sign in sign up
<<
Home , Araeococcus, Brewcaria, Brocchinia, Bromeliaceae, Bromelioideae, Catopsis

AmericanJournal of 84(5): 664-670. 1997.

EXAMINATION OF SUBFAMILIAL PHYLOGENY IN USING COMPARATIVE SEQUENCING OF THE PLASTID LOCUS NDHFI

RANDALL G. TERRY,2'4 GREGORY K. BROWN,2'5 AND RICHARD G. OLMSTEAD3,6

2 Departmentof Botany,University of Wyoming,Laramie, Wyoming82071; and 3Department of Environmental,Population, and OrganismicBiology, Universityof Colorado, Boulder,Colorado 80309

Parsimonyanalysis of 31 sequences of the chloroplastlocus ndhF was used to address questionsof subfamilialphylogeny in Bromeliaceae. Results presentedhere are congruentwith those fromchloroplast DNA restrictionsite analysis in recog- nizing a clade containingBromelioideae and ,and in resolvingTillandsioideae near the base of the family. Placements of several taxonomicallydifficult genera (e.g., Glomeropitcairniaand ) corroboratethose of traditional treatments;however, these data suggestthat (Pitcairnioideae)is the sistergroup to theremainder of Bromeliaceae. Furtherevidence for the paraphylyof Pitcairnioideaeincludes the resolutionof as the sistergroup to . Implicationsfor taxonomicrealignment at the subfamilylevel are considered.

Key words: Bromeliaceae; molecular systematics;ndhF; phylogeny.

Bromeliaceae are largelya neotropicalassemblage ex- the subject of much speculation and contention(Schim- hibitingnotable morphological,physiological, and eco- per, 1888; Mez, 1904; Tietze, 1906; Pittendrigh,1948; logical variability(Pittendrigh, 1948; Tomlinson, 1969; Tomlinson, 1969; Benzing, Givnish, and Bermudes, Benzing and Renfrow, 1974; Smith and Downs, 1974, 1985; Smith,1989). Only recentlyhave cladisticanalyses 1977, 1979; Benzing, 1980; Smith, 1989; Martin,1994). of both morphologicaland molecular data been used to Selection for water and nutrientprocurement apparently address relationshipsamong the primarylines of Bro- has been an importantimpetus for evolutionin the fam- meliaceae. Gilmartinand Brown (1987) used parsimony ily, and the independentorigin and convergentevolution analysis of morphologicalcharacters to conclude thatpit- of featuresassociated with adaptationto extremeenvi- cairnioidsare in the family,a contentionweakened ronmentsare recognized componentsof the evolutionary by data matrixerrors and the singularuse of Velloziaceae historyof the group(Pittendrigh, 1948; Tomlinson,1969; as an outgroup (Simpson, 1988). Using restrictionsite Medina, 1974; Benzing, Givnish, and Bermudes, 1985). variation in chloroplast DNA (cpDNA), Ranker et al. Previous assessmentsof relationshipsin the familyusing (1990) providedevidence supportingthree assertions: (1) traditionalcharacters (i.e., morphologicaland ecological) sensu stricto(excluding Glomeropitcair- have been confoundedby high levels of homoplasy(Var- nia) is basal in the family; (2) Bromelioideae and Pit- adarajan and Gilmartin,1988a). Consequently,whereas cairnioideae are sister taxa, although the lattermay be the monophylyof the family and its taxonomic cohe- paraphyletic;and (3) Glomeropitcairniais phylogeneti- siveness have been stronglymaintained, considerable un- cally distinctfrom the remainderof Tillandsioideae and certaintyexists regardingintrafamilial relationships. may warrantrecognition as a subfamily.Sampling in the Phylogeneticrelationships among the three tradition- studyby Ranker et al. (1990) was limited (i.e., 11 taxa ally recognized bromeliad subfamilies,Tillandsioideae, and 18 restrictionsite mutations),and conclusions were Bromelioideae, and Pitcairnioideae (Mez, 1935; Smith, restrictedto subfamilyrelationships. Parsimony analysis 1955; Smith and Downs 1974, 1977, 1979) have been of rbcL sequences (Clark and Clegg, 1990) is in agree- mentwith the findingsof Gilmartinand Brown (1987) in I Manuscriptreceived 25 July 1995; revision accepted 11 October 1996. placing Pitcairnioideaenear the base of the family.How- The authorsthank Harry Luther,Director of the Bromeliad Identifi- ever, a notable feature of the rbcL study (Clark and cation Center,Marie Selby Botanical Gardens,Sarasota, forpro- Clegg, 1990) is the instabilityof the data withrespect to vidingaccess to theresearch collections; Elton Leme, InstitutoBoavista, resolutionof subfamilyrelationships (i.e., maximum-like- Rio de Janeirofor providingmaterial of and ; lihood analyses of all data and of thirdcodon positions Carlos Palaci forsupplying material of ; Tom Givnish and Ken alone supportBromelioideae and Tillandsioideae,respec- Sytsma,University of Wisconsin,Madison forGlomeropitcairnia DNA and outgroupsequences; and to David Benzing, W Dennis Clark, Dan tively,as basal in Bromeliaceae). Lastly, cpDNA restric- Crawford,Dean Jordan,and William K. Smith for criticallyreviewing tion site variationstudies by Givnish,Sytsma, and Smith the manuscript.This researchwas supportedby a grantfrom the Bro- (1990), and Givnish et al. (1992) resolve Pitcairnioideae meliad Society, Inc. to RGT, and NSF grantsDEB 9108268 to GKB, and Tillandsioideae as sistertaxa, and place Bromelioi- and BSR 9107827 to RGO. deae basal in the family.The details of these studies re- 4 Present address: Departmentof Environmentaland Resource Sci- main unpublished. ences Universityof Nevada, Reno, NV 89557. 5Author for correspondence. In this study,comparative sequencing of the plastid 6 Presentaddress: Departmentof Botany,University of Washington, locus ndhF is used to examine subfamilyrelationships in Seattle, WA 98195. Bromeliaceae. In addition,the placementsof several tax- 664 May 1997] TERRY ET AL.-BROMELIACEAE NDHF PHYLOGENY 665 onomically difficultgenera (e.g., Brocchinia, Glomero- TABLE 1. Sources of plant materialincluded in this study. , Navia) are examined. ndhF,a locus thatpu- GenBank tativelyencodes a chlororespiratorypeptide, is approxi- accession matelytwice as variable and over 50% longerthan rbcL Taxon Voucher no. (Wolfe, 1991; Olmstead, Sweere, and Wolfe, 1993; Olm- stead and Palmer, 1994; Olmstead and Sweere, 1994). Stegolepis hitchcockiiMaguire Givnish s.n. (WIS) Recent studieshave used ndhF sequences to resolve phy- Bromeliaceae subf. Bromelioideae logenetic relationshipsin dicot (Olmstead and Sweere, haltoniiH.Luther SEL 85-1447 (SEL) L75844 1994; Scotland et al., 1995; Olmstead and Reeves, 1995) ananassoides (Baker) and monocot (Clark, Zhang, and Wendel, 1995; Neyland L.B.Sm. Brown 3129 (RM) L75845 and Urbatsch,1996) families. pectinatusL.B.Sm. SEL 85-231 (SEL) L75846 macrolepis L.B.Sm. SEL 91-6 (SEL) L75858 sp. Brown 3128 (RM) L75860 MATERIALS AND METHODS Canistrumgiganteum (Baker) L.B.Sm. Brown 3183 (RM) L75861 Thirtyspecies representing29 genera,and all bromeliadsubfamilies Cryptanthusbeuckeri E.Morren SEL 89-499 (SEL) L75856 were sampled in the presentstudy. Voucher specimens are indicatedin disjuncta L.B.Sm. SEL 83-393 (SEL) L75906 Table 1. The fractionof genera sampled per subfamilyare 15/29(Bro- alvimii (L.B.Sm. & R.WRead) R.WRead SEL 90-297 (SEL) L75907 melioideae), 8/15 (Pitcairnioideae), and 6/6 (Tillandsioideae). Within pineliana var.pineli- the constraintsof tissue availability,genera were selected thatrepresent ana (Lemaire) L.B.Sm. SEL 86-261 (SEL) L75893 the taxonomic, morphological,and ecological variabilitywithin bro- Nidulariumselloanum (Baker) meliad subfamilies.All Bromeliaceae ndhF sequences used in thisstudy Pereira Leme 1830 (HB) L75894 have been submittedto GenBank (Table 1). Orthophytumgurkedii Hutchin- Primersfor amplificationand sequencing of ndhF (Fig. 1) were de- son SEL 88-268 (SEL) L75900 signed for this study following a comparison of published sequences marmorata(Lemaire) fromNicotiana (Solanaceae), Oryza (Poaceae), and Barleria (Acantha- R.WRead SEL 83-68 (SEL) L75896 ceae), as well as partialsequences fromBromeliaceae ( vittata, Ronnbergiapetersii L.B.Sm. SEL 78-907 (SEL) L75897 Wittrockialeucophoea (Baker) utriculata, spectabilis, and Ronnbergiapetersii). Leme Leme 987 (HB) L75895 InitialndhF sequences forBromeliaceae were obtainedin a preliminary studyusing primerspublished in Olmstead and Sweere (1994). Most Bromeliaceae subf. Pitcairnioideae genomic DNAs were isolated using the method of Doyle and Doyle Brocchinia acuminata L.B.Sm. SEL 81-1937 (SEL) L75859 (1987), althoughextremely mucilaginous tissues were extractedusing sp. Brown 3131 (RM) L75857 an organic step-gradientprocedure (R. Wallace, Iowa State University, Encholirionsp. SEL 84-364 (SEL) L75862 personal communication).Extracted DNAs were amplifiedfor ndhF in penduliflora (C.H.Wright)L.B.Sm. SEL 69-1976-12 (SEL) L75863 a two-stepprotocol using the polymerasechain reaction(PCR; Mullis Navia splendensL.B.Sm. SEL 83-288 (SEL) L75892 et al., 1986). The firststep involved symmetricamplification (Erlich, hirtziiH.Luther SEL 93-294 (SEL) L75901 1989; Innis et al., 1990) of the locus in two overlappingfragments. The Pitcairnia carinata Mez Brown 3173 (RM) L75902 5' and 3' fragmentsof the gene were amplifiedusing primerpairs 032F- Puya aequatorialis Andr6 SEL 93-211 (SEL) L75903 1101R and 745F-2110R, respectively(Fig. 1). Bromeliaceae subf. Tillandsioideae Single-strandedsequencing templateswere generatedby asymmetric Catopsis montanaL.B.Sm. SEL 91-3 (SEL) L75854 amplification(Kaltenboeck et al., 1992) of double-strandedPCR prod- Catopsis wangeriniiMez & uct as template,and sequenced using the dideoxy method of Sanger, Werckle ex Mez Palacf 1235 (RM) L75855 Nicklen, and Coulson (1977). Glomeropitcairniapenduliflora Sequences were aligned by eye and analyzed using PAUP, version (Griseb.) Mez Givnish s.n. (WIS) L75864 3.1.1 (Swofford,1993). Nucleotide positions37-2109 were included in (L.) Rus- phylogeneticanalyses, although the actual number of positions se- by ex Mez SEL 82-225 (SEL) L75865 quenced withinthis region varied among taxa. Searches for most par- pleiosticha (Gri- simonious trees,decay analyses, and bootstrappingwere all conducted seb.) Utley & H.Luther SEL 81-1986 (SEL) L75891 Benth. SEL 79-0519 (SEL) L75899 using the HEURISTIC search option and the TBR (tree bisection-re- Vriesea malzinei E.Morren SEL 78-757 (SEL) L75915 connection)swapping algorithm with ACCTRAN (acceleratedtransfor- mation optimization)in effect.All trees were rooted with the ndhF sequence of Stegolepis hitchcockii(Rapateaceae; see Clark et al., 1993; Duvall et al., 1993). The effectof alternativegroupings on tree length es were conductedusing the HEURISTIC option in PAUP (Swofford, was examined using the CONSTRAIN TREES option (Swofford, 1993). 1993). Searches for islands of most parsimonious trees (Maddison, 1991) were conductedby proceedingthrough 500 replicatesof random RESULTS orderentry stepwise additionof taxa, saving all optimaltrees. All trees up to four steps longer than optimal were saved in the decay analysis, ThirtyndhF sequences from Bromeliaceae were in- and 100 replicatesof bootstrappingwere performed. cluded in this study.An average of 97.5% (?3.3% SD) Topologies resultingfrom ndhF sequences and restrictionsite data of the 2079 nucleotides were sequenced for at least one were compared by includingrepresentatives of only those genera ex- strand,71.9% (?8.9% SD) of which were confirmedby amined by Ranker et al. (1990) in the ndhF matrix(with the exception sequencing the complementarystrand. Intergenericdi- of Encholirion,which replaced the closely related ; the vergencevalues forndhF sequences withinBromeliaceae truncatedmatrix is hereafterdesignated DELMAT). Analyses of DEL- are among the lowest reportedfrom any group of flow- MAT, rooted with Stegolepis, were performedto assess the effectof ering , ranging from 0.1 to 0.7% in 61 pairwise differentoutgroups on the resultingtopologies. All comparativesearch- comparisons,and being ?0.3%H in five pairwise compar- 666 AMERICAN JOURNALOF BOTANY [Vol. 84

32 274 451 745 1101 1318 1600 1927 5' 3' 274R 451R 745R 1101R 1318R 1600R 1927R 2110R 100 bp

Forward Reverse

32 -- TACCTTTTCTTCCACTTCCAGTT *211 OR -- CCCCCTATATATTTGATACCTTCTCC *274 -- CTTACTTCTATTATGTCAATACTAA 1 9 27 R -- CACATTTTTTATTCGGTCCACAAG 451 -- TGGGAACTTGTGGGAATGTG *1 600 R -- CATAGTATTGTCCGATTCGTGAGG 745 -- TGGTTACCTGATGCTATGGAAGG *1 31 8R -- GAAACATATAAAATGCGGTTAATCC 1101 -- GGAACCTATTGTTGGATATTCACC 1 1 01 R -- GGTGAATATCCAACAATAGGTTCC * 1 318 -- GGATTAACCGCATTTTATATGTTTC 745 R -- CCTTCCATAGCATCAGGTAACCA *1 600 -- CCTCACGAATCGGACAATACTATG 451R -- CACATTCCCACAAGTTCCCA 1927 -- CTTGTGGACCGAATAAAAAATGTG *27 4R-- TTAGTATTGACATAATAGAAGTAAG Fig. 1. Map of the chloroplastgene ndhF fromVriesea espinosae (Bromeliaceae) with the relativeposition of primingsites indicated.Coding strand(forward) and complementary(reverse) primersare given above and below the line, respectively.Numbers indicate the 5'-most positionof the primerrelative to start(position 1 on the coding strand) in tobacco. Primer sequences are shown. Asterisksindicate modifiedversions of previouslypublished primersequences (Olmstead and Sweere, 1994). isons. The maximum divergence within Bromeliaceae 2110. Of the 308 variable positions,71 (23%) are infor- was 2.5% (Billbergia macrolepis vs. Vriesea malzenii; mative. and Orthophytumgurkedii vs. Tillandsia complanata), Phylogeneticanalysis of ndhF sequences produced 120 while a divergence of 8.1 % was observed between the most-parsimonioustrees of 406 steps having a consisten- outgroupand Araeococcus pectinatus.Variable positions cy index (CI) of 0.58 (excluding autapomorphies)and a are most frequentin the 3' half of the gene, with55% of retentionindex (RI) of 0.78. Random orderentry search- all variable sites occurringbetween positions 1250 and es indicated a single island of most parsimonioustrees. Figures 2 and 3 presentstrict and majority-ruleconsensus trees,respectively. Brocchinia ] Brocchinia Several branchesin thendhF treeare supportedby low 98 Dyckia 69 bootstrapvalues and few characterstate changes. Branch- Encholirion es delimitingTillandsioideae, Pitcairnioideae sensu stric- 42 Fosterella f55 TPepenia Pit s.s. to (definedhere as excluding Brocchinia; i.e., including Pitcairnia Dyckia, Encholirion,Fosterella, Pepinia, Pitcairnia, and Navia Navia), and Pitcairnioideaesensu strictoplus Bromelioi- Puya ] Puya deae and Puya all have bootstrapvalues <70% and are Aechmea 67 supportedby three,one, and two characterstate trans- 2 HohenbHohenbergia formations,respectively. Tillandsioideae and Pitcairnioi- 1 r Araeococcus deae sensu strictoare unresolvedin the strictconsensus 46 Quesnelia of all trees up to one step longer than the most parsi- 8 / 3 Lymania monious, and resolutionof Pitcairnioideaesensu stricto >4 ~~~~~~Billbergia plus Bromelioideae and Puya is lost at two steps longer Canist rum Bro in decay analyses. However, the branch supportingBro- 73 - Neoregalia meliaceae sensu stricto(defined as all bromeliadsinclud- 3 I - ~ ~ 0Nidulariurn ed in the analysis excludingBrocchinia), while having a >2Wit trockia comparativelylow bootstrapvalue (74%), is maintained 7 2 Ananas 1 by eight characterstate transformationsand is resolved in the strictconsensus of all treesup to foursteps longer Bromelia than the most parsimonious.Other clades stronglysup- 96 _ Catopsis montana ported by bootstrappingand decay analysis include: (1) >4 Catopsis wawranea Catopsis; (2) Mezobromelia plus Tillandsia, Vriesea, and 6 4 G1lomeropi tcai rni a Guzmania; and (3) Puya plus Bromelioideae. Bootstrap 81 Guzmania Til values for these groups are 96%, 100%, and 87%, re- 1 86 Tillandsia 100( _ 2 Vri esea spectively,and each is presentin the strictconsensus of ,4 Mezobromelia all trees up to four steps longer than the most parsimo- Stegolepis ] Rapat nious. Results frombootstrap and decay analyses (Fig. 2) in- Fig. 2. Strictconsensus of 120 most-parsimonioustrees of 406 steps dicate supportfor inclusion of Catopsis and Glomeropit- (CI = 0.58; RI = 0.78). Numbers above the internodesare bootstrap values. Numbers below the internodesare decay values at which the cairnia in Tillandsioideae. Placementof each as the sister node collapses. Bro, Bromelioideae; Til, Tillandsioideae. Pit. s.s., Pit- group to Bromeliaceae sensu strictoresulted in an in- cairnioideae sensu stricto;Rapat, Rapateaceae. crease in tree lengthof one and two steps, respectively, May 1997] TERRY ET AL.-BROMELIACEAE NDHF PHYLOGENY 667

Brocchinia ] Brocchinia putativeprimitiveness of this subfamily,and suggests a DDyckia more distantrelationship with either Tillandsioideae or 4 Encholirion Bromelioideae. Despite the apparentassociation of Til- 14 Fosterella landsioideae and Bromelioideae when consideredfrom an 1 , Pepenia Pit s.s. 8 Pitcairnia ecological perspective,few of the molecular studies ad- 1 3 dressing subfamilyphylogeny in Bromeliaceae substan- 8 Navia J 14 Puya ] Puya tiatethis relationship (Givnish, Sytsma, and Smith,1990; Ranker et al., 1990; Givnish et al., 1992). Phylogenetic 124 _ 2 Q Aechmea 224 0 Hohenbergia reconstructionbased on ndhF sequences integratestra- 1 Ronnbergia ditional and molecular perspectives of subfamilyrela- Araeococcus a core com- 2 1 2LQuesnelia tionshipsin Bromeliaceae in two ways. First, ponentof Pitcairnioideae(i.e., Navia, Pitcairnia,Pepinia, 1 Billbergia 7 1 Canist rum Fosterella, Encholirion, and Dyckia) is resolved as the 2 Neoregalia Bro sistergroup to the clade containingPuya and Bromelioi- deae (Fig. 2). This findingis largelyconsistent with that 2 Nidulari.um Wit trockia 8 . 1 3 resultingfrom restriction site analysis of the chloroplast 4 6 Lymania genome (Ranker et al., 1990; see below). Second, the 9Ananas resolutionof Brocchinia at the base of the family cor- 3 4 Cryptanthus roboratesthe contentionthat Bromeliaceae is ancestrally 1 14 Orthophytum pitcairnioid-likewith respect to morphologyand ecolog- Bromelia 14 withas- montana ical preference(Fig. 2). This resultis consistent 1 Catopsis sertionsthat epiphyticlines in Bromeliaceae may have 17 wawranea Catopsis arisen independentlyfrom an ancestral stock that was 3 13 _Guzmania Til morphologicallyand ecologically comparable to extant 3 1 Tillandsia Pitcairnioideae(Benzing, Givnish, and Bermudes, 1985; Vriesea 6 9] Smith, 1989). Character state reconstructionsfor 2 Mezobromelia a position,fruit type, carbon metabolism,and growthhabit Stegolepis ] Rapat indicate that the ancestral state for these charactersin Fig. 3. The majority-ruleconsensus tree of the 120 most-parsimo- Bromeliaceae is the same as the condition typifiedby nious trees. The numberof supportingcharacter state transformations most pitcairnioids(R. Terry and G. K. Brown, unpub- inferredfrom ACCTRAN optimizationis given below the internode. lished data). Furthermore,the common ancestryof Til- Pit. s.s., Pitcairnioideaesensu stricto;Bro, Bromelioideae; Til, Tilland- landsioideae and Bromelioideae is not supportedby sioideae; Rapat, Rapateaceae. morphology,ovary position,or fruittype data. Although Bromelioideae appear exclusively or largely monomor- while placementof Glomeropitcairniaat the base of Pit- phic for a numberof unique features(e.g., inferiorova- cairnioideae sensu strictoincreased tree length by six ries, CAM metabolism,and baccate fruits;see Smithand steps. RestrictingTillandsioideae to a sistergroup rela- Downs, 1979), polymorphismin Puya in ovary position tionshipwith eitherPitcairnioideae sensu strictoor Bro- (superior to partlyinferior) and carbon metabolism (C3 melioideae plus Puya resultedin lengthincreases of two and CAM) suggest a possible Pitcairnioideae-Bromelioi- steps in each case. Otheralternative placements and their deae linkage. increase of tree length include: (1) restrictionof Puya The resultspresented here are mostlyconsistent with that aequatorialis to a basal positionin Pitcairnioideae(seven the conclusions from Ranker et al. (1990), except steps); (2) placement of Navia splendens as the sister analysis of ndhF sequences does not supportGlomero- group to Bromeliaceae sensu strictoand to Bromeliaceae pitcairnia as a lineage distinctfrom Tillandsioideae. To- (threeand ten steps,respectively); (3) restrictionof Broc- pological incongruencebetween these two studiesappar- is chinia to a basal positionin eitherTillandsioideae or Pit- entlyresults, in part,from sampling differences.This cairnioideae (seven steps in each case). suggestedby phylogeneticanalyses of DELMAT, the re- sults of which are consistentwith those of the restriction DISCUSSION site study in identifyingthree primarylineages in Bro- meliaceae (i.e., Glomeropitcairnia,Tillandsioideae sensu Implicit in taxonomic treatmentsof Bromeliaceae is stricto,and Pitcairnioideae plus Bromelioideae; results the close relationshipof the two most ecologically com- not shown). Moreover, analysis of DELMAT including plex subfamilies, Tillandsioideae and Bromelioideae Brocchinia resolves Brocchinia as basal in thefamily and (Smith, 1955; Hutchinson, 1973; Smith and Downs, repositionsGlomeropitcairnia in Tillandsioideae. Incon- 1974, 1977, 1979). Both are largely epiphytic,and pos- gruencein the ndhF and restrictionsite treesis probably sess a host of morphologicaland physiologicalattributes not attributableto differencesin outgroupchoice between associated with these life forms(e.g., reduced root sys- the studies, because results from analysis of DELMAT tems, crassulacean acid metabolism[CAM], and absorb- are not affectedby using either Vellozia (Velloziaceae) ing ).Cladistic analysis of morphologicalfea- or Stegolepis (Rapateaceae) as the outgroup. Trees re- turesis supportiveof a sistergroup relationshipfor Til- sultingfrom analysis of DELMAT differfrom that of the landsioideae and Bromelioideae (Gilmartinand Brown, restrictionsite data in threeways: (1) a paraphyleticPit- 1987). Moreover,the relativemorphological and ecolog- cairnioideae and a monophyleticBromelioideae are iden- ical simplicityof Pitcaimioideae is consistentwith the tified;(2) a Puya-Bromelioideaesister group relationship 668 AMERICAN JOURNAL OF BOTANY [Vol. 84

is resolved; and (3) Glomeropitcairniais the sistergroup some Pitcairnia and (Smith and Downs, 1974; to the remainderof Bromeliaceae, as compared to the Smith, 1988). sistergroup of Bromelioideae-Pitcairnioideae(Ranker et The placement of Glomeropitcairnia(two spp.) has al., 1990). Differencesin the numberof phylogenetically been problematicaldue to the charactersthat suggest af- informativecharacters may also contributeto inconsis- finitywith subfamilies Pitcairnioideae and Tillandsioi- tencies between the restrictionsite and ndhF sequence deae. Mez (1896) emphasized the semi-inferiorovary in phylogenies. On a per taxon basis, this study included recognizingGlomeropitcairnia as a subgenus of Pitcair- z112% more phylogeneticallyuseful charactersthan the nia in Pitcairnioideae. Harms (1930) and Mez (1935) restrictionsite study.Sampling differencesnotwithstand- considered seed morphologyin treatingthe genus as a ing, resultspresented in Fig. 2 are consistentwith those monotypic tribe in Tillandsioideae. Smith and Downs based on restrictionsite analysis (Ranker et al., 1990) in (1977) did not consider tribesand recognized Glomero- supportinga basal Tillandsioideae and in defininga Pit- pitcairnia as one of six Tillandsioideae genera. Studies cairnioideae-Bromelioideaelineage. of subfamilyrelationship in Bromeliaceae have consid- Resolution of Brocchinia as the sistergroup to the re- ered the potentialimportance of Glomeropitcairniaas a mainder of Bromeliaceae furthersubstantiates the dis- phylogeneticlink between Brocchinia and Tillandsioi- tinctivenessof the genus and suggeststhat recognition of deae (Benzing, Givnish, and Bermudes, 1985). Results the group as a monotypicsubfamily may be warranted. presentedhere are consistentwith those of Gilmartinet Most treatmentshave recognizedthis group of 18 al. (1989) in supportinginclusion of Glomeropitcairnia endemic to Guayana and as a pitcairnioidge- in Tillandsioideae. Weak supportin the ndhF phylogeny nus (Mez, 1935; Smith, 1955; Smith and Downs, 1974; forinclusion in Tillandsioideae (sensu Smithand Downs, Smith, 1988). However, cladistic analysis of morpholog- 1977) suggeststhat Glomeropitcairnia diverged from the ical featuresfrom 16 genera of Pitcairnioideaehave led remainderof Tillandsioideae soon afterthe originof the some authorsto question the inclusion of Brocchinia in subfamily. that subfamily(Varadarajan and Gilmartin,1988b). A Puya is a genus of nearly 200 species that occupy subsequentrevision recognized the genus as a monotypic rockyslopes of the Andean Cordillerafrom Chile to Co- tribe in Pitcairnioideae (Varadarajan and Gilmartin, lumbia (Smith and Downs, 1974). Previous taxonomies 1988c). Seed morphologyand ontogeny in Brocchinia have unanimouslyincluded the genus in Pitcairnioideae are notably differentfrom the remainderof Pitcairnioi- based on a numberof characterstraditionally associated deae, and similaritiesto the morphologycharacteristic of with that subfamily (Baker, 1889; Mez, 1896, 1935; Tillandsioideae seed have been noted (Varadarajan and Harms, 1930; Smith, 1955; Smith and Downs, 1977; Gilmartin, 1988c). Furthermore,the mature tank tri- Smith, 1988). Unique seed types (Varadarajan and Gil- chomes of some Brocchinia are distinguishedfrom those martin, 1988c) and anthocyanins(Scogin, 1985) have of otherbromeliads in havingliving shield (cap) cells that been identifiedin Puya, althoughthe utilityof thesechar- acters in possess an unusual labryrinthinewall organization(Tom- delimitinggroups withinthe genus remainsun- linson, 1969; Benzing et al., 1976; Owen, Benzing, and clear. Smith (1934) emphasized the primitivenature of the genus and Thomson, 1988; Owen and Thomson, 1991). suggested placement of Puya at the base of Bromeliaceae. More recentstudies Most taxonomies of Bromeliaceae recognize the dis- supportplacement withinPitcaimioideae (Varadarajan and Gilmartin, tinctivenessof Navia (101 spp.). Seed morphologyhas 1988a). Results presentedhere indicate a well-supportedPuya- been importantin treatmentsthat recognize Navia as rep- Bromelioideae clade. Other featuressupporting a Puya- resentinga monotypicsubfamily (Harms, 1930) or tribe Bromelioideae relationshipinclude similaritiesin foliar (Mez, 1935; Hutchinson, in Pitcairnioideae 1973) (Smith, scale anatomy(Varadarajan and Gilmartin,1987), inferior 1955; Smith and Downs, 1974). Smith (1934) cited geo- ovaries (Smith and Downs, 1974), and CAM metabolism graphical distributionand morphologicaldata in consid- (Smith, 1989; Martin, 1994). A study of phylogenetic the ering common ancestryof Navia and Rapateaceae. relationshipswithin Puya may be useful in identifying However, he did not consider the genus to be near the taxa sharinga most recent common ancestor with Bro- base of Bromeliaceae, citingas evidence the rarelysemi- melioideae, resultingin refinedhypotheses of phylogeny inferiorovary and unappendaged seed of Navia, both of and characterevolution at the base of the Puya-Brome- which are consideredderived featuresin othermembers lioideae clade. of the family (Smith and Downs, 1974, 1977, 1979). Parsimonyanalysis of ndhF sequences indicates four These argumentswere marshalled in favor of the hy- major lineages thatmay be more naturallyrecognized as pothesisthat Rapateaceae were derivedfrom within Bro- subfamilies:(1) Brocchinia, (2) Tillandsioideae, (3) Pit- meliaceae via Navia (Smith, 1934). Cladistic analysis of cairnioideae sensu stricto(represented here by Dyckia, morphologicalcharacters is in agreementwith the ndhF Encholirion,Fosterella, Pepinia, Pitcairnia, and Navia), phylogenyin supportinginclusion of Navia withinPit- and (4) Bromelioideae sensu lato (Bromelioideae repre- cairnioideae (Varadarajan and Gilmartin, 1988a). Fur- sented here plus Puya). Alternatively,support for a Pit- thermore,a Navia-Rapateaceae sistergroup relationship cairnioideae sensu stricto-Bromelioideaeclade suggests is not supportedby analysis of ndhF sequences in which formalrecognition of thisgroup as a subfamily,with trib- Stegolepis is included and trees are rooted with Vellozia al designations for Pitcairnioideae sensu stricto,Puya, (Velloziaceae; resultsnot shown). These findingssuggest and Bromelioideae. These results can be interpretedas thatthe distinguishingqualities of Navia are apomorphic supportingthe previouslyrecognized tribaldesignations although not unique in Pitcairnioideae,because similar for Glomeropitcairnia(Harms, 1930; Mez, 1935) and ovary position and seed morphologies are present in .Navia (Mez, 1935; Hutchinson,1973), althoughseveral May 1997] TERRY ET AL.-BROMELIACEAE NDHF PHYLOGENY 669 taxa throughoutthe family that are otherwise less dis- MEZ, C. 1896. Bromeliaceae. In A. deCandolle [ed.], Monographiae tinctiveare delimitedby equal or greaternumbers of nu- Phanerogamarum9: 1-990. G. Masson, Paris. realignments . 1904. Physiologische Bromeliaceen-Studien.I. Die Wasser- cleotide substitutions.Few of the suggested Okonomie der extrematmospharischen Tillandsien. Jahrbiucherfiir are based exclusivelyon sequence data (e.g., Brocchinia, WissenschaftlicheBotanik 40:157-229. Glomeropitcairnia,and Navia are morphologicallyquite . 1935. Bromeliaceae. In A. Engler [ed.], Das Pflanzenreich4: distinct). 161-667. J. Cramer,Stuttgart. MULLIS, K., F FALONA, S. SCHARF, R. SAIKI, G. HORN, AND H. ERLICH. 1986. Specific enzymaticamplification of DNA in vitro:the poly- LITERATURE CITED merase chain reaction. Cold Spring Harbor Symposia on Quanti- tativeBiology 51: 263-273. BAKER, J. G. 1889. Handbook of the Bromeliaceae. George Bell and NEYLAND,R., ANDL. E. URBATSCH.1996. Phylogenyof subfamilyEp- Sons, London. idendroideae (Orchidaceae) inferredfrom ndhF chloroplastgene BENZING,D. H. 1980. The biology of thebromeliads. Mad River Press, sequences. AmericanJournal of Botany 83: 1195-1206. Eureka, CA. OLMSTEAD,R. G., AND J. D. PALMER. 1994. ChloroplastDNA system- T GIVNISH, AND D. BERMUDES. 1985. Absorptive trichomes in , atics: a review of methodsand data analysis. AmericanJournal of (Bromeliaceae) and theirevolutionary and sys- Botany 81: 1205-1224. tematicsignificance. Systematic Botany 10: 81-91. , AND P A. REEVES. 1995. Evidence for the polyphylyof the K. HENDERSON,B. KESSEL, AND J. SULAK. 1976. The absorptive , Scrophulariaceaebased on chloroplastrbcL and ndhF sequences. capacities of bromeliadtrichomes. American Journal of Botany63: Annals of the Missouri Botanical Garden 82: 176-193. 1009-1014. , AND J. A. SWEERE. 1994. Combiningdata in phylogeneticsys- of Bromeli- , AND A. RENFROW. 1974. The mineral nutrition tematics:an empiricalapproach using threemolecular data sets in Botanical Gazette 135: 281-288. aceae. the Solanaceae. SystematicBiology 43: 467-481. CLARK, L. G., W. ZHANG, AND J. F WENDEL. 1995. A phylogeny of the , AND K. H. WOLFE. 1993. Ninetyextra nucleotide in grass family (Poaceae) based on ndhF sequence data. Systematic ndhF gene of tobacco chloroplastDNA: a summaryof revisionsto Botany 20:436-460. the 1986 genome sequence. Plant Molecular Biology 22: 1191- 1990. Phylogenetic comparisons CLARK, W. D., AND M. T CLEGG. 1193. among rbcL sequences in the Bromeliaceae. American Journalof OWEN, T. P, D. H. BENZING, AND W. W. THOMSON. 1988. Apoplastic Botany 77: 115 (Abstract). and ultrastructuralcharacterizations of the trichomesfrom the car- S. GAUT, M. R. DUVALL, AND M. T CLEGG. 1993. Phylo- , B. nivorousbromeliad Brocchinia reducta. Canadian Journalof Bot- genetic relationshipsof the Bromeliiflorae-Commeliniflorae-Zingi- any 66: 941-948. berifloraecomplex of monocots based on rbcL sequence compar- , AND W. W. THOMSON. 1991. Structureand functionof a spe- isons. Annals of the Missouri Botanical Garden 80: 987-998. cialized cell wall in the trichomesof the carnivorousbromeliad DOYLE, J. J.,AND J. L. DOYLE. 1987. A rapid DNA isolation procedure Brocchinia reducta. Canadian Journalof Botany 69: 1700-1706. forsmall quantitiesof freshleaf tissue. PhytochemicalBulletin 19: PITTENDRIGH,C. S. 1948. The bromeliad-Anopheles-malariacomplex 11-15. in Trinidad.I-The bromeliadflora. Evolution 2: 58-89. DUVALL, M. R., M. T CLEGG, M. W. CHASE, W. D. CLARK, W. J. KRESS, RANKER, T. A., D. E. SOLTIS, P S. SOLTIS, AND A. J. GILMARTIN. 1990. H. G. HILLS, L. E. EGUIARTE,J. F SMITH, B. S. GAUT, E. A. ZIMMER, Subfamilial phylogeneticrelationships of the Bromeliaceae: evi- ANDG. H. LEARN. 1993. Phylogenetichypotheses for the mono- dence fromchloroplast DNA restrictionsite variation.Systematic cotyledons constructedfrom rbcL sequence data. Annals of the Missouri Botanical Garden 80: 607-619. Botany 15: 425-434. SANGER, NICKLEN, AND 1977. DNA sequencing ERLICH,H. A., ed. 1989. PCR technology:principles and applications F, S. A. R. COULSON. for DNA amplification.Stockton Press, New York, NY with chain-terminatinginhibitors. Proceedings of the National USA 74: 5463-5667. GILMARTIN,A. J., AND G. K. BROWN. 1987. , related mon- Academy of Sciences, Bo- ocots, and resolutionof relationshipsamong Bromeliaceae subfam- SCHIMPER, A. E W. 1888. Die epiphytischeVegetation Amerikas. ilies. SystematicBotany 12: 493-500. tanischeMittheilungen aus den Tropen, II. Gustav Fischer,Jena. SCOGIN, R. 1985. Floral anthocyaninsin the genus Puya. Biochemical , G. S. VARADARAJAN,AND M. NEIGHBORS. 1989. Status of Glomeropitcairniawithin evolutionary history of Bromeliaceae. Systematicsand Ecology 13: 387-389. SystematicBotany 14: 339-348. SCOTLAND, R. W, J. A. SWEERE, P. A. REEVES, AND R. G. OLMSTEAD. GIVNISH, T. J., K. J. SYTSMA, AND J. F SMITH. 1990. A re-examination 1995. Higher-level systematics of Acanthaceae determinedby of phylogeneticrelationships among bromeliad subfamiliesusing chloroplastDNA sequences. AmericanJournal of Botany 82: 266- cpDNA restrictionsite variation.American Journalof Botany 77: 275. 133 (Abstract). SIMPSON, M. G. 1988. A critiqueof "Bromeliales, related monocots, AND W. J. HAHN. 1992. Molecular evolution, and resolutionof relationshipsamong Bromeliaceae subfamilies." phylogeny,and geographyin the Pitcairnioideae(Bromeliaceae). SystematicBotany 13: 610-614. AmericanJournal of Botany 79: 145 (Abstract). SMITH, J. A. C. 1989. Epiphyticbromeliads. In U. Luttge [ed.], Vas- HARMS,H. 1930. Bromeliaceae. In A. Engler and K. Prantl[eds.], Die cular plants as ,evolution and ecophysiology,108-138. naturlichenPflanzenfamilien, 2d. ed., 15a: 65-159. W. Engelmann. Springer-Verlag,Berlin. Liepzig. SMITH,L. B. 1934. Geographical evidence on the lines of evolutionin HUTCHINSON,J. 1973. The familiesof floweringplants, 3rd. ed., Oxford the Bromeliaceae. Botanische Jahrbulcherfur systematik,pflanzen- UniversityPress, London. geschichteund pflanzengeographie66: 446-468. INNIS, M. A., D. H. GELFAND, J. J. SNINSKY, AND T. J. WHITE. 1990. 1955. The Bromeliaceae of . SmithsonianMiscellaneous PCR protocols, a guide to methods and applications. Academic Collections 126: 1-290. Press, New York, NY . 1988. New key to the genera of the Bromeliaceae. Beitrdge KALTENBOECK, B., J. W. SPATAFORA,X. ZHANG, K. G. KOUSOULAS, M. zur Biologie der Pflanzen63: 403-411. BLACKWELL, AND J. STORZ. 1992. Efficient production of single- , AND R. J. DOWNS. 1974. Pitcairnioideae.Flora Neotropica 14: strandedDNA as long as 2 kb for sequencing of PCR-amplified 1-658. DNA. BioTechniques 12: 164-171. , AND . 1977. Tillandsioideae. Flora Neotropica 14: MADDISON,D. R. 1991. The discoveryand importanceof multipleis- 663-1492. lands of most-parsimonioustrees. Systematic Zoology 40: 315-328. , AND . 1979. Bromelioideae. Flora Neotropica 14: MARTIN,C. E. 1994. Physiological ecology of the Bromeliaceae. Bo- 1493-2142. tanical Review 60: 1-82. SWOFFORD, D. L. 1993. PAUP: phylogeneticanalysis using parsimony, MEDINA,E. 1974. Dark CO2 fixation,habitat preference and evolution version 3.1.1. Illinois Natural HistorySurvey, Champaign, IL. withinthe Bromeliaceae. Evolution 28: 677-686. TIETZE, M. 1906. Physiologische Bromeliaceen studien. II. Die en- 670 AMERICAN JOURNAL OF BOTANY [Vol. 84

twickelungder wasseraufnehmendenBromiliaceen-. Zeit- , AND . 1988b. Taxonomic realignmentswithin the sub- schriftfuir Naturwissenschaften 78: 1-49. familyPitcairnioideae (Bromeliaceae). SystematicBotany 13: 294- TOMLINSON,P B. 1969. Commelinales-Zingiberales.In C. R. Metcalfe 299. [ed.], Anatomyof the ,vol. 3, 193-294. Clarendon , AND . 1988c. Seed morphologyof the subfamilyPit- Press, Oxford. cairnioideae (Bromeliaceae) and its systematicimplications. Amer- VARADARAJAN, G. S., AND A. J. GILMARTIN. 1987. Foliar scales of the ican Journalof Botany 75: 808-818. subfamilyPitcairnioideae (Bromeliaceae). SystematicBotany 12: WOLFE, K. H. 1991. Protein-codinggenes in chloroplastDNA: a com- 562-571. pilation of nucleotide sequences, data base entries,and rates of , AND . 1988a. Phylogeneticrelationships of groups of molecular evolution. In L. Bogorad and I. K. Vasil [eds.], The genera withinthe subfamilyPitcairnioideae (Bromeliaceae). Sys- photosyntheticapparatus: molecular biology and operation,467- tematicBotany 13: 283-293. 482. Academic Press, New York, NY