1; $query_lng = '';

}

# Read subject if (/^>((\S+).*)/) { $subject_dest = $1; $subject = $2; $subject_lng = ''; }

@hitname = 0;

} # end single record array input print "$query,$matches,$hitnames[1]$hitevals[1]$hitnames[2]$hitevals[2]$hitnames[3]$hitevals[3]$hi tnames[4]$hitevals[4]$hitnames[5]$hitevals[5]$hitnames[6]$hitevals[6]$hitnames[7]$hitevals[7] $hitnames[8]$hitevals[8]$hitnames[9]$hitevals[9]$hitnames[10]$hitevals[10]\n";

} # end full array input loop

149

Appendix 2.2: List of dogwood samples with collection dates, collection locations, and processing results. Samples which produced Discula destructiva were marked with “+”. Sample Envelope Collection date Species Collection location D. destructiva Other fungal species 1/2010 1 2010.06.01 Cornus florida Ontario, Norfolk - N/A 1/2010 2 2010.05.26 C. florida Ontario, Norfolk - N/A 1/2010 3 2010.05.27 C. florida Ontario, Niagara Falls - N/A 1/2010 4 2010.06.01 C. florida Ontario, Norfolk - N/A 2/2010 1 2010.06.25 C. florida Ontario, Norfolk - N/A 2/2010 2 2010.06.25 C. florida Ontario, Norfolk + N/A 2/2010 3 2010.06.25 C. florida Ontario, Norfolk + N/A 2/2010 4 2010.06.24 C. florida Ontario, Norfolk - N/A 2/2010 5 2010.06.23 C. florida Ontario, Niagara Falls - N/A 3/2010 1 2010.07.14 C. florida Ontario, Norfolk - N/A 3/2010 2 2010.07.14 C. florida Ontario, Norfolk - N/A 4/2010 1 2010.07.16 C. florida Ontario, Norfolk - N/A 4/2010 2 2010.07.16 C. florida Ontario, Norfolk - N/A 4/2010 3 2010.07.16 C. florida Ontario, Niagara Falls - N/A 5/2010 1 2010.08.06 C. florida Ontario, Norfolk - N/A 5/2010 2 2010.08.06 C. florida Ontario, Norfolk - N/A 5/2010 3 2010.08.09 C. florida Ontario, Norfolk - N/A 5/2010 4 2010.08.09 C. florida Ontario, Norfolk - N/A 5/2010 5 2010.08.04 C. florida Ontario, Niagara Falls - N/A 1/2011 1 2011.05.25 C. florida Ontario, Norfolk - N/A 1/2011 2 2011.05.25 C. florida Ontario, Norfolk - N/A 2/2011 1 2011.06.06 C. florida Ontario, Middlesex + N/A 3/2011 1 2011.06.17 C. florida Ontario, Norfolk + N/A 3/2011 2 2011.06.17 C. florida Ontario, Norfolk - N/A 3/2011 3 2011.06.17 C. florida Ontario, Norfolk - N/A 3/2011 4 2011.06.17 C. florida Ontario, Norfolk + N/A 4/2011 1 2011.06.29 C. florida Ontario, Norfolk + N/A 4/2011 2 2011.06.29 C. florida Ontario, Norfolk - N/A 4/2011 3 2011.06.29 C. florida Ontario, Norfolk - N/A 4/2011 4 2011.06.29 C. florida Ontario, Norfolk - N/A 5/2011 1 2011.07.13 C. florida Ontario, Norfolk + N/A 5/2011 2 2011.07.13 C. florida Ontario, Norfolk - N/A 5/2011 3 2011.07.13 C. florida Ontario, Norfolk + N/A 6/2011 1 2010.07.07 C. sericea var. B.C., Hornby Island - N/A occidentalis 6/2011 2 2010.07.07 C. nuttallii B.C., Hornby Island + N/A 6/2011 3 2010.07.07 C. florida 'Eddy's B.C., Hornby Island + N/A White Wonder' 6/2011 4 2010.07.07 C. nuttallii B.C., Victoria + N/A 7/2011 1 2010.07.25 C. florida Ontario, Norfolk + - 7/2011 2 2010.07.25 C. florida Ontario, Norfolk - Pleuroceras tenellum 7/2011 3 2010.07.25 C. florida Ontario, Norfolk + - 8/2011 1 2011.08.05 C. florida Ontario, Middlesex - Pleuroceras tenellum 8/2011 2 2011.08.05 C. florida Ontario, Middlesex - - 8/2011 3 2011.08.05 C. florida Ontario, Middlesex - -

150

Appendix 2.2 (continued): List of dogwood samples with collection dates, collection locations, and processing results. Samples which produced Discula destructiva were marked with “+”. Sample Envelope Collection date Species Collection location D. destructiva Other fungal species 9/2011 1 2011.08.09 C. racemosa Ontario, Haldimand - - 10/2011 1 2011.07.05 C. nuttallii B.C., Vancouver + - 11/2011 1 2011.08.16 C. florida Ontario, Norfolk + Discula quercina 11/2011 2 2011.08.16 C. florida Ontario, Norfolk + Discula quercina 11/2011 3 2011.08.16 C. amomum Ontario, Essex - - 11/2011 4 2011.08.16 C. sericea Ontario, Essex - - 12/2011 1 2011.08.15 C. florida Ontario, Norfolk - - 12/2011 2 2011.08.15 C. florida Ontario, Norfolk - - 13/2011 1 2011.07.16 C. florida Ontario, Norfolk - Alternaria alternata 13/2011 2 2011.07.16 C. florida Ontario, Norfolk - Alternaria alternata 13/2011 3 2011.08.03 C. florida Ontario, Norfolk - Phomopsis sp. 13/2011 4 2011.08.03 C. florida Ontario, Norfolk - Dothiorella gregaria 13/2011 5 2011.08.25 C. florida Ontario, Norfolk - Alternaria alternata 13/2011 6 2011.08.25 C. florida Ontario, Norfolk - Phomopsis sp. 14/2011 1 2011.08.03 C. sericea Ontario, Guelph - Alternaria alternata 15/2011 1 2011.08.29 C. florida Ontario, Norfolk - Epicoccum nigrum 15/2011 2 2011.08.29 C. florida Ontario, Norfolk + Alternaria alternata 15/2011 3 2011.08.29 C. florida Ontario, Norfolk + Phomopsis sp. 16/2011 1 2011.08.09 C. alba 'Ivory Halo' Ontario, Guelph - Alternaria alternata Colletotrichum sp. Epicoccum nigrum 17/2011 1 2011.09.07 C. amomum Ontario, Oxford - Alternaria alternata Colletotrichum sp. 17/2011 2 2011.09.07 C. sericea Ontario, Oxford - Alternaria alternata Colletotrichum sp. 17/2011 3 2011.09.07 C. racemosa Ontario, Oxford - Alternaria alternata 17/2011 4 2011.09.07 C. alternifolia Ontario, Oxford - Alternaria alternata 17/2011 5 2011.09.07 C. florida Ontario, Oxford - Alternaria alternata Colletotrichum sp. 17/2011 6 2011.09.07 C. amomum Ontario, Oxford - Colletotrichum sp. 18/2011 1 2011.09.15 C. florida Ontario, Guelph - Alternaria alternata 18/2011 2 2011.09.15 C. florida Ontario, Guelph - Alternaria alternata 19/2011 1 2011.09.16 C. florida Ontario, Norfolk - Alternaria alternata Colletotrichum sp. Dothiorella gregaria 19/2011 2 2011.09.02 C. florida Ontario, Norfolk + Alternaria alternata Colletotrichum sp. 19/2011 3 2011.08.19 C. florida Ontario, Norfolk - Colletotrichum sp. 19/2011 4 2011.08.05 C. florida Ontario, Norfolk + Dothiorella gregaria 5 2011.07.22 C. florida Ontario, Norfolk + Alternaria alternata 20/2011 1 2011.09.16 C. florida Ontario, Norfolk - Phomopsis sp. 20/2011 2 2011.09.02 C. florida Ontario, Norfolk - Phomopsis sp. 20/2011 3 2011.08.19 C. florida Ontario, Norfolk - Alternaria alternata Phomopsis sp.

151

Appendix 2.2 (continued): List of dogwood samples with collection dates, collection locations, and processing results. Samples which produced Discula destructiva were marked with “+”. Sample Envelope Collection date Species Collection location D. destructiva Other fungal species 20/2011 4 2011.08.05 C. florida Ontario, Norfolk - Alternaria alternata 20/2011 5 2011.07.22 C. florida Ontario, Norfolk - - 21/2011 1 2011.09.16 C. florida Ontario, Norfolk - Alternaria alternata Colletotrichum sp. Dothiorella gregaria 21/2011 2 2011.09.02 C. florida Ontario, Norfolk - Alternaria alternata Colletotrichum sp. 21/2011 3 2011.08.19 C. florida Ontario, Norfolk - Dothiorella gregaria 21/2011 4 2011.08.05 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 21/2011 5 2011.07.22 C. florida Ontario, Norfolk - Dothiorella gregaria 21/2011 6 2011.07.08 C. florida Ontario, Norfolk - Alternaria alternata 22/2011 1 2011.09.02 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 22/2011 2 2011.09.16 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 22/2011 3 2011.08.19 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 22/2011 4 2011.07.22 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 22/2011 5 2011.07.08 C. florida Ontario, Norfolk - Alternaria alternata 23/2011 1 2011.09.16 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 23/2011 2 2011.09.02 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 23/2011 3 2011.08.19 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 23/2011 4 2011.07.08 C. florida Ontario, Norfolk + Alternaria alternata Dothiorella gregaria 23/2011 5 2011.07.22 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 24/2011 1 2011.09.16 C. florida Ontario, Norfolk - Alternaria alternata 24/2011 2 2011.09.02 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 24/2011 3 2011.08.19 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria Epicoccum nigrum 24/2011 4 2011.08.05 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 24/2011 5 2011.07.22 C. florida Ontario, Norfolk - - 24/2011 6 2011.07.08 C. florida Ontario, Norfolk - - 25/2011 1 2011.09.02 C. florida Ontario, Norfolk - Alternaria alternata Phomopsis sp. 25/2011 2 2011.09.16 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria

152

Appendix 2.2 (continued): List of dogwood samples with collection dates, collection locations, and processing results. Samples which produced Discula destructiva were marked with “+”. Sample Envelope Collection date Species Collection location D. destructiva Other fungal species 25/2011 3 2011.08.19 C. florida Ontario, Norfolk - Phomopsis sp. 25/2011 4 2011.08.05 C. florida Ontario, Norfolk + Alternaria alternata Dothiorella gregaria 25/2011 5 2011.07.22 C. florida Ontario, Norfolk + Dothiorella gregaria 25/2011 6 2011.07.08 C. florida Ontario, Norfolk - Alternaria alternata 26/2011 1 2011.09.02 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 26/2011 2 2011.09.16 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 26/2011 3 2011.08.19 C. florida Ontario, Norfolk - Alternaria alternata Epicoccum nigrum 26/2011 4 2011.08.05 C. florida Ontario, Norfolk - - 26/2011 5 2011.07.22 C. florida Ontario, Norfolk - Epicoccum nigrum 26/2011 6 2011.07.08 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 27/2011 1 2011.09.10 C. alternifolia Ontario, Norfolk - Dothiorella gregaria Phomopsis sp. 27/2011 2 2011.09.10 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 27/2011 3 2011.09.10 C. florida Ontario, Norfolk - Alternaria alternata 27/2011 4 2011.09.10 C. florida Ontario, Norfolk - Alternaria alternata 27/2011 5 2011.09.25 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 27/2011 6 2011.09.25 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 27/2011 7 2011.09.25 C. florida Ontario, Norfolk - Alternaria alternata 27/2011 8 2011.09.25 C. alternifolia Ontario, Norfolk - Alternaria alternata Colletotrichum sp. 27/2011 9 2011.10.06 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria Epicoccum nigrum 27/2011 10 2011.10.06 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria Epicoccum nigrum 27/2011 11 2011.10.06 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria 27/2011 12 2011.10.06 C. alternifolia Ontario, Norfolk - Alternaria alternata 27/2011 13 2011.10.18 C. florida Ontario, Norfolk - Alternaria alternata Dothiorella gregaria Epicoccum nigrum 27/2011 14 2011.10.18 C. florida Ontario, Norfolk - Alternaria alternata 27/2011 Dothiorella gregaria 27/2011 15 2011.10.18 C. florida Ontario, Norfolk - Alternaria alternata 27/2011 16 2011.10.18 C. alternifolia Ontario, Norfolk - Alternaria alternata

153

3/2012 1 2012.05.13 C. florida Ontario, Guelph - Alternaria alternata 3/2012 2 2012.05.13 C. florida Ontario, Guelph - Alternaria alternata 3/2012 3 2012.05.13 C. florida Ontario, Guelph - Alternaria alternata 4/2012 1 2012.05.23 C. florida Ontario, Middlesex - Dothiorella gregaria Colletotrichum sp. Phomopsis sp. Alternaria alternata 5/2012 1 2012.05.25 C. nuttallii B.C., Vancouver + - 5/2012 2 2012.05.25 C. nuttallii B.C., Vancouver + - 6/2012 1 2012.05.25 C. florida Ontario, Norfolk + Alternaria alternata Phomopsis sp. 6/2012 2 2012.05.25 C. florida Ontario, Norfolk - Phomopsis sp. Alternaria alternata Colletotrichum sp. 7/2012 1 2012.05.24 C. nuttallii B.C., Victoria + - 7/2012 2 2012.05.24 C. nuttallii B.C., Victoria + - 7/2012 3 2012.05.24 C. nuttallii B.C., Victoria + - 7/2012 4 2012.05.24 C. nuttallii B.C., Victoria + - 7/2012 5 2012.05.24 C. nuttallii B.C., Victoria + -

154

Appendix 2.2(continued): List of dogwood samples with collection dates, collection locations, and processing results. Samples which produced Discula destructiva were marked with “+”. Sample Envelope Collection date Species Collection location D. destructiva Other fungal species 7/2012 6 2012.05.24 C. nuttallii B.C., Victoria + Colletotrichum sp. Dothiorella gregaria 7/2012 7 2012.05.24 C. nuttallii B.C., Victoria + - 7/2012 8 2012.05.24 C. nuttallii B.C., Victoria + - 8/2012 1 2012.06.10 C. racemosa Ontario, Guelph - Epicoccum nigrum - Alternaria alternata - Dothiorella gregaria 8/2012 2 2012.06.10 C. racemosa Ontario, Guelph - Alternaria alternata 8/2012 3 2012.06.10 C. racemosa Ontario, Guelph - - 9/2012 1 2012.06.08 C. florida Ontario, Norfolk - Dothiorella gregaria 9/2012 2 2012.06.08 C. florida Ontario, Norfolk + Phomopsis sp. 9/2012 3 2012.06.08 C. florida Ontario, Norfolk - Epicoccum nigrum Colletotrichum sp. Discula quercina 9/2012 4 2012.06.08 C. florida Ontario, Norfolk - Phomopsis sp. 9/2012 5 2012.06.08 C. florida Ontario, Niagara + - 9/2012 6 2012.06.08 C. florida Ontario, Norfolk - Colletotrichum sp. 9/2012 7 2012.06.08 C. florida Ontario, Norfolk - Phomopsis sp. 9/2012 8 2012.06.08 C. florida Ontario, Norfolk + - 10/2012 1 2012.06.20 C. florida Ontario, Middlesex + Phomopsis sp. Colletotrichum sp. Epicoccum nigrum 10/2012 2 2012.06.20 C. florida Ontario, Middlesex + Colletotrichum sp. 11/2012 1 2012.06.19 C. nuttallii B.C., Victoria + - 11/2012 2 2012.06.19 C. nuttallii B.C., Victoria + - 11/2012 3 2012.06.19 C. nuttallii B.C., Victoria + - 11/2012 4 2012.06.19 C. nuttallii B.C., Victoria + - 11/2012 5 2012.06.19 C. nuttallii B.C., Victoria + - 11/2012 6 2012.06.19 C. nuttallii B.C., Victoria + - 11/2012 7 2012.06.19 C. nuttallii B.C., Victoria + - 11/2012 8 2012.06.19 C. nuttallii B.C., Victoria + - 12/2012 1 2012.07.06 C. alternifolia Ontario, Guelph - Alternaria alternata 13/2012 1 2012.06.28 C. kousa Japan, Sapporo - Yeasts Dothiorella gregaria 13/2012 2 2012.06.28 C. florida Japan, Sapporo - Yeasts Dothiorella gregaria 14/2012 1 2012.06.22 C. florida Ontario, Middlesex + - - Colletotrichum sp. Alternaria alternata 13/2012 2 2012.06.27 C. florida Ontario, Norfolk + - 13/2012 3 2012.06.27 C. florida Ontario, Norfolk - Dothiorella gregaria Phomopsis sp. 15/2012 1 2012.07.05 C. nuttallii B.C., Vancouver + - 16/2012 1 2012.07.15 C. alternifolia Ontario, Guelph - Alternaria alternata 16/2012 2 2012.08.07 C. alternifolia Ontario, Guelph - Botryosphaeria dothidea 16/2012 3 2012.08.07 C. florida Ontario, Guelph - Discula quercina

155

Appendix 2.2 (continued): List of dogwood samples with collection dates, collection locations, and processing results. Samples which produced Discula destructiva were marked with “+”. Sample Envelope Collection date Species Collection location D. destructiva Other fungal species 16/2012 4 2012.08.07 C. florida Ontario, Guelph - Pleuroceras tenellum 16/2012 5 2012.08.07 C. racemosa Ontario, Guelph - Pilidium concavum Pestalotiopsis sp. 17/2012 1 2012.07.13 C. florida Ontario, Niagara Fall + - 18/2012 1 2012.07.15 C. florida Ontario, Essex + Alternaria alternata, Epicoccum nigrum 18/2012 2 2012.07.15 C. florida Ontario, Essex - - 18/2012 3 2012.07.15 C. florida Ontario, Essex - - 19/2012 1 2012.08.03 C. nuttallii B.C., Vancouver + Colletotrichum sp. Yeasts 20/2012 1 2012.07.30 C. nuttallii B.C., Victoria + - 20/2012 2 2012.07.30 C. nuttallii B.C., Victoria + - 20/2012 3 2012.07.30 C. nuttallii B.C., Victoria + - 20/2012 4 2012.07.30 C. nuttallii B.C., Victoria + - 20/2012 5 2012.07.30 C. nuttallii B.C., Victoria + - 20/2012 6 2012.07.30 C. nuttallii B.C., Victoria + - 20/2012 7 2012.07.30 C. nuttallii B.C., Victoria + - 20/2012 8 2012.07.30 C. nuttallii B.C., Victoria + - 21/2012 1 2012.09.04 C. florida Ontario, Norfolk - - 21/2012 2 2012.09.04 C. florida Ontario, Norfolk - Alternaria alternata Colletotrichum sp. 22/2012 1 2012.08.13 C. nuttallii B.C., Victoria + - 22/2012 2 2012.08.13 C. nuttallii B.C., Victoria + - 22/2012 3 2012.08.13 C. nuttallii B.C., Victoria + - 22/2012 4 2012.08.13 C. nuttallii B.C., Victoria + - 22/2012 5 2012.08.13 C. nuttallii B.C., Victoria + - 22/2012 6 2012.08.13 C. nuttallii B.C., Victoria + - 22/2012 7 2012.08.13 C. nuttallii B.C., Victoria + - 22/2012 8 2012.08.13 C. nuttallii B.C., Victoria + - 23/2012 1 2012.09.04 C. nuttallii B.C., Vancouver + - 24/2012 1 2012.09.14 C. florida Ontario, Norfolk + Alternaria alternata 25/2012 1 2012.10.02 C. florida Ontario, Norfolk + Alternaria alternata Phomopsis sp. Discula quercina

156

Appendix 2.3 Dogwood Disease Symptom Guide Note: Fungal isolates were obtained by surface sterilization of symptomatic plant tissues and culturing on agar media, unless otherwise specified Figure 1 Alternaria alternata Information on Leaf symptoms leaf-sample Name: flowering dogwood (Cornus florida) Collection: Norfolk County, Ontario, September 2011 Percent of all samples which produced A. alternata: > 50%

Information on 4 day colony on potato dextrose Hyphae and conidia fungal isolate agar (PDA) Name: Alternaria alternata Identification: morphology Range: world-wide Life style: opportunistic pathogen, causing leaf spots and leaf blight and also asthma on humans Typical host: multiple hosts

157

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 2 Botryosphaeria dothidea Information on Leaf symptoms leaf-sample Name: pagoda dogwood (C. alternifolia) Collection: the Guelph Arboretum, Ontario, August, 2012 Percent of all samples which produced B. dothidea: < 5%

Information on 25 day colony on PDA Ascospores fungal isolate Name: Botryosphaeria dothidea Identification: ITS sequence Accession: 12579 Range: native to Northern hemisphere Life style: opportunistic pathogen causing cankers and dieback Typical host: multiple hosts http://www.plantmanagementnetw ork.org/pub/php/research/2006/ba bygold/

158

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 3 Colletotrichum sp. Information on Leaf symptoms leaf-sample Name: flowering dogwood (C. florida) Collection: Norfolk County, Ontario, September 2011. Percent of all samples which produced Colletotrichum sp.: > 50%

Information on 20 day colony on PDA Conidia fungal isolate Name: Colletotrichum gloeosporioides Identification: morphology Range: world-wide Life style: pathogenic, causing anthracnose Typical host: multiple hosts

159

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 4 Discula destructiva Information on Leaf symptoms and signs leaf-sample 1. Name: flowering dogwood (C. florida) Collection: Niagara Falls, Ontario, July 2012

1a. Necrotic spots on adaxial leaf surface 1b. Acervuli as brown dots on the abaxial leaf surface

2. & 3. Name: Pacific dogwood (C. nuttallii) Collection: Victoria Island, British Columbia, May 2012 (picture 2) and Capilano Golf Course, West Vancouver (picture 3)

Percent of all samples which produced D. destructiva: 42%

160

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 4 (continued) Discula destructiva Information on 14 day colony on PDA fungal isolate Name: Discula destructiva Identification : morphology and ITS sequence Range: introduced in North America from central Asia Life style: pathogenic, produces dogwood anthracnose Typical host: flowering dogwood (C. florida) and Pacific dogwood (C. nuttallii)

Conidia

161

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 5 Discula quercina Information on Leaf symptoms leaf-sample Name: flowering dogwood (C. florida) Collection: the Guelph Arboretum, Ontario, August 2012 Percent of all samples which produced D. quercina: < 5%

Information on 9 day colony on PDA Conidia fungal isolate Name: Discula quercina (Teleomorph: Apiognomonia quercina) Accession:11167, 11168 Identification: ITS sequence Range: world-wide Life style: endophytic on oak Typical host: oak (Quercus sp.)

162

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 6 Dothiorella gregaria Information on Leaf symptoms leaf-sample Name: flowering dogwood (C. florida) Collection: Norfolk County, Ontario, October 2011 Percent of samples which produced D. gregaria: > 50%

Information on 30 day colony on PDA Hyphae and conidia fungal isolate Name: Dothiorella gregaria Identification: morphology Range: world-wide Life style: pathogenic Typical host: multiple hosts

163

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 7 Epicoccum nigrum Information on Leaf symptoms leaf-sample Name: gray dogwood (C. racemosa) Collection: the Guelph Arboretum, Ontario, June 2012 Percent of all samples which produced E. nigrum: < 50%

Information on 30 day colony on PDA Hyphae and conidia fungal isolate Name: Epicoccum nigrum Identification: morphology Range: world-wide Life style: endophytic and saprophytic Typical host: multiple hosts

164

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 8 Elsinoe corni Information on leaf-sample Leaf symptoms Name: grey dogwood (C. racemosa) Collection: the Guelph Arboretum, July 2012

Information on Colony Spores fungal isolate Name: Elsinoe corni Range: introduced Life style: pathogenic, causing anthracnose Not available Not available Typical host: dogwood

165

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 9 Melanconium oblongum Information on Leaf symptoms leaf-sample Name: Pacific dogwood (C. nuttallii) Collection: Victoria Island, British Columbia, April 2012 Percent of all samples which produced M. oblongum: < 5%

Information on 28 day colony on PDA Conidia fungal isolate Name: Melanconium oblongum Identification: ITS sequence Range: North America, Japan Accession: 12189 Life style: saprophytic, considered a weak parasite, this fungus invades weakened or dead tissue and causes what is referred to as Melanconis dieback Typical host: butternut, walnut

166

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 10 Microsphaera penicillata Information on Leaf symptoms and signs leaf-sample Name: pagoda dogwood (C. alternifolia) Collection: Received from Jennifer Llewellyn, OMAFRA, on October 2011 Percent of all samples which had M. penicillata: < 5%

Information on fungus Detail of appendages on cleistothecia Name: Microsphaera penicillata (also known as M. pulchra or Erysiphe pulchra) Identification: morphology Range: Ontario Life Style: pathogenic Typical host: multiple hosts, including dogwood

167

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 11 Parallelodiplosis subtruncata Information on Leaf symptoms and signs leaf-sample Name: pagoda dogwood (C. alternifolia) Collection: Starkey Hill Conservation Area, Guelph, Ontario, July 2012 Percent of all samples which had P. subtruncata: < 5%

Information on Insect larva the causal agent Name: Parallelodiplosis subtruncata Order Diptera (Flies), Family Cecidomyiidae (gall midges and wood midges)

168

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 12 Pestalotiopsis sp.* Information on Leaf symptoms leaf-sample Name: grey dogwood (C. racemosa) Collection: the Guelph Arboretum, August 2012 Percent of all samples which produced Pestalotiopsis sp.: < 5%

Information on 28 day colony on PDA Conidia fungal isolate Name: Pestalotiopsis sp. Identification: morphology Accession: 12533 Range: world-wide Life Style: endophytic and pathogenic Typical host: multiple hosts

*Pestalotiopsis sp. was isolated by the wet chamber method (see section 2.2.3)

169

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 13 Pilidium concavum* Information on Leaf symptoms leaf-sample Name: grey dogwood (C. racemosa) Collection: the Guelph Arboretum, August 2012 Percent of all samples which produced P.concavum: < 5%

Information on 9 day colony on PDA Conidia fungal isolate Name: Pilidium concavum Identification: ITS sequence Accession: 12578 Range: world-wide Life Style: pathogenic Typical host: multiple hosts

*Pilidium concavum was isolated by the wet chamber method (see section 2.2.3)

170

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 14 Phomopsis sp. Information on Leaf symptoms leaf-sample Name: flowering dogwood (C. florida) Collection: Norfolk County Ontario, May 2012 Percent of all samples which produced Phomopsis sp.: > 50%

Information on 28 day colony on PDA Conidia fungal isolate Name: Phomopsis vismiae Identification: morphology Range: world- wide Life Style: pathogenic Typical host: multiple hosts

171

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 15 Pleuroceras tenellum Information on Leaf symptoms leaf-sample

Name: flowering dogwood (C. florida) Collection: Norfolk County, Ontario, August 2011 Percent of all samples which produced P. tenellum: < 5%

Information on 35 day colony on PDA Spores fungal isolate

Name: Pleuroceras tenellum Identification: ITS sequence Accession: 11163, 11164 Range: temperate regions of Northern Not available hemisphere Life Style: saprophytic, on overwintered leaves in hardwood forests of temperate regions Typical host: Acer sp.

172

Appendix 2.3 Dogwood Disease Symptom Guide (continued) Figure 16 Septoria cornicola* Information on Leaf symptoms leaf-sample Name: Red osier dogwood (C. sericea) Collection: Guelph, Ontario, October 2012 Percent of all samples which produced

S. cornicola:

< 5% Information on 4 month colony on malt extract Conidia fungal isolate agar Name: Septoria cornicola Identification: morphology and ITS sequence Accession: 12577 Range: wherever the host exists Life Style: pathogenic Typical host: Cornus sp.

*Septoria cornicola was isolated by the wet chamber method (see section 2.2.3)

173

Appendix 2.4

ITS regions of nine different morphotypes of fungi collected from symptomatic samples of dogwood. Nucleotides written with lower case letters were corrected manually after visualization using Chromas Lite.

> Botryosphaeria dothidea tgatCGgGCTcGgccGaTCCTCCCACCCTTTGTGTACCTACCTCTGTTGCTTTGGCGGGCCG CGGTCCTCCGCGgCCGCCCCCCTCCCCGGGGGGTGGCCAGCcCCCGCCAGAGGaCCA TCAAACTCCAGTCAGTAAACGATGCAGTCTGAAAAAcATTTAAtAAACTAAAACTTTC AACAACGGAtCTCTTGGTTCTGGCATCGATGAAgAACGCAGCGAAATGCGATAAGTA ATGtGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACgCaCaTTGccCCCTTTGGT ATTCCGAAGGgCATGCC TGTTCGAGCGTCaTTACAACCCTCAAGCTCTGcTTGgtATTGGGCACCGtCCTTTGcGGG CgcccctCAAAgACCTCGGcGGtGGCGTCTTGCCTCAAGCGTAGTAaAAcATACATCTCGC TTCGGAgCgCAGGGCGTCcCCCGccGgAcgAACCTTCTGaAcTTTTCtcaaGgTTGaCCTCGG atCaggTAGGgAtACCCGCTGAACTTAAGCATATCAATA

>Discula destructiva (isolate 1110) ITS consensus sequence GGGTGCTACCCAGAAaCCCATTGTGAATCATACCTAAAATGTTGCCTCGGCAGTGGT TGGCTTCTTCGGAGGTCCCTTTCGTAAGAAAGGAGCAGACCGGCCGGTGGCCCTATA AACTCTTTGTTTTTGTAACATCATCTGAGTAAAAAACAACTAAATGAATCAAAACTT TCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAA GTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCC GGTGGTATTCCACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAAGCCTCAG CTTTGGTGTTGGAGGAAGACCTGTAAAAGGGTCCCCTCCCAAATTTAGTGGCGGGCT CGCTAGAATTTTGAGCGTAGTAATTTTACCTCGTTTTTAAAGACTAGTGGGACTTCTT GCCGTAAAACCCCCCAACTTTCTGAAAATTGACCTCGGATCAGGTAGGAATACCCGC TGAACTTAAGCATATCAATAAGNGGGAGGG

> Discula quercina CACGGTgCTAcCCAGAAACCCTTTGTGAATTATTCTCATTGTTGCCTCGcatTGACTGGC CTCTTCTGGAGGTCCCTTTCTCTTCGGGGAAAGGAGCAGGTCGGCCGgtggcTAatAAAC TCTTTGTTTTTACAGTGTATCTTCTGAGTAAACAACTATAAATGAATCAAAACTTTTA ACAACGGATCTCTTGGtTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAA TGTGAATTGCAGAATTCAGtGAATCATCGAATCTTTGAACGCACATTGcGCCCgcTGGt ATTCCaGCG

174

Appendix 2.4 (continued)

> Melanconium oblongum (isolate 12189) CCtCaCGGTgcTAcCCAGaAAcCCTTTGTGAACTTATACCACTATTATGTTGCCTCGcaGtg gtggcTCTTTTTGGAGTCCCCCTAGTCTCTGATTAGGGAGCAGGCCGGCCGAtgCcTATA AACTCTTGTTTGTACAGTATCTCTTCTGAGTTTTTAAAAATAAATGAATCAAAACTTT CAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCG CTGGTATTCCAgcgaTGCCTGTTCGAGCGTCATTTCAACCCTCAGGCTTCGCtgGTGTTG GGGCACTACCTGTAAAAGGGTAAGCCCTGAAATTCAGTGGCAGGCTCGCTAGAACT CTGAGCGTAGTAACTATACGTCGCTTTGGAAGGACTAGCGGTGCTCTCGCCGTAAAA CCCCCCATTTTCTGAAAGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG CATATCAATagcNGGAGGAA

> Pestalotiopsis vismiae (isolate 12533) AGGTCACCATTAAAAATTGGGGGAtTTAGCGGCTAAAGACGCTGCAACTCCAGTCAA AAGCGAGATAAAAATTTACTACGCTCAGAGGATATCGCAGATCCGCCGTTGTATTTC AGGAGCTACAGCTAGTAAAAGCAGTAGGCTCCCAACACTAAGCTAGGCTTAAGGGT TGAAATGACGCTCGAACAGGCATGCCCACTAGAATACTAATGGGCGCAATGTGCGT TCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTG CGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGACTTATTAA AATAAGACGCTCAGATTACAATAAAATAACAAGAGTTTGGTAGTCCACCGGCAGCC GCTACAGGGTAGGCCGTTCCAGGGTAAGGCGCTACAGGGTAGGCCGTTCCAGGGTA AGGTGCACCGAGCAGCTTCTGCCGAGGCAACAATGGTAAGTTCACATGGGTTGGGA GTTTAGAAAACTCTATAATGATCCCTCCGC

> Pilidium concavum ATCTCCCTTTCTTGNTGNTTGNNCGGTTGCCTTGNCTTCGGNCAGGATTATTCTGAAT CAG TGTCGTCTGAGTTGTACCACAAATACAATAAAACTTTCAACAACGGATCTCTTGGTT CTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGACACC GTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGC CTGTTCGAGCGTCATTACACTATTCTTCGGAGTATTGACAGTGGCTTACGCCTTGTCT AAAACCCTTGGTGGTAACTATCAATCACGCATAGTAATCTCTGCGAAGGTGGATAGG TAAACACTGAAAACTTCTTGTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT AAGCATA

175

Appendix 2.4 (continued)

> Phomopsis sp. GGTCaAATTTTCAGAAGTTGGGGgTTTAACGGCAGGgCACCGNCcCgcGGgCCTTCCAA AGCGAGGGTTTAACTACTACGCTCGGGGTCCTGGCGAGCTCGCCACTAGATTTCAGG GCCTGCCCTTTTACAGGCAGTGCCCCAACACCAAGCAATGCTTGAGGGTTGAAATGA CGCTCGAACAGGCATGCCCTCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGAT TCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTC ATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTGTTTTTTC TCAGAGTTTCAGTGTAAAAACAAGAGTTAACTTGGCCGCCGGCGTGCCGTCTCCTCA CCGGGGTGAGGGGCCTACTAGAGACCAGCATGCGCCGAGGCAACAGTAAGGTATAA GTTCACAAAGGGTTTCTGGGTGCGCCTAGGGCGCGTTCCAGCAATGATCCCTCCGCA

> Pleuroceras tenellum (isolate 11163) CGGGTGCTACCCAGAaaCCCTTTGTGAATACTACTTAAAAATGTTGCCTCGGCGCAGG TTGGCCCTTTTACAGGGTCCCTTCTCCCCTAGGGGTTAAGGAGCAGACCCGCCGGCG GCCCTATAAACTCTTGTTTTTGTAAAATCATCTGAGTAAAAAAAAATAAATGAATCA AAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGC GATAAGTAATG TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGTGGT ATTCCACCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAAGCCTAGCTTTGGT GTTGGAGGAAGACCTGTAAAAAGGTCCCCTCCCAAATTTAGTGGCGGGCTCGCTAG AATTTTGAGCGTAGTAATTTTACCTCGTTTTTAAAGACTAGTGGGACTTCTTGCCGTA AAACCCCCCAACTTTCTGAAAATTGACCTCGAA

> Septoria cornicola (isolate12577) AACAATGAAGTCACAACGCTTGGAGACGGACAGCTCAGCCGGAGACTTTAAGGCGC GCGGAACCCCGCGACGCCCAATACCAAGCCAGGCTTGAGTGGTGAAATGACGCTCG AACAGGCATGCCCTCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATG ATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGAT GCCAGAACCAAGA GATCCGTTGTTGAAAGTTTTGTTTAATTTACTTAAACTCCGACGCAGAGATGCAGTG TTGGAGGGCCTCCGGGGGCGCCCGCCGACGAACGGCAGGGTCGCCCCCGAAGCAAC GAGTACGTTCACAAAGGGTTGGAGGGTCGGGGGCTGCCCGGGGGGGGTAATCCCCC CCGTGGGCCCCCTCCAGCTCGATAATGATCCCTCCGCA

176

Appendix 3.1

An example of SAS statements used to analyze mycelial growth data of Discula destructiva. data first; input expt isol$ temp rep$ grow; cards; 1 11121 6 1 1 1 11132 6 2 1 1 12205 6 3 5 2 11121 5 1 1 2 11132 5 2 1 2 12205 5 3 1 ... ; run; proc glm; class expt temp; model grow= expt temp ; means expt temp /LSD lines; run;

177

Appendix 3.2

An example of SAS statements used to analyze disease ratings data of Discula destructiva on Cornus spp. and other woody species. data first; input expt sp$ rep$ necr; cards; 1 C.aBY 1 101 1 C.flo 2 100 1 C.kou 3 80 1 C.rac 1 40 1 C.ser 2 0 2 C.aBY 1 50 2 C.flo 2 70 2 C.kou 3 100 2 C.rac 1 20 2 C.ser 2 10

... ; run; proc glm; class expt sp; model necr= expt sp; means sp/LSD lines; run;

178