DOCSLIB.ORG

Skin Transcriptome Profiling of Changthangi Goats Highlights The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Skin Transcriptome Profiling of Changthangi Goats Highlights The www.nature.com/scientificreports OPEN Skin transcriptome profling of Changthangi goats highlights the relevance of genes involved in Pashmina production Sonika Ahlawat1*, Reena Arora1, Rekha Sharma1, Upasna Sharma1, Mandeep Kaur1, Ashish Kumar1, Karan Veer Singh1, Manoj Kumar Singh2 & Ramesh Kumar Vijh1 Pashmina, the world’s fnest natural fber is derived from secondary hair follicles of Changthangi goats which are domesticated in Ladakh region of Jammu and Kashmir by nomadic pastoralists. Complex epithelial-mesenchymal interactions involving numerous signal molecules and signaling pathways govern hair follicle morphogenesis and mitosis across diferent species. The present study involved transcriptome profling of skin from fber type Changthangi goats and meat type Barbari goats to unravel gene networks and metabolic pathways that might contribute to Pashmina development. In Changthangi goats, 525 genes were expressed at signifcantly higher levels and 54 at signifcantly lower levels with fold change >2 (padj < 0.05). Functional annotation and enrichment analysis identifed signifcantly enriched pathways to be formation of the cornifed envelope, keratinization and developmental biology. Expression of genes for keratins (KRTs) and keratin-associated proteins (KRTAPs) was observed to be much higher in Changthangi goats. A host of transcriptional regulator genes for hair follicle keratin synthesis such as GPRC5D, PADI3, HOXC13, FOXN1, LEF1 and ELF5 showed higher transcript abundance in Pashmina producing goats. Positive regulation of Wnt signaling pathway and negative regulation of Oncostatin M signaling pathway may be speculated to be important contributors to hair follicle development and hair shaft diferentiation in Changthangi goats. Tirty four registered breeds and many non-descript populations represent the diverse caprine genetic resources of India which inhabit four eco-zones viz. Temperate Himalayan, North Western, Southern Peninsular and Eastern region. Tere is great variability in Indian goats with regard to many phenotypic traits such as color, size, reproductive and productive parameters. Additionally, on the basis of utility, they are classifed into milk, meat and fber type breeds (www.nbagr.res.in). An important breed of extremely cold Temperate Himalayan region of India is Changthangi which is a source of world’s most luxurious natural fber, Pashmina/Cashmere. Hence, these goats are also referred to as Pashmina or Cashmere goats. Te ability of this breed to adapt to high altitude hypoxic conditions has enabled it to thrive in difcult terrains of Changthang region of Ladakh and hilly tract of Leh. In contrast, Barbari is a breed of North Western region, which is primarily reared for milk and meat purpose. Tese animals are small sized, short-haired and white coloured with small light brown patches1. Pashmina is considered the world’s fnest natural fber and is obtained from undercoat of goats native to Asia. Indian Pashmina is mainly derived from Changthangi goats which are domesticated in Ladakh region of Jammu and Kashmir by nomadic pastoralists (Changpas) and is a prominent symbol of their cultural heritage. It is also known as Cashmere, Kashmir and pashm in India (http://jksheephusbandrykashmir.nic.in). Te other Cashmere producing countries are China, Mongolia, Iran, Afghanistan, Pakistan and Nepal. Owing to its warmth, fneness, acclaimed aesthetic value and lusture, it has rightly been called “sof gold” or “the king of fbers”. Te premium price it fetches is understandable in light of its greater sofness than even superfne merino of the same diameter2. Cashmere is derived from secondary hair follicles of goats which undergo cyclic variation as a result of complex epithelial-mesenchymal interactions. Tese physiological processes involve interactions of numerous signal mol- ecules and signaling pathways which govern hair follicle morphogenesis and mitosis3. 1ICAR-National Bureau of Animal Genetic Resources, Karnal, India. 2ICAR-Central Institute for Research on Goats, Mathura, India. *email: [email protected] SCIENTIFIC REPORTS | (2020) 10:6050 | https://doi.org/10.1038/s41598-020-63023-6 1 www.nature.com/scientificreports/ www.nature.com/scientificreports Percent of Percent Number Number of raw Processed high quality aligned of genes Sample details reads reads data reads expressed Barbari1 42,180,760 40,871,412 96.90 94.33 17,891 Barbari2 44,027,632 42,757,303 97.11 94.41 18,089 Barbari3 43,653,637 42,326,495 96.96 93.24 17,923 Barbari4 46,000,800 44,554,407 96.86 94.22 17,870 Changthangi1 52,572,185 50,994,026 97.00 95.85 18,756 Changthangi2 51,395,618 49,913,541 97.12 94.35 17,721 Changthangi3 55,521,228 53,856,077 97.00 95.14 18,461 Changthangi4 53,981,415 51,928,597 96.20 94.42 19,521 Table 1. Summary of read statistics of 8 libraries from Barbari and Changthangi breeds. Transcriptomic profling using the Illumina high-throughput sequencing platform has opened new vistas for unraveling of global gene expression and annotation of whole transcriptomes underpinning phenotypic and physiological variability. Such advances in genome research have facilitated an improved understanding of sys- temic gene expression and ensuing regulatory mechanisms in several species4. Over the last fve years, Cashmere goats have become focus of intense study and there have been attempts to identify molecular mechanisms gov- erning hair follicle morphogenesis5, hair follicle cycling under natural and shortened photoperiod conditions4, and also, delineating the gene networks controlling the coat color in these goats6. However, to the best our knowl- edge, there are no reports on comparative transcriptome profling of skin of goats inhabiting contrasting climatic regions and difering in terms of utility, particularly from the Indian subcontinent. Terefore, the present study was planned to elucidate complete repertoire of transcripts expressed in the skin of fber type Changthangi goats from cold desert region of India and compare it with meat type Barbari goats from hot arid regions of the coun- try. Novel information from the caprine skin transcriptomes can contribute to elucidation of genetic networks determining adaptation to divergent agro-ecological zones and diferences in the quality of the fber produced by the two breeds under study. Results In order to quantify the gene expression patterns of goat skin samples, cDNA libraries were constructed from 4 animals each of Changthangi and Barbari breeds and these libraries were subjected to deep sequencing using Illumina HiSeq platform. Summary of RNA Seq data. Te number of raw reads and processed reads varied from 42.1 to 55.5 mil- lion and 40.8 to 53.8 million, respectively for diferent samples. Mapping with the Capra hircus reference assem- bly ARS1 yielded 93.24 to 95.85% aligned reads, suggesting good quality of RNA-seq data for further analysis. Similarity in the percentage of mapped reads eliminated any sequencing biases in the dataset generated. Detailed results are presented in Table 1. Functional enrichment analysis. Based on annotation of the Bos taurus genome, the top 30 genes with highest expression in both breeds were linked to biological functions such as cellular macromolecule metabolic process, cellular biosynthetic process, skin development, intermediate flament cytoskeleton organization, hair follicle morphogenesis and epidermis morphogenesis. A total of 1147 genes were expressed at signifcantly higher levels and 948 at signifcantly lower levels in Changthangi goats (padj < 0.05) as compared to Barbari goats. Gene Ontology enrichment analysis was performed for the diferentially expressed genes (DEGs). Top 5 enriched func- tional categories included signal, coiled coil, intermediate flament, cytoskeleton, keratin and diferentiation. Classifcation of the DEGs into biological process (BP), cellular components (CC) and molecular function (MF) is detailed in Fig. 1. On the basis of KEGG enrichment analysis, the DEGs were observed to be involved in several pathways which include protein processing in endoplasmic reticulum, transcriptional misregulation in cancer, ribosome biogene- sis in eukaryotes, adherens junction, FoxO signaling pathway, AMPK signaling pathway and extracellular matrix receptor interaction. Genes related to adherens junction were ACTB, PTPRJ, CREBBP, CSNK2B, LEF1, SMAD3, CTNND1, ACTN1, NECTIN4, TCF7L1, VCL, IGF1R, SORBS1, FYN and SSX2IP. Genes representing extra- cellular matrix receptor interaction pathway included ITGA1, HSPG2, VWF, ITGA9, CD47, LAMC3, LAMA5, ITGB7, COMP, ITGB6, SV2B, THBS1, COL11A1, FN1 and SPP1. Amongst the DEGs, 524 genes with higher expression and 53 genes with lower expression with a fold change >2, were considered for further analysis. For the highly expressed genes, a total of 14 annotation clusters were identifed (enrichment score of >0.5 and padj < 0.05). Te most enriched clusters in decreasing order of enrich- ment score were structural molecule activity, cornifed envelope, diferentiation, serine-type endopeptidase inhibitor activity and cell adhesion. Te most prominent clusters for the genes with lower expression were trans- membrane helix, immunoglobulin subtype, signal peptide and calcium ion binding. Signifcant Gene Ontology terms for the genes with higher expression in Changthangi goats included cell diferentiation, multicellular organism development, keratinocyte diferentiation, hair follicle morphogenesis and establishment of skin bar- rier. Most of these genes were components of nucleus, cytoplasm, extracellular
Load more

Recommended publications
  • Development and Maintenance of Epidermal Stem Cells in Skin Adnexa
    International Journal of Molecular Sciences Review Development and Maintenance of Epidermal Stem Cells in Skin Adnexa Jaroslav Mokry * and Rishikaysh Pisal Medical Faculty, Charles University, 500 03 Hradec Kralove, Czech Republic; [email protected] * Correspondence: [email protected] Received: 30 October 2020; Accepted: 18 December 2020; Published: 20 December 2020 Abstract: The skin surface is modified by numerous appendages. These structures arise from epithelial stem cells (SCs) through the induction of epidermal placodes as a result of local signalling interplay with mesenchymal cells based on the Wnt–(Dkk4)–Eda–Shh cascade. Slight modifications of the cascade, with the participation of antagonistic signalling, decide whether multipotent epidermal SCs develop in interfollicular epidermis, scales, hair/feather follicles, nails or skin glands. This review describes the roles of epidermal SCs in the development of skin adnexa and interfollicular epidermis, as well as their maintenance. Each skin structure arises from distinct pools of epidermal SCs that are harboured in specific but different niches that control SC behaviour. Such relationships explain differences in marker and gene expression patterns between particular SC subsets. The activity of well-compartmentalized epidermal SCs is orchestrated with that of other skin cells not only along the hair cycle but also in the course of skin regeneration following injury. This review highlights several membrane markers, cytoplasmic proteins and transcription factors associated with epidermal SCs. Keywords: stem cell; epidermal placode; skin adnexa; signalling; hair pigmentation; markers; keratins 1. Epidermal Stem Cells as Units of Development 1.1. Development of the Epidermis and Placode Formation The embryonic skin at very early stages of development is covered by a surface ectoderm that is a precursor to the epidermis and its multiple derivatives.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Pashmina Shawls
    Pashmina Shawls March 27, 2021 About Pashmina Shawls In 2019, the Bureau of India Standards (BIS) published an Indian standard for identification, marking and labelling the Pashmina Shawls for its purity. Pashmina Shawls are a fine variant of shawls spun from cashmere wools. A cashmere wool itself is obtained from the Changthangi goat native to the high plateau of Ladakh. Pashmina Shawls status symbol not just for the wealthy in Indian but even across the world, known for its soft features, The shawl made up of pashmina wool was promoted as an alternative to Shahtoosh shawl. Shahtoosh Shawls is made from the Tibetan Antelope. Due to demand for Shahtoosh, the shawl had wiped out 90% of the Tibetan Antelope. To preserve what population is left, other alternatives, like the pashmina shawl, are being considered. History of Pashmina Shawls Pashmina shawls gained much prominence in the days of the Mughal Empire as objects of rank and nobility. Babur first established the practice of giving khilat – giving ‘robes of honour’ – in 1526 to members of his court for their devoted service, high achievements or as a mark of royal favour, made of Pashmina wool. Upon the complete conquest of Kashmir in 1568 by Akbar, a pair of pashmina shawls were an integral part of a khilat ceremony. Pashmina Pashmina is a fine type of cashmere wool. The wool comes from a number of different breeds of the cashmere goat; such as the changthangi or Kashmir pashmina goat from the Changthang Plateau in Tibet and part of the Ladakh region and few parts of Himachal Pradesh.
    [Show full text]
  • Edinburgh Research Explorer
    Edinburgh Research Explorer International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list Citation for published version: Davenport, AP, Alexander, SPH, Sharman, JL, Pawson, AJ, Benson, HE, Monaghan, AE, Liew, WC, Mpamhanga, CP, Bonner, TI, Neubig, RR, Pin, JP, Spedding, M & Harmar, AJ 2013, 'International Union of Basic and Clinical Pharmacology. LXXXVIII. G protein-coupled receptor list: recommendations for new pairings with cognate ligands', Pharmacological reviews, vol. 65, no. 3, pp. 967-86. https://doi.org/10.1124/pr.112.007179 Digital Object Identifier (DOI): 10.1124/pr.112.007179 Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Pharmacological reviews Publisher Rights Statement: U.S. Government work not protected by U.S. copyright General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 1521-0081/65/3/967–986$25.00 http://dx.doi.org/10.1124/pr.112.007179 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:967–986, July 2013 U.S.
    [Show full text]
  • Study for Pathogenesis of Congenital Cholesteatoma with Comparison of Proteins Expressed in Congenital Cholesteatoma, Acquired C
    Study for pathogenesis of congenital cholesteatoma with comparison of proteins expressed in congenital cholesteatoma, acquired cholesteatoma and skin of the external auditory canal through proteomics Seung Ho Shin Department of Medicine The Graduate School, Yonsei University Study for pathogenesis of congenital cholesteatoma with comparison of proteins expressed in congenital cholesteatoma, acquired cholesteatoma and skin of the external auditory canal through proteomics Directed by Professor Jae Young Choi The Doctoral Dissertation submitted to the Department of Medicine, the Graduate School of Yonsei University in partial fulfillment of the requirements for the degree of Doctor of Philosophy Seung Ho Shin June 2014 ACKNOWLEDGEMENTS In the initial period of my fellowship, I wrote a book, Temporal Bone Dissection Manual as a coauthor with Professor Won Sang Lee, Ho-Ki Lee and Jae Young Choi. Through this book, I learned about much knowledge from them. Professor Jae Young Choi advised me to go for a Ph.D. I admitted graduate school for a Ph.D. in 2007. In my doctoral course, he has instructed me in detail on the basic research. He has demonstrated precise and delicate laboratory techniques and showed outstanding ability to create new ideas. Also, he has often said to me that a researcher must be honest to his colleagues and even to himself. After the summer of 2013, he gave me an idea for this paper, which was for congenital cholesteatoma analysis with proteomics. He always displayed endless energy and enthusiasm for scientific experiments even after many demanding surgeries. His passion motivated me to follow suit and seven months of our work at last bore fruit.
    [Show full text]
  • Steroid-Dependent Regulation of the Oviduct: a Cross-Species Transcriptomal Analysis
    University of Kentucky UKnowledge Theses and Dissertations--Animal and Food Sciences Animal and Food Sciences 2015 Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis Katheryn L. Cerny University of Kentucky, [email protected] Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Cerny, Katheryn L., "Steroid-dependent regulation of the oviduct: A cross-species transcriptomal analysis" (2015). Theses and Dissertations--Animal and Food Sciences. 49. https://uknowledge.uky.edu/animalsci_etds/49 This Doctoral Dissertation is brought to you for free and open access by the Animal and Food Sciences at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Animal and Food Sciences by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Hypomesus Transpacificus
    Aquatic Toxicology 105 (2011) 369–377 Contents lists available at ScienceDirect Aquatic Toxicology jou rnal homepage: www.elsevier.com/locate/aquatox Sublethal responses to ammonia exposure in the endangered delta smelt; Hypomesus transpacificus (Fam. Osmeridae) ∗ 1 2 Richard E. Connon , Linda A. Deanovic, Erika B. Fritsch, Leandro S. D’Abronzo , Inge Werner Aquatic Toxicology Laboratory, Department of Anatomy, Physiology and Cell Biology, School of Veterinary Medicine, University of California, Davis, California 95616, United States a r t i c l e i n f o a b s t r a c t Article history: The delta smelt (Hypomesus transpacificus) is an endangered pelagic fish species endemic to the Received 9 May 2011 Sacramento-San Joaquin Estuary in Northern California, which acts as an indicator of ecosystem health Received in revised form 29 June 2011 in its habitat range. Interrogative tools are required to successfully monitor effects of contaminants upon Accepted 2 July 2011 the delta smelt, and to research potential causes of population decline in this species. We used microarray technology to investigate genome-wide effects in fish exposed to ammonia; one of multiple contami- Keywords: nants arising from wastewater treatment plants and agricultural runoff. A 4-day exposure of 57-day Hypomesus transpacificus + old juveniles resulted in a total ammonium (NH4 –N) median lethal concentration (LC50) of 13 mg/L, Delta smelt ␮ Microarray and a corresponding un-ionized ammonia (NH3) LC50 of 147 g/L. Using the previously designed delta + Biomarker smelt microarray we assessed altered gene transcription in juveniles exposed to 10 mg/L NH4 –N from Ammonia this 4-day exposure.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Anti-GPRC5D/CD3 Bispecific T Cell-Redirecting Antibody for the Treatment of Multiple Myeloma
    Author Manuscript Published OnlineFirst on July 3, 2019; DOI: 10.1158/1535-7163.MCT-18-1216 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. MCT-18-1216R1, Molecular Cancer Therapeutics, T. Kodama et al. Anti-GPRC5D/CD3 bispecific T cell-redirecting antibody for the treatment of multiple myeloma Tatsushi Kodama1, 2, Yu Kochi3, Waka Nakai2, Hideaki Mizuno2, Takeshi Baba2, Kiyoshi Habu2, Noriaki Sawada2, Hiroyuki Tsunoda2, Takahiro Shima3, Kohta Miyawaki3, Yoshikane Kikushige3, Yasuo Mori3, Toshihiro Miyamoto3, Takahiro Maeda4, and Koichi Akashi3, 4 Authors' Affiliations: 1Chugai Pharmabody Research Pte. Ltd., Singapore, 2Research Division, Chugai Pharmaceutical Co., Ltd., Kamakura, Kanagawa, Japan, 3Department of Medicine and Biosystemic Science, Kyushu University Graduate School of Medical Sciences, Fukuoka, Japan, 4Center for Cellular and Molecular Medicine, Kyushu University Hospital, Fukuoka, Japan Corresponding Authors: Tatsushi Kodama, Chugai Pharmabody Research Pte. Ltd., 3 Biopolis Drive, #07-11 to 16, Synapse, 138623, Singapore; Phone: + 65-6933-4860; Fax: + 65-6684-2257; E-mail: [email protected] Running Title: Anti-GPRC5D/CD3 bispecific T cell-redirecting antibody Keywords: GPRC5D, bispecific T cell-redirecting antibody, multiple myeloma Financial information: This study was funded by Chugai Pharmaceutical Co., Ltd. Conflict of interest statement: Tatsushi Kodama, Waka Nakai, Hideaki Mizuno, Takeshi Baba, Kiyoshi Habu, Noriaki Sawada, and Hiroyuki Tsunoda are employees of Chugai 1 Downloaded from mct.aacrjournals.org on September 24, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 3, 2019; DOI: 10.1158/1535-7163.MCT-18-1216 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • Structural and Biochemical Changes Underlying a Keratoderma-Like Phenotype in Mice Lacking Suprabasal AP1 Transcription Factor Function
    Citation: Cell Death and Disease (2015) 6, e1647; doi:10.1038/cddis.2015.21 OPEN & 2015 Macmillan Publishers Limited All rights reserved 2041-4889/15 www.nature.com/cddis Structural and biochemical changes underlying a keratoderma-like phenotype in mice lacking suprabasal AP1 transcription factor function EA Rorke*,1, G Adhikary2, CA Young2, RH Rice3, PM Elias4, D Crumrine4, J Meyer4, M Blumenberg5 and RL Eckert2,6,7,8 Epidermal keratinocyte differentiation on the body surface is a carefully choreographed process that leads to assembly of a barrier that is essential for life. Perturbation of keratinocyte differentiation leads to disease. Activator protein 1 (AP1) transcription factors are key controllers of this process. We have shown that inhibiting AP1 transcription factor activity in the suprabasal murine epidermis, by expression of dominant-negative c-jun (TAM67), produces a phenotype type that resembles human keratoderma. However, little is understood regarding the structural and molecular changes that drive this phenotype. In the present study we show that TAM67-positive epidermis displays altered cornified envelope, filaggrin-type keratohyalin granule, keratin filament, desmosome formation and lamellar body secretion leading to reduced barrier integrity. To understand the molecular changes underlying this process, we performed proteomic and RNA array analysis. Proteomic study of the corneocyte cross-linked proteome reveals a reduction in incorporation of cutaneous keratins, filaggrin, filaggrin2, late cornified envelope precursor proteins, hair keratins and hair keratin-associated proteins. This is coupled with increased incorporation of desmosome linker, small proline-rich, S100, transglutaminase and inflammation-associated proteins. Incorporation of most cutaneous keratins (Krt1, Krt5 and Krt10) is reduced, but incorporation of hyperproliferation-associated epidermal keratins (Krt6a, Krt6b and Krt16) is increased.
    [Show full text]
  • Spiny Mice (Acomys) Exhibit Attenuated Hallmarks of Aging And
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.07.083287; this version posted May 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 2 3 4 5 6 Title: Spiny mice (Acomys) exhibit attenuated hallmarks of aging and rapid cell turnover after UV 7 exposure in the skin epidermis 8 Authors: Wesley Wong1, Austin Kim1, Ashley W. Seifert2, Malcolm Maden3, and Justin D. Crane1 9 Affiliations: 1Department of Biology, Northeastern University, 360 Huntington Avenue, Boston, 10 MA 02115, 2Department of Biology, University of Kentucky, Lexington, KY 40506, 3UF 11 Genetics Institute & Department of Biology, University of Florida, Gainesville, FL 32611 12 13 Keywords: Spiny mouse, skin, epidermis, UV radiation, aging 14 15 16 17 18 19 20 21 22 23 24 25 26 27 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.07.083287; this version posted May 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 28 Abstract 29 The study of long-lived and regenerative animal models has revealed diverse protective responses 30 to stressors such as aging and tissue injury. Spiny mice (Acomys) are a unique mammalian model 31 of skin regeneration, but their response to other types of physiological skin damage have not been 32 investigated.
    [Show full text]