Master Regulators of Muscle Atrophy: Role of Costamere Components
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
1933.Full.Pdf
0270.6474/84/0408-1933$02.00/O The Journal of Neuroscience Copyright 0 Society for Neuroscience Vol. 4, No. 8, pp. 1933-1943 Printed in U.S.A. August 1984 PARTIAL PURIFICATION AND FUNCTIONAL IDENTIFICATION OF A CALMODULIN-ACTIVATED, ADENOSINE 5’-TRIPHOSPHATE-DEPENDENT CALCIUM PUMP FROM SYNAPTIC PLASMA MEMBRANES1 DIANE M. PAPAZIAN,* HANNAH RAHAMIMOFF,$ AND STANLEY M. GOLDIN§’ Departments of *Biological Chemistry and $Pharmacology, Harvard Medical School, Boston, Massachusetts 02115 and *Department of Biochemistry, Hadassah Medical School, Hebrew University, Jerusalem, Israel Received July 18, 1983; Revised February 27, 1984; Accepted February 28, 1984 Abstract Synaptic plasma membranes isolated from rat brain contain a calmodulin-activated Ca2+ pump. It has been purified 80- to 160-fold by solubilization with Triton X-100 and affinity chromatography on a calmodulin- Sepharose 4B column. After reconstitution into phospholipid vesicles, the affinity-purified pump efficiently catalyzed ATP dependent Ca2+ transport, which was activated 7- to g-fold by calmodulin. The major protein component of the affinity-purified preparation had a M, = 140,000; it was virtually the only band visualized on a Coomassie blue-stained SDS polyacrylamide gel. It has been identified as the Ca”’ pump by two functional criteria. First, it was phosphorylated by [y-““P]ATP in a Ca’+-dependent manner; the phosphorylated protein had the chemical reactivity of an acyl phosphate, characteristic of the phosphorylated intermediates of ion-transporting ATPases. Second, the protein was enriched by transport-specific fractiona- tion, a density gradient procedure which uses the transport properties of the reconstituted Ca2+ pump as a physical tool for its purification. -
Te2, Part Iii
TERMINOLOGIA EMBRYOLOGICA Second Edition International Embryological Terminology FIPAT The Federative International Programme for Anatomical Terminology A programme of the International Federation of Associations of Anatomists (IFAA) TE2, PART III Contents Caput V: Organogenesis Chapter 5: Organogenesis (continued) Systema respiratorium Respiratory system Systema urinarium Urinary system Systemata genitalia Genital systems Coeloma Coelom Glandulae endocrinae Endocrine glands Systema cardiovasculare Cardiovascular system Systema lymphoideum Lymphoid system Bibliographic Reference Citation: FIPAT. Terminologia Embryologica. 2nd ed. FIPAT.library.dal.ca. Federative International Programme for Anatomical Terminology, February 2017 Published pending approval by the General Assembly at the next Congress of IFAA (2019) Creative Commons License: The publication of Terminologia Embryologica is under a Creative Commons Attribution-NoDerivatives 4.0 International (CC BY-ND 4.0) license The individual terms in this terminology are within the public domain. Statements about terms being part of this international standard terminology should use the above bibliographic reference to cite this terminology. The unaltered PDF files of this terminology may be freely copied and distributed by users. IFAA member societies are authorized to publish translations of this terminology. Authors of other works that might be considered derivative should write to the Chair of FIPAT for permission to publish a derivative work. Caput V: ORGANOGENESIS Chapter 5: ORGANOGENESIS -
VIEW Open Access Muscle Spindle Function in Healthy and Diseased Muscle Stephan Kröger* and Bridgette Watkins
Kröger and Watkins Skeletal Muscle (2021) 11:3 https://doi.org/10.1186/s13395-020-00258-x REVIEW Open Access Muscle spindle function in healthy and diseased muscle Stephan Kröger* and Bridgette Watkins Abstract Almost every muscle contains muscle spindles. These delicate sensory receptors inform the central nervous system (CNS) about changes in the length of individual muscles and the speed of stretching. With this information, the CNS computes the position and movement of our extremities in space, which is a requirement for motor control, for maintaining posture and for a stable gait. Many neuromuscular diseases affect muscle spindle function contributing, among others, to an unstable gait, frequent falls and ataxic behavior in the affected patients. Nevertheless, muscle spindles are usually ignored during examination and analysis of muscle function and when designing therapeutic strategies for neuromuscular diseases. This review summarizes the development and function of muscle spindles and the changes observed under pathological conditions, in particular in the various forms of muscular dystrophies. Keywords: Mechanotransduction, Sensory physiology, Proprioception, Neuromuscular diseases, Intrafusal fibers, Muscular dystrophy In its original sense, the term proprioception refers to development of head control and walking, an early im- sensory information arising in our own musculoskeletal pairment of fine motor skills, sensory ataxia with un- system itself [1–4]. Proprioceptive information informs steady gait, increased stride-to-stride variability in force us about the contractile state and movement of muscles, and step length, an inability to maintain balance with about muscle force, heaviness, stiffness, viscosity and ef- eyes closed (Romberg’s sign), a severely reduced ability fort and, thus, is required for any coordinated move- to identify the direction of joint movements, and an ab- ment, normal gait and for the maintenance of a stable sence of tendon reflexes [6–12]. -
The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts. -
Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure. -
Vocabulario De Morfoloxía, Anatomía E Citoloxía Veterinaria
Vocabulario de Morfoloxía, anatomía e citoloxía veterinaria (galego-español-inglés) Servizo de Normalización Lingüística Universidade de Santiago de Compostela COLECCIÓN VOCABULARIOS TEMÁTICOS N.º 4 SERVIZO DE NORMALIZACIÓN LINGÜÍSTICA Vocabulario de Morfoloxía, anatomía e citoloxía veterinaria (galego-español-inglés) 2008 UNIVERSIDADE DE SANTIAGO DE COMPOSTELA VOCABULARIO de morfoloxía, anatomía e citoloxía veterinaria : (galego-español- inglés) / coordinador Xusto A. Rodríguez Río, Servizo de Normalización Lingüística ; autores Matilde Lombardero Fernández ... [et al.]. – Santiago de Compostela : Universidade de Santiago de Compostela, Servizo de Publicacións e Intercambio Científico, 2008. – 369 p. ; 21 cm. – (Vocabularios temáticos ; 4). - D.L. C 2458-2008. – ISBN 978-84-9887-018-3 1.Medicina �������������������������������������������������������������������������veterinaria-Diccionarios�������������������������������������������������. 2.Galego (Lingua)-Glosarios, vocabularios, etc. políglotas. I.Lombardero Fernández, Matilde. II.Rodríguez Rio, Xusto A. coord. III. Universidade de Santiago de Compostela. Servizo de Normalización Lingüística, coord. IV.Universidade de Santiago de Compostela. Servizo de Publicacións e Intercambio Científico, ed. V.Serie. 591.4(038)=699=60=20 Coordinador Xusto A. Rodríguez Río (Área de Terminoloxía. Servizo de Normalización Lingüística. Universidade de Santiago de Compostela) Autoras/res Matilde Lombardero Fernández (doutora en Veterinaria e profesora do Departamento de Anatomía e Produción Animal. -
Spatiotemporal Single-Cell Analysis Reveals Critical Roles of Mechano-Sensing Genes at the Border Zone in Remodeling After Myocardial Infarction
Spatiotemporal single-cell analysis reveals critical roles of mechano-sensing genes at the border zone in remodeling after myocardial infarction Shintaro Yamada Tokyo University https://orcid.org/0000-0002-3240-358X Toshiyuki Ko The University of Tokyo Satoshi Hatsuse The University of Tokyo Seitaro Nomura The University of Tokyo Bo Zhang The University of Tokyo Zhehao Dai The University of Tokyo https://orcid.org/0000-0002-0363-7563 Shunsuke Inoue The University of Tokyo Masayuki Kubota The University of Tokyo Kosuke Sawami The University of Tokyo Takanobu Yamada The University of Tokyo Tatsuro Sassa The University of Tokyo Mikako Katagiri The University of Tokyo Kanna Fujita The University of Tokyo Manami Katoh The University of Tokyo Masamichi Ito The University of Tokyo Mutsuo Harada Page 1/21 The University of Tokyo Haruhiro Toko The University of Tokyo Norifumi Takeda The University of Tokyo https://orcid.org/0000-0003-4818-3347 Hiroyuki Morita The University of Tokyo Hiroyuki Aburatani The University of Tokyo Issei Komuro ( [email protected] ) The University of Tokyo Graduate School of Medicine Article Keywords: spatiotemporal single-cell analysis, myocardial infarction, left ventricular remodeling. Posted Date: June 22nd, 2021 DOI: https://doi.org/10.21203/rs.3.rs-620498/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 2/21 Abstract The left ventricular remodeling after myocardial infarction (MI) causes heart failure, but its underlying mechanisms remain largely unknown. Here, we performed an integrative analysis of spatial transcriptomics and single cell RNA-seq in murine MI model and found that mechanical stress-response genes are expressed at the border zone and play a critical role in left ventricular remodeling after MI. -
Identification of a Variant Hotspot in MYBPC3 and of a Novel CSRP3
ORIGINAL ARTICLE Identification of a variant hotspot inMYBPC3 and of a novel CSRP3 autosomal recessive alteration in a cohort of Polish patients with hypertrophic cardiomyopathy Martina Lipari1, Ewa Wypasek2,3, Marek Karpiński2, Lidia Tomkiewicz ‑Pająk2,4, Luigi Laino1, Francesco Binni1, Diana Giannarelli5, Paweł Rubiś2,4, Paweł Petkow ‑Dimitrow6,7, Anetta Undas2,7, Paola Grammatico1, Irene Bottillo1 1 Division of Medical Genetics, Department of Molecular Medicine, Sapienza University, San Camillo ‑Forlanini Hospital, Rome, Italy 2 John Paul II Hospital, Kraków, Poland 3 Faculty of Medicine and Health Sciences, Andrzej Frycz Modrzewski Krakow University, Kraków, Poland 4 Department of Cardiac Vascular Diseases, Institute of Cardiology, Jagiellonian University Medical College, Kraków, Poland 5 Biostatistical Unit, Regina Elena National Cancer Institute, Istituti di Ricovero e Cura a Carattere Scientifico (IRCCS), Rome, Italy 6 2nd Department of Cardiology, Institute of Cardiology, Jagiellonian University Medical College, Kraków, Poland 7 Institute of Cardiology, Jagiellonian University Medical College, Kraków, Poland KEY WORDS ABSTRACT CSRP3 human KO, INTRODUCTION Hypertrophic cardiomyopathy (HCM) is a heart disorder caused by autosomal dominant hypertrophic alterations affecting both sarcomeric genes and other nonsarcomeric loci in a minority of cases. However, cardiomyopathy, in some patients, the occurrence of the causal pathogenic variant or variants in homozygosity, compound MYBPC3 founder heterozygosity, or double heterozygosity has also been described. Most of the HCM pathogenic variants mutation, Polish are missense and unique, but truncating mutations of the MYBPC3 gene have been reported as founder population pathogenic variants in populations from Finland, France, Japan, Iceland, Italy, and the Netherlands. OBJECTIVES This study aimed to assess the genetic background of HCM in a cohort of Polish patients. -
Development of a High-Throughput Screen to Identify Small Molecule Enhancers of Sarcospan for the Treatment of Duchenne Muscular Dystrophy
UCLA UCLA Previously Published Works Title Development of a high-throughput screen to identify small molecule enhancers of sarcospan for the treatment of Duchenne muscular dystrophy. Permalink https://escholarship.org/uc/item/85z6k8t7 Journal Skeletal muscle, 9(1) ISSN 2044-5040 Authors Shu, Cynthia Kaxon-Rupp, Ariana N Collado, Judd R et al. Publication Date 2019-12-12 DOI 10.1186/s13395-019-0218-x Peer reviewed eScholarship.org Powered by the California Digital Library University of California Shu et al. Skeletal Muscle (2019) 9:32 https://doi.org/10.1186/s13395-019-0218-x RESEARCH Open Access Development of a high-throughput screen to identify small molecule enhancers of sarcospan for the treatment of Duchenne muscular dystrophy Cynthia Shu1,2,3, Ariana N. Kaxon-Rupp2, Judd R. Collado2, Robert Damoiseaux4,5 and Rachelle H. Crosbie1,2,3,6* Abstract Background: Duchenne muscular dystrophy (DMD) is caused by loss of sarcolemma connection to the extracellular matrix. Transgenic overexpression of the transmembrane protein sarcospan (SSPN) in the DMD mdx mouse model significantly reduces disease pathology by restoring membrane adhesion. Identifying SSPN-based therapies has the potential to benefit patients with DMD and other forms of muscular dystrophies caused by deficits in muscle cell adhesion. Methods: Standard cloning methods were used to generate C2C12 myoblasts stably transfected with a fluorescence reporter for human SSPN promoter activity. Assay development and screening were performed in a core facility using liquid handlers and imaging systems specialized for use with a 384-well microplate format. Drug-treated cells were analyzed for target gene expression using quantitative PCR and target protein expression using immunoblotting. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Role of the Nuclear Receptor Rev-Erb Alpha in Circadian Food Anticipation and Metabolism Julien Delezie
Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism Julien Delezie To cite this version: Julien Delezie. Role of the nuclear receptor Rev-erb alpha in circadian food anticipation and metabolism. Neurobiology. Université de Strasbourg, 2012. English. NNT : 2012STRAJ018. tel- 00801656 HAL Id: tel-00801656 https://tel.archives-ouvertes.fr/tel-00801656 Submitted on 10 Apr 2013 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE CNRS UPR 3212 · Institut des Neurosciences Cellulaires et Intégratives THÈSE présentée par : Julien DELEZIE soutenue le : 29 juin 2012 pour obtenir le grade de : Docteur de l’université de Strasbourg Discipline/ Spécialité : Neurosciences Rôle du récepteur nucléaire Rev-erbα dans les mécanismes d’anticipation des repas et le métabolisme THÈSE dirigée par : M CHALLET Etienne Directeur de recherche, université de Strasbourg RAPPORTEURS : M PFRIEGER Frank Directeur de recherche, université de Strasbourg M KALSBEEK Andries -
Physiologist Physiologist
Published by The American Physiological Society Integrating the Life Sciences from Molecule to Organism The PhysiologistPhysiologist Generating Support for Science INSIDE in the 111th Congress Rebecca Osthus APS Science Policy Analyst APS The 2008 election cycle brings a new is somewhat more promising. There is a administration to Washington, DC this plan to double the agency’s budget over Bylaw Changes January and also ushers in the 111th the next several years as part of the p. 240 Congress. With many new Members of America COMPETES Act, but so far Congress in both the House of yearly increases have not lived up to Representatives and the Senate, now is the goals laid out by Congress. Annual Meeting of the time for APS members to reach out Lawmakers are also making deci- the Nebraska and communicate the importance of sions about what regulations govern Physiological supporting biomedical research the use of animals in research, whether through strong federal funding and federally funded scientists should con- Society sound policy making. While scientists tinue to consult for and own stock in p. 243 carry out research in labs across the pharmaceutical and biotechnology com- country, many decisions are being made in APS Membership Washington, DC that Statistics will affect how they do p. 244 their jobs. The current fiscal cri- sis means that it is Starting a Lab: more important than How to Develop a ever before to make a strong case for federal Budget and Buy investment in research. Equipment Since the completion of p. 252 the doubling of the NIH budget, yearly increas- es have failed to keep Congress Extends pace with inflation, Current Levels of causing success rates for extramural grants Research Funding to fall into the teens.