Iowa State University Capstones, Theses and Retrospective Theses and Dissertations Dissertations

2000 Effects of altering expression on assembly in a skeletal line Qunfeng Dong Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/rtd Part of the Cell Biology Commons

Recommended Citation Dong, Qunfeng, "Effects of altering titin expression on myofibril assembly in a cell line " (2000). Retrospective Theses and Dissertations. 12680. https://lib.dr.iastate.edu/rtd/12680

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. INFORMATION TO USERS

This manuscript has been reproduced from the microfilm master. UMI films the text directly from the original or copy submitted. Thus, some thesis and dissertation copies are in typewriter face, while others may be from any type of computer printer.

The quality of this rBproduction is dependent upon the quality of the copy submitted. Broicen or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction.

In the unlikely event that the author did rrat send UMI a complete manuscript and there are missing pages, these will t>e noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize materials (e.g., maps, drawings, charts) are reproduced by sectioning the original, beginning at the upper left-hand comer and continuing from left to right in equal sections with small overiaps.

Photographs included in the original manuscript have t>een reproduced xerographically in this copy. Higher quality 6* x 9' black and white photographic prints are available for any photographs or illustrations appearing In this copy for an additional charge. Contact UMI directiy to order.

Bell & Howell Information and Learning 300 North Zeeb Road, Ann Artx>r, Ml 48106-1346 USA 800-521-0600

Effects of altering titin expression on myofibril assembly in a skeletal muscle cell line

by

Qunfeng Dong

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major Biochemistry

Major Professor Ted W. Huiatt

Iowa State University

Ames, Iowa

2000 UMI Number 9977319

UMI^

UMI Microfomi9977319 Copyright 2000 by Bell & Howell Infomriation and Learning Company. All rights reserved. This microform edition is protected against unauthorized copying under Title 17, United States Code.

Bell & Howell Information and Leaming Company 300 North Zeeb Road P.O. 00x1346 Ann Arbor. Ml 48106-1346 ii

Graduate College Iowa State University

This is to certify that the Doctoral dissertation of

Qunfeng Dong has met the dissertation requirements of Iowa State University

Signature was redacted for privacy.

Major Professor

Signature was redacted for privacy. Focjhe Majdr Program

Signature was redacted for privacy.

For the Gradi tllege iii

TABLE OF CONTENTS

GENERAL INTRODUCTION 1 Introduction 1 Dissertation Organization 2 Review of Literature 2 References 27

OVEREXPRESSION OF THE A BAND REGION OF TITIN ALTERS MYOFIBRIL ASSEMBLY IN C2C12 MUSCLE CELL CULTURES 45 Abstract 45 Introduction 46 Materials and Methods 48 Results 55 Discussion 60 References 64

ANTISENSE INHffimON OF TITIN IN C2C12 MUSCLE CELLS 90 Abstract 90 Introduction 91 Materials and Methods 93 Results 96 Discussion 99 References 106

GENERAL CONCLUSIONS 126

ACKNOWLEDGEMENTS 129 I

GENERAL INTRODUCTION

Introduction

Titin is a giant muscle protein that spans the distance from the Z line to the M line in the of striated muscle. Several in vivo roles have been hypothesized for this protein, such as providing muscle elasticity, maintaining saxcomeric integrity and functioning as a "molecular scaffold" to direct the myofibril assembly. The specific goals of my graduate work were to investigate the "molecular scaffold" role of titin by creating cultured cell systems in which the expression of titin was altered and then examining the myofibril assembly in such systems. To archive the above goal, two partial titin cDNAs from the Z line and A band regions of the titin molecule were first cloned from mouse skeletal muscle by

RT-PCR. Two approaches were then used to alter titin expression in cultures of the mouse muscle cell line C2C12. One was a so-called dominant-negative approach, which involved transiently transfecting C2C12 cells with a fusion construct consisting of a partial A band titin cDNA linked to a cDNA for green fluorescent protein

Dissertation Organization

The main body of this dissertation contains two manuscripts. Both manuscripts will

be submitted for publication in the Journal of Animal Science. I was responsible for the

design and implementation of all the experiments described in these manuscripts. The

organization of this dissertation includes four chapters. Chapter one is a general introduction

that contains a brief literature review covering myofibril structure, myofibril assembly and a

specific review of the literature related to titin. Chapters two and three are the two

manuscripts. Chapter four is an overall summary. The references cited in each chapter,

which are formatted in author/year style, are listed in corresponding separate References

sections within each chapter of the dissertation.

Review of Literature

Myofibril Ultrastructure

The structural and functional unit of skeletal muscle consists of muscle fibers, which

are very long cells about 20 to 100 ^m in diameter. Each muscle fiber/cell itself then contains

parallel bundles of around one thousand 1 to 2 ^m diameter myofibrils, which may extend

for the whole length of the fiber. Myofibrils show a repeating structure of transverse bands

when viewed under the electron microscope and this structure is responsible for the cross- striated appearance of muscle fibers in the phase-contrast microscope (Huxley, 1972). The

banding pattern is formed by a series of partially overlapping thick and thin protein

filaments, which results in alternating regions of greater and lesser electron density, known

as A bands and I bands, respectively (Huxley, 1963, 1967, 1972). The basic repeating unit of

the myofibril is called the and each sarcomere is usually 2.3 to 2.8 ^m long in

relaxed muscle. The ends of the sarcomere are defined by narrow electron dense structures 3 known as Z disks or Z lines, located at the center of each I band. The central region of the A band is the H zone, which is less electron-dense than the lateral region. The H zone is, in turn, centered on the electron dense M disk or M line. Electron microscope observations of vertebrate muscle have identified specific striations within the M line, labeled as Ml, M4,

M4', M6 and M6' (Small et al., 1992).

The thick filaments, located only in the A band, are composed mainly of the protein myosin (Huxley, 1963; Pepe, 1%7; Lowey et al., 1969). Sarcomeric myosin is a hexamer consisting of two myosin heavy chains (MHCs), two essential myosin light chains (MLCs), and two regulatory MLCs. Each MHC is composed of a globular head domain, which contains ATP- and actin-binding sites and has ATPase activity. The head domain is connected to a long rod domain by a thin neck portion, to which both the essential and regulatory MLCs are bound. In the A band, myosin rods form thick filaments, which each have a roughly cylindrical filament backbone with the heads in a quasi-helical array on the filament surface (Squire, 1981). In addition to myosin, there are some myosin-binding proteins (MyBPs), such as MyBP-C (C-protein) (Offer et al., 1973), MyBP-H (H-protein)

(Starr and Offer, 1983; Bahler et al., 1985) and MyBP-X (the slow-type isoform of MyBP-C)

(Bennett et al., 1985; Reinach et al., 1982; Dennis et al., 1984). These MyBPs are distributed in the central two-thirds of the cross-bridge bearing region of the A band, called the C zone.

This C zone contains a set of 11 transverse repeats of 43 nm axial spacing, distributed along the constant diameter region of the thick filaments. Seven to nine of these repeats are decorated with antibodies specific for one or more isoforms of MyBP-C (Bennett et al., 1986;

Dennis et al., 1984; Craig and Offer, 1976). The A band also contains the A band part of the protein titin, which interacts with other thick filament proteins (Labeit et al., 1992; Labeit 4

and Kolmerer, 1995a; Houmeida et al., 1995; Freiburg and Gautel, 1996). A detailed review

of titin will be given later in this section.

The major components of the thin filaments, which are localized mainly in the I band

and extend into the A band, are actin (Hanson and Lowy, 1963) and some actin-binding

proteins such as , (Ebashi et al., 1968) and tropomodulin (Fowler et al.,

1993). The globular actin monomers (G-actin) are associated to form a double-helical

filament (F-actin). Tropomyosin, which is a dimer of two a-helical subunits, is associated

head-to-tail, forming long strands that lie in the major grooves of the actin filament. Troponin consists of three subunits: (TnC), the Ca^"^ receptor, (TnT), an elongated molecule which binds to tropomyosin at its head-to-tail junction; and

(Tnl), which binds to actin. The troponin-tropomyosin complex constitutes a Ca^* sensitive switch that regulates the contraction of striated muscle fibers (for a recent review of troponin and tropomyosin, see Solaro and Rarick, 1998). Besides the I band region of titin, the I band also contains , which spans the whole length of thin filaments with its C terminus anchored at the Z line and its N terminus extending toward the distal ends of thin Hlaments, in skeletal muscle (Wang and Wright, 1988; Wang et al., 1996), or , a nebulin-like protein, in (Moncman and Wang, 1995).

Within the Z line, actin filaments torn one sarcomere overlap with filaments from the adjacent sarcomere, forming a square lattice that is cross-linked in a zig-zag pattern by a- actinin, which is an anti-parallel dimeric protein and major component of periodic Z lines in myofibrils in striated muscle cells (Ebashi et al., 1964; Ebashi and Ebashi, 1965; Suzuki et al., 1976; Yamaguchi et al., 1985). a-Actinin consists of three major domains; (1) a conserved N-terminal region containing actin binding sites; (2) four spectrin-like repeats that 5 are likely to be involved in anti-parallel dimerization, as well as harboring binding sites for

P-integrins; and (3) the C-terminal, containing two EF-hand Ca^^ binding domains, which are believed to be non-functional in muscle cells (Duhaiman and Bamberg, 1984; Blanchard et al., 1989; Arimura et al., 1988). Other Z line structural components include the N-terminal region of titin (Labeit et al., 1992) and the C-terminal end of nebulin in skeletal muscle

(Wang and Wright, 1988; Wang et al., 1996) or nebulette in cardiac muscle (Moncman and

Wang, 1995). Recent studies (Sorimachi et al., 1997; Young et al., 1998; Gregorio et al.,

1998) have indicated the N-terminal regions of titin from adjacent overlap within the Z line. The C-terminal end of nebulin seems to interact with F-actin through its a helical actin-binding repeats within the Z line region (Pfiihl et al., 1994; Labeit and Kolmerer,

1995b; Pfuhl et al., 1996; Wang et al., 1996). The Z lines also contain another actin-binding protein, CapZ (also called P-actinin) (Casella et al., 1986; Maruyama et al., 1990), which binds with a high afHnity to the barbed end of actin filaments. In addition, intermediate filaments (IPs), comprised primarily of , are located at the periphery of Z lines

(Robson, 1989).

Five major proteins have been described to be localized at the M line region: M- protein (Masaki and Takaiti, 1974), myomesin (Grove et al., 1984, 1985), the muscle isofoim of creatine kinase (Turner et al., 1973; Strehler et al., 1983), skelemin (Price, 1987) and the

C-terminal end of titin (Labeit and Kolmerer, 1995a; Houmeida et al., 1995; Freiburg and

Gautel, 1996). The major role of creatine kinase is to catalyze the reversible exchange of high-energy phosphate between phosphocreatine and ATP, thus regulating the intracellular

ATP concentration. In the M line, creatine kinase is thought to be the component that makes up the M4-M4' bridges (Wallimann et al., 1983; Wallimann and Eppenberger, 1985). 6

Skelemin is located at the periphery of M line in skeletal muscle and was suggested to play a

role in the linkage of sarcomeres to the intermediate filament cytoskeleton (Price, 1987; Price

and Gomer, 1993). Recently, it was shown that myomesin and skelemin are encoded by the

same gene. Differential splicing produces both myomesin and the skelemin polypeptide,

which contains an extra exon that encodes a serine/proline-rich region (Steiner et al., 1999).

M-protein is restricted to skeletal muscle fast fibers (Grove et al., 1985; Obermann et al.,

1996; Van der Ven and Furst, 1997). The complete cDNA sequence of M-protein revealed

that M-protein and myomesin share overall domain organization; a unique amino-terminal

head followed by immunoglobulin-fold domains (Steiner et al., 1998; Noguchi et al., 1992;

Vinkemeier et al., 1993). Immunoelectron microscope studies using antibodies against

different domains of titin, myomesin, and M-protein have indicated that the C-terminal

region of titin enters the M-band parallel to the thick filaments and crosses into the opposite

half of the sarcomere. Myomesin seems to bridge the central Ml line, is mostly oriented

parallel to the thick filaments and crosses the center of the M-band, but its N-terminus may

be perpendicular to the thick filament axis (Obermann et al., 1996).

Myofibril Assembly

Formation of sarcomeres requires the coordinate expression of the constituent

myofibrillar proteins and their precise organization into a higher order structure. Decades of

research have been devoted into understanding the spatial and temporal relationships

between myofibrillar proteins and their interactions during myofibrillogenesis. However, the exact mechanism involved in the regulation and development of sarcomere structure is still

not fully understood. 7

Native myosin molecules have the ability to form thick filaments in vitro (Huxley,

1963; Moos et al., 1975). A conserved 29 amino acid domain of the skeletal muscle myosin

rod has been identified to be both required and sufficient for assembly of myosin

subfragments into higher-ordered structures (Sohn et al., 1997). Recent studies further

showed that, in Drosophila flight muscle, myosin molecules without heads could assemble

into thick filaments, which in turn assemble with thin filaments into hexagonally packed

arrays resembling normal myoHbrils, although the thick Hlament length as well as sarcomere

length and myofibril shape are abnormal (Cripps et al., 1999). In addition to the intrinsic self-

assembly property of myosin, other factors such as MyBPs, titin, and M line proteins may

also be required for correct myosin thick filament assembly in vivo. In the presence of the

normal content of MyBP-C, synthetic thick Hlaments resemble native thick filaments much

better in their thickness, length, bare zone, and distribution of myosin heads (Maw, 1986). In

vivo expression of a mutant MyBP-C lacking the myosin-binding motif in chicken skeletal

muscle cells in culture resulted in missing cross-striations or myofibrillar disarray (Gilbert,

1996). The role of titin for thick filament assembly will be reviewed in detail later. The M

line proteins are probably responsible for the lateral alignment of thick filaments through

their interactions with myosin and titin. Myomesin interacts with myosin through its unique

N-terminal head (Obermann et al., 1997; Auerbach et al., 1999). M-protein binds the myosin

rod through its domains Mp2 and Mp3, and this interaction is prevented by PKA-dependent phosphorylation of a serine residue in the adjacent Mpl domain (Obermann et al., 1998).

Similar to myosin, purified G-actin also can polymerize spontaneously into varied- length filaments in vitro (Oosawa and Asakura, 1975), in contrast to the strikingly uniform length of thin filaments in skeletal muscle sarcomeres (for review, see Fowler, 1996). 8

During myoflbrillogenesis, multiple proteins appear to be responsible for specifically

regulating the length, polarity, stability and spatial organization of actin thin Hlaments. CapZ

is believed to nucleate actin Hlament assembly from the barbed filament end (Casella et al.,

1986; Caldwell et al., 1989). CapZ has also been proposed to target and align the barbed ends of the thin Hlaments at Z lines based on the observation that it assembles at nascent Z bodies before mature actin striations have developed in skeletal myotubes (Schafer et al., 1993).

Furthermore, when CapZ's actin capping activity is inhibited in embryonic chick skeletal myotubes by microinjection of anti-CapZ antibodies or by transfection of mutant CapZ cDNA, which abolishes the ability of CapZ to interact with actin, the organization of a- actinin into periodic Z lines and the appearance of actin striations are delayed during assembly (Schafer et al., 1995). At the pointed end, the thin filaments are capped by tropomodulin, which is a tropomyosin- and actin-binding protein (Fowler et al., 1993).

Several studies have indicated that tropomodulin is required for maintaining actin filament length and thin filament stability in vivo. Microinjection of an antibody that inhibits the actin capping activity of tropomodulin into beating embryonic chick cardiac myocytes resulted in inappropriate elongation of actin from the thin filament pointed ends (Gregorio et al., 1995).

By infection of rat cardiac myocytes with antisense adenoviral expression vectors, Sussman et al. (1998) demonstrated that reduction of tropomodulin levels leads to disappearance of mature actin striations and accumulation of non-striated actin filament bundles.

Unexpectedly, in chick cardiac myocytes, tropomodulin does not seem to be required for the initial determination of thin filament length since tropomodulin is one of the latest markers of myofibril organization. The assembly of tropomodulin into myofibrils occurs after the appearance of actin filament striations (Gregorio and Fowler, 1995). However, in chick 9

skeletal muscle cells, recent studies have shown that tropomodulin capped the thin filament

pointed ends well before the precise alignments of thin filaments into organized, mature sarcomeres (Almenar-Queralt et al., 1999).

In skeletal muscle, nebulin has been proposed as a molecular ruler for thin filament assembly mainly based on: (1) the size of nebulin correlates with the length of thin filaments in different skeletal muscles (Hu et al., 1986; Locker and Wild, 1986; Wang and Wright,

1988); and (2) nebulin sequence organization correlates with the molecular organization of the thin filament (Wang et al., 1996). In support of this hypothesis, nebulin has been shown to bind actin in vitro through its unique 3S-residue modules (Chen et al., 1993; Jin and Wang,

1991; Pfuhl et al., 1994; Root and Wang, 1994; Wang et al., 1996; Zhang et al., 1998). In addition, nebulin has also been shown in vitro to have a-actinin, myosin, , tropomyosin, and troponin binding activities (Nave et al., 1990; Jin and Wang, 1991; Root and Wang, 1994; Wang et al., 1996). Immunofluorescence staining of assembling myofibrils in differentiating chick skeletal myotubes shows that nebulin epitopes first appear in association with nascent Z bodies, and then the nebulin striations develop prior to the reorganization of a-actin into mature I bands, supporting the hypothesis that nebulin may play a role in restricting the length of the actin filaments and ordering the uniform-length thin filaments into perfect registration in the sarcomere (Moncman and Wang, 1996). The possible role of titin in maintaining thin filament structure is discussed in the later section.

Mutants of C. elegans and Drosophila and cultured myocyte models indicate that the assembly of thick and thin filaments seems to be independent of one another (Zengel and

Epstein, 1980; Karlik et al., 1984; Beall et al., 1989; Chun and Falkenthal, 1988; Vikstrom et al., 1997; Holtzer et al., 1997). Probably the best evidence comes from the studies with null 10

mutations of actin and myosin genes in Drosophila. For example, formation of aligned thick

filament arrays containing M lines is observed in Drosophila indirect flight muscle (IFM)

specific actin null mutants (Karlik et al., 1984; Beall et al., 1989). Thin fllament/Z line

assemblies are able to form in the Drosophila IFM-specific myosin null mutants (Chun and

Falkenthal, 1988). However, in the complete myosin null mutants, the formed thin filaments

are not uniform in length and the thin filaments are disorganized, suggesting the thick and

thin filament interaction regulates thin ^lament length and alignment (Beall et al., 1989).

Considerable progress has been made in the recent years to elucidate the molecular

structures of Z lines and M lines (Young et al., 1998; Obermann et al., 1996, 1997). For Z

line assembly, the interaction between a-actinin and titin seems to play a major role in the

organizing process and this will be discussed in later section. For M line assembly,

myomesin is implicated in anchoring thick filaments to titin because of its distribution in all

types of adult striated muscle (Grove et al., 1989) and its affinity for both myosin and titin

(Obermann et al., 1995, 1997). Myomesin interacts with myosin through its unique amino-

terminal head. The My2 domain of myomesin is necessary for its incorporation into the M-

band. The interaction with titin is through its My4, My5, and My6 domains. Interestingly,

PKA-dependent phosphorylation of a serine residue in the linker region between My4 and

MyS domains prevents this interaction, indicating an important regulatory role for

phosphorylation in M line assembly.

Several models have been proposed to interpret the sequence of events of myofibril assembly in vivo. The first model (Dlugosz et al., 1984), based on inmiunofluorescence studies of cultured cardiomyocytes, proposed that the so-called stress fiber-like structures

(SFLS), which formed at the periphery of spreading cardiomyocytes, might act as temporary 11

scaffolds or templates for myofibril assembly. The SFLSs are composed of actin fllaments

and other non-muscle proteins. During myofibrillogenesis, muscle specific proteins are

recruited into the SFLSs and SFLSs are eventually transformed into myofibrils. According to

this model, one SFLS is replaced by one myofibril. This model was further extended by

recent observations (Holtzer et al., 1997), made on chick skeletal and cardiac myogenic cells,

cultured mouse C2C12 myotubes, and mouse BC3H-1 myoblasts. This recent paper

suggested that I-Z-I bodies and A bands assemble separately and then intermix to form non-

striated myofibrils (NSMF). Later, NSMFs are transformed into the striated myofibrils

(SMFs) with narrow mature Z lines and definitive A bands. A recent immunofluorescence

study (Ojima et al., 1999) on the growth tips of chicken skeletal muscle myotubes showed

that the initiation of I-Z-I bodies involves the relatively concurrent and cooperative

interaction of sarcomeric a-actinin, the N-terminal of titin, a-actin, the C-terminal of

nebulin, and a recently identified Z line protein - (Mues et al., 1998; Gregorio et

al., 1998; Valle et al., 1997).

A different model postulated the importance of the so-called premyofibril, which is

formed de novo at the spreading edges of cardiomyocytes, as a precursor structure during

myofibril assembly (Rhee et al., 1994; LoRusso et al., 1997). This model is supported by the observations of the movements of a-actinin dots in living cultured cardiac cells using

rhodamine-labeled a-actinin or GFP-a-actinin, which directly demonstrate separations and

realignments of adjacent dots to form the regular Z lines of mature sarcomeres (Dabiri et al.,

1997; McKenna et al., 1986; Sanger et al., 1986). According to this model, premyoHbrils are composed of 'mini-sarcomeres', which contain narrower spaced Z lines and nonmuscle isoforms of contractile proteins such as myosin UB. Later during myofibrillogenesis, the distance between individual Z lines increases to reach the distance normally observed in the

sarcomeres, and non-muscle myosin is replaced by its muscle isoforms (Rhee et al., 1994;

LoRusso et al., 1997). However, both of the above models have been challenged by the

result of a recent study. Ehler et al (1999) showed that, when myofibrillogenesis was

observed in vivo in normally situated cells in early development of chick embryo by

confocal microscopy, no typical stress fiber-like structures or premyofibrils could be detected, suggesting these structures could be antifacts, possibly caused by the artificial two- dimensional properties of the cell culture system. Instead, they found that sarcomeric proteins

like a-actinin, titin, and actin formed dense body-like structures in cardiomyocytes that did

not yet contain myofibrils. They proposed that those dense body-like structures serve as the first organized complexes during myofibril assembly (Ehler et al., 1999).

Titin

Discovery. Titin (also named connectin), a giant protein in striated muscle, was discovered by Wang et ai. (1979) and Maruyama et al. (1977). It is the most third abundant myfibrillar protein, making up to 10% of total myofibrillar protein mass (Trinick et al., 1984;

Wang, 1985; Maruyama, 1986). By low-pcrcentage SDS polyacrylamide gel electrophoresis, titin shows a doublet band of extremely high molecular weight (Wang et al, 1979). The lower of the doublet bands (T2) is usually considered to be a proteolytic product of the upper of the doublet bands (Tl) (Wang, 1985; Maruyama, 1986; Kurzban and Wang, 1988).

Morphology and Organization in the Sarcomere. The titin molecule has been shown by electron microscopy to be a long, flexible, strings of beaded domains, carrying a globular head at one end (Maruyama et al., 1984; Trinick et al., 1984; Wang et al., 1984; Nave et al.. 1989). Individual, randomly bent titin molecules, when straightened by using centripetal force, showed a mean length of approximately 0.9 nm (Nave et al, 1989).

Early inmiunomicroscopy studies, with both polyclonal anti-titin antibodies and a series of nonrepetitive anti-titin monoclonal antibodies, revealed that single titin molecules span from Z line to M line in each half-sarcomere (Wang et al., 1979; Gassner, 1986;

Pierobon, 1992; Maruyama, 1981; Maniyama, 1984; Maruyama, 1985; Furstet al., 1988). By using novel antibodies to specific titin domains, the ultrastnictural layout of titin has been further refined within the sarcomere (Yajima et al., 1996; Obermann et al., 1996; Bennett and

Gautel, 1996; Giegorio et al., 1998). Currently, the organization of titin can be described as follows (reviewed in Kolmerer et al., 1998; and Gregorio et al., 1999): (1) The N-terminal 80 to 100 kDa of titin is anchored in the Z line, where titin molecules from opposite sarcomeres fully overlap (Gregorio et al., 1998); (2) Up to 1.5 MDa of titin spans the remainder of the half I band; (3) About 2 MDa of titin is located in the A band; and (4) About 200 kDa of the carboxyl-terminal titin is in the M line region where, as in Z lines, titin filaments from opposite half-sarcomeres fiilly overlap (Obermann et al., 1997).

Elasticity. Inmiunolabeling studies using a series of titin monoclonal antibodies have shown that, whereas the epitopes in the A band remained fixed relative to the thick filaments upon moderate stretching or shortening, the epitopes of site-specific anti-titin antibodies in the I band are movable (Furst et al., 1988, 1989; Itoh et al., 1988). Furthermore, the elastic property of the I band portion of titin is not uniform. Those I band titin epitopes within 100 nm of the Z line or within SO nm of the edge of the A band are inextensible relative to the Z line or the A band under physiological conditions, respectively (Furst et al., 1988; Trombitas and Pollack, 1993; Horowits et al., 1989; Trombitas et al., 1991). 14

Molecular structure. The complete cDNA sequence of human cardiac titin, 82 kb, was determined by Labeit and Kolmerer (1995a). The deduced polypeptide contains 26,926 amino acid residues. About 90% of titin's mass is composed of two types of repeated iOO- residue motifs, which belong to either the fibronectin type HI (Fn3) or the immunoglobulin

C2 (Ig) domain superfamilies (also referred to as motif I and motif II, respectively) (Labeit and Kolmerer, 1995a). Both of these domains were originally found in extracellular molecules involved in cell-cell recognition and then were identified in a group of intracellular muscle proteins, such as the above mentioned myomesin, M-protein, and

MyBPs. In addition, the observation that many thick filament-associated proteins contain these two domains points toward a role for these domains in mediating interactions with myosin (Furst and Gautel, 1995; Bantle et al., 1996). NMR spectroscopy studies have showed that both Fn3 and Ig domains form a similar ^-sandwich structure consisting of two anti-parallel ^-sheets with a hydrophobic core (Pfuhl and Pastore, 1995; Muhle-Goll et al.,

1997; Muhle-Goll et al., 1998).

The Ig and Fn3 domains are arranged in different patterns throughout the titin molecule. The Fn3 domains are found only in the titin A band region whereas the Ig domains are found over the entire titin molecule (Labeit and Kolmerer, 1995a). The A band titin further forms two types of super-repeats, both consisting of Fn3 and Ig domains arranged into distinct patterns (Labeit and Kolmerer, 1995a). Within the C-zone (the middle one third of each half thick filament), Fn3 and Ig domains form an eleven-domain super-pattern (-Fn3-

Fn3-Fn3-Ig-Fn3-Fn3-Fn3-Ig-Fn3-Fn3-Ig-) that is repeated eleven times. This super-repeat structure appears to correspond with the presence of the eleven 43 nm crossbridge repeats of the thick filaments within the C-zone. The A band titin at the D-zone, which is near the A-I junction, has Fn3 and Ig repeats arranged into a seven-domain-super-pattem (-Ig-Fn3-Fn3-

Ig-Fn3-Fn3-Fn3-) that is repeated seven times.

Most of the I band titin is formed by tandemly arranged Ig repeats, except in the central region around the N2 line where it contains a unique nonrepetitive segment that is

unusually rich in P (proline), E (glutamate), V (valine), and K (lysine). This segment of the central I band titin is referred to as the 'PEVK domain' (Labeit and Kolmerer, 1995a).

At the Z line, titin contains four Ig domains (Yajima et al., 1996; Gautel et al., 1996), and up to seven copies of Z-repeats (Gautel et al., 1996). The Z-repeats are 45-residue

repeating motifs that are differentially expressed among different muscle tissues.

Interestingly, the number of expressed titin Z-repeats seems to correlate to the thickness of

the Z line (Gautel et al., 1996; Ohtshuk et al., 1997b; Sorimachi et al., 1997; Peckham et al.

1997). Titin's Z-repeats form two subgroups, the two invariant flanking repeats that are most closely related to each other, and the differentially spliced central repeats (Gautel et al.,

1996).

In contrast to the ordered patterns in the central A band portion of titin, the sequence of the C-terminal region of titin in the M line forms a complex structure of Ig domains. At the periphery of the M line region, titin contains a serine/threonine protein kinase domain that is closely related to the kinase domains in invertebrate titin analogues (Labeit et al.,

1992; Benian et al., 1989; Ayme-Southgate et al., 1991; Heierhorst et al., 1994) and in myosin light chain kinase (Olson et al., 1990; Person et al., 1991).

The titin gene. In the human genome, the gene coding for titin has been mapped to a single locus on the long arm of Chromosome 2 (Labeit et al., 1990), and specifically assigned with high resolution to 2q24 (Pelin ct al., 1997) by the radiation hybrid method (Cox, 1995). 16

It was also shown, in both human and mouse, by genetic and FISH mapping studies that the

genes for titin and nebulin are in physical proximity (Muller-Seitz et al., 1993; Rossi et al.,

1994; Peiin et al., 1997). Partial titin genomic sequence data indicate that the A band-titin-

encoding region is extremely compact and contains about 80% coding DNA. In contrast, less

than 10% of the genomic DNA of the PEVK-encoding region represents coding information

(Kolmerer et al., 1999). Analysis of the exon/intron organization within the partial 3'- end

titin genomic sequence has shown that the exon/intron junctions in general locate at domain

junctions (Kolmerer et al., 1996).

Interaction of titin with other sarcomeric components and implied Junction. Three

distinct interactions of the Z line portion of titin have been identified by either using the yeast

two-hybrid system or biochemical analysis (Gregorio et al., 1998; Muse et al., 1998; Ohtsuka et al., 1997a, 1997b; Sorimachi et al., 1997; Young et al., 1998). First, the extreme N-

terminal titin Ig repeats Z1 and Z2 (residue 1-200) bind to telethonin in the periphery of the Z

line. Both the Z1 and Z2 repeats are required for binding (Gregorio et al., 1998; Mues et al.,

1998). Over-expression of either the Z1-Z2 domains or telethonin, both conjugated with the green fluorescent protein (GFP), in primary cultures of cardiac myocytes resulted in severe myofibril disruption, suggesting that their interaction is critical for the structural integrity of sarcomeres (Gregorio et al., 1998). Second, the Z-repeats, including both the flanking and central Z-repeats, can bind to the C-terminal portion of a-actinin (Gregorio et al., 1998;

Ohtsuka et al., 1997a, 1997b; Sorimachi et al., 1997; Young et al., 1998). The Z-repeat binding site on a-actinin has been mapped to a pseudo-calmodulin domain which contains a non-functional EF-hand (Ohtsuka et al., 1997b). Therefore, the titin Z-repeat region may provide multiple a-actinin binding sites, correlating the number of Z-repeats and the number 17 of Z filaments (presumably composed of a-actinin; Luther, 1991) found within the Z line region. In supporting the important structural role of the Z-repeats, a recent study (Ayoob et al., 2000) shows that over-expression of the Z-repeats conjugated with GFP leads to loss of myofibrils in chick cardiomyocytes in culture. Third, another a-actinin binding motif (70 residue) on titin, denoted as Zq, is found at the Z line edge. Zq interacts with the two central spectrin-like repeats of the a-actinin rod and this unique interaction was proposed to represent a termination motif for a-actinin incorporation into the Z line (Young et al., 1998).

Overall, the molecular layout of the Z line titin and its interactions with other Z line proteins points to the hypothesis that Z line titin may act as an organizer for Z line assembly (Gautel et al., 1996). Thus, disrupting titin interactions in the Z line region may result in abnormal Z line or myofibril structure. In addition to the above mentioned over-expression examples, other evidence also seem to be in agreement that Z line titin is critical for the assembly and maintenance of myofibril structure. Tumacioglu et al. (1997) transfected cardiomyocytes with a GFP fusion construct containing 362 amino acids of the Z line region of titin. The fluorescent fusion protein targets the a-actinin-rich Z lines of contracting myofibrils, with myofibril disassembly occurring as high amounts of titin-GFP fragments accumulated.

Peckham et al. (1997) demonstrated that over-expression of the entire Z line titin coupled with GFP leads to a disruption of sarcomere assembly in a specific myogenic cell line -

H2k^tsA58.

Using solid-phase binding assays and co-sedimentation experiments, Jin (199S) first demonstrated that a single titin fnS motif, or Ig motif with weaker affinity, is able to bind F- actin. Then Astier et al. (1998) showed a purified ISO kDa portion of titin, which corresponds to the Nl-line region of I band titin, has a high binding affinity to F-actin. Furthermore, this interaction was found to be inhibited by phosphoinositides (PIP2). Native titin also shows interactions with both filamentous actin and reconstituted thin Hlaments by in vitro motility and binding assays, and increased calcium results in enhanced binding of thin filaments to titin (Kellermayer and Granzier, 1996a). After removal of actin from rat cardiacmyocytes by gelsolin extraction, immunofluorescence microscopy reveals the increased extensibility of the previously-stiff, Z line-flanking titin, indicating that titin binds to actin filaments near the

Z line region (Linke et al., 1997). The in vivo role of the interaction between titin and actin filaments was proposed to straighten the otherwise folded titin molecule and anchor it correctly into the Z line (Gregorio et al., 1999). Recently, Linke et al. (1999) found that over- expression of the entire N2-B region of I band titin or its N-terminus in cardiomyocytes greatly disrupted thin fllament, but not thick filament, structure. This Hnding suggests the

N2-B region of I band titin contributes to the stabilization of thin filament integrity.

Titin also binds to myosin and some myosin-associated proteins. Native titin aggregates myosin rods (Maruyama et al., I98S). A single titin fh3 motif, but not the Ig motif, can bind myosin, as indicated by solid-phase binding assays and co-sedimentation experiments (Jin, 199S). The titin binding site on myosin was mapped to a short LMM-region peptide (Labeit et al., 1992; Soteriou et al., 1993; Houmeida et al., 1995). In addition, a weak interaction of titin with the HMM-region and subfragment-1 region of myosin has also been reported by using solid-phase binding assays (Wang et al., 1992). The C-zone titin's eleven- domain super-repeats are responsible for the binding to the tail portion of myosin and to

MyBP-C (Labeit et al., 1992; Houmeida et al., 1995; Freiburg and Gautel, 1996). Other thick filament proteins, such as MyBP-H, and AMP-deaminase, also showed interaction with purified titin by solid phase binding studies (Soteriou et al., 1993). The interactions and 19 primary strucnire of the A band titin appears to provide a molecular basis for titin to control the assembly and length of the thick ^laments (Labeit, 1992; Gautel 1996). For example, since the titin eleven-domain super repeats match nicely with the 43 nm thick Hlament repeat in the correspondingly repetitive patterns of attachment sites for MyBP's, titin's interactions with these proteins may correlate to the A band assembly and solve the puzzle why MyBP-C doesn't decorate all the myosin in the A band, but only stripes spaced 43 nm apart (Gautel,

1996). An immunofluorescence microscopy study, using antibodies raised against recombinant fragments of the titin sequence flanking the A band border, found a six-fh3 domain near the end of the A band titin exactly correlates with the gap in the crossbridges of myosin at the thick filament end. This six-fn3 domain was then proposed to be a thick filament termination motif and involved in the perturbed packing of myosin molecules towards the end of the thick filament (Bennett and Gautel, 1996).

At the M line region, one of the titin's Ig domains, M4, has been found to interact with myomesin in vitro (Obermann et al., 1997). This binding seems to be affected by phosphorylation of a serine residue (Ser482) in the linker between myomesin domains My4 and My5. If phosphorylated, either by cAMP-dependent kinase or by similar or identical activities in muscle extracts, myomesin can not bind to titin any more (Obermann et al.,

1997). Beside myomesin, M-protein was also found to be a component of the globular head structure of isolated titin (Nave et al., 1989; Vinkemeier et al., 1993). Like the Z line portion of titin, the M line portion of titin might also provide a blueprint for other M line proteins.

Yeast two-hybrid studies have also identified two specific binding sites for the muscle-specific calpain protease (also known as p94) in the titin molecule (Sorimachi et al.,

1995). One is at the N2-A segment within the I band; the other is in the M line region of titin (Sorimachi et al., 1995; Kinbara et al., 1997). Since the half-life of free soluble p94 is very short, the binding of p94 to titin may stablize this enzyme (Sorimachi et al., 1995).

Titin isoforms. from different striated have been shown to move differently on gels, and different sizes of titin isoforms seem to correlate with the different elastic characteristics of slow/fast skeletal muscles and cardiac muscle (Wang et al., 1991).

Different titin isoforms have been identified in various muscle types and tissues. In human striated muscle, there are four types of distinct isoforms; two cardiac and two skeletal muscle isoforms, differing in both the number of immunoglobulin domains and the length of the

PEVK region (Labeit and Kolmerer, 1995a). Titin isoforms are likely the results of differential splicing of the titin gene. This differential splicing results in possible structural and functional differences among various muscle types and tissues. As indicated above, the expression of titin isoforms in the Z line has been suggested to correlate with the different Z line widths (Sorimachi et al., 1997). In the M line, a single exon, Mex5, has been found to be differentially expressed in different types of muscle (Kolmerer et al., 1996). It was shown that the minimal binding site for the p94 protease in the M line titin includes the Mex5 domain. Binding to titin seemed to stablize the otherwise short half-life free p94. The skipping of the Mex5 exon could be involved in the pathology of muscular dystrophies

(Sorimachi et al., 1995; Kinbara et al., 1997).

Titin's kinase domain and its possible Junction. As mentioned above, titin contains a serine/threonine kinase domain at its C-terminal region. The kinase domain of titin is homologous to the myosin light chain kinase (MLCK) family (Labeit et al., 1992; Olson et al., 1990; Person et al., 1991; Sebestyen et al., 1996). Invertebrate titin analogues, such as twitchin (Benian et al., 1989), contain a similar catalytic kinase domain. Further sequence comparison and evolutionary analysis of titin, twitchin and MLCK have suggested that the titin kinase may have a different function than twitchin kinase and MLCK despite overall homology (Higgins et al., 1993). Unlike twitchin, which can phosphorylate invertebrate myosin, vertebrate titin can not phosphorylate vertebrate myosin (Heierhorst et al., 1996).

The only substrate so far identified for the titin kinase domain is telethonin, which is a Z line component in early differentiating myocytes (Mayans et al, 1998). It's still unclear how the

M line region titin kinase could access the Z line telethonin and how this phosphorylation affects sarcomere assembly. The activity of the titin kinase domain is regulated by both binding of Ca^^-calmodulin to unblock the phosphate binding site and phosphorylation of a tyrosine to activate the substrate-binding site (Mayans et al, 1998). It has been proposed that titin kinase domain is transiently in close proximity to the Z line telethonin and this phosphorylation may play a role in myofibril assembly (Mayans et al., 1998).

Phosphorylation motifs. Titin is phosphorylated in vivo, mainly on its serine residues

(Somerville and Wang, 1987, 1988). In the Z line part of titin, two phosphorylation motifs, located at the edge of the central Z line and in the Z line periphery (Gautel et al., 1996;

Young et al., 1998), can be phosphorylated in vitro by SP-specific protein serine/threonine kinases of the extracellular signal regulated kinase (ERK) family as well as by developing muscle extracts (Sebestyen et al., 1995; Gautel et al., 1996). In both regions, multiple copies of serine-proline rich motifs are inserted between the Ig domains of titin (Sebestyen et al.,

1995; Labeit and Kolmerer, 1995a). In the M line, a similar inter-domain linker contains 4 repeats of the sequence VKSP (Gautel et al., 1993). KSP-motifs are the major phosphorylation sites for the brain-specific cyclin-dependent kinase cdk5 in neurofilaments

(Lee et al., 1988; Shetty et al., 1993; Songyang et al., 1996). The kinase activities from 22

developing muscle extracts that can phosphorylate titin KSP-motifs in vitro share functional characteristics with cyclin-dependent kinase (Gautel et al., 1993). Because myogenic differentiation is likely mediated by signal transduction pathways that may involve

MAP/ERK kinase activation (Thorbum and Thorbum, 1994; Thorbum et al., 1997), the

phosphorylation of titin in both the Z line and M line region might sense the up-stream signals and control myoHbrillogenesis, including the assembly of the Z line and M line. In addition, a unique 11-residue serine-rich sequence in the A-I junction region of chicken cardiac titin was also identifled and represents a potential phosphorylation site (Tan et al.,

1993).

The physiological role of titin in striated muscle. Horowits et al. (1986) utilized low doses of ionizing radiation to fragment giant proteins present in single fibers from rabbit

psoas muscle fibers, and showed that passive tension was reduced over the same range of radiation dose that fragmented titin. Selective digestion of titin in different muscle fibers with low concentrations of trypsin gave similar results, and the decrease in passive tension was quantitatively matched by the extent of titin degradation (Funatsu et al., 1990; Higuchi, 1992;

Granzier and Irving, 1995). Further studies using trypsin treatment found that selective degradation of titin abolished the ability of isolated cardiac myocytes to re-lengthen to their original slack length following shortening (Helmes et al., 1996). These results suggest that titin is the source of passive tension, and titin functions as a bi-directional molecular spring that resists lengthening as well as shortening (Funatsu et al., 1990; Horowits et al., 1986;

Yoshioka et al., 1986).

By observing the behavior of specific titin antibodies with sarcomere stretch, two groups (Linke et al., 1996; Gautel and Goulding, 1996) have suggested that stretching of titin 23 occurs in 3 steps: (1) with small amounts of stretch above slack length, the I band Ig domain is straightened, resulting in little increase in passive tension; (2) at moderate stretch, the

PEVK domain is unraveled to develop significant passive tension; and (3) further extreme stretch may result in unfolding of the Ig domains. Thus, the titin molecules essentially contain two elements in series. The different length of the PEVK domain and the different number of expressed Ig domains may explain the tissue-specificity of muscle stiffness (Linke et al., 1996; Labeit et al., 1997).

Several groups have succeeded in studying the mechanical properties of single titin molecules by using a variety of techniques: micro-needle (Kellermayer and Granzier, 1996b); optical trap (Kellermayer et al., 1997; Tskhovrebova et al., 1997); and atomic force microscopy (Rief et al., 1997). In sunmiary of their results, the mechanical properties of isolated titin molecules are consistent with the model in which Ig-domains are straightened by low forces and the PEVK region then extends at high forces (Horowits, 1998). The mechanical experiments also indicated that stress relaxation and hysteresis are caused by the unfolding of titin Ig domains at high forces, and that refolding occurs only when the molecule is released to very low force levels (Horowits, 1998).

Titin may also play an important role in centering thick filaments, and thus preventing sarcomere asymmetry resulting from the thick filaments moving closer to one Z line than the other during contraction and passive stretch (Horowits and Podolsky, 1987; 1988).

Destruction of titin by ionizing radiation leads to axial misalignment of thick filaments upon stretch, and this disorder is irreversibly increased by activation (Horowits et al., 1986). Also, digestion of titin by trypsin results in sarcomere disorder, thick Hlaments losing their central position, and dislocation of whole A bands from the I bands (Higuchi, 1992). Titin and Myofibril Assembly

Besides acting as elastic element and centering thick filaments, titin has been suggested to act as a molecular ruler for assembly of other myofibrillar proteins into myofibrils (for a recent review, see Gregorio et al., 1999). In order to determine the developmental relationship between titin and other myofibrillar proteins, numerous immunofluorescence studies have been carried out since the late 1980s, by using a variety of antibodies against titin and other myofibrillar proteins. The role of titin in cardiac myofibril assembly was analyzed either in in vivo embryos (i.e. Tokuyasu and Maher, 1987a and

1987b; Schaart et al., 1989; Van der Loop et al., 1992), or in in vitro cultured cardiomyocytes

(i.e. Wang et al., 1988; Handel et al., 1991; Van der Loop et al., 1996a). The role of titin in skeletal myofibril assembly was also analyzed either in in vivo embryos (i.e. Shimada et al.,

1996; Furst et al., 1989), or in in vitro cultured skeletal muscle cells (i.e. Kurpakus and

Huiatt, 1986; Handel et al. 1989; Colley et al., 1990; Van der Loop et al., 1996b). Huge amounts of data have been generated (for detailed review, see Shimada et al., 1996; Fulton,

1999). For the most part, the different systems offer similar conclusions, i.e., that the sarcomeric proteins are expressed in a defined temporal order and the appearance of organized titin is usually the earliest event during myofibril assembly. Recent studies also seem to reinforce the above view. Ehler et al. (1999) studied myoHbrillogenesis in situ by confocal microscopy of immunofluorescently triple-labeled whole mount preparations of early chicken . Their results indicated a complex formed by the N-terminus of titin, a- actinin and actin is the first step in myofibril assembly. There is a short delay in the maturation of the M line epitope pattern of titin with respect to Z line epitopes and that of myomesin, which preceded that of MyBP-C. In addition, Guan et al. (1999) studied 25 myofibrillogenesis in cultured mouse embryonic stem cell-derived cardiomyocytes by immunofluorescence staining. They found that, during cardiac myofibrillogenesis, titin (Z line), a-actinin, myomesin, titin (M line), myosin, a-actin, and cardiac troponin T sequentially formed myofibrils, whereas M-protein was only organized at terminal stages.

Another similar study (Van der Ven et al., 1999) in cultured human skeletal muscle cells, also by immunofluorescence microscopy using antibodies against myofibrillar proteins, showed that first titin, then myomesin and MyBP-C gradually form a regularly arranged scaffold on nascent striated myofibrils, and Anally the myosin changes from the continuous staining of SFLS to the periodic staining for mature myofibrils, although myosin was expressed as one of the first myofibrillar proteins.

Interestingly, of all the organized mRNAs, titin mRNA was detected first and showed the earliest organized pattern by in situ hybridization with an A band titin cDNA as probe in cultured chicken skeletal muscle cells (Fulton and Alftine, 1997). Initially, titin mRNA was first in the punctuate patterns near nucleus inside the mononucleated cells. Later in mature myotubes, the titin mRNA was localized as a linear but non-periodic array at the time when titin protein already became as a periodic pattern. Eventually, titin mRNA is present as a periodic array.

Overall, these studies show titin's early organization in myoflbrillar assembly.

Taken together with its ability to interact with other myofibrillar proteins through the Z line to the M line in the sarcomere, the proposed role for titin as a molecular ruler appears to be very promising. 26

Nonmuscle and invertebrate titin-like molecules

Cellular titin. Eileitsen and Keller (1992) reported that there are titin-like, 3000 kDa proteins in brush borders of chicken intestinal epithelial cells. Antibodies to this protein cross-reacted with chicken breast muscle titin. Eilertsen et al. (1994) further reported that this protein colocalized with myosin 11 filaments in stress fibers in this terminal web domain.

Chromosomal titin. Machado et al. (1998) identified a chromosomal protein in human cells and Drosophila embryos by using a human autoimmune scleroderma serum. The cloned corresponding Drosophila gene encodes the homologue of vertebrate titin based on protein size and sequence similarity. Since condensation during mitosis is essential for separation and compaction of chromosomes, it is suggested that titin acts as a "molecular- ruler" to control the axial diameter of mitotic chromosomes.

Invertebrate titin-like proteins. Titin-like proteins have been identifled in invertebrate muscle. They all shared the common presence of the flbronectin type m and immunoglobulin

C2 domains. Twitchin, a 735 kDa protein found in C. elegans (Benian et al., 1989), is encoded by the u/tc-89 gene and is related to M line formation in C. elegans bodywall muscle sarcomeres (Benian et al., 1996). Projectin, a 1200 kDa protein, was isolated from locust flight muscle (Nave and Weber, 1990). It links the myosin filament to the Z line in locust and honeybee flight muscle. Kettin, SOOkDa, is found in arthropod muscle. It only consists of immunoglobulin C2 domains and it is an integral component of the Z line (Lakey et al.,

1993).

Titin-related muscle disease

The large size of the titin gene makes it difficult to identify any genetic disease associated with titin. However, the large size of the gene also makes it impossible to 27

completely avoid any mutation. It is likely that mutations affecting the important parts of the

gene will result in early embryonic death. In the mouse, genetic mapping studies have

positioned a locus causing progressive muscular dystrophy within the region of the titin and

the nebulin genes (Muller-Seitz et al., 1993). This genetic disease, referred to as muscular

dystrophy with myositis, is a slowly progressing muscular dystrophy characterized by

pronounced inflammatory infiltration of both the skeletal and cardiac muscles (Muller-Seitz

et al., 1993). Also, Freiburg and Gautel (1996) identified a titin-binding site within the C-

terminal region of human cardiac MyBP-C. That region is deleted in patients suffering from

the chromosome-II-associated form of familial hypertrophic . Therefore,

this disorder is likely due to thick-filament misassembly resulting from abolishing

interactions among titin, myosin, and MyBP-C.

References

Almenar-Queralt, A., Gregorio, C. C., Fowler, V. M. (1999) Tropomodulin assembles early in myoflbrillogenesis in chick skeletal muscle: evidence that thin filaments rearrange to form striated myofibrils. J. Cell Sci. 112:1111-1123.

Arimura, C., Suzuki, T., Yanagisawa, M., Imamura, M., Hamada, Y., Masaki, T. (1988) Primary structure of chicken skeletal muscle and fibroblast a-actinin deduced from cDNA sequences. Eur. J. Biochem. 177:649-655.

Astier, C., Raynaud, F., Lebart, M. C., Roustan, C., Benyamin, Y. (1998) Binding of a native titin fragment to actin is regulated by PIP2. FEBS. Lett. 429:95-98.

Auerbach, D., Bantle, S., Keller, S., Hinderling, V., Leu, M., Ehler, E., Perriard, J. C. (1999) Different domains of the M-band protein myomesin are involved in myosin binding and M-band targeting. Mol. Biol. Cell 10:1297-1308.

Ayoob, J. C., Tumacioglu, K. K., Mittal, B., Sanger, J. M., Sanger, J. W. (2000) Targeting of cardiac muscle titin fragments to the Z-bands and dense bodies of living muscle and non-muscle cells. Cell Motil. Cytoskel. 45:67-82. 28

Ayme-Southgate, A., Vigureaux, J., Benian, G., Pardue, M. (1991) Drosophila has a twitchin/titin-related gene that appears to encode projectin. Proc. Natl. Acad. Sci. USA. 88:7973-7977.

Bahler, M., Eppenberger, H. M., Wallimann, T. (1985) Myofibrillar M-band proteins represent constituents of native thick filaments, fi^yed filaments and bare zone assemblages. J. Mol. Biol. 186:381-391.

Bantle, S., Keller, S., Haussmann, I., Auerbach, D., Perriard, E., Muhlebach, S., Perriard, J. C. (1996) Tissue-specific isoforms of chicken myomesin are generated by alternative splicing. J. Biol. Chem. 271:19042-19052.

Beall, C. J., Sepanski, M. A., Fyrberg, E. A. (1989) Genetic dissection of Drosophila myofibril formation: effects of actin and myosin heavy chain null alleles. Genes Dev. 3:131-140.

Benian, G. M., Kiff, J. E., Neckelmann, N., Moerman, D. G., Waterston, R. H. (1989) Sequence of an unusually large protein implicated in regulation of myosin activity in C. elegans. Nature 342:45-50.

Benian, G. M., Tinley, T. L., Tang, X., Borodovsky, M. (1996) The Caenorhabditis elegans gene unc-89, required for muscle M line assembly, encodes a giant modular protein composed of Ig and signal transduction domains. J. Cell Biol. 132:835-848.

Bennett, P., Craig, R., Starr, R., Offer, G. (1986) The ultrastructural location of C- protein, X-protein and H-protein in rabbit muscle. J. Muscle Res. Cell Motil. 7:550-567.

Bennett, P. M., Gautel, M. (1996) Titin domain patterns correlate with the axial disposition of myosin at the end of the thick filament. J. Mol. Biol. 255:604-616.

Blanchard, A., Ohanian, V., Critchley, D. (1989) The structure and function of a-actinin. J. Muscle Res. Cell Motil. 10:280-289.

Caldwell, J. E., Heiss, S. G., Mermall, V., Cooper, J. A (1989) Effects of CapZ, an actin capping protein of muscle, on the polymerization of actin. Biochemistry 28:8506-8514.

Casella, J. F., Maack, D. J., Lin, S. (1986) Purification and initial characterization of a protein from skeletal muscle that caps the barbed ends of actin filaments. J. Biol. Chem. 261:10915-10921.

Chen, M. J., Shih, C. L., Wang, K. (1993) Nebulin as an actin zipper. A two-module nebulin fragment promotes actin nucleation and stabilizes actin filaments. J. Biol. Chem. 268:20327-20334. 29

Chun, M., Falkenthal, S. (1988) Ifm(2)2 is a myosin heavy chain allele that disrupts myofibrillar assembly only in the indirect Hight muscle of Drosophila melanogaster. J. Cell Biol. 107:2613-2621.

Colley, N. J., Tokuyasu, K. T., Singer, S. J. (1990) The early expression of myofibrillar proteins in round postmitotic myoblasts of embryonic skeletal muscle. J. Cell Sci. 95:11- 22.

Cox, D. R. (1995) Mapping with radiation hybrids. Genome Digest 4:14-15.

Craig, R., Offer, G. (1976) The location of C-protein in rabbit skeletal muscle. Proc. R. Soc. Lond. B. Biol. Sci. 192:451-461.

Cripps, R. M., Suggs J. A., Bernstein S. I. (1999). Assembly of thick filaments and myofibrils occurs in the absence of the myosin head. EMBO. J. 18:1793-1804.

Dabiri, G. A., Tumacioglu, K. K., Sanger, J. M., Sanger, J. W. (1997) Myofibrillogenesis visualized in living embryonic cardiomyocytes. Proc. Natl. Acad. Sci. USA. 94:9493- 9498.

Dennis, J. E., Shimizu, T., Reinach, F. C., Fischman, D. A. (1984) Localization of C- protein isoforms in chicken skeletal muscle: ultrastructural detection using monoclonal antibodies. J. Cell Biol. 98:1514-1522.

Dlugosz, A. A., Antin, P. B., Nachmias, V. T., Holtzer, H. (1984) The relationship between stress fiber-like structures and nascent myofibrils in cultured cardiac myocytes. J. Cell Biol. 99:2268-2278.

Duhaiman, A., Bamburg, J. (1984) Isolation of brain a-actinin. Its characterization and comparison of its properties with those of muscle a-actinins. Biochemistry 23: 1600-1608.

Ebashi, S., Ebashi, F., Maruyama, K. (1964) A new protein factor promoting contraction of actomyosin. Nature 203:645-646.

Ebashi, S., Ebashi, F. (1965) a-Actinin, a new structural protein from striated muscle. I. Preparation and action on actomyosin-ATP interaction. J. Biochem. 58:7-12.

Ebashi, S., Kodama, A., Ebashi, F. (1968) Troponin. J. Biochem. 64:465-477.

Ehler, E., Rothen, B. M., Hammerie, S. P., Komiyama, M., Perriard, J. C. (1999) Myofibrillogenesis in the developing chicken heart: assembly of Z-disk, M line and the thick filaments. J. Cell Sci.112:1529-1539. 30

Eilertsen, K. J., Keller, T. C. S. (1992) Identification and characterization of two huge protein components of the brush border cytoskeleton: Evidence for a cellular isoform of titin. J. Cell Biol. 119:549-557.

Eilertsen, K. J., Kazmierski, S. T., Keller, T. C. S. (1994) Cellular titin localization in stress fibers and interaction with myosin 11 Hlaments in vitro. J. Cell Biol. 126:1201-1210.

Fowler, V. M., Sussmann, M. A., Miller, P. G., Flucher, B. E., Daniels, M. P. (1993) Tropomodulin is associated with the free (pointed) ends of the thin filaments in rat skeletal muscle. J. Cell Biol. 120: 411-420.

Fowler, V. M. (1996) Regulation of actin filament length in erythrocytes and striated muscle. Curr. Opin. Cell Biol. 8:86-96.

Freiburg, A., Gautel, M. (1996) A molecular map of the interaction between titin and myosin-binding protein C. Implications for sarcomeric assembly in familiar hypertrophic cardiomyopathy. Eur. J. Biochem. 235:317-323.

Fulton, A. B. (1999) The elastic filament system in . Rev. Physiol. Biochem. Pharmacol. 138:139-164.

Fulton, A. B., Alftine, C. (1997) Organization of protein and mRNA for titin and other myofibril components during myofibrillogenesis in cultured chicken skeletal muscle. Cell Struct. Funct. 22:51-58.

Funatsu, T., Higuchi, H., Ishiwata, S. (1990) Elastic filaments in skeletal muscle revealed by selective removal of thin filaments with plasma gelsolin. J. Cell Biol. 110:53-62.

Furst, D. O., Gautel, M. (1995) The of a molecular giant: how the sarcomere cytoskeleton is assembled from immunoglobulin superfamily molecules. J. Mol. Cell Cardiol. 27:951-959.

Furst, D. O., Osbom, M., Nave, R., Weber, K. (1988) The organization of titin filaments in the half sarcomere revealed by monoclonal antibodies in immunoelectron microscopy: A map of ten non-repetitive epitopes starting at the Z line extends close to the M line. J. Cell Biol. 106:1563-1572.

Furst, D. O., Osbom, M., Weber, K. (1989) Myogenesis in the mouse embryo: differential onset of expression of myogenic proteins and the involvement of titin in myofibril assembly. J. Cell Biol. 109:517-527.

Gassner, D. (1986) Myofibrillar interaction of blot inmiunoaffinity-purified antibodies against native titin as studied by direct immunofluorescence and inmiunogold staining. Eur. J. Cell Biol. 40:176-184. 31

Gautel, M., Leonard, K., Labeit, S. (1993) Phosphorylation of KSP-motifs in the C-terminal region of titin in differentiating myoblasts. EMBO. J. 12:3827-3834.

Gautel, M. (1996) The super-repeats of titin/connectin and their interactions: glimpses at sarcomeric assembly. Adv. Biophys. 33:27-37.

GauteJ, M., Goulding, D. (1996) A molecular map of titin/connectin elasticity reveals two different mechanisms acting in series. FEES. Lett. 385:11-14.

Gautel, M., Goulding, D., Bullard, B., Weber, K., Furst, D. O. (1996) The central Z-disk region of titin is assembled from a novel repeat in variable copy numbers. J. Cell Sci. 109:2747-2754.

Gilbert, R., Kelly, M. G., Mikawa, T., Fischman, D. A. (1996) The carboxyl terminus of myosin bin^ng protein-C (MyBP-C, C-protein) specifies incorporation into the A band of striated muscle. J. Cell Sci.109:101-111.

Granzier, H. L., Irving, T. C. (1995) Passive tension in cardiac muscle: contribution of collagen, titin, microtubules, and intermediate filaments. Biophys. J. 68:1027-1044.

Gregorio, C. C., Fowler, V. M. (1995) Mechanisms of thin Hlament assembly in embryonic chick cardiac myocytes: tropomodulin requires tropomyosin for assembly. J. Cell Biol. 129:683-95.

Gregorio, C. C, Trombitas, K., Centner, T., Kolmerer, B., Stier, G., Kunke, K., Suzuki, K., Obermayr, F., Herrmann, B., Granzier, H., Sorimachi, H., Labeit, S. (1998) The NIC terminus of titin spans the Z-disc: its interaction with a novel 19 kD ligand (T-cap) is required for sarcomeric integrity. J. Cell Biol. 143:1013-1027.

Gregorio, C. C., Granzier, H., Sorimachi, H., Labeit, S. (1999) Muscle assembly: a titanic achievement? Curr. Opin. Cell Biol. 11:18-25.

Grove, B. K., Kurer, V., Lehner, C., Doetschman, T. C., Perriard, J.-C., Eppenberger, H. M. (1984) A new 185,000-dalton skeletal muscle protein detected by monoclonal antibodies. J. Cell Biol. 98:518-524.

Grove, B. K, Cemy, L., Perriard, J. C., Eppenberger, H. M. (1985) Myomesin and M-protein: expression of two M-band proteins in pectoral muscle and heart during development. J. Cell Biol. 101:1413-1421.

Grove, B. K., Cemy, L., Perriard, J. C., Eppenberger, H. M., Thomell, L. E. (1989) Fiber type-specific distribution of M-band proteins in chicken muscle. J. Histochem. Cytochem. 37:447-454. 32

Guan, K., Furst, D. O., Wobus, A. M. (1999) Modulation of sarcomere organization during embryonic stem cell-derived cardiomyocyte differentiation. Eur. J. Cell Biol. 78:813-23.

Handel, S. E., Wang, S. M., Greaser, M. L., Schultz, E., Bulinski, J. C., Lessard, J. L. (1989) Skeletal muscle myoHbrillogenesis as revealed with a monoclonal antibody to titin in combination with detection of the a- and y-isoforms of actin. Dev. Biol. 132:35- 44.

Handel, S. E., Greaser, M. L., Schultz, E., Wang, S. M., Bulinski, J. C., Lin, J. J., Lessard, J. L. (1991) Chicken cardiac myofibrillogenesis studied with antibodies specific for titin and the muscle and nonmuscle isoforms of actin and tropomyosin. Cell Tiss. Res. 263:419-430.

Hanson, J., Lowy, J. (1963) The structure of F-actin and of actin filaments isolated from muscle. J. Mol. Biol. 6: 46-60.

Heierhorst, J., Probst, W., Vilim, F., Buku, A., Weiss, K. (1994) Autophosphorylation of molluscan twitchin and interaction of its kinase domain with calcium/calmodulin. J. Biol. Chem. 269:21086-21093.

Heierhorst, J., Kobe, B., Feil, S., Parker, M. W., Benian, G. M., Weiss, K. R., Kemp, B. (1996) Ca2+/S100 regulation of giant protein kinase. Nature 380:636-639.

Higgins, D., Labeit, S., Gautel, M., Gibson, T. (1993) The evolution of titin and related giant muscle proteins. J. Mol. Evolution 38:395-404.

Higuchi, H. (1992) Changes in contractile properties with selective digestion of connectin (titin) in skinned Hbers of frog skeletal muscle. J. Biochem. 111:291-295.

Helmes, M., Trombitas, K., Granzier, H. (1996) Titin develops restoring force in rat cardiac myocytes. Circ. Res. 79:619-626.

Holtzer, H., Hijikata, T., Lin, Z. X., Zhang, Z. Q., Holtzer, S., Protasi, F., Franzini- Armstrong, C., Sweeney, H. L. (1997) Independent assembly of 1.6 microns long bipolar MHC filaments and I-Z-I bodies. Cell Struct. Funct. 22:83-93.

Horowits, R., Kempner, E. S., Bisher, M. E., Podolsky, R. J. (1986) A physiological role for titin and nebulin in skeletal muscle. Nature 323:160-164.

Horowits, R., Podolsky, R. J. (1987) The positional stability of thick filaments in activated skeletal muscle depends on sarcomere length: evidence for the role of titn filaments. J. Cell Biol. 105:2217-2223.

Horowits, R., Podolsky, R. J. (1988) Thick filament movement and isometric tension in activated skeletal muscle. Biophys. J. 54:165-171. 33

Horowits, R., Maruyama, K., Podolsky, R. J. (1989) Elastic behavior of connectin Hlaments during thick filament movement in activated skeletal muscle. J. Cell Biol. 109:2169- 2176.

Horowits, R. (1998) The physiological role of titin in striated muscle. Rev. Physiol. Biochem. Pharmacol. 138:57-96.

Houmeida, A., Holt, J., Tskhovrebova, L., Trinick, J. (1995) Studies of the interaction between titin and myosin. J. Cell Biol. 131:1471-1481.

Hu, D. H., Kimura, S., Maruyama, K. (1986) Sodium dodecyl sulfate gel electrophoresis studies of connectin-like high molecular weight proteins of various types of vertebrate and invertebrate muscles. J. Biochem. 99:1485-1492.

Huxley, H. E. (1963) Electron microscope studies on the structure of natural and synthetic protein filaments from striated muscle. J. Mol. Biol. 7:281-308.

Huxley, H. E. (1967) Recent X-ray diffraction and electron microscope studies of Striated muscle. J. Gen. Physiol. 50:71-81.

Huxley, H. E. (1972) Molecular basis of contraction in cross-striated muscle, ed. G. Bourne., pp. 302-387. New Yoric: Academic.

Itch, Y., Suzuki, T., Kimura, S., Ohashi, K., Higuchi, H., Sawada, H., Shimizu, T., Shibata, M., Maruyama, K. (1988) Extensible and less-extensible domains of connectin filaments in stretched vertebrate skeletal muscle sarcomeres as detected by immunofluorescence and immunoelectron microscopy using monoclonal antibodies. J. Biochem. 104:504- 508.

Jin, J. P., Wang, K. (1991) Cloning, expression, and protein interaction of human nebulin fragments composed of varying numbers of sequence modules. J. Biol. Chem. 266:21215-21223.

Jin, J. P. (1995) Cloned rat cardiac titin class I and class n motifs. Expression, purification, characterization, and interaction with F-actin. J. Biol. Chem. 270:6908-6916.

Karlik, C. C., Coutu, M. D., Fyrberg, E. A. (1984) A nonsense mutation within the act88F actin gene disrupts myofibril formation in Drosophila indirect flight muscles. Cell 38:711-719.

Kellermayer, M. S., Granzier, H. L. (1996a) Calcium-dependent inhibition of in vitro thin filament motility by native titin. FEBS. Lett. 380:281-286. 34

Kellermayer, M. S., Granzier, H. L. (1996b) Elastic properties of single titin molecules made visible through fluorescent F-actin binding. Biochem. Biophys. Res. Commun. 221:491- 497.

Kellermayer, M. S., Smith, S. B., Granzier, H. L., Bustamante, C. (1997) Folding-unfolding transitions in single titin molecules characterized with laser tweezers. Science 276:1112- 1116.

Kinbara, K., Sorimachi, H., Ishiura, S., Suzuki, K. (1997) Muscle-specific calpain, p94, interacts with the extreme C-terminal region of connectin, a unique region flanked by two immunoglobulin C2 motifs. Arch. Biochem. Biophys. 342:9^-107.

Kolmerer, B., Olivieri, N., Witt, C. C., Herrmann, B. G., Labeit, S. (1996) Genomic organization of the M line titin and its tissue-specific expression in two distinct isoforms. J. Mol. Biol. 256:556-563. .

Kolmerer, B., Witt, C. C., Freiburg, A., Millevoi, S., Stier, G., Sorimachi, H., Pelin, K., Carrier, L., Schwartz, K., Labeit, D., Gregorio, C. C., Linke, W. A., Labeit, S. (1999) The titin cDNA sequence and partial genomic sequences: insights into the molecular genetics, cell biology and physiology of the titin Hlament system. Rev. Physiol. Biochem. Pharmacol. 138:19-55.

Kurzban, G. P., Wang, K. (1988) Giant polypeptides of skeletal muscle titin: sedimentation equilibrium in guanidine hydrochloride. Biochem. Biophys. Res. Commun. 150:1155- 1161.

Labeit, S., Barlow, D. P., Gautel, M., Gibson, T., Holt, J., Hsieh, C. L., Francke, U., Leonard, K, Wardale, J., Whiting, A., Trinick, J. (1990) A regular pattern of two types of 100- residue motif in the sequence of titin. Nature 345:273-276.

Labeit, S., Gautel, M., Lakey, A., Trinick, J. (1992) Towards a molecular understanding of titin. EMBO. J. 11:1711-1716.

Labeit, S., Kolmerer, B. (1995a) Titins: Giant proteins in charge of muscle ultrastructure and elasticity. Science 270:293-296.

Labeit, S., Kolmerer, B. (1995b) The complete primary structure of human nebulin and its correlation to muscle structure. J. Mol. Biol. 248:308-315.

Labeit, S., Kolmerer, B., Linke, W. A. (1997) The giant protein titin. Emerging roles in physiology and pathophysiology. Ciic. Res. 80:290-294.

Lakey, A., Labeit, S., Gautel, M., Ferguson, C., Barlow, D. P., Leonard, K., Bullard, B. (1993) Kettin, a large modular protein in the Z-disc of insect muscle. EMBO. J. 12:2863- 2871. 35

Lee, v., Otvos, L., Garden, J., Hollosi, M., Dietzschold, B., Lazzaiini, R. A. (1988) Identification of the major multiphosphorylation site in mammalian neurofllaments. Proc. Natl. Acad. Sci. USA. 85:1998-2002.

Lin, Z., Lu, M., Schultheiss, T., Choi, J., Holtzer, S., DiLullo, C., Fischman, D. A., Holtzer, H., Locker, R. H., Wild, D. J. (1986) A comparative study of high molecular weight proteins in various types of muscle across the animal kingdom. J. Biochem. 99:1473- 1484.

Linke, W. A., Ivemeyer, M., Olivieri, N., Kolmerer, B., Ruegg, J. C., Labeit, S. (1996) Towards a molecular understanding of the elasticity of titin. J. MoL Biol. 261:62-71.

Linke, W. A., Ivemeyer, M., Labeit, S., Hinssen, H., Ruegg, J. C., Gautel, M. (1997) Actin -titin interaction in cardiac myoHbrils: probing a physiological role. Biophys. J. 73:905- 919.

Linke, W. A., Rudy, D. E., Cenmer, T., Gautel, M., Witt, C., Labeit, S., Gregorio, C. C. (1999) I band titin in cardiac muscle is a three-element molecular spring and is critical for maintaining thin filament structure. J. Cell Biol. 146:631-644.

LoRusso, S. M., Rhee, D., Sanger, J. M., Sanger, J. W. (1997) Premyofibrils in spreading adult cardiomyocytes in tissue culture: evidence for reexpression of the embryonic program for myofibrillogenesis in adult cells. Cell Motil. Cytoskel. 37:183-198.

Lowey, S., Goldstein, L., Cohen, C., Luck, M. (1967) Proteolytic degradation of myosin and the meromyosins by a water-insoluble polyanionic derivative of trypsin. J. Mol. Biol. 34:287-304.

Luther, P. K. (1991) Three-dimensional reconstruction of a simple Z-band in fish muscle. J. Cell Biol. 113:1043-1055.

Machado, C,. Sunkel, C. E., Andrew, D. J. (1998) Human autoantibodies reveal titin as a chromosomal protein. J. Cell Biol. 141:321-333.

Maruyama, K., Matsubara, S., Natori, R., Nonomura, Y., Kimura, S., Ohashi, K., Murakami, P., Handa, S., Eguchi, G. (1979) Connectin, an elastic protein of muscle: characterization and function. J. Biochem. 82:317-337.

Maruyama, K., Kimura, S., Ohashi, K., Kuwano, Y. (1981) Connectin, an elastic protein of muscle. IdentiHcation of titin with connectin. J. Biochem. 89:701-709.

Maruyama, K., Sawada, H., Kimura, S., Ohashi, K., Higuchi, H., Umazume, Y. (1984) Connectin filaments in stretched skinned fibers of frog skeletal muscle. J. Cell Biol. 99:1391-1397. 36

Maruyama, K., Kimura, S., Yoshidomi, H., Sawada, H., Kilcuchi, M. (1984) Molecular size and shape of beta-connectin, an elastic protein of striated muscle. J. Biochem. 95:1423- 1433.

Maruyama, K., Yoshioka, T., Higuchi, H., Ohashi, K., Kimura, S., Natori, R. (1985) Connectin filaments link thick filaments and Z lines in frog skeletal muscle as revealed by immunoelectron microscopy. J. Cell Biol. 101:2167-2172.

Maruyama, K. (1986) Connectin, an elastic Hlamentous protein from striated muscle. Int. Rev.Cytol. 104:81-114.

Maruyama, K., Kurokawa, H., Oosawa, M., Shimaoka, S., Yamamoto, H., Ito, M., Maruyama, K. (1990) Beta-actinin is equivalent to CapZ protein . J. Biol. Chem. 265: 8721-8715.

Masaki, T., Takaiti, O. (1974) M-protein. J. Biochem. 75:367-380.

Maw, M. C., Rowe, A. J. (1986) The reconstruction of myosin Hlaments in rabbit psoas muscle from solubilized myosin. J. Muscle Res. Cell Motil. 7:97-109.

Mayans, O., Van der Ven, P. F., Wilm, M., Mues, A., Young, P., Furst, D. O., Wilmanns, M., Gautel, M. (1998) Structural basis for activation of the titin kinase domain during myofibrillogenesis. Nature 395:863-869.

McKenna, N. M., Johnson, C. S., Wang, Y. L. (1986) Formation and alignment of Z lines in living chick myotubes microinjected with rhodamine-labeled a-actinin. J. Cell Biol. 103:2163-2171.

Moncman, C. L., Wang, K. (1995) Nebulette: a 107 kD nebulin-like protein in cardiac muscle. Cell Motil. Cytoskel. 32:205-225.

Moncman, C. L., Wang, K. (1996) Assembly of nebulin into the sarcomeres of avian skeletal muscle. Cell Motil. Cytoskel. 34:167-184.

Moos, C., Offer, G., Starr, R., Bennett, P. (1975) Interaction of C-protein with myosin, myosin rod and light meromyosin. J. Mol. Biol. 97:1-9.

Mues, A., Van der Ven, P. F. M., Young, P., Furst, D. O., Gautel, M. (1998) Two immunoglobulin-Uke domains of the Z-disc portion interact in a conformation-dependent way with telethonin. FEBS. Lett. 428:111-114.

Muhle-Goll, C., Nilges, M., Pastore, A. (1997) IH and 15N NMR resonance assignments and secondary structure of titin type I domains. J. Biomol. NMR. 9:2-10. 37

Muhle-Goll, C., Pastore, A., Nilges, M. (1998) The three-dimensional structure of a type I module from titin: a prototype of intracellular fibronectin type HI domains. Structure 6:1291-1302.

Muller-Seitz, M., Kaupmann, K., Labeit, S., Jockusch, H. (1993) Chromosomal localization of the mouse titin gene and its relation to "muscular dystrophy with myositis" and nebulin genes on chromosome 2. Genomics 18:559-561.

Nave, R., Furst, D. O., Weber, K. (1989) Visualization of the polarity of isolated titin molecules: a single globular head on a long titin rod as the M band anchoring domain? J. Cell Biol. 109:2177-2187.

Nave, R., Weber, K. (1990) A myofibrillar protein of insect muscle related to vertebrate titin connects Z-band and A band: purification and molecular characterization of invertebrate mini-titin. J. Cell Sci. 95:535-544.

Nave, R., Furst, D. O., Weber, K. (1990) Interaction of a-actinin and nebulin in vitro. Support for the existence of a fourth filament system in skeletal muscle. FEBS. Lett. 269:163-166.

Noguchi, J., Yanagisawa, M., Imamura, M., Kasuya, Y., Sakurai, T., Tanaka, T., Masaki, T. (1992) Complete primary structure and tissue expression of chicken pectoralis M- protein. J. Biol. Chem. 267:20302-20314.

Obermann, W., Plessmann, U., Weber, K., Furst, D. O. (1995) Purification and biochemical characterization of myomesin, a myosin and titin binding protein, from bovine skeletal muscle. Eur. J. Biochem. 233:110-115.

Obermann, W. M, Gautel, M., Steiner, F, Van der Veen, P. F. M., Weber, K., Furst, D. O. (1996) The structure of the sarcomeric M band: localization of defined domains of myomesin, M protein, and the 250 kDa carboxyl terminal region of titin by immunoelectron microscopy. J. Cell Biol. 134:1441-1453.

Obermann, W. M., Gautel, M., Weber, K., Furst, D. O. (1997) Molecular structure of the sarcomeric M band: mapping of titin and myosin binding domains in myomesin and the identification of a potential regulatory phosphorylation site in myomesin. EMBO. J. 16:211-220.

Obermann, W. M. J., Van der Ven, P. F. M., Steiner, F., Weber, K., Furst, D. O. (1998) Mapping of a myosin-binding domain and a regulatory phosphorylation site in M- protein, a structural protein of the sarcomeric M band. Mol. Biol. Cell 9:829-840.

Offer, G., Moos, C., Starr, R. (1973) A new protein of the thick filaments of vertebrate skeletal myofibrils. Extractions, purification and characterization. J. Mol. Biol. 74:653-676. 38

Ohtsuka, H., Yahami, H., Kimura, S., Maruyama, K. (1997a) Binding of the N terminal fragment of connectin/titin to a-actinin as revealed by yeast two-hybrid systems. FEBS. Lett. 401:65-67.

Ohtsuka, H., Yahami, H., Maruyama, K., Kimura, S. (1997b). The N-Terminal Z repeat 5 of connectin/titin binds to the C-terminal region of a-actinin. Biochem. Biophys. Res. Commun. 235:1-3.

Ojima, K., Lin, Z. X., Zhang, Z. Q., Hijikata, T., Holtzer, S., Labeit, S., Sweeney, H. L., Holtzer, H. (1999) Initiation and maturation of I-Z-I bodies in the growth tips of transfected myotubes. J. Cell Sci. 112:4101-4112.

Olson, N. J., Person, R., Needleman, D., Hurwitz, M., Kemp, B., Means, A. (1990) Regulatory and structural motifs of chicken gizzard myosin light chain kinase. Proc. Natl. Acad. Sci. USA. 87:2284-2288.

Oosawa, F., Asakura, S. (1975) Thermodynamics of the polymerization of Protein, ed. B. Horecker., N. O. Kaplan., J. Marmur., H. A. Scheraga., pp 1-194. New York: Academic.

Peckham, M., Young, P. and Gautel, M. (1997). Constitutive and Variable Regions of Z-disk Titin/Connectin in Myofibril Formation: A Dominant-negative Screen. Cell Struct. Funct. 22:95-101.

Pelin, K., Ridanpaa, M., Donner, K., Wilton, S., Krishnarajah, J., Laing, N., Kolmerer, B., Millevoi, S., Labeit, S., De La Chapelle, A., Wallgren-Pettersson, C. (1997) Refmed localization of the genes for nebulin and titin on chromosome 2q allows the assignment of nebulin as a candidate gene for autosomal recessive nemaline myopathy. Eur. J. Hum. Genet. 5:229-234.

Pepe, F. A. (1967) The myosin filament. I. Structural organization from antibody Staining observed in electron microscopy. J. Mol. Biol. 27:203-225.

Person, R. B., Kemp, B. E. (1991) Protein kinase phosphorylation site sequences and consensus specifity motifs: tabulations. Meth. Enzymol. 201:62-81.

Pierobon, B. S., Biral, D., Betto, R., Salviati, G. (1992) Immunoelectron microscopic epitope locations of titin in rabbit heart muscle. J. Muscle Res. Cell Motil. 13:35-38.

Pfuhl, M., Pastore, A. (1995) Tertiary structure of an immunoglobulin-like domain from the giant muscle protein titin: a new member of the I set. Structure 3:391-401.

Pfuhl, M., Winder, S. J., Pastore, A. (1994) Nebulin, a helical actin binding protein. EMBO. J. 13:1782-1789. 39

Pfuhl, M., Winder, S. J., Morelli, M. A., Labeit, S., Pastore, A. (1996) Correlation between conformational and binding properties of nebulin repeats. J. Mol. Biol. 257:367-384.

Price, M. G. (1987) Skelemins: cytoskeletal proteins located at the periphery of M-discs in mammalian striated muscle. J. Cell Biol. 104:1325-1336.

Price, M. G., Gomer, R. H. (1993) Skelemin, a cytoskeletal M-disc periphery protein, contains motifs of adhesion/recognition and intermediate Hlament proteins. J. Biol. Chem. 268:21800-21810.

Reinach, F. C., Masaki, T., Shafiq, S., Obinata, T., Fischman, D. A. (1982) Isoforms of C-protein in adult chicken skeletal muscle: detection with monoclonal antibodies. J. Cell Biol. 95:78-84.

Rhee, D., Sanger, J. M., Sanger, J. W. (1994) The premyofibril: evidence for its role in myoHrbillogenesis. Cell Motil. Cytoskel. 28:1-24.

Rief, M., Gautel, M., Oesterhelt, F., Fernandez, J. M., Gaub, H. E. (1997) Reversible unfolding of individual titin immunoglobulin domains by AFM. Science 276:1109-1112.

Robson, R. M. (1989) Intermediate filaments. Curr. Opin. Cell Biol. 1:36-43.

Root, D. D., Wang, K. (1994) Calmodulin-sensitive interaction of human nebulin fragments with actin and myosin. Biochemistry 33:12581-12591.

Rossi, E., Faiella, A., Zeviani, M., Labeit, S., Floridia, G., Brunelli, S., Canmiarata, M., Boncinelli, E., Zuffardi, O. (1994) Order of six loci at 2q24-q31 and orientation of the HOXD locus. Genomics 24:34-40.

Sanger, J. M., Mittal, B., Pochapin, M. B., Sanger, J. W. (1986). Myofibrillogenesis in living cells microinjected with fluorescently labeled a-actinin. J. Cell Biol. 102:2053- 2066.

Schaart, G., Viebahn, C., Langmann, W., Ramaekers, F. (1989) Desmin and titin expression in early postimplantation mouse embryos. Development 107:585-596.

Schafer, D. A., Waddle, J. A., Cooper, J. A. (1993) Localization of CapZ during myofibrillogenesis in cultured chicken muscle. Cell Motil. Cytoskel. 25:317-35.

Schafer, D. A., Hug, C., Cooper, J. A. (1995) Inhibition of CapZ during myofibrillogenesis alters assembly of actin filaments. J. Cell Biol. 128:61-70.

Schultheiss, T., Lin, Z. X., Lu, M. H., Murray, J., Fischman, D. A., Weber, K., Masaki, T., Imamura, M., Holtzer, H. (1990) Differential distribution of subsets of myofibrillar proteins in cardiac nonstriated and striated myofibrils. J. Cell Biol. 110:1159-1172. 40

Sebestyen, M. G., Fritz, J. D., Wolff, J. A., Greaser, M. L. (1996) Primary structures of the kinase domain region of rabbit skeletal and cardiac titin. J. Muscle Res. Cell Motil. 17:343-348.

Shetty, K. T., Link, W. T., Pant, H. C. (1993) Cdc2-like kinase from rat spinal cord specifically phosphorylates KSPXK motifs in neurofilament proteins: isolation and characterization. Proc. Natl. Acad. Sci. USA. 90:6844-6848.

Shimada, Y., Komiyama, M., Begum, S., Maniyama, K. (1996) Development of connectin/titin and nebulin in striated muscles of chicken. Adv. Biophys. 33:223-233.

Small, J. v., Furst, D. O., Thomell, L. E. (1992) The cytoskeletal lattice of muscle cells. Eur. J. Biochem. 208:559-572.

Songyang, Z., Lu, K. P., Kwon, Y. T., Tsai, L. H., Filhol, O., Cochet, C., Brickey, D. A., Soderling, T. R., Bartleson, C., Graves, D. J., DeMaggio, A. J., Hoekstra, M. F., Blenis, J., Hunter, T., Cantley, L. C. (1996) A structural basis for substrate specificities of protein Ser/Thr kinases: Primary sequence perference of Casein Kinase I and U, Phosphorylase Kinase, Calmodulin-^pendent Kinase II, CDK5 and Erkl. Mol. Cell Biol. 16:6486-6493.

Sohn, R. L., Vikstrom, K. L., Strauss, M., Cohen, C., Szent-Gyorgyi, A.G., Leinwand, L. A. (1997) A 29 residue region of the sarcomeric myosin rod is necessary for filament formation. J. Mol. Biol. 266:317-330.

Solaro, R. J., Rarick, H. M. (1998) Troponin and Tropomyosin: proteins that switch on and tune in the activity of cardiac . Circ. Res. 83:473-480.

Sommerville, L. L., Wang, K. (1987) In vivo phosphorylation of titin and nebulin in frog skeletal muscle. Biochem. Biophys. Res. Commun. 147:986-992.

Sommerville, L. L., Wang, K. (1988) Sarcomere matrix of striated muscle: In vivo phosphorylation of titin and nebulin in mouse diaphragm muscle. Arch. Biochem. Biophys. 262:118-129.

Sorimachi, H., Kinbara, K., Kimura, S., Takahashi, M., Ishiura, S., Sasagawa, N., Sorimachi, N., Shimada, H., Tagawa, K., Maruyama, K., Suzuki, K. (1995) Muscle-specific calpain, p94, responsible for limb girdle muscular dystrophy type 2A, associates with connectin through IS2, a p94-specific sequence. J. Biol. Chem. 270:31158-31162.

Sorimachi, H., Freiburg, A., Kolmerer, B., Ishiura, S., Stier, G., Gregorio, C. C., Labeit, D., Linke, W. A., Suzuki, K., Labeit, S. (1997) Tissue-specific expression and a-actinin binding properties of the Z-disc titin: implications for the nature of vertebrate Z-discs. J. Mol. Biol. 270:688-695. 41

Soteriou, A., Gamage, M., Trinick, J. (1993) A survey of interactions made by the giant protein titin. J. Cell Sci. 104:119-123.

Squire, J. (1981) The Structural Basis of Muscular Contraction. Plenum Press, New York. pp. 344-362.

Starr, R., Offer, G. (1983) H-protein and X-protein. Two new components of the thick filaments of vertebrate skeletal muscle J. Mol. Biol. 170:675-698.

Steiner, F., Weber, K., Furst, D. O. (1998) Structure and expression of the gene encoding murine M-protein, a sarcomere-speciHc member of the inununoglobulin superfamily. Genomics 49:83-95.

Steiner, F., Weber, K., Furst, D. O. (1999) M band proteins myomesin and skelemin are encoded by the same gene: analysis of its organization and expression. Genomics 56:78- 89.

Strehler, E. E., Carlsson, E., Eppenberger, H. M., Thomell, L. E. (1983) Ultrastructural localization of M band proteins in chicken breast muscle as revealed by combined immunocytochemistry and ultramicrotomy. J. Mol. Biol. 166:141-158.

Sussman, M. A., Baque, S., Uhm, C. S., Daniels, M. P., Price, R. L., Simpson, D., Terracio, L., Kedes, M. (1998) Altered expression of tropomodulin in cardiomyocytes disrupts the sarcomeric structure of myofibrils. Circ. Res. 82:94-105.

Suzuki, A., Goll, D. E., Singh, I., Allen, R. E., Robson, R. M., Stromer, M. H. (1976) Some properties of purified skeletal muscle a-actinin. J. Biol. Chem. 251:6860-6870.

Tan, K. O., Sater, G. R., Myers, A. M., Robson, R. M., Huiatt, T. W. (1993) Molecular characterization of avian muscle titin. J. Biol. Chem. 268:22900-22907.

Thorbum, J., Thorbum, A. (1994) The tyrosine kinase inhibitor, genistein, prevents a-adrenergic-induced cardiac muscle cell hypertophy by inhibiting activation of the Ras- Map kinase signaling pathway. Biochem. Biophys. Res. Commun. 202:1586-1591.

Thorbum, J., Xu, S., Thorbum, A. (1997) MAP kinase- and Rho-dependent signals interact to regulate gene expression but not actin morphology in cardiac muscle cells. EMBO.J. 16:1888-1900.

Tokuyasu, K. T., Maher, P. A. (1987a) Inununocytochemical studies of cardiac myofibrillogenesis in early chick embryos. I. Presence of inmiunofluorescent titin spots in premyofibril stages. J. Cell Biol. 105:2781-2793. 42

Tokuyasu, K. T., Maher, P. A. (1987b) Immunocytochemical studies of cardiac myoflbriliogenesis in early chick embryos, n. Generation of a-actinin dots within titin spots at the time of the first myofibril formation. J. Cell Biol. 105:2795-2801.

Trinick, J., Knight, P., Whiting, A. (1984) Purification and properties of native titin. J. Mol. Biol. 180:331-356.

Trombitas, K., Baatsen, P. H., Kellermayer, M. S., Pollack, G. H. (1991) Nature and origin of gap filaments in striated muscle. J. Cell Sci.100:809-814.

Trombitas, K., Pollack, G. H. (1993) Elastic properties of the titin filament in the Z line region of vertebrate striated muscle. J. Muscle Res. Cell Motil. 14:416-422.

Tskhovrebov, L., Trinick, J., Sleep, J. A., Simmons, R. M. (1997) Elasticity and unfolding of single molecules of the giant muscle protein titin. Nature 387:308-312.

Tumacioglu, K. K., Mittal, B., Dabiri, G. A., Sanger, J. M., Sanger, J. W. (1997) An N -terminal fragment of titin coupled to green fluorescent protein localizes to the Z-bands in living muscle cells: overexpression leads to myofibril disassembly. Mol. Biol. Cell 8:705-717.

Turner, D. C., Wallimann, T., Eppenberger, H. M. (1973) A protein that binds specifically to the M line of skeletal muscle is identified as the muscle form of creatine kinase. Proc. Natl. Acad. Sci. USA. 70:702-705.

Valle, G., Faulkner, G., De Antoni, A., Pacchioni, B., Pallavacini, A., Pandolfo, D., Tiso, N., Toppo, S., Lanfranchi, G. (1997) Telethonin, a novel sarcomeric protein of heart and skeletal muscle. FEBS. Lett. 415:163-168.

Van der Loop, F. T., Schaart, G., Langmann, W., Ramaekers, F. C., Viebahn, C. (1992) Expression and organization of muscle specific proteins during the early developmental stages of the rabbit heart. Anat. Embryol. 185:439-450.

Van der Loop, F. T., Van Eys, G. J., Schaait, G., Ramaekers, F. C. (1996a) Titin expression as an early indication of heart and skeletal muscle differentiation in vitro. Developmental re-organization in relation to cytoskeletal constituents. J. Muscle Res. Cell Motil. 17:23- 36.

Van der Loop, F. T., Van der Ven, P. F., Furst, D. O., Gautel, M., Van Eys, G. J., Ramaekers, F. C. (1996b) Integration of titin into the sarcomeres of cultured differentiating human skeletal muscle cells. Eur. J. Cell Biol. 69:301-307.

Van der Ven, P. F., Furst, D. O. (1997) Assembly of titin, myomesin and M-protein into the sarcomeric M band in differentiating human skeletal muscle cells in vitro. Cell Struct. Funct. 22:163-171. 43

Van der Ven, P. F., Ehler, E., Perriard, J. C., Furst, D. O. (1999) Thick filament assembly occurs after the formation of a cytoskeletal scaffold. J. Muscle Res. Cell Motil. 20:569- 579.

Vikstrom, K. L., Seller, S. H., Sohn, R. L., Strauss, M., Weiss, A., Welikson, R. E., Leinwand, L. A. (1997) The vertebrate myosin heavy chain: genetics and assembly properties. Cell Struct. Funct. 22:123-129.

Vinkemeier, U., Obermann, W., Weber, K., Furst, D. O. (1993) The globular head domain of titin extends into the center of the sarcomeric M band. cDNA cloning, epitope mapping and immunoelectron microscopy of two titin-associated proteins. J. Cell Sci. 106:319- 330.

Wallimann, T., Doetschman, T. C., Eppenberger, H. M. (1983). Novel staining pattern of skeletal muscle M lines upon incubation with antibodies against MM-creatine kinase. J. Cell Biol. 96:1772-1779.

Wallimann, T., Eppenberger, H. M. (1985) Localization and function of M line-bound creatine kinase. Cell Muscle Motil. 6:239-285.

Wang, K., McClure, J., Tu, A. (1979) Titin; Major myofibrillar components of striated muscle. Proc. Natl. Acad. Sci. USA. 76:3698-3702.

Wang, K., Ramirez, M. R., Palter, D. (1984) Titin is an extraordinarily long, flexible, and slender myofibrillar protein. Proc. Natl. Acad. Sci. USA. 81:3685-3689.

Wang, K. (1985) Sarcomere-associated sytoskeletal lattices in striated muscle. Review and hypothesis. Cell Muscle Motil. 6:315-369.

Wang, K., Wright, J. (1988) Architecture of the sarcomere matrix of skeletal muscle: immunoelectron microscopic evidence that suggests a set of parallel inextensible nebulin filaments anchored at the Z line. J. Cell Biol. 107:2199-212.

Wang, S. M., Greaser, M. L., Schultz, E., Bulinski, J. C., Lin, J. J., Lessard, J. L. (1988) Studies on cardiac myofibrillogenesis with antibodies to titin, actin, tropomyosin, and myosin. J. Cell Biol. 107:1075-1083.

Wang, K., McCarter, R., Wright, J., Beverly, J., Ramirez, M. R. (1991) Regulation of skeletal muscle stiffness and elasticity by titin isoforms: a test of the segmental extension model of resting tension. Proc. Natl. Acad. Sci. USA. 88:7101-7105.

Wang, S. M., Jeng, C. J., Sun, M. C. (1992) Studies on the interaction between titin and myosin. Histol. Histopathol. 7:333-337. 44

Wang, K., Knipfer, M., Huang, Q. Q., Van der ven. A., Hsu, L. C., Gutierrez, G., Quian, X. L., Stedman, H. (1996) Human skeletal muscle nebulin sequence encodes a blueprint for thin fl lament architecture. Sequence motifs and affinity profiles of tandem repeats and terminal SH3. J. Biol. Chem. 271:4304-4314.

Yajima, H., Ohtsuka, H., Kawamura, Y., Kume, H., Murayama, T., Abe, H., Kimura, S., Maruyama, K. (1996) A 11.5 kb 5'-terminal cDNA sequence of chicken breast muscle connectin/titin reveals its Z line binding region. Biochem. Biophys. Res. Commun. 223:160-164.

Yamaguchi, M., Izumimoto, M., Robson, R. M., Stromer, M. H. (1985). Fine structure of wide and narrow vertebrate muscle Z lines. A proposed model and computer simulation of Z line architecture. J. Mol. Biol. 184:621-643.

Yoshioka, T., Higuchi, H., Kimura, S., Ohashi, K., Umazume, Y., Maruyama, K. (1986) Effects of mild trypsin treatment on the passive tension generation and connectin splitting in stretched skinned fibers from frog skeletal muscle. Biomed. Res. 7:181-186.

Young, P., Ferguson, C., Banuelos, S., Gautel, M. (1998) Molecular structure of the sarcomeric Z-disk: two types of titin interactions lead to an asymmetrical sorting of a- actinin. EMBO. 1.17:1614-1624.

Zengel, J. M., Epstein, H. F. (1980) IdentiHcation of genetic elements associated with muscle structure in the nematode C. elegans. Cell Motil. 1:73-97.

Zhang, J. Q., Weisberg, A., Horowits, R. (1998) Expression and purification of large nebulin fragments and their interaction with actin. Biophys. J. 74:349-359. 45

EFFECTS OF OVEREXPRESSION OF A BAND PARTIAL TITIN FRAGMENT ON

MYOFIBRIL ASSEMBLY

A paper to be submitted to the Journal of Animal Science

Qunfeng Dong, Richard M. Robson and Ted W. Huiatt

Abstract

The protein titin makes up a third filament system in striated muscle in addition to the

thick and thin filaments. A single titin molecule spans an entire half sarcomere, with its N-

and C-termini in the Z line and M line, respectively. The A band portion of titin interacts

with other thick filament proteins and it has been proposed that this region of titin acts as a

molecular blueprint controlling the positions of other contractile proteins in the thick

filament, potentially regulating the length and organization of the thick filament. To test

titin's role in thick filament assembly, cultures of the mouse skeletal muscle cell line C2C12

were transfected with a fusion construct consisting of a 1.5 kb cDNA (mTA) fragment from

the A band region of titin linked to the cDNA for green fluorescent protein (GPP). The mTA cDNA encodes 500 amino acids that are located in the C-zone region of titin. The time- course of myofibril assembly in the transfected cultures was monitored by

immunofluorescence labeling with antibodies to myofibrillar proteins. A dominant negative

phenotype was observed in those transfected myotubes expressing high levels of this mTA

fusion protein, with delayed myofibril A band assembly compared to non-transfected

myotubes and myotubes only transfected with GPP. Assembly of the Z line and thin filament

regions of the sarcomere were not affected. These results indicate that the C-zone region of

titin plays an important role in organizing the structure of the myofibrillar A band. 46

Introduction

Titin, also named connectin, is the largest known protein. A single titin polypeptide

has a molecular mass of about 3 MDa. In skeletal and cardiac muscles, titin makes up to 10%

of the total myofibrillar protein, behind only myosin and actin in abundance (for reviews, see

Trinick, 1994; Maruyama, 1997; Trinick and Tskhovrebova, 1999). A single titin polypeptide

spans an entire half sarcomere (Furst et al., 1988), with its N-terminal region embedded in

the Z line and its C-terminal region extending into the M line (Granzier and Irving, 1995).

The primary structure of the titin molecule is extensively modular, mostly composed of two

types of repeated 100-residue motifs, which belong to either the fibronectin type HI (Fn3) or

the immunoglobulin C2 (Ig) domain superfamilies (also referred to as motif I and motif II,

respectively) (Labeit and Kolmerer, 1995). Both of these domains were originally identified in extracellular molecules involved in cell-ceil recognition and subsequently were identified in a group of intracellular muscle proteins. NMR spectroscopy studies showed that both the

Fn3 and Ig domains form a similar ^-sandwich structure consisting of two anti-parallel P- sheets with a hydrophobic core (Pfuhl and Pastore, 1995; Muhle-Goll et al., 1997; Muhle-

Goll et al., 1998).

The Ig and Fn3 domains are arranged in different patterns throughout the titin molecule (Labeit and Kolmerer, 1995). Most of the I band titin is formed by tandemly arranged Ig repeats, except in the central region around the N2 line where it contains a unique nonrepetitive segment that is unusually rich in P (proline), E (glutamate), V (valine), and K (lysine). This segment of the central I band titin is referred to as the 'PEVK domain'

(Labeit and Kolmerer, 1995), and it appears to act as an elastic spring element that provides 41

passive tension during (Horowits et al., 1986; Funatsu et al., 1990;

Granzier and Irving, 1995; Linke et al., 1996).

The A band portion of titin contains two types of super-repeats, both consisting of

Fn3 and Ig domains arranged in distinct patterns (Labeit and Kolmerer, 1995). Within the C-

zone (the middle one third of each half thick filament), Fn3 and Ig domains form an eleven-

domain-super-pattem (-Fn3-Fn3-Fn3-Ig-Fn3-Fn3-Fn3-Ig-Fn3-Fn3-Ig-) that is repeated

eleven times. This super-repeat structure appears to correlate with the presence of the eleven

43 nm crossbridge repeats and repetitive patterns of attachment sites for the MyBPs of the

thick filaments within the C-zone (Gautel, 1996). The A band titin at the D-zone, which

corresponds to the end of the thick filaments near the A-I junction, has Fn3 and Ig repeats

arranged into a seven-domain-super-pattem (-Ig-Fn3-Fn3-Ig-Fn3-Fn3-Fn3-) that is repeated

seven times.

In vitro studies have shown that A band titin interacts with other thick filament

proteins, such as LMM-myosin, MyBP-C, M protein, and myomesin (Maruyama et al., 1985;

Labeit et al., 1992; Houmeida et al., 1995; Obeimann et al., 1996). The eleven-domain super-

repeats in the C-zone region of titin are responsible for the binding to the tail portion of

myosin and to MyBP-C (Labeit et al., 1992; Houmeida et al., 1995; Freiburg and Gautel,

1996). In addition, immunofluorescence labeling studies have shown that titin is one of the

earliest myofibrillar proteins to be expressed and organized during myofibrillogenesis (Furst

et al., 1989; Shimada et al., 1996; Ehler et al. 1999; van der Loop et al., 1992; van der Loop et al., 1996; van der Ven et al; 1999). Therefore, the A band region of titin is thought to act as a molecular template defining the positions of other contractile proteins in the thick filament and potentially detennining the length of the thick filaments themselves (Whiting et al., 1989; Trinick, 1996; Wang, 1996).

Recently, several groups have investigated the function of titin by using an in vivo over-expression approach. It has been shown that the association of titin filaments with the Z line, via their interaction with T-cap and a-actinixi, appears to be critical for the assembly and maintenance of myofibrillar Z line stnicture (Tumacioglu et al., 1997; Peckham et al., 1997;

Gregorio et al., 1998; Ayoob et al., 2(XX)).

In this study, to provide in vivo evidence about the role that titin plays in thick filament assembly, we have over-expressed a partial A band, C-zone titin and monitored its effects on myofibrillogenesis during skeletal muscle cell differentiation. A dominant negative phenotype was observed in myotubes expressing high levels of the partial A band titin, with delayed myosin filament assembly. These data indicate that the titin indeed plays an important role in maintaining and organizing the structure of the myofibrillar A band.

Materials and Methods

Antibodies

The hybridoma expressing monoclonal myosin antibody MF20 (Bader et al., 1982) and monoclonal titin antibody 9D10 (Wang and Greaser, 1985) were both obtained from the

Developmental Studies Hybridoma Bank (University of Iowa, Iowa City, LA), with undiluted cell culture supematants used for all experiments with both antibodies. Monoclonal myosin antibody, My32, (Havenith et al., 1990; Carter et al., 1990) to mouse skeletal myosin (Sigma

Chemical Co., St Louis, MO) was used at a 1:400 dilution. Monoclonal a-actinin antibody,

BM75.2 (Abd-El-Basset et al., 1991) (Sigma), was used at a 1:800 dilution. Rhodamine- labeled phalloidin (Molecular Probes, Inc., Eugene, OR) was used to detect F-actin at a 1:100 49

dilution. Rhodamine-coupled goat anti-mouse secondary antibodies (ICN Biomedicals, Inc.

Irvine, CA) were used to visualize antibody labeling at a 1:100 dilution.

Plasmids

The prokaryotic expression vector, pET-21, which adds a His-tag to the expressed

protein, was obtained from Novagen (Madison, WI). The mammalian expression vector,

pEGFP-CI (Clontech Laboratories, Inc. Palo Alto, CA) encodes a red-shifted variant of wild-

type green fluorescent protein (GFP) from the jellyfish Aequorea victoria. The encoded

green fluorescent protein has a 488 nm excitation maximum and a 507 nm emission

maximum.

RT-PCR Cloning of the Partial A Band Titin cDNA

cDNAs encoding the A band region of mouse skeletal muscle titin were isolated by

RT-PCR. Mouse leg muscles were dissected, flash frozen and stored in liquid nitrogen. Total

RNA was extracted with a guanidinium thiocyanate-phenol-chloroform extraction procedure

(Chomczynski and Sacchi, 1987). RT-PCR primers were designed based on the partial mouse

A band titin sequence in Genbank (accession number x64700), with the following sequences:

Al, upper primer, 5' — GCTTACCAGAAGGCATGTGACC - 3'; and A2, lower primer, 5' -

GTTCCAGGATAATGTGATGCTC - 3'; A2 was also used for synthesis of the 1st strand cDNA by RT.

The reverse transcriptions were carried out in reaction mixture containing 1 ng total

RNA and 10 units of AMV reverse transcriptase (Promega Corp., Madison, WI) in a total volume of 20 ^1. The first strand reaction products were then used in PCR amplification with

Taq DNA polymerase (Promega). Initial denaturation was done at 94 °C for 3 min, followed by 30 cycles of 98 ®C for 40 sec, 52 °C for 1 min and 72 ®C for 3 min, and final extension of 50

10 min at 72 °C. The resulting partial A band titin cDNA (designated mTA) was gel purified

using a Qiagen gel extraction kit, and cloned into pT7 Blue-T vector (Novagen) to produce

pT7-mTA for sequencing. Double stranded plasmid DNA was sequenced by the chain

termination method (Sanger et al., 1977) at the Iowa State University DNA Sequencing and

Synthesis Facility with an Applied Biosystem Model 373A DNA sequencer using the T7 or

universal primers carried by the vector. Sequence data were assembled, translated and analyzed using the University of Wisconsin GCG software package (Devereux et al., 1984).

Genbank searches were conducted using the NCBI BLAST server (Altshul et al., 1990).

Expression of A band titin

Initially, the titin clone mTA was inserted into the Xba I site of plasmid pRc/RSV

(Invitrogen, Carlsbad, CA) to make a pRc-mTA construct. The Hind HUXba I fragment from

pRc-mTA was then in-frame ligated into the Hind HUXba I sites of the plasmid EGFP-Cl to produce the GFP-mTA construct.

Using pT7-mTA as template, primers 5'- CGCGGATCCATTTTATAAGCCAGGCC

-3' / 5'- CCCAAGCTTCCAGGATAATGTGATG -3' were used to introduce BamH VHind m sites to the mTA cDNA, which was then inserted into BamHl / Him/m sites of the prokaryotic expression vector pET-21 (Novagen), which adds a His-tag to the N terminus end of the expressed protein, to produce the pET-mTA construct.

The pET-mTA construct was transformed into E. coli strain BL21(DE3) (Novagen

Inc.), a phage X lysogen containing the T7 RNA polymerase gene under control of the lacUVS promoter. A 50 ml pregrowth culture of the transformed strain in LB medium, plus

50 fxg/ml ampicillin, was grown overnight at 37 ''C. The overnight culture was diluted 1:10 and grown at 30 °C for 80 min. IPTG was then added to a flnal concentration of I mM, and the cultures were shaken vigorously for an additional 3.5 h. Cells were collected by

centrifugation at 4,000 g for 10 min, and the pellet was suspended in sonication buffer (500

mM NaCl, 0.1 mM PMSF, 5 ^iM E64, 50 mM Na-phosphate, pH 8.0). The resuspended

pellet was stored at -20 °C overnight and subsequently thawed and sonicated. Cellular debris

was pelleted by centrifugation at 10,000 g, and the supernatant was incubated with Ni-NTA

resin (Qiagen, Valencia, CA ) on ice for 1 h. The resin was then loaded onto a column, and

the column was washed sequentially with sonication buffer and sonication buffer with added

40mM imidazole-HCl, pH 7.0, until the A280 of the eluant was less than 0.01 for each wash.

Proteins were eluted from the column by sequential application of 100 mM and 250 mM imidazole-HCl, pH 7.0, in sonication buffer. Fractions were collected and stored at -20 °C until used.

Microliter plate binding assay

Ninety six-well plates were coated with either the whole bacteria lysate or purified

His-mTA diluted in Coating buffer (2(X) mM KCl, 1 mM EDTA, 0.3 mM DTT, 50 mM Tris-

HCl, pH 8.0) at a concentration of 0.5 ^g/^l and 0.1 ^g/pJ. respectively, for 1 h at 37 °C and then overnight at 4 °C. The plates were then incubated with Blocking buffer (200 mM KCl,

3% BSA, 0.5% Tween-20, 50 mM Tris-HCl, pH 7.5) at room temperature for 2 h with 6 changes of buffer. Series dilutions of rabbit muscle myosin in Dilution buffer (600 mM KCl,

1% BSA, and 0.05% Tween-20, 20 mM Na-phosphate, pH 7.5) were then added to each well, and the plates were incubated overnight at 4 "C. After incubation, plates were washed 5 times with the blocking buffer and then incubated with monoclonal myosin antibody, MF20, at room temperature for 1 h. After 3 washes with TBS-T buffer (500 mM NaCl, 0.2% 52

Tween-20, 20 mM Tris-HCI, pH 7.5), plates were then incubated with alkaline phosphate- conjugated second antibody at a dilution of 1:30,000 (Sigma) at room temperature for 1 h.

After 9 washes with TBS-T, bound antibodies were detected with alkaline phosphatase substrate 104 (0.5 mg per 1.2 ml 1 M diethanolamine, pH 9.3) (Sigma) and signals were quantitated with a microplate reader at 405 nm.

Precipitation assay

Rabbit myosin was prepared from rabbit leg muscle and separated from MyBP-C and

M-protein by DEAE-Sephadex chromatography according to Pastra-Landis et al. (1983).

The above purified expressed His-mTA was dialyzed against the Binding buffer (5 mM EDTA, 50 mM KCl, 1 mM DTT, 1 mM PMSF, 50 mM Tris-HCI, pH 8.0) overnight at 4

°C. The Ni-NTA agarose beads (Qiagen) were washed 3 times with cold Buffer A (150 mM

NaCl, 1% Triton X-100, 50 mM HEPES, pH 7.6) and then incubated with the expressed titin fragments overnight at 4 °C with inverted shaking. The agarose beads were then washed 3 times with cold Buffer A and stored at 4°C until used.

Medium was removed firom 3-d myotube culture of C2C12 cells (grown as described in next section). 0.4 ml lysis buffer (1% Triton X-1(X), 5 mM EDTA, 5 mM EGTA, 20 mM

Na-phosphate, 1 mM PMSF, 600 mM KCl, 50 mM HEPES, pH 7.6) was added. The plate was incubated at 0 °C for 10 min, the lysate was removed and centrifuged at 10,000 g for 10 min at 4 °C. The agarose beads were washed 3 times with Buffer B (150 mM NaCl, 1%

Triton X-100, 50 mM imidazole-HCl, 50 mM HEPES, pH 7.6). The supernatant or 0.2 mg/ml myosin was then incubated with titin-coated agarose beads at 4 °C for overnight with inverted shaking. The beads were precipitated by the centrifiigation at 2,000g for 2 min and 53 washed 5 times with buffer A. Then 2x SDS loading buffer was added, and the beads were incubated at 100 °C for 5 min. Samples were vortexed and then centrifuged. The supematants were separated by SDS-PAGE on an 8% acrylamide gel and electrcphoretically transferred onto a nylon membrane for about 12 h at 100 V. The blot was blocked with PBS containing

5% non-fat dry milk, incubated with monoclonal myosin antibody MF20 for 2 h at room temperature, washed 3x for 10 min in 5% nonfat dry milk in PBS, and incubated with secondary antibody in PBS for 1 h at room temperature. Detection was done with an

Enhanced ChemiLuminescence (ECL) kit (Amersham Pharmacia Biotech, NJ).

Cell culture and transfection

Mouse skeletal muscle cell line C2C12 (Blau et al., 1983) was obtained from ATCC

(Rockville, MD). For transfections, cells were grown to 70% confluence onto collagen- coated Arclar cover-slips (EMS, Fort Washington, PA) in Proliferation medium (DMEM,

10% FBS) in 5% CO2 in a 37 ®C incubator. Cells were washed twice in OptiMEM (Life

Technologies), placed in 800 (xl fresh OptiMEM. DNA liposome complexes were prepared by combining 1.5 ^g plasmid DNA with 10 ^l lipofectamine (Life Technologies) in 200 ^1 serum-free OptiMEM. After 30 min, the complexes were added dropwise to the culture dish, and cultures incubated for 5 h in 5% CO2 in a 37 ®C incubator. Then, 2 ml of the DMEM containing 20% FBS was added to the dish. 24 h after transfection, cells were washed once with PBS (150 mM NaCl, 20 mM Na-phosphate, pH 7.0) and differentiation was induced by addition of low serum differentiation medium (DMEM, 4% HS, lO'^M insulin). The DNAs used for the above transfection were purified by using the Concert^ maxi-prep protocol

(Life Technologies). Immunofluorescence staining and confocal microscopy

Cultures grown on the Arclar cover-slips were rinsed with PBS and fixed with freshly

prepared 3.2% formaldehyde in PBS at room temperature for 25 min. Cells were then

permeabilized by incubation with 0.5% Triton X-100 in PBS for 5 min, or 0.1% Triton X-

100 in PBS for 15 min at room temperature. After 30 min with the blocking buffer (5% goat

serum, 10% FBS, and 1% BSA in PBS), cells were incubated with the primary antibodies for

90 min at 37 °C. Following 10 washes with the blocking buffer for total 30 min, cells were

incubated with secondary antibodies for 1 h at room temperature and washed 10 times with

PBS. Cover slips were mounted with Vectashield® medium (Vector Laboratories, InC.,

Burlingame, CA). Rhodamine-labeled phalloidin, which binds specifically to F-actin, was

used to visualize stress fibers and thin filaments within myofibrils (Zhikarev et al., 1997).

Stained cells were examined with a Leca TCS NT confocal microscope system using a lOOx

(NA 1.4) objective with excitation filters for rhodamine orGFP. Micrographs were recorded

as digital images on a SenSys cooled HCCD camera and images were processed using Adobe

Photoshop. Results were from two independent experiments. To provide more quantitative

evidence for the effect of transfection with the mTA construct on myofibrillogenesis, cells

expressing GFP in cultures transfected with either the GFP-mTA or EGFP vector alone were

scored according to their stage of myofibril assembly, determined by either myosin or titin

localization. Results are shown in Table 1. As described above, organization of myosin

exhibited an initial diffuse pattern, then organization in SFLSs, nascent myofibrils, and

finally mature striations. As shown in Table 1, more of the cells expressing the GFP-mTA construct were at earlier stages of organization in comparison to the pEGFP transfected cells at each day from day 3 through day 5. The difference was significant at each day. Scoring of titin assembly via a progression from diffuse organization, to aligned dots, to mature

striations and comparison of number of cells at each stage between the pEGFP and GFP-

mTA transfected cells yielded similar results, namely that expression of mTA led to

significantly more cells at earlier stages.

Results

For transfection into the mouse-derived C2C12 muscle cell line, a 1.5-kb mouse

skeletal muscle cDNA was obtained by RT-PCR using primers designed based on mouse

partial A band titin cDNA sequence (Genbank access number X647(X)). Sequence analysis confirmed that the cloned cDNA was the mouse skeletal muscle titin cDNA expected.

Further analysis revealed that this cDNA encodes three fh3 domains and one Ig domain

belonging to the A band C-zone region of titin as shown in Fig. 1. It spans the parts of No. 4 and No. 5 eleven-domain-super-repeats.

To determine if this region of titin was capable of interacting with myosin, the mTA titin cDNA was expressed in E. coli and two in vitro binding assays were used to examine interactions of the expressed titin fragment with myosin. The purified expressed titin fragment was analyzed by SDS-PAGE (Fig. 2). The purified product exhibits a single -60 kDa band which is the expected molecular weight of A band titin protein from the 1.5-kb gene fragment.

First, a microtiter plate binding assay was used to characterize the interactions of expressed titin fragment with myosin. Plates were coated with either 0.5 ^g/M-l of cell lysate from E. coli cells expressing His-tagged A band titin, 0.1 |ig/fAl of purified titin A band fragment, or a blocking buffer only as negative control. Wells were then incubated with a series dilution of myosin, ranging from 0.01 ^g/^1 to 1.5 ^g/^l, and binding was detected 56 with myosin antibody. Myosin was puriHed by ion-exchange chromatography to remove myosin binding proteins such as MyBP-C or M-protein. As shown in Fig. 3, the wells coated with cell lysate containing the mTA protein or the purified mTA titin fragment bound more myosin in comparison to the controls. The amount of bound myosin increased with the increasing concentration of the overlayed myosin (Fig. 3). The protein coated wells overlayed with only l" and 2°^ antibody did not show any absorbance. This experiment demonstrated that the cloned A band titin can interact with purified skeletal muscle myosin in vitro.

A second binding study, a precipitation assay, was done to further demonstrate that the mouse A band titin fragment bound mouse muscle myosin. For this experiment, Ni-NTA conjugated agarose beads were bound with His-mTA titin fragment. Then, the titin beads were incubated with either C2C12 myotube culture lysates or purified myosin as a positive control. If the His-mTA fragment could interact with myosin, the myosin should be sedimented with the His-mTA beads. The incubation was carried out in buffer containing 600 mM KCl in order to keep myosin soluble. After repeated washes, the bound proteins were dissociated by boiling with SDS loading buffer, and bound proteins were analyzed by

Western blotting using myosin antibody for detection. The resulting Western blot (Fig. 4) showed that myosin was precipitated by the beads coated with His-mTA from both pure myosin and C2C12 cell lysates (Fig. 4, lane A2 and lane B2). As expected, the proteins washed from the control beads that contained no His-mTA titin did not precipitate any myosin (Fig. 4, lane A1 and lane Bl). This result also strongly indicates an interaction between the cloned A band titin and myosin. Because the in vitro binding studies demonstrated that the mTA titin fragment was capable of binding to myosin, overexpression of this titin fragment in myogenic cells should be capable of disrupting the normal interactions between myosin and titin that occur during myofibrillogenesis. Thus, to test the hypothesis that normal interactions between A band titin and myosin are necessary for proper myofibril assembly, cells of the C2C12 skeletal muscle cell line were transiently transfected with the mTA construct. Expression of mTA should act in a dominant negative fashion to block normal titin-myosin interactions. Transfections were done with a construct containing the mTA cDNA linked to the cDNA for green fluorescent protein (GFP). The vector used contained a variant of wild type GFP with enhanced fluorescence and expression in mammalian cells, known as EGFP. Use of the GFP-mTA fusion protein allowed determination of which cells were expressing the construct as well as localization of the expressed GFP-mTA protein in the cells. Cultures of proliferating C2C12 myoblasts were transfected 24 h before the medium was changed from proliferation medium

(containing 10% FBS) to differentiation medium (containing 4% horse serum) to induce differentiation. Immunofluorescence with antibodies to the myofibrillar proteins myosin, titin, and a-actinin along with rhodamine-phalloidin labeling of actin were used to examine myofibrillogenesis over the period from 1 to S d after induction of differentiation. For convenience, cultures induced to differentiate by this medium change will be referred to as

"myotube cultures", with the time after induction of differentiation indicated, i.e., a 3-d myotube culture is one that had been grown for 3 d after induction of differentiation. Control cultures were transfected with the pEFGP vector only.

The effect of the mTA transfection on assembly of myosin during myofibrillogenesis was detected by labeling with the monoclonal myosin antibody, My32. Examples of typical 58 localization patterns are shown in Figs. 4-6. During the first two days, both pEGFP transfected control cells and GPF-mTA transfected cells started to form myotubes, but no evident organization of myosin into regular pattern was detected (data not shown). Beginning with 3-d myotube cultures, myosin started to appear localized along the stress fiber like structures (SFLSs) inside pEGFP transfected myotubes (Fig. 5b). However, in the GFP-mTA transfected cultures myosin still appeared to be in diffuse state inside myotubes showing GFP expression (Fig. 5c, d right). A myotube in the same GFP-mTA transfected culture, but that was not expressing the construct.as shown by lack of GFP fluorescence (Fig. 5c, d left), showed similar structures as that of the pEGFP transfected myotube. In 4 d myotube cultures, myosin was beginning to show some normal myofibrillar striation patterns inside both the pEGFP transfected myotubes (Fig. 6b) and in myotubes not expressing GFP in the transfected culture (Fig. 6d). Myosin localization did not show striation patterns in the GFP- mTA transfected myotubes (Fig. 6d). In cells expressing GFP-mTA in 4 d cultures, the majority of myosin still showed diffuse localization and only few SFLSs could be observed

(Fig. 6d). In 5 d cultures, mature myofibrillar structure can be observed in pEGFP vector transfected myotubes by myosin immunofluorescence (Fig. 7a, b). The myosin striation patterns in cells expressing EGFP alone are aligned across the whole myotube (Fig. 7b).

Inside the GFP-mTA transfected myotubes, more SFLSs appeared but only a few nascent myofibrils could be found underneath the membrane (Fig. 7d). Cells not expressing GFP in the GFP-mTA transfected cultures (Fig. 7c, d) had a similar myosin localization pattern as the pEGFP transfected controls. These results show that the GFP alone did not affect myofibril assembly, because of the similar patterns of the non-transfected cells and the vector 59 only transfected control cells during myofibrillogenesis. However, myosin organization was delayed or disrupted in the cells expressing the GFP-mTA construct.

Monoclonal titin antibody 9D10, which binds specifically to the PEVK region of titin, was used to detect native titin organization during myofibrillogenesis (Fig. 8-10). During the first two days, the labeling showed either diffuse or dot-like pattern in both the control myotubes and GFP-mTA transfected myotubes (data not shown). After 3 days, titin appeared on the SFLSs and showed some nascent striation patterns underneath the membrane inside the pEGFP transfected myotubes (Fig. 8b) and in myotubes not expressing GFP in the GFP- mTA transfected cultures (Fig. 8d). Cells expressing the GFP-mTA construct only showed few SFLSs after the titin antibody staining (Fig. 8d) in 3 d myotube cultures. After 4 days, myotubes transfected with pEGFP displayed clear striation pattern with the titin antibody

(Fig. 9b). Titin striations were also seen in myotubes not expressing GFP in the GFP-mTA transfected cultures (Fig. 9d) in the GFP-mTA transfected 4 d myotube cultures. In myotubes expressing the GFP-mTA, only SFLSs were observed in 4 d myotube cultures

(Fig. 9d). After 5 days, mature myofibril striation patterns were seen in pEGFP transfected myotubes (Fig. 10b). The GFP-mTA transfected myotube (Fig.lOd) only showed a few striations. In this 5 d culture (Fig. lOc, d), the myotubes not expressing GFP (Fig. 10c, d) already had a clear myofibril pattern in comparison with the myotube expressing the GFP- mTA construct although it was much smaller than the transfected myotube. These results indicate that expression of the GFP-mTA construct also affects the ability of titin to assemble correctly in I band region.

Rhodamine-phalloidin was used to detect actin filament assembly since it specifically labels the F-actin. During the 1 to 5 d time-course of labeling, no obvious differences were found in the F-actin labeling patterns between the myotubes expressing the GFP-mTA

construct transfected myotubes and either pEGFP transfected myotubes or myotubes not

expressing GPP in the GFP-mTA transfected cultures. In all the myotubes studied,

rhodamine-phalloidin labeled progressively from stress fibers at the early stage of

myofibrillogenesis (1-d myotube cultures) to the sthation patterns in mature myofibrils (Fig.

11). Therefore, F-actin assembly does not seems to be affected by over-expression of the

partial A band region of titin.

Z line assembly was monitored by staining for its major component, a-actinin, by use of the monoclonal a-actinin antibody BM75.2. Similar to the F-actin labeling, the a-actinin

labeling pattern did not show any difference between the myotubes expressing the GFP-mTA

construct transfected myotubes and either pEGFP transfected myotubes or myotubes not

expressing GFP in the GFP-mTA transfected cultures. During myofibrillogenesis, a-actinin showed diffiise dot-like labeling at first and then quickly became associated with the SFLSs and subsequently mature into striation patterns (Fig. 12).

Discussion

The thick filament assembly requires the precise alignment of hundreds of myosin molecules, along with associated proteins such as MyBP-C, MyBP-H. The synthetic thick filaments in vitro reconstituted by purified major thick filament proteins lack the uniform length distribution as in the native A band, indicating the involvement of regulatory elements

(Condeelis, 1977; Margossian et al., 1987; Vibert and Castellani, 1989). Titin has been proposed to be such a regulatory element for the assembly of the myosin thick filament based on its molecular layout and its ability to interact with thick filament proteins such as myosin and MyBPs (for reviews, see Gautel, 1996; Trinick, 1996). 61

To further investigate the regulatory role of titin, we over-expressed a partial A band

titin by transient transfecting the cDNA into skeletal muscle myoblasts, and monitored its

effects on myofibrillogenesis. The partial A band titin we chose to express contains two Ig

domains and three Fn3 domains. Since Fn3 domains are only found in the A band region,

their fimction has been proposed to be specific for the interaction of titin with myosin

(Gautel, 1996). In vitro binding studies have shown that the binding affinity of recombinant multi-module fragments of titin to the LMM-myosin increases with the number of the Fn3 domains (Labeit et al., 1992; Soteriou et al., 1993). In our studies, we have further demonstrated in vitro that the cloned partial A band titin interacts with myosin. Over- expression of this partial A band titin, attached to a GFP tag in C2C12 myotube cultures, resulted in a delay of myosin filament organization as indicated by myosin antibody staining.

Since expressing GFP alone does not have any apparent effects, the observed delay of myosin filament assembly may be due to the interactions between the over-expressed titin

fragments with myosin molecules. These results suggest that myosin molecules need to interact with the native A band titin in order to be organized during normal thick filament assembly. The over-expressed A band titin fragments may bind to the myosin and compete with the interaction with the native titin.

Besides myosin molecules, other thick filament components may also be affected by the over-expressed titin fragment. Sequence comparison with the human cardiac titin has mapped the expressed titin cDNA to the A band C-zone region. Within the thick filament C- zone, Fn3 and Ig domains form a eleven-domain-super-pattem that is repeated eleven times.

Since each of Fn3 or Ig repeats is about 4 nm long, these super-repeat structures appear to correlate with the presence of the eleven 43 nm repetitive patterns of attachment sites for the 62

MyBP's of the thick filaments within the C-zone (for review see Gautel et al., 1996). In

addition to the tail portion of myosin, the eleven-domain super-repeats also bind to MyBP-C

(Labeit et al., 1992). The first Ig domain of such eleven-domain super-repeat has higher

affinity to MyBP-C (Freiburg and Gautel 1996). The titin-binding site on MyBP-C has been

identified within the C-terminal region, which is deleted in patients suffering fi'om the

chromosome-11-associated form of familial hypertrophic cardiomyopathy, indicating the

importance of the interaction between titin and MyBP-C. Furthermore, MyBP-C binds very

strongly to myosin and alters myosin filament structure in vitro (Moos et al., 1975; Koretz,

1979; Miyahara and Noda, 1980; Koretz et al., 1982; Davis, 1988). It has been proposed that

MyBP-C is essential for correct thick filament formation (Gilbert et al., 1996). Thus, the observed random distribution of myosin molecules in our studies might result fi-om MyBP-C being carried away through its interaction with the over-expressed titin Segments.

Our results support the current hypothesis that A band titin is involved in the thick filament assembly through its interactions with the thick filament components. The dominant negative phenotype indicates that correct assembly of a temary complex by myosin, titin, and possibly MyBP-C is critical for the thick filament organization to form A bands. Also, our results showed the dominant negative effects appeared to be neutralized at the late stage of myofibrillogenesis. The appearance of correct myosin filament organization at some local regions is possibly due to the increasing expression of thick filament proteins such as myosin compared to the decreasing partial A band titin expression fi-om the transiently transfected

DNA constructs. The expression of muscle specific proteins have been shown to be dramatically increased after fusion. We speculate at a certain point, the endogenous myosin or MyBP-C overwhelmed the suppression by the exogenous partial A band titin. The transfected DNA constructs may also become degraded or the existing expressed partial A band titin protein could no longer be its active form. Also, the neighboring nontransfected myoblasts could be added onto the transfected myotubes, providing more myosin and other thick filament proteins.

We also investigated the effects of the partial A band titin over-expression on thin filament and Z line assembly. The organization of the PEVK region of titin also seems to be affected. The PEVK region is in the center of titin molecule, closer to the A band with respect to the Z line. Our explanation is that the PEVK region is no longer in situ and possibly not correctly folded after the over-expressed partial A band titin disrupts the A band assembly. The endogenous A band titin is believed to be immobilized by interaction with the thick filament. Furthermore, studies have suggested that, in general, titin bound to the thick filaments is stretched relative to its unbound slack length in both skeletal and cardiac muscles

(Higuchi et al., 1992; Roos and Brady, 1989). Thus, when the A band titin is released from the proper binding and stretch, the organization of titin in the I band is also disrupted.

In contrast, labeling of the actin filament and the major Z line component, a-actinin, do not show any significant disruption by mTA expression when compared to the normal patterns shown in the control cells. This indicates that the Z line and thin filaments form correctly in the absence of a normal A band structure. Although the exact events during myofibrillogenesis are not fully understood yet, a number of studies have suggested that the assembly of thin and thick filament occurs independently during myofibrillogenesis (Ehler et al., 1999; Holtzer et al., 1997). Moreover, the maturation of the Z line and thin filament organization occurs before that of the myosin filament (Ehler et al., 1999; Van der Ven et al.,

1999). Linke et al. (1999) disrupted the thin filaments by over-expressing the N2-B region of 64

the titin in cardiac myocytes. They found well-formed sarcomeres visible by both the MyBP-

C and myosin staining in the absence of thin filament.

In summary, the over-expression of the partial A band C-zone titin disrupted the

myosin filament formation but left the Z line and thin filament organization intact. These

data further demonstrated that the A b

maintaining and organizing the structure of the myofibrillar A band. Our findings also

support the hypothesis that nucleation and assembly of I-Z-I bodies occurs independently of

the formation of sarcomeric thick filaments and vice versa. Previously, our attempts to create

stable transfectants of the partial A band C-zone titin fragments were unsuccessful (data not

shown), suggesting that constitutive expression of the partial A band C-zone titin might also

interfere with myoblast viability.

References

Abd-el-Basset, E. M., Ahmed, I., Fedoroff, S. (1991) Actin and actin-binding proteins in differentiating astroglia in tissue culture. J. Neurosci. Res. 30:1-17.

Altshul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990) Basic local alignment search tool. J. Mol. Biol. 215:403-410.

Ayoob, J. C., Tumacioglu, K. K., Mittal, B., Sanger, J. M., Sanger, J. W. (2000) Targeting of cardiac muscle titin fragments to the Z-bands and dense bodies of living muscle and non-muscle cells. Cell Motil. Cytoskel. 45:67-82.

Bader, D., Masaki, T., Fischman, D. A. (1982) Immunochemical analysis of myosin heavy chain during avian myogenesis in vivo and in vitro. J. Cell Biol. 95:763-770.

Blau, H. M., Chiu, C. P., Webster, C. (1983) Cytoplasmic activation of human nuclear genes in stable heterocaiyons. Cell 32:1171-1180.

Carter, R. L., Jameson, C. F., Philp, E. R., Pinkerton, C. R. (1990) Comparative phenotypes in liiabdomyosarcomas and developing skeletal muscle. Histopathology 17:301-309.

Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem.l62:156-159. 65

Condeelis, J. S. (1977) The self-assembly of synthetic filaments of myosin isolated from Chaos carolinensis and Amoeba proteus. J. Cell Sci. 25:387-402.

Davis, J. S. (1988) Interaction of C-protein with pH 8.0 synthetic thick filaments prepared from the myosin of vertebrate skeletal muscle. J. Muscle Res. Cell Motil. 9:174-183.

Devereux, J., Haeberli, P., Smithies, O. (1984) A comprensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 12:387-395.

Ehler, E., Rothen, B. M., Hammerle, S. P., Komiyama, M., Perriard, J. C. (1999) Myofibrillogenesis in the developing chicken heart: assembly of Z-disk, M-Iine and the thick filaments. J. Cell Sci.l 12:1529-1539.

Freiburg, A., Gautel, M. (1996) A molecular map of the interaction between titin and myosin-binding protein C. Implications for sarcomeric assembly in familiar hypertrophic cardiomyopathy. Eur. J. Biochem. 235:317-323.

Funatsu, T., Higuchi, H., Ishiwata, S. (1990) Elastic filaments in skeletal muscle revealed by selective removal of thin filaments with plasma gelsolin. J. Cell Biol. 110:53-62.

Furst, D. O., Osbom, M., Nave, R., Weber, K. (1988) The organization of titin filaments in the half sarcomere revealed by monoclonal antibodies in immunoelectron microscopy: A m^ of ten non-repetitive epitopes starting at the Z line extends close to the M-line. J. Cell Biol. 106:1563-1572.

Furst, D. O., Osbom, M., Weber, K. (1989) Myogenesis in the mouse embryo: differential onset of expression of myogenic proteins and the involvement of titin in myofibril assembly. J. Cell Biol. 109:517-527.

Gautel, M. (1996) The super-repeats of titin/connectin and their interactions: glimpses at sarcomeric assembly. Adv. Biophys. 33:27-37.

Gilbert, R., Kelly, M. G., Mikawa, T., Fischman, D. A. (1996) The carboxyl terminus Of myosin binding protein C (MyBP-C, C-protein) specifies incorporation into the A band of striated muscle. J. Cell Sci. 109:101-111.

Granzier, H. L., Irving, T. C. (1995) Passive tension in cardiac muscle: contribution of collagen, titin, microtubules, and intermediate filaments. Biophys. J. 68:1027-1044.

Gregorio, C. C, Trombitas, K., Centner, T., Kolmerer, B., Stier, G., Kunke, K., Suzuki, K., Obermayr, P., Herrmann, B., Granzier, H., Sorimachi, H., Labeit, S. (1998) The NH2 terminus of titin spans the Z-disc: its interaction with a novel 19 kD ligand (T-cap) is required for sarcomeric integrity. J. Cell Biol. 143:1013-1027. 66

Havenith, M. G., Visser, R., Schrijvers-van Schendel, J. M., Bosman, F. T. (1990) Muscle fiber typing in routinely processed skeletal muscle with monoclonal antibodies. Histochemistry 93:497-499.

Higuchi, H., Suzuki, T., Kimura, S., Yoshioka, T., Maruyama, K., Umazume, Y. (1992) Localization and elasticity of connectin (titin) filaments in skinned fi-og muscle fibers subjected to partial depolymerization of thick filaments. J. Muscle Res. Cell Motil. 13:285-294.

Holtzer, H., Hijikata, T., Lin, Z. X., Zhang, Z. Q., Holtzer, S., Protasi, F., Franzini- Armstrong, C., Sweeney, H. L. (1997) Independent assembly of 1.6 microns long bipolar MHC filaments and I-Z-I bodies. Cell Struct. Funct. 22:83-93.

Horowits, R., Kempner, E. S., Bisher, M. E., Podolsky, R. J. (1986) A physiological role for titin and nebulin in skeletal muscle. Nature 323:160-164.

Houmeida, A., Holt, J., Tskhovrebova, L., Trinick, J. (1995) Studies of the interaction between titin and myosin. J. Cell Biol. 131:1471-1481.

Koretz, J. F. (1979) Effect of C-protein on synthetic myosin filament structure. Biophys. J. 27:433-446.

Koretz, J. F., Coluccio, L. M., Bertasso, A. M. (1982) The aggregation characteristics of column-purified rabbit skeletal myosin in the presence and absence of C-protein at pH 7.0. Biophys. J. 37:433-440.

Labeit, S., Gautel, M., Lakey, A., Trinick, J. (1992) Towards a molecular understanding of titin. EMBO. J. 11:1711-1716.

Labeit, S., Kolmerer, B. (1995) Titins: Giant proteins in charge of muscle ultrastructure and elasticity. Science 270:293-296.

Linke, W. A., Ivemeyer, M., Olivieri, N., Kolmerer, B., Ruegg, J. C., Labeit, S. (1996) Towards a molecular imderstanding of the elasticity of titin. J. Mol. Biol. 261:62-71.

Linke, W. A., Rudy, D. E., Centner, T., Gautel, M., Witt, C., Labeit, S., Gregorio, C. C. (1999) I band titin in cardiac muscle is a three-element molecular spring and is critical for maintaining thin filament structure. J. Cell Biol. 146:631-644.

Margossian, S. S., Huiatt, T. W., Slayter, H. S. (1987) Control of filament length by the regulatory light chains in skeletal and cardiac . J. Biol. Chem. 262:5791-5796.

Maruyama, K., Yoshioka, T., Higuchi, H., Ohashi, K., Kimura, S., Natori, R. (1985) Connectin filaments link thick filaments and Z lines in fix}g skeletal muscle as revealed by immunoelectron microscopy. J. Cell Biol. 101:2167-2172. 67

Maruyama, K (1997) Connectin/titin, giant elastic protein of muscle. FASEB. J. 11:341 -345.

Miyahara, M., Noda, H. (1980) Interaction of C-protein with myosin. J. Biochem. 87:1413-1420.

Moos, C., Offer, G., Starr, R-, Bennett, P. (1975) Interaction of C-protein with myosin, myosin rod and light meromyosin. J. Mol. Biol. 97:1-9.

Muhle-Goll, C., Nilges, M., Pastore, A. (1997) IH and 15N NMR resonance assignments and secondary structure of titin type I domains. J. Biomol. NMR. 9:2-10.

Muhle-Goll, C., Pastore, A., Nilges, M. (1998) The three-dimensional structure of a type I module from titin: a prototype of intracellular fibronectin type ni domains. Structure 6:1291-1302.

Obermann, W. M, Gautel, M., Steiner, F, Van der Veen, PFM., Weber, K., Furst, D. O. (1996) The structure of the sarcomeric M band: localization of defined domains of myomesin, M protein, and the 250 kD carboxy terminal region of titin by immimoelectron microscopy. J. Cell Biol. 134:1441-1453.

Pastra-Landis, S. C., Huiatt, W. T., Lowey, S. (1983) Assembly and kinetic properties of myosin light chain isozymes fi'om fast skeletal muscle. J. Mol. Biol. 170:403-22.

Peckham, M., Young, P., Gautel, M. (1997). Constitutive and Variable Regions of Z- disk Titin/Connectin in Myofibril Formation: A Dominant-negative Screen. Cell Struct. Funct. 22:95-101.

Pfiihl, M., Pastore, A. (1995) Tertiary structure of an immunoglobulin-like domain fi'om the giant muscle protein titin: a new member of the I set. Structure 3:391-401.

Roos, K. P., Brady, A. J. (1989) Stiffiiess and shoitning changes in extracted rat cardiac myocytes. Am. J. Physiol. 256:539-551.

Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Molecular cloning : a laboratory manual. 2nd ed. Cold Spring Harbor, New Yoric. Cold Spring Harbor Laboratory.

Sanger, F., Nicklen, S., Coulson, A. R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Sci. USA. 74:5463-5467.

Shimada, Y., Komiyama, M., Begum, S., Maruyama, K. (1996) Development of coimectin/titin and nebulin in striated muscles of chicken. Adv. Biophys. 33:223-233. 68

Soteriou, A., Gamage, M., Trinick, J. (1993) A survey of interactions made by the giant protein titin. J. Cell Sci. 104:119-123.

Trinick, J. (1994) Titin and nebulin: protein rulers in muscle? Trends Biochem. Sci. 19:405-409.

Trinick, J. (1996) Titin as a scaffold and spring. Current Biology 6:258-260.

Trinick, J., Tskhovrebova, L. (1999) Titin: a molecular control freak. Trends Cell Biol. 9:377-380.

Tumacioglu, K. K., Mittal, B., Dabiri, G. A., Sanger, J. M., Sanger, J. W. (1997) An N -terminal fragment of titin coupled to green fluorescent protein localizes to the Z-bands in living muscle cells: overexpression leads to myofibril disassembly. Mol. Biol. Cell 8:705-717.

Van der Loop, F. T., Schaart, G., Langmann, W., Ramaekers, F. C., Viebahn, C. (1992) Expression and organization of muscle specific proteins during the early developmental stages of the rabbit heart. Anat. Embryol. 185:439-450.

Van der Loop, F. T., Van Eys, G. J., Schaart, G., Ramaekers, F. C. (1996) Titin expression as an early indication of heart and skeletal muscle differentiation in vitro. Developmental re-organization in relation to cytoskeletal constituents. J. Muscle Res. CellMotiL 17:23-36.

Van der Ven, P. F., Ehler, E., Perriard, J. C., Furst, D. O. (1999) Thick filament assembly occurs after the formation of a cytoskeletal scaffold. J. Muscle Res. Cell Motil. 20:569- 579.

Vibert, P., Castellani, L. (1989) Substructure and accessory proteins in scallop myosin filaments. J. Cell Biol. 109:539-47.

Wang, K. (1996) Titin/connectin and nebulin: giant protein rulers of muscle structure and function. Adv. Biophys. 33:123-34.

Wang, S. M., Greaser, M. L. (1985). Immunocytochemical studies using a monoclonal Antibody to bovine cardiac titin on intact and extracted myofibrils. J. Muscle Res. Cell Motil. 6:293-312.

Whiting, A., Wardale, J., Trinick, J. (1989) Does titin regulate the length of thick filaments? J. Mol. Biol. 205:263-268.

Zhikarev, V., Sanger, J. M., Sanger, J. W., Goldman, Y. E., Shuman, H. (1997) Distribution and orientation of ihodamine-phalloidin bound to thin filaments in skeletal and cardiac myofibrils. Cell Motil. Cytoskel. 37:363-377. 69

Table 1. Evaluation of the organization of myosin and titin in transfected myotubes.

"No. of Antibody Day Construct Labeling patterns •Student's t test Myotubes My32 (Myosin) 3 EGFP Diffuse 3 SFLS 8 GFP-mTA Diffiise 16 0.025 >P>0.0l SFLS 7

4 EGFP Diffuse or SFLS 2 Nascent striatioa 6 GFP-mTA Diffuse or SFLS 10 0.05 > P > 0.025 Nascent striatioa 5

5 EGFP Diffuse or SFLS 4 Mature striatioa 10 GFP-mTA Diffuse or SFLS II 0.05 > P > 0.025 Mature striatioa 6

9D10 (Titin) 3 EGFP Diffuse 3 Aligned dots 10 GFP-mTA Diffuse 8 0.025 >P >0.01 Aligned dots 4

4 EGFP Diffuse or aligned dots 3 Mature striation 8 GFP-mTA Diffuse or aligned dots 9 0.05 >P> 0.025 Mature striatioa 5

5 EGFP Diffuse or arrays 3 Mature striation 9 GFP-mTA Diffuse or arrays 14 0.05 >P> 0.025 Mature striatioa 9

The number of (nmsfected mycxubes with different myosin and titin localizatioo patterns is shown in this table.

The number of cells exhibiting each labeling pattern was compared between the cells expressing GFP in EGFP and GFP-mTA transfected cultures. Significance was determined using Student's t test Differences for each day were significant accofding to the Probability level shown. 70

D-zone C-zone P-zone

A-band titincaimiEi]) iiiiiiiiiiiiiiiii nnmicp 1-3 4 5 6-11 Cloned titin fiagment mTA m

D Fn3 repeat •I Ig repeat

Figure 1. Domain structure and position in the titin sequence of tiie cloned mouse skeletal muscle titin fragment mTA. The upper diagram shows the three regions of titin found in each half of the myofibrillar A-band, from the M-line (at the right end of the diagram) to the end of the thick filament (at the left), as determined from the human cardiac muscle titin sequence (Labeit and Kohlmerer, 1995). These regions correspond to the P-zone, the C-zone, which is the region where MyBP-C and MyBP-H are located, and the D-zone, which extends from the C-zone to the end of the thick filament. The C-zone region of titin consists of 11 repeats of an 11-domain pattern. The cloned titin fragment mTA contains one complete Ig domain and three complete Fn3 domains, along with partial domains at each end, and spans part of the fourth and flfth super-repeats in the C-zone, as shown in the lower diagram. 71

Figure 2. Purification of the expressed mTA titin fragment from E. coU, Shown is a Coomassie-Blue stained SDS-PAGE gel of fractions obtained in the purification of the his-tagged mTA titin fragment. Lane 1, molecular weight standards; Lane 2, whole cell lysate; Lane 3, mTA fragment purified by chromatography on an Ni- NTA column. Molecular weights are indicated at the left; the position of the mTA band is indicated by the arrow at the right. 72

A405 0.5 u^ul ceD ^te coated 0.6

0.5 0.1 u^ul purified tidn fragment 0.4 coated

0.3 Block 0.2

0.1 Otify 1st and 2nd Ab 0 0 O.OI 0.02 0.04 0.09 0.18 0.37 0.75 1.5 -0.1 Onty 2nd Ab Oveiiayed n^sn (ug^ul)

Figure 3. Microtiter plate assay of the interaction of titin fragment mTA with myosin. Whole bacterial cell lysate (containing His-mTA titin) or purified His-mTA titin were coated on the wells of a microtiter plate. After blocldng and washing, the plates were incubated with increasing concentrations of myosin, in blocking buffer containing 600 mM KCI, as described in the Materials and Methods. Binding was detected with myosin antibody, alkaline phosphatase-conjugated second antibody and alkaline phosphatase substrate, quantitated by using a microtiter plate reader, and expressed directly as absorbance of the alkaline phosphatase reaction. 73

Myosin

Figure 4. Precipitation assay of the interaction of mTA titin fragment with myosin. Proteins interacting with the expressed mTA protein were precipitated from solution using mTA protein attached to agarose beads and analyzed by inmiunoblotting. Lysates from 3-d C2C12 myotube cultures or purified myosin were incubated with agarose beads coated with mTA titin fragment or control beads with no protein, and beads and bound proteins were collected by centrifugation. The beads were washed, and bound proteins were eluted by heating in SDS-PAGE loading buffer and removal of the beads by centrifugation. Samples were analyzed by SDS-PAGE and immunoblotting with a monoclonal myosin antibody MF20, using chemiluminescence detection. A) Immunoblot of the protein precipitated from purified myosin diluted in lysis buffer. Lane 1, protein precipitated by control beads; lane 2, proteins precipitated by beads coated with the his-tagged mTA titin fragment. B) Immunoblot of the protein precipated from a C2C12 myotube culture lysate. Lane 1, protein precipitated by control beads; lane 2, proteins precipitated by beads coated with the his-tagged mTA titin fragment. The position of myosin is indicated Figure 5. Fluorescence localization of GFP and myosin in 3-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-mTA construct (bottom, panels c and d). Cultures were fixed and labeled with myosin antibodies after 3 d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict myosin localization via rhodamine immunofluorescence. The myotube transfected with EGFP vector alone (a, b) shows expression of GFP and organization of myosin along SFLSs (arrow in b). In the culture transfected with GFP-mTA (c, d) the myotube at the right demonstrates GFP expression in a diffuse pattern and also shows myosin localization in a generally diffuse pattern, with no clear SFLSs. Other myotubes in the same culture that are not expressing GFP show myosin localization along clear SFLSs (arrow in d). 75

*

I

I

\ Figure 6. Fluorescence localization of GFP and myosin in 4-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-mTA construct (bottom, panels c and d). Cultures were fixed and labeled with myosin antibodies after 4 d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict myosin localization via rhodamine immunofluorescence. In the control cultures (a, b) a myotube expressing GFP (a) shows clear myofibrillar striations with the myosin labeling (arrow in b). In the GFP-mTA transfected cultures (c, d), the myotube at the left expressed GFP along SFLS with a few pleliminary striations; the myotube at the right shows not GFP expression and clear myofibrillar localization of myosin (arrow in d).

Figure 7. Fluorescence localization of GFP and myosin in S-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-mTA construct (bottom, panels c and d). Cultures were fixed and labeled with myosin antibodies after 5 d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict myosin localization via rhodamine immunofluorescence. A myotube in the control, pEGFP-transfected culture (a, b) shows GFP expression and organized and aligned myofibrils with myosin labeling (arrow in b). In the GFP-mTA-transfected culture (c, d) the myotube at the upper left that shows GFP fluorescence shows only faint striations along the membrane, while an adjacent myotube that did not express GFP shows aligned myofibrils (arrow in d). 79

•> '

J V •*

cd Figure 8. Fluorescence localization of GFP and titin in 3-d transfected myotulie cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-mTA construct (bottom, panels c and d). Cultures were fixed and labeled with titin antibodies after 3 d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict titin localization via rhodamine immunofluorescence. In the control, pEGFP-transfected culture (a, b) a myotube expressing GFP (a) shows titin localized in arrays of dots or stripes (b). In the culture transfected with GFP-mTA, a myotube expressing the GFP construct (left side of panel c) shows poorly aligned dots and diffuse labeling for titin (d); an adjacent myotube that did not expressing the constnict shows a titin localization as a series of dots (arrow in d).

Figure 9. Fluorescence localization of GFP and litin in 4-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-mTA construct (bottom, panels c and d). Cultures were fixed and labeled with titin antibodies after 4 d in differentiation medium. Images on left (a and c) depict GFP fluorescence; images on the right (b and d) depict titin localization via rhodamine immunofluorescence. A myotube in the control culture that expressed GFP (a) demonstrated titin localization as a series of doublet bands characteristic of myofibrillar labeling (arrow in b). In the GFP-mTA transfected culture, a myotube that expressed GFP (c) shows repeated striations but few doublets (right myotube in d) while an adjacent myotube that did not express GFP shows aligned doublet bands (arrow in d). 83

•

r' Figure 10. Fluorescence localiiation of GFP and titin in 5-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-mTA construct (bottom, panels c and d). Cultures were fixed and labeled with titin antibodies after S d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict titin localization via rhodamine immunofluorescence. A myotube in the control, pEGFP-transfected culture (a, b) that shows GFP expression (a) shows titin labeling in a myoflbrillar pattern of aligned doublets (b). In the GFP-mTA-transfected cultures (c, d), a myotube expressing GFP shows both diffuse titin localization and some regions of single or double titin bands (d), while an adjacent myotube that did not express GFP again shows titin localization in a myofibrillar pattern (arrows in d). 85 Figure 11. Fluorescence localization of GFP and actin in transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (upper panels, a-0 or the GFP-mTA construct (lower panels, g- I). Cultures were fixed and labeled with rhodamine-phalloidin. For each pair of images of the same field (a and b, c and d, etc.) the left-hand image of each pair (a, c, e, g. i, k) depicts GFP fluorescence while the right-hand image of each pair (b, d, f, h, j, I) shows actin localization via rhodamine-phalloidin fluorescence. From left to right, pairs of images show cultures 3-d (a, b, g, h), 4-d (c, d, i, j) and S-d (e, f, k, I) after addition of differentiation medium. The actin localization patterns of myotubes that express GFP in the control, pEGFP-transfected cultures are similar to the patterns seen in the GFP-mTA-transfected cultures.

Figure 12. Fluorescence localization of GFP and a-actinin in transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (upper panels, a-0 or the GFP-mTA construct (lower panels, g- I). Cultures were flxed and labeled with a monoclonal antibody to a-actinin. For each pair of images of the same field (a and b, c and d, etc.) the left-hand image of each pair (a, c, e, g. i, k) depicts GFP fluorescence while the right-hand image of each pair (b, d, f, h, j, I) shows a-actinin localization via rhodamine fluorescence. From left to right, pairs of images show cultures 3-d (a, b, g, h), 4-d (c, d, i, j) and S-d (e, f, k, I) after addition of differentiation medium. The a- actinin labeling patterns for the control, EGPF-transfected cultures (a-0 and the GFP-mTA-transfected cultures (g-l) are very similar. 89

r 90

ANTISENSE INHIBITION OF TITIN EXPRESSION ON MYOFIBRIL ASSEMBLY

A paper to be submitted to the Journal of Animal Science

Qunfeng Dong, Richard M. Robson, Ted W. Huiatt

Abstract

Besides the thick and thin filaments, titin makes up a third Hlament system in striated muscle. A single titin molecule spans the entire half sarcomere, with its N- and C-termini in the Z line and M line, respectively. Titin interacts with other thick ^lament proteins and is proposed to act as a molecular blueprint controlling the positions of other contractile proteins in the thick filament (Whiting et al., 1989; Trinick, 1996; Wang, 1996). In order to test the role of titin in the process of myofibril assembly in developing muscle cells, cultures of the mouse skeletal muscle cell line C2C12 were transiently transfected with a green fluorescent protein (GPP) construct designed to express anti-sense titin RNA. The anti-sense RNA targets the 5' beginning region of native titin message including the 5' untranslated region and start codon. Myofibril assembly in the transfected culture was monitored by immunofluorescence labeling antibodies to myofibrillar proteins over a period from 1 to 5 d after myoblast fiision was induced. Expression of the anti-sense titin RNA decreased the titin expression and delayed titin and myosin organization. As a consequence, a delayed myofibril

A band assembly in transfected myotubes, compared to non-transfected myotubes and myotubes only expressing the GPP, was observed. These data suggested that titin expression and organization indeed plays an important role in organizing the structure of the myofibrillar myosin thick filament during myofibrillogenesis. 91

Introduction

Titin (Wang et al., 1979) makes up to 10% of the total myofibrillar proteins in skeletal and cardiac muscle (for reviews, see Maruyama, 1997; Trinick, 1996). A single titin

polypeptide spans the entire half sarcomere (Furst et al., 1988), with its N-terminal region embedded in the Z line and its C-terminal region extended into the M line (Granzier and

Irving, 1995). The primary structure of the titin molecule is mostly composed of two types of repeated 100-residue motifs, which belong to either the fibronectin type HI (Fn3) or the immunoglobulin C2 (Ig) domain superfamilies (also referred to as motif I and motif II, respectively) (Labeit and Kolmerer, 1995). In the A band region, the Ig and Fn3 domain forms eleven eleven-domain super-repeats in the thick filament C-zone (the middle one third of each half thick filament) (Labeit and Kolmerer, 1995). This super-repeat structure appears to correlate with the presence of the eleven 43 nm crossbridge repeats and repetitive patterns of attachment sites for the MyBP's of the thick filaments within the C-zone (for review see

Gautel et al., 1996). In vitro studies have showed that A band titin interacts with other thick filament proteins, such as myosin, MyBP-C, M protein, and myomesin (Maruyama et al.,

1985; Labeit et al., 1992; Houmeida et al., 1995; Obermann et al., 1996). Based on those interaction results, the A band titin has been proposed to act as a molecular template defining the positions of other contractile proteins in the thick filament (Whiting et al., 1989; Trinick,

1996; Wang, 1996).

In vitro studies have been carried out to investigate titin's physiological roles.

Horowits et al. (1986) utilized low doses of ionizing radiation to fragment giant proteins present in single fibers from rabbit psoas muscle fibers and showed that passive tension was reduced over the same range of radiation dose that fragmented titin. Selective digestion of 92

titin in different muscle fibers with low concentration of trypsin gave similar results, and the

decrease in passive tension was quantitatively matched by the extent of titin degradation

(Funatsu et al., 1990; Higuchi, 1992; Granzier and Irving, 1995). Further studies using

trypsin treatment found that selective degradation of titin abolished the ability of isolated cardiac myocytes to re-lengthen to their original slack length following shortening (Helmes et al., 1996). These results suggest that titin is the source of passive tension, and titin functions as a bi-directional molecular spring that resists lengthening as well as shonening

(Funatsu et al., 1990; Horowits et al., 1986; Yoshioka et al., 1986).

In vitro studies have also suggested that titin plays an important role in centering thick filaments and thus preventing sarcomere asymmetry resulting from the thick filament moving closer to one Z line than the other during contraction and passive stretch (Horowits and Podolsky, 1987; 1988). Destruction of titin by ionizing radiation leads to axial misalignment of thick filaments upon stretch, and this disorder is irreversibly increased by activation (Horowits et al., 1986). Also, digestion of titin by trypsin results in sarcomere disorder, thick Hlaments losing their central position, and dislocation of whole A bands from the I bands (Higuchi, 1992).

To address the functional properties of titin in vivo, we have utilized the antisense

RNA approach to inhibit the titin biosynthesis in cultured myotubes. Antisense RNA may interfere with transcript stability, translation (Melton, 198S), and mRNA transport between nucleus and cytosol (Kim and Wold, 1985). Protein synthetic inhibition is proportional to the number of antisense RNA molecules introduced into the cells (McGarry and Lindquist,

1986). We demonstrated that the high-level expression of antisense RNA, generated by a

GFP vector, suppressed and delayed titin synthesis and organization in cultured myotubes. 93

Depression of titin correlated with delayed myosin Hlament assembly. These data indicate

that titin indeed plays an important role in maintaining and organizing the structure of the

myofibril A band.

Materials and Methods

Antibodies

The hybridoma expressing monoclonal myosin antibody MF20 (Bader et al., 1982) and

monoclonal titin antibody 9D10 (Wang and Greaser, 1985) were both obtained firom

Developmental Studies Hybridoma Bank (University of Iowa, Iowa City, lA); undiluted cell culture supematants were used for all experiments with both antibodies. Monoclonal myosin

antibody, My32, (Havenith et al., 1990; Carteret al., 1990) to mouse skeletal myosin (Sigma

Chemical Co., St Lx)uis, MO) was used at a 1:400 dilution. Monoclonal a-actinin antibody,

BM75.2 (Abd-El-Basset et al., 1991) (Sigma) was used at a 1:8(X) dilution. Rhodamine-

labeled phalloidin (Molecular Probes, Inc., Eugene, OR) was used to detect F-actin at a 1:100

dilution; rhodamine-coupled goat anti-mouse secondary antibodies (ICN Biomedicals, Inc.

Irvine, CA) were used to visualize antibody labeling at a 1:100 dilution.

Molecular Cloning

The mouse cDNA encoding the Z line region of titin was isolated by reverse transcnption-polymerase chain reaction (RT-PCR) from mouse skeletal muscle RNA. Adult mouse leg muscles were dissected, flash frozen and stored in liquid nitrogen. Total RNA was extracted by a guanidinium thiocyanate-phenol-chloroform extraction procedure

(Chomczynski and Sacchi, 1987). Based on the human cardiac and chicken skeletal Z line homology regions, the following RT-PCR primers were designed to clone the mouse skeletal

Z line titin: Zlinel, upper primer (5' ATTAGAGGCTCACCGATTCATGT 3'), 2^ine2, lower primer (5' CGCCCCCGCACAGCTAGCCCTCACT 3'), and Zline3, 1st strand RT primer (S'CGCTTGCCATCTTTGTACCATG 3'). Reverse transcription was carried out in reaction mixture containing 1 ^g total RNA and 10 units of AMV reverse transcriptase

(Promega Corporation, Madison, WI) in a total volume of 20 ^1. The 1st strand reaction products were then used in PGR amplitication with Taq DNA polymerase (Promega). Initial denaturation was done at 94 °C for 3 min, followed by 30 cycles of 98 °C for 40 sec, 52 °C for 1 min, 72 "C for 3 min and final extension of 10 min at 72 °C. The resulting partial Z line titin cDNA (designated mTZ) was gel purified using a Qiagen gel extraction kit and cloned to pGEM-T vector (Promega) to produce pGEM-mTZ for sequencing. Double stranded plasmid DNA was sequenced by the.chain termination method (Sanger et al., 1977) at the

Iowa State University DNA Sequencing and Synthesis Facility with an Applied Biosystem

Model 373A DNA sequencer using the 17 or universal primers carried by the vector.

Sequenced data was assembled, translated and analyzed using the University of Wisconsin

GCG software package (Devereux et al., 1984). Genbank searches were conducted using the

NCBI BLAST server (Altshul et al., 1990).

The Sac I fragment from pGEM-mTZ was then ligated into the Sac I site of the plasmid pEGFP-Cl. The antisense orientation was selected to produce the GFP-antiTZ construct. Recombinant DNA manipulation was performed using standard procedures

(Sambrook et al., 1989).

Cell Culture and Transfection

Mouse skeletal mouse cell line C2C12 (Blau et al., 1983) was obtained from ATCC

(Rockville, MD). For transfections, cells were grown to 70% confluence onto collagen- coated Arclar cover-slips (EMS, Fort Washington, PA) in Proliferation medium (DMEM, 10% FBS) in 5% CO2 in a 37 °C incubator. Cells were washed twice in OptiMEM (Life

Technologies) and placed in 800 |il fresh OptiMEM. DNA liposome complexes were prepared by combining l.S ^g plasmid DNA with 10 ^1 lipofectamine (Life Technologies) in

200 ^l serum-free OptiMEM. After 30 min, the complexes were added dropwise to the culture dish, and cultures incubated for S h in S% CO2 in a 37 incubator. Then, 2 ml of the

DMEM containing 20% FBS was added to the dish. Twenty-four hours after transfection, cells were washed once with PBS (150 mM NaCl, 20 mM Na-phosphate, pH 7.0) and differentiation was induced by low scrum differentiation medium (DMEM, 4% HS, 10 ®M insulin). The DNA used for above transfection were purified by using the Concert™ maxi- prep protocol (Life Technologies).

Immunofluorescence Staining and Confocal Microscopy

Cultures grown on the Arciar cover-slips were rinsed with PBS and Hxed with freshly prepared 3.2% formaldehyde in PBS at room temperature for 25 min. Cells were then permeabilized by incubation with 0.5% Triton X-100 in PBS for 5 min, or 0.1% Triton X-

100 in PBS for 15 min at room temperature. After 30 min with the blocking buffer (5% goat serum, 10% FBS, 1% BSA in PBS), cells were incubated with the primary antibodies for 90 min at 37 °C. Following 10 washes with the blocking buffer for total 30 min, cells were incubated with secondary antibodies for 1 h at room temperature and washed lOx with PBS.

Cover slips were mounted with Vectashield® medium (Vector Laboratories, InC.,

Burlingame, CA). Rhodamine-labeled phalloidin, which binds specifically to F-actin, was used to visualize stress fibers and thin filaments within myofibrils (Zhikarev et al., 1997).

Stained cells were examined with a Leca TCS NT confocal microscope system using a lOOx 96

(NA 1.4) objective with excitation Hlters for ihodamine or GFP. Micrographs were recorded as digital images on a SenSys cooled HCCD camera and images were processed using Adobe

Photoshop.

Results

Isolation of Mouse Titin Z line cDNA

For transfecting mouse skeletal muscle cell line C2CI2, 2.2-kb mouse skeletal muscle

Z line cDNA was obtained from the RT-PCR by using the primers designed based on the human cardiac muscle Z line titin cDNA sequence (Labeit and Kolmerer, 1995). Sequence analysis shows the cloned mouse Z line titin has a high homology to the human titin Z line sequence at nucleotide acid level and contains the 5'-untranslated region and Z line titin open reading frame including the start codon (Fig. 1).

Inhibition of Titin Expression and Organization by Anti-sense Titin RNA in C2C12 Cells

One proposed function of titin is to act as a scaffold for the thick Hlament assembly.

In order to in^'estigate this proposed function, we carried out experiments to inhibit titin expression with anti-sense RNA and detect its effects on myofibrillogenesis. The antisense titin RNA was introduced into the cells by the GFP-antiTZ construct shown in Fig. 2. The

GFP-antiTZ construct was designed by inserting the S'end -0.5 kb of the cloned titin Z line cDNA (mTZ) in the anti-sense orientation to the 3' end of GFP ORF in the pEGFP vector.

C2C12 cells were transfected with the GFP-antiTZ construct. After 24 h, transfected cells were then switched to the fusion medium to induce differentiation. Cultures induced to differentiate are referred to herein as myotube cultures, with time 0 set at the time of the medium change. Thus, aid myotube culture has been grown in differentiation medium for 1 d. The process of the differentiation was monitored from days 1 to 5 by immunofluorescence labeling with antibodies to myofibrillar proteins. Control cells were transfected by the pEGFP vector only. The myotubes expressing the GFP-antiTZ construct showed various levels of green fluorescence. In the same cultures, the myotubes not showing GFP fluorescence can be viewed as controls of normal myofibrillogenesis.

Monoclonal titin antibody 9D10, which binds specifically to the PEVK region of titin, was used to detect titin expression level and organization during myofibrillogenesis (Fig. 3-

5). During the first two days, the staining with 9D10 showed either a diffuse or dot-like pattern in the control myotubes but faint labeling in the GFP-mTZ transfected myotubes

(data not shown). In 3 d myotube cultures transfected with pEGFP vector only (Fig. 3 a and b), titin appeared along the SFLSs in arrays of dots or stripes inside the myotubes expressing

GFP (Fig. 3b). Titin localization similar to the control culture was seen in myotubes not expressing GFP (Fig. 3c) in the GFP-mTA transfected cultures (Fig. 3d). In GFP-antiTZ transfected cultures, myotubes expressing GFP (Fig. 3c) only showed faint titin labeling in the regions underneath cell membranes (Fig. 3d). After 4 days, myotubes transfected with pEGFP displayed clear striation patterns with the titin antibody (Fig. 4b). Titin striations were also seen in myotubes not expressing GFP in the GFP-antiTZ transfected 4 d myotube cultures (Fig. 4d). In myotubes expressing GFP-antiTZ, there were only a few striations underneath the membrane region seen with titin labeling in the 4 d myotube cultures (Fig.

4d). After 5 days, mature myofibril striation patterns were seen in pEGFP transfected myotube (Fig. Sb) and myotubes not expressing GFP in the GFP-antiTZ transfected cultures

(Fig. 5d). Myotubes expressing GFP-antiTZ (Fig. 5d) only showed a few striations near the . These experiments show that the antisense titin RNA decreases native titin 98 expression in cells expressing the GFP, and also dramatically delays organization of the small amount of titin that was expressed.

The effect of the GFP-antiTZ transfection on assembly of myosin during myofibrillogenesis was detected by labeling with the monoclonal myosin antibody, My32

(Fig. 6-8). During the first two days, both pEGFP transfected control cells and GPF-antiTZ transfected cells started to form small myotubes, but no evident structure-like patterns of myosin were detected (data not shown). Beginning with 3-d myotube cultures, myosin started to appear localized along the stress fiber like structures (SFLSs) inside pEGFP transfected myotubes (Fig. 6b). However, in the GFP-antiTZ transfected cultures myosin still appeared to be in a diffuse state inside myotubes showing GFP expression (Fig. 6 c, d). A myotube in the same GFP-mTA transfected culture that was not expressing GFP fluorescence (Fig. 6 c, d), showed similar structures as that of the pEGFP transfected myotube. In 4 d myotube cultures, myosin was beginning to show some normal myofibrillar striation patterns inside both the pEGFP transfected myotubes (Fig. 7b) and in myotube not expressing GFP in the transfected culture (Fig. 7f). In myotubes expressing GFP-antiTZ in 4 d cultures (Fig. 7 c, e), the majority of myosin still showed diffuse localization and only few SFLSs could be observed (Fig. 7 d, 0- In 5 d cultures, mature myofibril structure can be observed in the whole pEGFP vector transfected myotubes by myosin inmiunofluorescence (Fig. 8 a, b).

Inside the GFP-mTA transfected myotubes, more SFLSs appeared but only a few nascent myofibrils could be found (Fig. 8d). Cells not expressing GFP in the GFP-mTA transfected cultures (Fig. 8 c, d) had a similar myosin localization pattern as the pEGFP transfected controls. These results showed that myosin organization was delayed or disrupted in the cells expressing the GFP-antiTZ construct. 99

Rhodamine-phalloidin was used to detect actin filament assembly since it speciHcally labels F-actin. During the time-course of labeling, no major differences were found in the F- actin labeling panems between the myotubes expressing the GFP-antiTZ construct transfected myotubes and either pEGFP transfected myotubes or myotubes not expressing

GFP in the GFP-antiTZ transfected cultures. In all the myotubes studied, rhodamine- phalloidin labeled progressively from stress fibers at the early stage of myofibrillogenesis (1- d myotube cultures) to the striation patterns in mature myofibrils (Fig. 9). Therefore, F-actin assembly does not seem to be affected much by over-expression of the partial A band region of titin.

Z line assembly was monitored by staining for its major component, a-actinin, by use of the monoclonal a-actinin antibody BM7S.2. Similar to the F-actin labeling, the a-actinin labeling pattern did not show any difference between the myotubes expressing the GFP- antiTZ construct transfected myotubes and either pEGFP transfected myotubes or myotubes not expressing GFP in the GFP-antiTZ transfected cultures. During myofibrillogenesis, a- actinin showed an initial dot-like labeling pattern that progressed first quickly to association with SFLS and then developing into regular striation patterns (Fig. 10).

Discussion

This smdy showed antisense titin RNA decreased titin expression in transfected

C2C12 myotubes. The decreasing of titin expression was accompanied by delay in thick filament assembly without dramatic changes in actin and Z line assembly. The thick filament assembly requires the precise aligimient of hundreds of myosin molecules, along with associated proteins. Based on its molecular layout in the A band and its capability to interact with thick filament proteins such as myosin and MyBPs, titin has been proposed to be such a 100

regulatory element for the assembly of the myosin thick filament (for reviews, see Gautel,

1996; Trinick, 1996).

During the preparation of this manuscript. Van der ven et al. (2000) reponed a

subclone of the baby hamster kidney (BJK-21/C13) cell line, BHK-21-Bi, which bears a

small deletion within the titin gene. The small deletion resulted a truncated titin polypeptide

comprising the extreme amino-terminal 100 kDa of Z line portion of titin is synthesized.

Although the expression of other sarcomeric proteins seems not to be affected, the formation

of thick myosin Hlaments and the assembly of Z line are impaired. This (Van der ven et al.,

2000) is the first reported study involving in vivo knockout of titin and it provided direct

evidence for the important role of titin in myofibrillogenesis. However, this particular

permanent cell line is a mutant resulting from multiple passage of a clone of BHK-21 cells

over a five years period. The authors explained the reason of such deletion in titin gene was

possibly due to the absence of selective pressure on titin gene's function under their cell

culture conditions. Therefore, BHK-21-Bi should be regarded as a spontaneous mutant and

other genomic deterioration beside the titin gene may also occur in this cell line.

Here, we described an antisense mRNA approach that specifically created a titin

negative model. The antisense mRNA approach has been proved to be a powerful tool to

inhibit gene expression by interfering with transcript stability, translation (Melton, 1985) and

mRNA transportation between nucleus and cytoplasm (Kim and Wold, 1985). In our studies,

the titin cDNA was ligated into a GFP vector in an antisense orientation with the same

reading-frame as the cDNA for GFP (GFP-antiT2^. After transiently transfecting the construct into the C2C12 cells, the titin antisense mRNA should have been generated

together with GFP sense mRNA under one same promoter (Fig. 2). Therefore, a chimerical 101

mRNA with its 5' region consisting of the sense GFP mRNA and its 3' region consisting of

the antisense titin mRNA was generated inside the cells. Our hypothesis is that, if the

transfected constructs can not overexpress this chimerical mRNA inside the cells, the

antisense titin mRNA will be probably degraded together with partial amount of the native

sense titin mRNA, and this degradation will probably also destroy all the chimeric mRNA.

Thus, no chimeric mRNA could survive and no GFP protein can be expressed. Otherwise, if

we can see the expression of the GFP protein, the transfected constructs must have

overexpressed the chimeric mRNA which is more than enough to degrade the native mRNA.

Our data seem to support this hypothesis since the majority of myotubes showing high level

of GFP fluorescence label titin much more faintly than controls. Also, according to our

assumptions, it is possible that some myotubes may also contain less titin but show no GFP

fluorescence. However, in our study, we did not particularly look for and examine those

myotubes. Thus, the included sense GFP mRNA at the 5' region will give two advantages for

this study. First, it can indicate the expression of the transfected constructs directly by its

green fluorescence. Second, it can also indicate the overexpression level of the antisense titin

mRNA. To support these assumptions, we also prepared a different antisense construct in

which the GFP and antisense titin Z line cDNA were under two identical but independent

CMV promoters. This construct should result in independent GFP mRNA and independent antisense titin Z line RNA. After transfecting C2C12 cells with this construct, the resulting myotube cultures showed the same percentage (>30%) of green myotubes as transfection with the GFP vector alone (data not shown). However, cells transfected with the GFP-antiTZ construct always show very low percentage (<5%) of green myotubes. Since the transfection efficiency should be about the same for the two different constructs, the difference between 102

the percentage of the green myotubes can be best explained as the result of the sense GFP

mRNA being degraded with the antisense titin mRNA/native sense titin mRNA in the GFP- antiTZ transfected myotubes.

In vivo over-expression of this chimeric GFP-antiTZ resulted in a decrease of titin expression as indicated by the titin antibody staining (Fig. 3-5) and also delay of myosin filament assembly as indicated by the myosin antibody staining (Fig. 6-8). Since expressing

GFP alone does not have any apparent effects (Fig. 3-8), the observed delay of myosin filament assembly is likely due to lack of sufficient titin molecules interacting with myosin.

While myosin in GFP vector transfected cells has already shown typical striation patterns, myosin in GFP-antiTZ transfected cells shows a diffuse appearance, which is in agreement with what Van der Ven observed in BHK-21-Bi cells. Our results support the current hypothesis that titin is involved in the thick filament assembly through its interactions with the thick filament components. Also, our results showed the antisense effects appeared to be neutralized at the late stage of myofibrillogenesis. The appearance of correct myosin filament organization at some local regions is possibly due to the increasing expression of native titin compared to the decreasing antisense titin RNA from the transiently transfected DNA constructs. The expression of muscle specific proteins have been well known to be dramatically increased after differentiation. We speculate at the certain point, the endogenous increasingly transcribed titin mRNA overwhelms the suppression by the exogenous antisense titin RNA. Also the neighboring nontransfected myoblasts could be added onto the transfected myotubes, providing more myosin and other thick filament proteins.

In contrast, the labeling of the actin thin filaments does not show significant disruption compared to the normal patterns shown in the control cells. This results support 103

the hypothesis that nebulin instead of titin is the scaffold of the thin filament assembly

(Wang et al., 1996). Also, it indicates that thin filament forms correctly in the absence of a

normal myosin filament structure. Although the exact events during myofibrillogenesis have

not been fully understood yet, recently studies have suggested that the assembly of thin and thick filament occurs independently during myofibrillogenesis (Ehler et al., 1999; Holtzer et al., 1997). Moreover, the maturation of the Z line and thin filaments occurs before that of the

myosin filament (Ehler et al., 1999; Van der Ven et al., 1999).

The major Z line component a-actinin also does not show any significant disruption in the presence of the antisense titin RNA in this study. This result is quite surprising and thus should be interpreted with great caution. In the past several years, several groups

(Tumacioglu et al.,1997; Peckham et al.,1997; Gregorio et al., 1998; Ayoob et al., 2000) have shown that the association of titin filaments with Z line, via their interaction with T-cap and a-actinin, appears to be critical for the assembly and maintenance of myofibril structure.

Basically, a dominant negative phenotype has been observed in living muscle cells expressing high levels of either the entire Z line region or part of Z line titin, with myofibril disassembly occurring in response to expression of these constructs. One possible explanation of what we observed is that the assembly of a-actinin only requires a small amount of titin. Because the antisense RNA inhibition does not necessarily completely block the expression of titin, the small amount of titin is enough for directing a-actinin location during myoHbrillogenesis.

No titin-linked diseases have yet been confirmed possibly because titin plays such important role for muscle function that defect mutations of titin could result in embryonic lethality. In fact, our previous anempts to create stable transfectants of C2C12 cells that 104 constitutively express titin antisense mRNA were unsuccessful (data not shown), suggesting that deletion of titin might also interfere with myoblast viability. Here, we described an antisense RNA transient inhibition approach to indicate the important function of titin in vivo. In summary, the antisense titin RNA disrupted the myosin filament formation but left the Z line and, to a large extent, thin filament intact. These data further demonstrated that titin plays an important role in maintaining and organizing the structure of the myofibril thick filament. Our findings also support the hypothesis that nucleation and assembly of I-Z-I bodies occurs independently of the formation of sarcomeric thick filaments and vice versa.

References

Abd-el-Basset, E. M., Ahmed, I., Fedoroff, S. (1991) Actin and actin-binding proteins in differentiating astroglia in tissue culture. J. Neurosci. Res. 30:1-17.

Altshul, S. P., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. (1990) Basic local alignment search tool. J. Mol. Biol. 215:403-410.

Ayoob, J. C., Tumacioglu, K. K., Mittal, B., Sanger, J. M., Sanger, J. W. (2000) Targeting of cardiac muscle titin fragments to the Z-bands and dense bodies of living muscle and non-muscle cells. Cell Motil. Cytoskel. 45:67-82.

Bader, D., Masaki, T., Fischman, D. A. (1982) Inmiunochemical analysis of myosin heavy chain during avian myogenesis in vivo and in vitro. J. Cell Biol. 95:763-770.

Blau, H. M., Chiu, C. P., Webster, C. (1983) Cytoplasmic activation of human nuclear genes in stable heterocaryons. Cell 32:1171-1180.

Carter, R. L., Jameson, C. F., Philp, E. R., Pinkerton, C. R. (1990) Comparative phenotypes in rhabdomyosarcomas and developing skeletal muscle. Histopathology 17:301-309.

Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem.162:156-159.

Devereux, J., Haeberli, P., Smithies, O. (1984) A comprensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 12:387-395. 105

Ehler, E., Rothen, B. M., Hanunerle, S. P., Komiyama, M., Perriard, J. C. (1999) Myofibrillogenesis in the developing chicken heart: assembly of Z-disk, M-line and the thick filaments. J. Cell Sci.l 12:1529-1539.

Freiburg, A., Gautel, M. (1996) A molecular map of the interaction between titin and myosin-binding protein C. Implications for sarcomeric assembly in familiar hypertrophic cardiomyopathy. Eur. J. Biochem. 235:317-323.

Funatsu, T., Higuchi, H., Ishiwata, S. (1990) Elastic Hlaments in skeletal muscle revealed by selective removal of thin filaments with plasma gelsolin. J. Cell Biol. 110:53-62.

Furst, D. O., Osbom, M., Nave, R., Weber, K. (1988) The organization of titin filaments in the half sarcomere revealed by monoclonal antibodies in immunoelectron microscopy: A map of ten non-repetitive epitopes starting at the Z line extends close to the M-line. J. Cell Biol. 106:1563-1572.

Gautel, M. (1996) The super-repeats of titin/connectin and their interactions: glimpses at sarcomeric assembly. Adv. Biophys. 33:27-37.

Granzier, H. L., Irving, T. C. (1995) Passive tension in cardiac muscle: contribution of collagen, titin, microtubules, and intermediate filaments. Biophys. J. 68:1027-1044.

Gregorio, C. C, Trombitas, K., Centner, T., Kolmerer, B., Stier, G., Kunke, K., Suzuki, K., Obermayr, P., Herrmann, B., Granzier, H., Sorimachi, H., Labeit, S. (1998) The NH2 terminus of titin spans the Z-disc: its interaction with a novel 19 kD ligand (T-cap) is required for sarcomeric integrity. J. Cell Biol. 143:1013-1027.

Havenith, M. G., Visser, R., Schrijvers-van Schendel, J. M., Bosman, F. T. (1990) Muscle fiber typing in routinely processed skeletal muscle with monoclonal antibodies. Histochemistry 93:497-499.

Higuchi, H. (1992) Changes in contractile properties with selective digestion of connectin (titin) in skinned fibers of frog skeletal muscle. J. Biochem. 111:291-295.

Helmes, M., Trombitas, K., Granzier, H. (1996) Titin develops restoring force in rat cardiac myocytes. Circ. Res. 79:619-626.

Horowits, R., Kempner, E. S., Bisher, M. E., Podolsky, R. J. (1986) A physiological role for titin and nebulin in skeletal muscle. Nature 323:160-164.

Horowits, R., Podolsky, R. J. (1987) The positional stability of thick filaments in activated skeletal muscle depends on sarcomere length: evidence for the role of titn filaments. J. Cell Biol. 105:2217-2223. 106

Horowits, R., Podolsky, R. J. (1988) Thick Hlament movement and isometric tension in activated skeletal muscle. Biophys. J. 54:165-171.

Houmeida, A., Holt, J., Tskhoviebova, L., Trinick, J. (1995) Studies of the interaction between titin and myosin. J. Cell Biol. 131:1471-1481.

Kim, S. K., Wold, B. J. (1985) Stable reduction of thymidine kinase activity in cells expressing high levels of anti-sense RNA. Cell 42:129-38.

Labeit, S., Gautel, M., Lakey, A., Trinick, J. (1992) Towards a molecular understanding of titin. EMBO. J. 11:1711-1716.

Labeit, S., Kolmerer, B. (1995) Titins: Giant proteins in charge of muscle ultrastructure and elasticity. Science 270:293-296.

Maruyama, K., Yoshioka, T., Higuchi, H., Ohashi, K., Kimura, S., Natori, R. (1985) Connectin Hlaments link thick filaments and Z lines in frog skeletal muscle as revealed by immunoelectron microscopy. J. Cell Biol. 101:2167-2172.

Maruyama, K. (1997) Connectin/titin, giant elastic protein of muscle. FASEB. J. 11:341 -345.

McGarry, T. J., Lindquist, S. (1986) Inhibition of heat shock protein synthesis by heat inducible antisense RNA. Proc. Nad. Acad. Sci. USA. 83:399-403.

Melton, D. A. (1985) Injected anti-sense RNAs specifically block messenger RNA translation in vivo. Proc. Natl. Acad. Sci. USA. 82:144-148.

Muhle-Goll, C., Nilges, M., Pastore, A. (1997) IH and 15N NMR resonance assignments and secondary structure of titin type I domains. J. Biomol. NMR. 9:2-10.

Muhle-Goll, C., Pastore, A., Nilges, M. (1998) The three-dimensional structure of a type I module from titin: a prototype of intracellular flbronectin type III domains. Structure 6:1291-1302.

Obermann, W. M, Gautel, M., Steiner, F, Van der Veen, P. F. M., Weber, K., Furst, D. O. (1996) The structure of the sarcomeric M band: localization of defined domains of myomesin, M protein, and the 250 kD carboxyl terminal region of titin by immunoelectron microscopy. J. Cell Biol. 134:1441-1453.

Peckham, M., Young, P. Gautel, M. (1997) Constitutive and Variable Regions of Z disk Titin/Connectin in Myofibril Formation: A Dominant-negative Screen. Cell Struct. Funct. 22:95-101. 107

Pfuhl, M., Pastore, A. (1995) Tertiary structure of an immunoglobulin-like domain from the giant muscle protein titin: a new member of the I set. Structure 3:391-401.

Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, New York. Cold Spring Harbor Laboratory.

Trinick, J. (1994) Titin and nebulin: protein rulers in muscle? Trends Biochem Sci 19:405-409.

Trinick, J. (1996) Titin as a scaffold and spring. Current Biology 6:258-260.

Tumacioglu, K. K., Mittal, B., Dabiri, G. A., Sanger, J. M., Sanger, J. W. (1997) An N -terminal fragment of titin coupled to green fluorescent protein localizes to the Z-bands in living muscle cells: overexpression leads to myoflbril disassembly. Mol. Biol. Cell 8:705-717.

Van der Ven, P. F., Ehler, E., Perriard, J. C., Furst, D. O. (1999) Thick filament assembly occurs after the formation of a cytoskeletal scaffold. J. Muscle Res. Cell Motil. 20:569- 579.

Van Der Ven, P. F., Bartsch, J. W., Gautel, M., Jockusch, H., Furst, D. O. (2000) A functional knock-out of titin results in defective myofibril assembly. J. Cell Sci. 113:1405-1414.

Wang, K. (1996) Titin/connectin and nebulin: giant protein rulers of muscle structure and function. Adv. Biophys. 33:123-134.

Wang, K., Knipfer, M., Huang, Q. Q., Van der ven. A., Hsu, L. C., Gutierrez, G., Quian, X. L., Stefan, H. (1996) Human skeletal muscle nebulin sequence encodes a blueprint for thin filament architecture. Sequence motifs and affinity profiles of tandem repeats and terminal SH3. J. Biol. Chem. 271:4304-4314.

Whiting, A., Wardale, J., Trinick, J. (1989) Does titin regulate the length of thick filaments? J. Mol. Biol. 205:263-268.

Yoshioka, T., Higuchi, H., Kimura, S., Ohashi, K., Umazume, Y., Maruyama, K. (1986) Effects of mild trypsin treatment on the passive tension generation and connectin splitting in stretch^ skinned Hbers from frog skeletal muscle. Biomed. Res. 7:181-186.

Zhikaiev, V., Sanger, J. M., Sanger, J. W., Goldman, Y. E., Shuman, H. (1997) Distribution and orientation of rhodamine-phalloidin bound to thin filaments in skeletal and cardiac myofibrils. Cell Motil. Cytoskel. 37:363-377. 108

mTZ: 12

hTZ: 36

mTZ: 72 TTTTGGGCACTCCTCAGAAATCAGAGTGCCTGAAAAG ,CTACTCAAGCACCGATGTT131 INI lllllll llllllllllllllllll IIMIIMIIIM Ml hTZ: 96 TTTTAGGCACTCTTGAGAAATCAGASTGCCTAGAAAG .CAACTCAAGCACCGACGTTIS 5

mTZ: 132 TACGCAGCCGTTACAAAGCGTTGTGGTACTGGAGGGTAGTACCGCAACCTTTGAGGCTCA 191 IIIIIIIIIMIIIIIIIIIIMIIIIIIiiMllllllllillllMIIIIIIIMIII hTZ: 156 TACGCAGCCGTTACAAAGCGTTGTGGTACTGGAGGGTAGTACCGCAACCTTTGAGGCTCA 215

mTZ: 192 CGTTAGTGGTTCCCCAGTTCCTGAGGTGAGCTGGTTTCGGGATGGCCAGGTGATTTCAAC 251 I lilllliM llllllllllllllllillMIII MIMIIIIIIIIIIIIIi II hTZ: 216 CATTAGTGGTTTTCCAGTTCCTGAGGTGAGCTGGTTTAGGGATGGCCAGGTGATTTCCAC 275

mTZ: 252 TTCCACTCTGCCCGGCGTGCAGATCTCCTTTAGCGATGGCCGCGCTAGATTGATGATCCC 311 IIIIIIIIIIIMIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII I III Mill! hTZ: 276 TTCCACTCTGCCCGGCGTGCAGATCTCCTTTAGCGATGGCCGCGCTAAACTGACGATCCC 335

mTZ: 312 CGCCGTGACTAAAGCCAACAGTGGACGATACTCCCTGAGAGCCACCAATGGATCTGGACA 371 llllllllllllllllllllllllllllll lllllll Mlllllllllllllllllll hTZ: 336 CGCCGTGACTAAAGCCAACAGTGGACGATATTCCCTGAAAGCCACCAATGGATCTGGACA 395

mTZ: 372 AGCGACTAGTACTGCTGAGCTTCTTGTGACAGCCGAGACAGCACCACCCAACTTCAGTCA 431 llllilllllllllllllllllll MM III Mlllllllllllllllllll III hTZ: 396 AGCGACTAGTACTGCTGAGCTTCTCGTGAAAGCTGAGACAGCACCACCCAACTTCGTTCA 455

mTZ: 432 GCGGCTGCAGAGCATGACTGTGAGACAAGGAAGCCAAGTGAGACTCCAAGTGAGAGTGAC 491 11 MMMIMMMI IMMMMMMMMMMMMMMMMMMMM hTZ: 456 ACGACTGCAGAGCATGACCGTGAGACAAGGAAGCCAAGTGAGACTCCAAGTGAGAGTGAC 515

mTZ: 492 TGGAATCCCTACACCTGTGGTGAAGTTCTACCGGGATGGA 531 IMMMMM MIMMMMMMMMMMMM hTZ: 516 TGGAATCCCTAACCCTGTGGTGAAGTTCTACCGGGATGGA 555

Figure 1. clMOl ••qu«nc« of the cloned mouse skeletal muscle partial Z line region of titin.

The 5' 0.5 kb sequence of cloned Z line titin cDNA is compared with hiiman cardiac muscle titin Z line (Labeit amd Kolmerer, 1995). The identity of Z line titin between these two species is 93%. The light box represents the 5' xmtreuislated region (UTR). The dark box marks the ATG start codon. mTZ: mouse Z line titin. hTZ: humsui Z line titin. CMV Promoter GFP SV40 PoIyA NEO

Figure 2. Constructs designed to express anti-sense titin RNA. The 5' 500 bps of the cloned Z-line titin cDNA was inserted in an antisense orientation into a GFP vector. The anti-sense titin cDNA is under the one CMV promoter together with the GFP cDNA. Figure 3. Fluorescence localization of GFP and lilin in 3-d transfecled myotube cultures.

C2C12 cell cultures were transfecled with EGFP vector (top, panels a and b) or the GFP-antiTZ construct (bottom, panels c and d). Cultures were flxed and labeled with titin antibodies after 3 d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict titin localization via rhodamine immunofluorescence. In the control, pEGH^-transfected culture (a, b) a myotube expressing GFP (a) shows titin localized in arrays of dots or stripes (b). In the culture transfected with GFP-antiTZ, a myotube expressing GFP (c) shows faint labeling for titin (d). In an adjacent myotube not expressing GFP, titin is localized in a pattern of dots (arrow in d). Ill

o Figure 4. Fluorescence localization of GFP and titin in 4-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-antiTZ construct (bottom, panels c and d). Cultures were fixed and labeled with titin antibodies after 4 d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict titin localization via rhodamine immunofluorescence. A myotube in the control culture that expressed GFP (a) demonstrated titin localization as a series of doublet bands characteristic of myofibrillar labeling (arrow in b). In the GFP-antiTZ transfected culture, a myotube that expressed GFP (c) shows few doublets underneath cell membrane (d) while an adjacent myotube that did not express GFP shows aligned doublet bands (arrow in d).

Figure 5. Fluorescence localization of GFP and titin in 5-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-antiTZ construct (bottom, panels c and d). Cultures were fixed and labeled with titin antibodies after S d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict titin localization via rhodamine immunofluorescence. A myotube in the control, pEGFP-transfected culture (a, b) that shows GFP expression (a) shows titin labeling in a myofibrillar pattern of aligned doublets (b). In the GFP-antiTZ-transfected cultures (c, d), a myotube expressing GFP shows a few regions of single or double titin bands (d), while an adjacent myotube that did not express G^ again shows titin localization in a myofibrillar pattern (arrows in d). 115 Figure 6. Fluorescence localization of GFP and myosin in 3-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-antiTZ construct (bottom, panels c and d). Cultures were fixed and labeled with myosin antibodies after 3d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and d) depict myosin localization via rhodamine immunofluorescence. The myotube transfected with EGFP vector alone (a, b) shows expression of GFP and organization of myosin along SFLSs (arrow in b). In the culture transfected with GFP-antiTZ (c, d) the myotube at the bottom expressing GFP in (c) shows myosin localization in a generally diffuse pattern, with no clear SFLSs. Other myotubes in the same culture that are not expressing GFP show myosin localization along clear SFLSs (arrow in d). 117 Figure 7. Fluorescence localization of GFP and myosin in 4-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-antiTZ construct (bottom, panels c-Q- Cultures were fixed and labeled with myosin antibodies after 4d in differentiation medium. Images on the left of each panel (a, c, e) depict GFP fluorescence; images on the right (b, d, 0 depict myosin localization via rhodamine immunofluorescence. In the control cultures (a, b) a myotube expressing GFP (a) shows clear myofibrillar striations with the myosin labeling (arrow in b). In the GFP-antiTZ transfected cultures (c-f). the myotubes expressing GFP (c, e) shows SFLSs or a few preliminary striations (e, 0 while the myotubes that show no GFP expression show clear myofibrillar localization of myosin (arrow in 0- 119 Figure 8. Fluorescence localization of GFP and myosin in 5-d transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (top, panels a and b) or the GFP-antiTZ construct (bottom, panels b and c). Cultures were fixed and labeled with myosin antibodies after S d in differentiation medium. Images on the left (a and c) depict GFP fluorescence; images on the right (b and c) depict myosin localization via rhodamine immunofluorescence. A myotube in the control, pEGFP-transfected culture (a, b) shows GFP expression and organized and aligned myofibrils with myosin labeling (arrow in b). In the GFP-antiTZ-transfected culture (c, d) the myotube at the upper left that shows GFP fluorescence shows only faint striations in some regions, while an adjacent myotube that did not express GFP shows aligned myofibrils (arrow in d). 121

• Figure 9. Fluorescence localization of GFP and actin in transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (upper panels, a-f) or the GFP-antiTZ construct (lower panels, g-l). Cultures were fixed and labeled with rhodamine-phalloidin. For each pair of images of the same field (a and b, c and d, etc.) the left-hand image of each pair (a, c, e, g. i, k) depicts GFP fluorescence while the right-hand image of each pair (b, d, f, h, j, I) shows actin localization via rhodamine-phalloidin Huorescence. From left to right, pairs of images show cultures 3-d (a, b, g, h), 4-d (c, d, i, j) and S-d (e, f, k, I) after addition of differentiation medium. The actin localization patterns of myotubes that express GFP in the control, pEGFP-transfected cultures arc similar to the patterns seen in the GFP-antiTZ-transfected cultures.

Figure 10. Fluorescence localization of GFP and a-actinin in transfected myotube cultures.

C2C12 cell cultures were transfected with EGFP vector (upper panels, a-0 or the GFP-antiTZ construct (lower panels, g-l). Cultures were fixed and labeled with a monoclonal antibody to a-actinin. For each pair of images of the same field (a and b, c and d, etc.) the left-hand image of each pair (a, c, e, g. i, k) depicts GFP fluorescence while the right-hand image of each pair (b, d, f, h, j, I) shows a-actinin localization via rhodamine fluorescence. From left to right, pairs of images show cultures 3-d (a, b, g, h), 4-d (c, d, i, j) and S-d (e, f, k, I) after addition of differentiation medium. The a- actinin labeling patterns for the control, EGPF-transfected cultures (a-Q and the GFP-antiTZ-transfected cultures (g-l) are very similar. 125

• y' 1^1 126

GENERAL CONCLUSIONS

The proposed role of titin as a molecular blueprint for myofibril assembly was investigated in the mouse skeletal muscle cell line C2C12 by two different approaches. One

was a so-called dominant-negative approach, which was implemented by transiently transfecting cells with a fusion construct consisting of a partial A band (C-zone) titin cDNA linked to a cDNA for green fluorescence protein (GFP). The working hypothesis for this approach was that, if titin, particularly the A band region, is important in the myofibril assembly through its interaction with other myofibrillar proteins, then the overexpression of this partial A band titin should interfere with the function of the native titin by competing for these interactions. The results from this first approach showed over-expression of the partial

A band C-zone titin disrupted the myosin filament assembly but did not affected assembly of the Z line and thin filaments. These findings demonstrated that the A band C-zone region of titin plays an important role in maintaining and organizing the structure of the myofibrillar A band. The other approach was an antisense mRNA approach, which was implemented by transiently transfecting cells with a fusion construct consisting of a partial Z line titin cDNA in the antisense orientation linked to GFP cDNA. The working hypothesis for this second approach was that the antisense mRNA would block the native titin expression by interfering with transcription or translation. The resulting decrease in titin expression may then alter normal myofibril assembly if titin is indeed important. The results from this second approach showed the antisense titin RNA decreased titin expression and disrupted the myosin filament assembly. But the Z line and, to a large extent, thin filament assembly were not affected.

Since either too much titin, resulting from overexpression; or too little titin, resulting from antisense inhibition, led to the disruption of thick filament organization, these data 127

indicate that the proper interaction between titin and myosin seem to be critical for correct

thick filament assembly, which is in agreement with the proposed role for the A band region

of titin that it acts as a molecular blueprint in thick filament assembly. Furthermore, the data

from both approaches seem to support the hypothesis that the assembly of Z lines and thin

filaments occurs independently of the formation of sarcomeric thick ^laments based on our

observations that: (1) Z line a-actinin assembly was not interrupted in the titin overexpression cells where thick filament assembly was disrupted; (2) thin filament assembly was not interrupted in the titin over-expression cells and, to a large extent, in the cells where titin expression was decreased by the antisense RNA approach. However, the Hnding that the a-actinin assembly was also not interrupted in cells where titin expression was inhibited by the antisense RNA approach is a surprise. In the past several years, several groups

(Tumacioglu et al.,1997; Peckham et al.,1997; Gregorio et al., 1998; Ayoob et al., 2000) have shown that the association of titin filaments with a-actinin, appears to be critical for the assembly and maintenance of myofibril structure based on observations that dominant negative phenotypes were found in muscle cells expressing high levels of either whole Z line or part of Z line titin, with myofibril disassembly occurring. In addition, a recent report (Van der ven et al., 2000) showed that a-actinin assembly was disrupted during the myoHbrillogenesis in a subclone of the baby hamster kidney (BJK-21/C13) cell line, BHK-

21-Bi, which bears a small deletion within the titin gene. One possible explanation of what we observed is that the assembly of a-actinin only requires a small amount of titin. Since the antisense RNA inhibition doesn't necessarily completely block the expression of titin, the 128

small amount of titin is possibly enough for directing a-actinin location during

myofibrillogenesis.

Despite proposed functions and models for titin, the large size of the titin molecule still makes it difficult to investigate titin's in vivo functions by applying traditional molecular

biology and cell biology methods to whole titin molecules. For example, for small

molecules, site-directed mutagenesis can be used to 'comb' through the critical amino acids and any mutated molecules can be easily transfected into cell culture system to examine their effects. Unfortunately, today's technologies can only allow such techniques to be applied to partial titin molecules. In addition, there is no report so far of knocking out the titin gene in animal systems. People have suspected that knocking out whole titin gene will result in early embryonic death. However, with more knowledge about titin's genomic DNA structures, it is possible that, in the future, transgenic animals with specific mutations in individual titin domains can be created. Without affecting larger parts of titin gene, such specifically mutated animals will be perfect for studying myofibril assembly or muscle elasticity.

References

Ayoob, J. C., Tumacioglu, K. K., Mittal, B., Sanger, J. M., Sanger, J. W. (2000) Targeting of cardiac muscle titin fragments to the Z-bands and dense bodies of living muscle and non-muscle cells. Cell Motil. Cytoskel. 45:67-82.

Peckham, M., Young, P., Gautel, M. (1997) Constitutive and Variable Regions of Z disk Titin/Connectin in Myofibril Formation; A Dominant-negative Screen. Cell Stmct. Funct. 22:95-101.

Tumacioglu, K. K., Mittal, B., Dabiri, G. A., Sanger, J. M., Sanger, J. W. (1997) An N -terminal fragment of titin coupled to green fluorescent protein localizes to the Z-bands in living muscle cells. Mol. Biol. Cell 8:705-17.

Van Der Ven, P. F., Baitsch, J. W., Gautel, M., Jockusch, H., Furst, D. O. (2000) A functional knock-out of titin results in defective myofibril assembly. J. Cell Sci. 113:1405-14. 129

ACKNOWLEDGEMENTS

I am thankful to my major professor. Dr. Ted W. Huiatt for supporting me to work on my projects. I appreciate all his understanding and patience. I also appreciate Dr. Richard M.

Robson for his support during the difficult time of my research. I would also like to thank

Dr. Daniel F. Voytas for his encouragement and advice.

I would like to extend my appreciation to other members of the Muscle Biology

Group, especially Jo Philips and Rob Bellin. I appreciate all the helps they provided to solve the day-to-day experimental procedure problems.

I am indebted to my parents and my family for their love, encouragement and help all the time. I feel ashamed when compared to their excellent achievement in both research and every day life.