DOCSLIB.ORG

D-Glyceric Aciduria Is Caused by Genetic Deficiency of D

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
D-Glyceric Aciduria Is Caused by Genetic Deficiency of D D-GLYCERIC ACIDURIA IS CAUSED BY GENETIC DEFICIENCY OF D-GLYCERATE KINASE Jörn Oliver Sass, Kathleen Fischer, Raymond Wang, Ernst Christensen, Sabine Scholl-Bürgi, Richard Chang, Klaus Kapelari, Melanie Walter To cite this version: Jörn Oliver Sass, Kathleen Fischer, Raymond Wang, Ernst Christensen, Sabine Scholl-Bürgi, et al.. D- GLYCERIC ACIDURIA IS CAUSED BY GENETIC DEFICIENCY OF D-GLYCERATE KINASE. Human Mutation, Wiley, 2010, 31 (12), pp.1280. 10.1002/humu.21375. hal-00591289 HAL Id: hal-00591289 https://hal.archives-ouvertes.fr/hal-00591289 Submitted on 9 May 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Human Mutation D-GLYCERIC ACIDURIA IS CAUSED BY GENETIC DEFICIENCY OF D-GLYCERATE KINASE For Peer Review Journal: Human Mutation Manuscript ID: humu-2010-0428.R1 Wiley - Manuscript type: Rapid Communication Date Submitted by the 23-Sep-2010 Author: Complete List of Authors: Sass, Jörn Oliver; Universitätsklinikum Freiburg, Zentrum für Kinder- und Jugendmedizin, Labor für Klinische Biochemie und Stoffwechsel Fischer, Kathleen; Universitätsklinikum Freiburg, Zentrum für Kinder- und Jugendmedizin, Labor für Klinische Biochemie und Stoffwechsel Wang, Raymond; Children's Hospital of Orange County, Division of Metabolic Disorders Christensen, Ernst; Rigshospitalet, Juliane Marie Centre, Dept. of Clinical Genetics Scholl-Bürgi, Sabine; Medizinische Universität Innsbruck, Department für Kinder- und Jugendheilkunde, Universitätsklinik für Pädiatrie IV Chang, Richard; Children's Hospital of Orange County, Division of Metabolic Disorders Kapelari, Klaus; Medizinische Universität Innsbruck, Department für Kinder- und Jugendheilkunde, Universitätsklinik für Pädiatrie I Walter, Melanie; Universitätsklinikum Freiburg, Zentrum für Kinder- und Jugendmedizin, Labor für Klinische Biochemie und Stoffwechsel inborn error of metabolism , D-glycerate, serine, fructose, chirality, Key Words: enantiomer John Wiley & Sons, Inc. Page 1 of 26 Human Mutation 1 2 3 4 5 6 7 D-GLYCERIC ACIDURIA IS 8 9 CAUSED BY GENETIC DEFICIENCY OF D-GLYCERATE KINASE 10 11 12 13 14 15 Jörn Oliver Sass 1 , Kathleen Fischer 1 , Raymond Wang 2 , Ernst Christensen 3 , 16 17 4 2 5 1 18 Sabine Scholl-Bürgi , Richard Chang , Klaus Kapelari , Melanie Walter 19 20 For Peer Review 21 22 23 1Labor für Klinische Biochemie & Stoffwechsel, Zentrum für Kinder- und Jugendmedizin, 24 25 2 26 Universitätsklinikum Freiburg, Germany; Division of Metabolic Disorders, Children's 27 28 Hospital of Orange County, Orange, CA, USA; 3Department of Clinical Genetics, Juliane 29 30 4 31 Marie Centre, Rigshospitalet, Copenhagen, Denmark; Universitätsklinik für Pädiatrie IV, 32 33 Department für Kinder- und Jugendheilkunde, Medizinische Universität Innsbruck, Austria; 34 35 5Universitätsklinik für Pädiatrie I, Department für Kinder- und Jugendheilkunde, 36 37 38 Medizinische Universität Innsbruck, Austria 39 40 41 42 43 44 45 46 47 48 Address correspondence to: 49 50 51 Prof. Dr. Jörn Oliver Sass, Labor für Klinische Biochemie & Stoffwechsel, Zentrum für 52 53 Kinder- und Jugendmedizin, Universitätsklinikum Freiburg, Mathildenstr. 1, 54 55 D-79106 Freiburg, Germany 56 57 58 Phone: +49-761-270 4371; Fax: +49-761-270 4527; 59 60 e-mail: [email protected] 1 John Wiley & Sons, Inc. Human Mutation Page 2 of 26 1 2 3 Abstract 4 5 6 7 D-glyceric aciduria is a rare inborn error of serine and fructose metabolism that was first 8 9 described in 1974. Most affected individuals have presented with neurological symptoms. The 10 11 12 molecular basis of D-glyceric aciduria is largely unknown; possible causes that have been 13 14 discussed are deficiencies of D-glycerate dehydrogenase, triokinase, and D-glycerate kinase. 15 16 In 1989, van Schaftingen has reported decreased D-glycerate kinase activity in the liver of a 17 18 19 single patient with D-glyceric aciduria. However, this analysis has not been performed in 20 For Peer Review 21 other affected individuals, and the underlying defect has remained unknown on the gene level 22 23 until now. We report three patients with deficiency of D-glycerate kinase. They are of 24 25 26 Serbian, Mexican, and Turkish origin and include the patient initially reported in 1974. All 27 28 had homozygous mutations in exon 5 of the GLYCTK gene encoding D-glycerate kinase: 29 30 31 c.1448delT (p.Phe483SerfsX2), c.1478T>G (p.Phe493Cys) or c.1558delC 32 33 (p.Leu520CysfsX108). Transient overexpression of the variant GLYCTK genes in HEK293 34 35 cells clearly showed loss of enzyme activity and immunoreactivity when compared to the 36 37 38 reference enzyme. Our work has revealed mutations in the GLYCTK gene as the cause of D- 39 40 glycerate kinase deficiency and D-glyceric aciduria and provides a non-invasive approach for 41 42 further diagnostic work-up and research. 43 44 45 46 47 48 49 Key Words: 50 inborn error of metabolism, D-glycerate, serine, fructose, chirality, enantiomer 51 52 53 54 55 56 57 58 59 60 2 John Wiley & Sons, Inc. Page 3 of 26 Human Mutation 1 2 3 Introduction 4 5 6 7 L-glyceric aciduria is a well known indicator for primary hyperoxaluria type II (MIM ID 8 9 260000), a disease which may lead to urolithiasis and nephrocalcinosis due the low solubility 10 11 12 of calcium oxalate. This is a clinically well defined and biochemically well understood inborn 13 14 error of metabolism, caused by mutations in the GRHPR gene, which result in deficiency of 15 16 glyoxylate reductase/hydroxypyruvate reductase (D-glyceric acid dehydrogenase; EC 17 18 19 1.1.1.26) (Cramer et al., 1999). 20 For Peer Review 21 22 23 In contrast, the clinical presentation of patients with D-glyceric aciduria (MIM ID 220120) is 24 25 26 rather heterogeneous. D-glyceric acid originates from serine catabolism and – to a minor 27 28 extent – from fructose metabolism. Up to now, only 10 children with D-glyceric aciduria have 29 30 31 been described in the literature (Table 1). Their clinical phenotypes range from an 32 33 encephalopathic presentation leading to death at 2.5 months of age, chronic metabolic 34 35 acidosis, seizures and severe mental retardation, microcephaly and speech delay to apparently 36 37 38 healthy siblings. Three more cases have been mentioned, but not been characterized except 39 40 for the report of D-glyceric acid identification in their urine (Rashed et al., 2002). Since 41 42 extraction of glyceric acid is often not effective in routine determinations of urinary organic 43 44 45 acids (Wadman et al., 1976, and own observations), it may well be that D-glyceric aciduria is 46 47 considerably underdiagnosed. 48 49 50 51 In the past, three different metabolic defects have been considered possible causes of D- 52 53 glyceric aciduria. Deficiency of D-glyceric acid dehydrogenase as has been suggested early 54 55 (Kølvraa et al. 1976). However, this hypothesis can be rejected today, not only, because this 56 57 58 enzyme deficiency is known to result in primary hyperoxaluria type 2 with accumulation of 59 60 the L-enantiomer of glyceric acid and not of the D-form, but also because the leukocyte enzyme activities reported by Kølvraa et al. 1976 for a patient with D-glyceric aciduria are 3 John Wiley & Sons, Inc. Human Mutation Page 4 of 26 1 2 3 too similar to the control values to suggest deficiency of D-glyceric acid dehydrogenase if 4 5 6 compared to other reports (Williams & Smith, 1968; Chalmers et al., 1984). 7 8 9 In a patient with normal erythrocyte triokinase (EC 2.7.1.28) activity, hepatic triokinase 10 11 12 deficiency has been suggested as an underlying cause of D-glyceric aciduria, because oral 13 14 loading with fructose or dihydroxyacetone yielded a major increase in the excretion of D- 15 16 glycerate, while administration of 200mg L-serine/ kg body weight did not (Duran et al., 17 18 19 1987). However, van Schaftingen (1989) has noted on this case that triokinase deficiency 20 For Peer Review 21 would not explain the excretion of D-glycerate on a fructose-free regimen. Bonham et al. 22 23 (1990) explained that a higher dose of L-serine may have been necessary in the patient of 24 25 26 Duran et al. (1987) in order to get plasma L-serine levels high enough to raise excretion of D- 27 28 glycerate. This implies impaired catabolism of serine in the patient – as well as in other 29 30 31 individuals with D-glyceric aciduria – thus advocating against hepatic triokinase deficiency as 32 33 an underlying cause. 34 35 36 Since it is understood that in the human D-glycerate can only be metabolized to D-2- 37 38 39 phosphoglycerate (Snell 1986), it is reasonable to suspect D-glycerate kinase (EC 2.7.1.31) as 40 41 the deficient enzyme. While liver activities of D-glycerate dehydrogenase and triokinase were 42 43 44 normal, van Schaftingen (1989) demonstrated deficiency of hepatic D-glycerate kinase in a 45 46 patient with D-glyceric aciduria described by Fontaine et al., 1989, and Largillière et al., 47 48 1991. However, confirmation of that finding in other individuals with D-glyceric aciduria was 49 50 51 never reported. Possibly, this can be explained by the need for liver tissue for the enzyme 52 53 assay, and by the fact that the latter is complicated by the low stability of the hepatic enzyme.
Load more

Recommended publications
  • Monosaccharides and Their Derivatives in Carbonaceous Meteorites: a Scenario for Their Synthesis and Onset of Enantiomeric Excesses
    life Review Monosaccharides and Their Derivatives in Carbonaceous Meteorites: A Scenario for Their Synthesis and Onset of Enantiomeric Excesses George Cooper 1,*, Andro C. Rios 1,2,* and Michel Nuevo 1,3 ID 1 NASA-Ames Research Center, Moffett Field, CA 94035, USA; [email protected] 2 Blue Marble Space, 1001 4th Ave, Ste 3201, Seattle, WA 98154, USA 3 Bay Area Environmental Research Institute, NASA Research Park, Moffett Field, CA 94035, USA * Correspondence: [email protected] (G.C.); [email protected] (A.C.R.) Received: 5 June 2018; Accepted: 22 August 2018; Published: 27 August 2018 Abstract: Carbonaceous meteorites provide the best glimpse into the solar system’s earliest physical and chemical processes. These ancient objects, ~4.56 billion years old, contain evidence of phenomena ranging from solar system formation to the synthesis of organic compounds by aqueous and (likely) low-temperature photolytic reactions. Collectively, chemical reactions resulted in an insoluble kerogen-like carbon phase and a complex mixture of discrete soluble compounds including amino acids, nucleobases, and monosaccharide (or “sugar”) derivatives. This review presents the documented search for sugars and their derivatives in carbonaceous meteorites. We examine early papers, published in the early 1960s, and note the analytical methods used for meteorite analysis as well as conclusions on the results. We then present the recent finding of sugar derivatives including sugar alcohols and several sugar acids: The latter compounds were found to possess unusual “D” enantiomeric (mirror-image) excesses. After discussions on the possible roles of interstellar grain chemistry and meteorite parent body aqueous activity in the synthesis of sugar derivatives, we present a scenario that suggests that most of Earth’s extraterrestrial sugar alcohols (e.g., glycerol) were synthesized by interstellar irradiation and/or cold grain chemistry and that the early solar disk was the location of the initial enantiomeric excesses in meteoritic sugar derivatives.
    [Show full text]
  • Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1
    [CANCER RESEARCH 34, 1439-1446, June 1974] Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1 Francis A. Farina,2 Jennie B. Shatton, Harold P. Morris, and Sidney Weinhouse The Fels Research Institute and the Department of Biochemistry, Temple University School oj Medicine, Philadelphia. Pennsylvania IV140 (F. A. F., J. B. S.. S. W.\, and the Department of Biochemistry. Howard University School of Medicine. Washington. D. C. 20001 [H. P. M .\ SUMMARY 23, 32, 41, 57). These alterations involve the replacement of those isozymes that are under dietary and hormonal control Pyruvate kinase (PK) (EC 2.7.1.40) isozymes were assayed by the host, and that have important metabolic functions in in normal rat liver and a series of transplantable rat the adult differentiated liver by other isozymes which are hepatomas ranging widely in growth rate and degree of normally either low in, or absent from, the adult tissue. As differentiation, with the use of gradient elution by chloride part of an ongoing study of this phenomenon, we have ion from columns of DEAE-cellulose. In agreement with examined the alteration of PK3 (EC 2.7.1.40) isozymes in other studies, three noninterconvertible forms were found in the Morris hepatomas (30. 31), a series of chemically rat tissues: isozyme I, the major form in adult rat liver: induced, transplantable rat hepatomas ranging widely in isozyme II, the sole form in heart and skeletal muscle: and growth rate and degree of differentiation. This enzyme isozyme III, the sole form in poorly differentiated hepato occupies a key position in the metabolism of cells and, as we mas, the major form in normal kidney and lung, and the pointed out previously (27, 28.
    [Show full text]
  • Pyruvate Kinase: Function, Regulation and Role in Cancer
    Pyruvate kinase: Function, regulation and role in cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Israelsen, William J., and Matthew G. Vander Heiden. “Pyruvate Kinase: Function, Regulation and Role in Cancer.” Seminars in Cell & Developmental Biology 43 (2015): 43–51. As Published http://dx.doi.org/10.1016/j.semcdb.2015.08.004 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/105833 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptSemin Cell Author Manuscript Dev Biol. Author Author Manuscript manuscript; available in PMC 2016 August 13. Published in final edited form as: Semin Cell Dev Biol. 2015 July ; 43: 43–51. doi:10.1016/j.semcdb.2015.08.004. Pyruvate kinase: function, regulation and role in cancer William J. Israelsena,1,* and Matthew G. Vander Heidena,b,* aKoch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA bDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA Abstract Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate and ADP to pyruvate and ATP in glycolysis and plays a role in regulating cell metabolism. There are four mammalian pyruvate kinase isoforms with unique tissue expression patterns and regulatory properties. The M2 isoform of pyruvate kinase (PKM2) supports anabolic metabolism and is expressed both in cancer and normal tissue. The enzymatic activity of PKM2 is allosterically regulated by both intracellular signaling pathways and metabolites; PKM2 thus integrates signaling and metabolic inputs to modulate glucose metabolism according to the needs of the cell.
    [Show full text]
  • Prevalence of Pyruvate Kinase Deficiency
    P3513 Prevalence of Red Cell Pyruvate Kinase Deficiency: A Systematic Literature Review Mike Storm1, Matthew H Secrest2*, Courtney Carrington2, Deb Casso2, Keely Gilroy1, Leanne Pladson1, Audra N Boscoe1 1Agios Pharmaceuticals Inc., Cambridge, MA, USA; 2IQVIA Epidemiology & Drug Safety, Seattle, WA and Cambridge, MA, USA; *Affiliation at the time research was conducted BACKGROUND METHODS (continued) RESULTS (continued) RESULTS (continued) • Pyruvate Kinase (PK) deficiency is a rare congenital hemolytic anemia Exclusion Criteria The remaining 34 studies were grouped based on methods and study Among these 4 studies, an important distinction was made between studies characterized by diminished activity of the PK enzyme in red blood population (Table 1). reporting diagnosed prevalence (n=3) and overall disease prevalence cells (RBC).1 • Non-human studies; (diagnosed and undiagnosed PK deficiency; n=1). Table 1. Distribution of extracted studies by type of study (n=34) • Low PK enzyme activity can lead to lifelong chronic hemolysis with • Publications that were not the primary report of the data • Two studies estimated diagnosed PK deficiency prevalence as 3.2 per associated symptoms and complications such as anemia, jaundice, (e.g., literature reviews); Type of study Number million4 and 8.5 per million5 by identifying diagnosed PK deficiency cases of studies gallstones, splenectomy and associated thrombosis, iron overload, and • Studies of PK deficiency prevalence/incidence conducted within a source from source populations of known size. liver cirrhosis.2 Population-based prevalence 2 population of patients with symptoms of PK deficiency such as anemia • We estimated the prevalence of diagnosed PK deficiency in a general • PK deficiency is caused by compound heterozygosity or homozygosity for or jaundice; Molecular PKLR screening in a general population 5 population to be 6.5 per million6 using data from another high-quality study 3 one or more of the >300 known mutations to the PKLR gene.
    [Show full text]
  • Promiscuity in the Part-Phosphorylative Entner–Doudoroff Pathway of the Archaeon Sulfolobus Solfataricus
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector FEBS 30191 FEBS Letters 579 (2005) 6865–6869 Promiscuity in the part-phosphorylative Entner–Doudoroff pathway of the archaeon Sulfolobus solfataricus Henry J. Lamblea, Alex Theodossisb, Christine C. Milburnb, Garry L. Taylorb, Steven D. Bullc, David W. Hougha, Michael J. Dansona,* a Centre for Extremophile Research, Department of Biology and Biochemistry, University of Bath, Bath BA2 7AY, UK b Centre for Biomolecular Sciences, University of St. Andrews, North Haugh, St. Andrews, Fife KY16 9ST, UK c Department of Chemistry, University of Bath, Bath BA2 7AY, UK Received 19 September 2005; revised 3 November 2005; accepted 3 November 2005 Available online 1 December 2005 Edited by Stuart Ferguson dation of both glucose and galactose, producing gluconate or Abstract The hyperthermophilic archaeon Sulfolobus solfatari- cus metabolises glucose and galactose by a ÔpromiscuousÕ non- galactonate, respectively [6]. Gluconate dehydratase then phosphorylative variant of the Entner–Doudoroff pathway, in catalyses the dehydration of gluconate to D-2-keto-3-deoxyg- which a series of enzymes have sufficient substrate promiscuity luconate (KDG) and galactonate to D-2-keto-3-deoxygalacto- to permit the metabolism of both sugars. Recently, it has been nate (KDGal) [7]. Both these compounds are cleaved by KDG proposed that the part-phosphorylative Entner–Doudoroff path- aldolase to yield pyruvate and glyceraldehyde [6]. Glyceralde- way occurs in parallel in S. solfataricus as an alternative route hyde dehydrogenase is then thought to oxidise glyceraldehyde for glucose metabolism. In this report we demonstrate, by to glycerate, which is phosphorylated by glycerate kinase to in vitro kinetic studies of D-2-keto-3-deoxygluconate (KDG) ki- give 2-phosphoglycerate.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pyruvate Kinase, Rbc
    Lab Dept: Chemistry Test Name: PYRUVATE KINASE, RBC General Information Lab Order Codes: PYKI Synonyms: Pyruvate Kinase, Erythrocytes CPT Codes: 84220 – Pyruvate kinase Test Includes: Pyruvate kinase RBC level reported in U/g Hb. Logistics Test Indications: Useful for the workup of cases of nonspherocytic hemolytic anemia, for a family workup to determine inheritance pattern (pyruvate kinase deficiency is autosomal recessive), and for genetic counseling. Lab Testing Sections: Chemistry - Sendouts Referred to: Mayo Medical Laboratories (MML Test: PK) Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: Daily, 24 hours Turnaround Time: 1 - 4 days, test set up Monday - Saturday Special Instructions: N/A Specimen Specimen Type: Whole blood Container: Yellow top (ACD- Solution B) tube Alternate tube: Lavender (EDTA) top tube Draw Volume: 6 mL (Minimum: 1 mL) blood Processed Volume: Same as Draw Volume Collection: Routine blood collection Special Processing: Lab Staff: Do Not centrifuge. Send whole blood refrigerated in original collection container. Do Not transfer blood to other containers. Store and ship at refrigerated temperatures. Forward promptly. Patient Preparation: None Sample Rejection: Specimen cannot be frozen; mislabeled or unlabeled specimens; gross hemolysis Interpretive Reference Range: ≥12 months: 6.7 – 14.3 U/g Hb Reference values have not been established for patients <12 months of age. Interpretation: Most hemolytic anemias due to pyruvate kinase (PK) deficiency are associated with activity levels less than 40% of mean normal. However, some patients with clinically significant hemolysis can have normal or only mildly decreased PK enzyme activity, which paradoxically may occur in individuals with most severe symptoms.
    [Show full text]
  • Coupling of Creatine Kinase to Glycolytic Enzymes at the Sarcomeric I-Band of Skeletal Muscle: a Biochemical Study in Situ
    Journal of Muscle Research and Cell Motility 21: 691±703, 2000. 691 Ó 2000 Kluwer Academic Publishers. Printed in the Netherlands. Coupling of creatine kinase to glycolytic enzymes at the sarcomeric I-band of skeletal muscle: a biochemical study in situ THERESIA KRAFT2,*, T. HORNEMANN1, M. STOLZ1,à, V. NIER2, and T. WALLIMANN1 1Swiss Federal Institute of Technology, Institute of Cell Biology, ETH ZuÈrich, HoÈnggerberg, CH-8093 ZuÈrich, Switzerland; 2Medizinische Hochschule Hannover, Molekular- und Zellphysiologie, D-30625 Hannover, Germany Received 29 September 2000; accepted in revised form 3 October 2000 Abstract The speci®c interaction of muscle type creatine-kinase (MM-CK) with the myo®brillar M-line was demonstrated by exchanging endogenous MM-CK with an excess of ¯uorescently labeled MM-CK in situ, using chemically skinned skeletal muscle ®bers and confocal microscopy. No binding of labeled MM-CK was noticed at the I-band of skinned ®bers, where the enzyme is additionally located in vivo, as shown earlier by immuno¯uorescence staining of cryosections of intact muscle. However, when rhodamine-labeled MM-CK was diused into skinned ®bers that had been preincubated with phosphofructokinase (PFK), a glycolytic enzyme known to bind to actin, a striking in vivo- like interaction of Rh-MM-CK with the I-band was found, presumably mediated by binding of Rh-MM-CK to the glycolytic enzyme. Aldolase, another actin-binding glycolytic enzyme was also able to bind Rh-MM-CK to the I- band, but formation of the complex occurred preferably at long sarcomere length (>3.0 lm). Neither pyruvate kinase, although known for its binding to actin, nor phosphoglycerate kinase (PGK), not directly interacting with the I-band itself, did mediate I-band targeting of MM-CK.
    [Show full text]
  • Prefoldin-Like Bud27 Influences the Transcription of Ribosomal Components and Ribosome Biogenesis in Saccharomyces Cerevisiae
    Downloaded from rnajournal.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press Prefoldin-like Bud27 influences the transcription of ribosomal components and ribosome biogenesis in Saccharomyces cerevisiae VERÓNICA MARTÍNEZ-FERNÁNDEZ,1,7,8 ABEL CUEVAS-BERMÚDEZ,1,8 FRANCISCO GUTIÉRREZ-SANTIAGO,1,8 ANA I. GARRIDO-GODINO,1 OLGA RODRÍGUEZ-GALÁN,2,3 ANTONIO JORDÁN-PLA,4 SERGIO LOIS,5 JUAN C. TRIVIÑO,5 JESÚS DE LA CRUZ,2,3 and FRANCISCO NAVARRO1,6 1Departamento de Biología Experimental-Genética, Universidad de Jaén, Paraje de las Lagunillas, s/n, E-23071, Jaén, Spain 2Instituto de Biomedicina de Sevilla (IBiS), Hospital Universitario Virgen del Rocío/CSIC/Universidad de Sevilla, E-41013 Seville, Spain 3Departamento de Genética, Universidad de Sevilla, E-41012 Seville, Spain 4ERI Biotecmed, Facultad de Biológicas, Universitat de València, E-46100 Burjassot, Valencia, Spain 5Sistemas Genómicos. Ronda de Guglielmo Marconi, 6, 46980 Paterna, Valencia, Spain 6Centro de Estudios Avanzados en Aceite de Oliva y Olivar, Universidad de Jaén, Paraje de las Lagunillas, s/n, E-23071, Jaén, Spain ABSTRACT Understanding the functional connection that occurs for the three nuclear RNA polymerases to synthesize ribosome com- ponents during the ribosome biogenesis process has been the focal point of extensive research. To preserve correct ho- meostasis on the production of ribosomal components, cells might require the existence of proteins that target a common subunit of these RNA polymerases to impact their respective activities. This work describes how the yeast prefoldin-like Bud27 protein, which physically interacts with the Rpb5 common subunit of the three RNA polymerases, is able to mod- ulate the transcription mediated by the RNA polymerase I, likely by influencing transcription elongation, the transcription of the RNA polymerase III, and the processing of ribosomal RNA.
    [Show full text]
  • Supplementary Information
    Supplementary information (a) (b) Figure S1. Resistant (a) and sensitive (b) gene scores plotted against subsystems involved in cell regulation. The small circles represent the individual hits and the large circles represent the mean of each subsystem. Each individual score signifies the mean of 12 trials – three biological and four technical. The p-value was calculated as a two-tailed t-test and significance was determined using the Benjamini-Hochberg procedure; false discovery rate was selected to be 0.1. Plots constructed using Pathway Tools, Omics Dashboard. Figure S2. Connectivity map displaying the predicted functional associations between the silver-resistant gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S3. Connectivity map displaying the predicted functional associations between the silver-sensitive gene hits; disconnected gene hits not shown. The thicknesses of the lines indicate the degree of confidence prediction for the given interaction, based on fusion, co-occurrence, experimental and co-expression data. Figure produced using STRING (version 10.5) and a medium confidence score (approximate probability) of 0.4. Figure S4. Metabolic overview of the pathways in Escherichia coli. The pathways involved in silver-resistance are coloured according to respective normalized score. Each individual score represents the mean of 12 trials – three biological and four technical. Amino acid – upward pointing triangle, carbohydrate – square, proteins – diamond, purines – vertical ellipse, cofactor – downward pointing triangle, tRNA – tee, and other – circle.
    [Show full text]
  • Purification of 3-Phosphoglycerate Kinase from Diverse Sources by Affinity Elution Chromatography by THEODORA FIFIS and ROBERT K
    Biochem. J. (1978) 175, 311-319 311 Printed in Great Britain Purification of 3-Phosphoglycerate Kinase from Diverse Sources by Affinity Elution Chromatography By THEODORA FIFIS and ROBERT K. SCOPES Department ofBiochemistry, La Trobe University, Bundoora, Victoria 3083, Australia (Received 8 March 1978) 1. Affinity elution chromatography was used to purify phosphoglycerate kinase from a variety of sources. The choice of buffer pH for the chromatography was made according to the relative electrophoretic mobility of the enzyme from the species concerned. 2. Outlines of the methods used to isolate the enzyme from over 20 sources are presented. The enzyme was purified from the muscle tissue of a variety of mammals, fish and birds, from liver of several animals, from yeast, Escherichia coli, and plant leaves. The more acidic varieties of the enzymes were purified by conventional gradient elution from ion-exchangers as affinity elution procedures were not applicable. 3. The structural and kinetic parameters investigated show that phosphoglycerate kinase is evolutionarily a highly conservative enzyme; there were few differences in properties regardless of source or function (glycolytic, gluconeogenic or photosynthetic). 4. A detailed comparison of the enzyme preparations purified from bovine muscle and bovine liver failed to detect any significant differences between them; the evidence indicates that they are genetically identical. Phosphoglycerate kinase (ATP-3-phospho-D- varies between the enzyme from one species and glycerate 1-phosphotransferase,
    [Show full text]
  • Photosynthetic Productivity: Can Plants Do Better?
    3 Photosynthetic Productivity: Can Plants do Better? John B. Skillman1, Kevin L. Griffin2, Sonya Earll1 and Mitsuru Kusama1 1Department of Biology, California State University, San Bernardino, California 2Lamont-Doherty Earth Observatory, Columbia University, New York, New York USA 1. Introduction By the time you finish this paragraph you will be a changed person. Change, of course, takes a variety of forms, from eroding mountains and melting snowflakes to the major changes we experience in our own lives - birth, growth, reproduction, and death. Less tangible, but changes nonetheless, are the small shifts in perspective that occur as we go through our days - new ideas, new feelings, and new understandings. But, as the Second Law of Thermodynamics reminds us, these varied and seemingly unrelated expressions of change do, in fact have a common source. All change arises from the decay of order - an increase in entropy. Sometimes the increased disarray that defines change is obvious, as when a crystalline cube of ice turns into a higgledy-piggledy puddle of water. Other times, the increased disorder is less obvious. Indeed, in living systems, change often seems to be associated with an increase in order. The gradual recovery of a lush and materially diverse living forest in the years following a catastrophic fire would seem to represent a net increase in order. The sequential nature of biological development, from zygote to adult, or from acorn to ancient oak, would seem to represent a net increase in order. The regulated changes in neuronal connectivity and brain architecture that occurs as the mind grasps new insights would seem to represent a net increase in order.
    [Show full text]