Supplementary Material Online

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Sycon raphanus CAC14731 98 Sycon raphanus CAC14730 Porifera 100 Sycon raphanus CAC14729 100 Echinococcus granulosus EUB62503 Schistosoma japonicum ACT20714 100 100 Echinococcus granulosus EUB63052 Platyhelminthes Schistosoma japonicum ACT20715 100 Caenorhabditis elegans AAC47715 54 100 Trichinella spiralis 1EFV59569 Nematoda Trichinella spiralis EFV52508 Biomphalaria glabrata NP_001298211 98 100 Lymnaea stagnalis Q25410.1 100 Pinctada fucata AGA94627.1 Mollusca Crassostrea gigas XP_011456321 Strongylocentrotus purpuratus XP_011668294 Echinodermata Xenopus leavis NP_001081702 89 100 100 Mus musculus NP_034698.2 Homo sapiens AAA59174.1 InR 96 Xenopus leavis BC060457.1 100 100 Mus musculus NP_035962.2 IRR Vertebrata 96 Homo sapiens NP_055030 100 Mus musculus NP_034643.2 97 Homo sapiens AAB22215 IGF1R Xenopus leavis NP_001081734.1

87 Metaseiulus occidentalis XP_003739590 100 Ixodes scapularis XP_002416224.1 Arachnida Ornithodoros rostratus GCJJ01004115.1 Daphnia pulex EFX85280.1 100 Daphnia pulex EFX62637.1 100 Daphnia pulex EFX63421.1 Crustacea Daphnia pulex EFX85381.1 Tetrodontophora bielanensis GAXI01021207 53 100 Anurida maritima GAUE01001371 99 Pogonus chalceus JU418048 Tribolium castaneum EFA02828 100 Apis mellifera XP_394771 Solenopsis invicta JF304723 75 Acyrthosiphon pisum XP_001942660 Nilaparvata lugens AIY24639 97 Homalodisca vitripennis HVIT005312-RA Homalodisca vitripennis HVIT005314-RA Pyrrhocoris apterus KX087105 73 100 Medauroidea extradentata GAWD01045541 Extatosoma tiaratum GAWG01048820 84 Tanzaniophasma sp. GAXB01155547 55 Blattella germanica KN196784_2 100 51 Zootermopsis nevadensis KDR21367 67 69 Leuctra sp. GAUF01012297 100 Extatosoma tiaratum GAWG01064895 92 Medauroidea extradentata GAWD01037141 Tetrix subulata GASQ01015035 55 100 Blattella germanica KN196784_1 Zootermopsis nevadensis KDR21366 100 Eurylophella sp. GAZG01015571 Ephemera danica GAUK01018742 Lepisma saccharina KX087106 100 Pyrrhocoris apterus KX087104 Pyrrhocoris apterus KX087103 Hexapoda Nilaparvata lugens AIY24638 55 Homalodisca vitripennis HVIT002229-RA Ephemera danica GAUK01018485 74 88 Epiophlebia superstes GAVW01013590 Tanzaniophasma sp. GAXB0203043 100 Medauroidea extradentata GAWD01065534 45 Extatosoma tiaratum GAWG01064894 51 Leuctra sp. GAUF01084507 Blattella germanica HG518668 100 Zootermopsis nevadensis KDR13786 60 Tetrix subulata GASQ02008536 Boreus hyemalis GAYK01004971 78 Tribolium castaneum XP_008199415 99 Pogonus chalceus JU427775 100 Nasonia vitripennis XP_008203941 Solenopsis invicta JF304722 100 Apis mellifera NP_001233596 100 Liposcelis bostrychophila GAYV01001422 Pediculus humanus corporis XP_002430961 Plutella xylostella XP_011567916 100 Bombyx mori NP_001037011 83 Danaus plexippus EHJ65074 Musca domestica XP_005178583 72 97 100 Ceratitis capitata XP_004518075 100 Bactrocera dorsalis XP_011210333 Drosophila melanogaster AAF55903 100 Aedes aegypti Q93105 Anopheles sinensis KFB49958 0.5 Acyrthosiphon pisum XP_008185917 Supplementary Figure 1. Phylogenetic tree of insulin receptor protein sequences identified across Animalia, including selected representatives of Insecta. Sycon raphanus InR sequences were set as outgroup. Duplication events in non-insect phyla are marked with arrowheads. The topology and branching supports were inferred using RAxML maximum likelihood algorithm with WAG + Γ model (-ln = 131220.705824), the bootstrap values calculated from 1000 replicates are shown for nodes represented in more than 50% of trees. InR, insulin receptor; IRR, insulin receptor-related receptor; IGF1R, insulin-like growth factor 1 receptor.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Sarcophaga peregrina GGEP01039589 >96 Musca domestica XP_011291787 >90 Ceratitis capitata XP_004527212 bootstrap >80 Drosophila melanogaster NP_724157 value (%) Clunio marinus CRL06839 Diptera >65 Aedes aegypti FAA01101 >50 Anopheles sinensis KFB49143 Liogma simplicicornis GEMK01029352 0.3 Plutella xylostella XP_011567028 Danaus plexippus EHJ77075 Lepidoptera InR2 InR1 Bombyx mori XP_004925605 Armisén et al. Kremer et al. GASS02028789 DR2 Platycentropus radiatus 2018 2018 Annulipalpia sp. GATX01005845_ Trichoptera Annulipalpia sp. GATX01012065 Boreus hyemalis GAYK01108088 Mecoptera Tribolium castaneum EFA01771 * Tribolium castaneum EFA02828 Dendroctonus ponderosae XP_019755840 Coleoptera Leptinotarsa decemlineata XP_023030119 InR-1 Pogonus chalceus JU418048 Lu & Pietrantonio Chrysopa pallens AVK43098 Neuroptera 2011 Xanthostigma xanthostigma GAUI02048109 Raphidioptera Fopius arisanus XP_011310956 Cephus cinctus XP_024940155 Athalia rosae XP_012259845 Hymenoptera Apis mellifera XP_394771 Solenopsis invicta JF304723 Pyrrhocoris apterus KX087105 (InR2) Jadera haematoloma AVT56265 Oncopeltus fasciatus AVT56270 Podisus maculiventris GFUB01178628 Halyomorpha halys XP_024217440 Lygus hesperus JAG20929 Rhodnius prolixus GECK01019799 Pagasa sp. GCXU01024823 Cimex lectularius XP_014242611 Heteroptera Rhagovelia antilleana INR2 Microvelia longipes INR2 Gerris buenoi INR2 Limnoporus dissortis INR2 Aquarius paludum INR2 Hydrometra cumata INR2 Mesovelia furcata INR2 Hebrus sp. INR2 Nilaparvata lugens AIY24639 Euscelidius variegatus GFTU01002760 Homalodisca vitripennis HVIT005314-RA Diceroprocta seminicta GGPH01050080 Neotibicen dorsatus GCYV01053567 * Clastoptera arizonana GEDC01010167 Mapuchea sp. GCXN01044447_1045662 Homalodisca liturata GECU01010637 Graphocephala atropunctata GEBQ01003303 Campylenchia latipes GCWI01051784 Auchenorrhyncha Euscelidius variegatus GFTU01002463 Graminella nigrifrons GAQX01001711 * Euscelidius variegatus GFTU01007873 Graphocephala atropunctata GEBQ01020846_01005496 * Cuerna arida GECZ01003109 Homalodisca liturata GECU01004804 Homalodisca vitripennis HVIT005312-RA Euscelidius variegatus GFTU01003387 Graminella nigrifrons GAQX01006206 Bemisia tabaci XP_018897134 Diaphorina citri XP_008479213 Pachypsylla venusta GAOP01019620 Phenacoccus solenopsis GGIT01015335 Adelges tsugae GBJX01018946 Daktulosphaira vitifoliae GDEB01025952 Sternorrhyncha Aphis citricidus ARD07922 Acyrthosiphon pisum XP_001942660 Diuraphis noxia XP_015363980 Myzus persicae XP_022180848 Perla marginata GATV02011223 Leuctra sp. GAUF01012297 Plecoptera Timema genevievae GFPR01021056 InR2_2 Aretaon asperrimus GAWC01082819 Phasmatodea Xu & Zhang Extatosoma tiaratum GAWG01064895 2017 Blattella germanica KN196784_1 Zootermopsis nevadensis KDR21366 Blattodea Cryptotermes secundus XP_023702527 InR2_1 Prorhinotermes simplex MH560589 (InR2) Xu & Zhang Tetrix subulata GASQ01015035 Orthoptera Zootermopsis nevadensis KDR21367 2017 Cryptotermes secundus XP_023702537 Prorhinotermes simplex MH560588 (InR3) Blattodea Blattella germanica KN196784_2 InR2-like Timema genevievae GFPR01028898 Armisén et al. Aretaon asperrimus GAZQ02010804_GAWC01050212 Phasmatodea 2018 Extatosoma tiaratum GAWG01048820 Tanzaniophasma sp. GAXB01155547 Mantophasmatodea Tetrix subulata GASQ02006861 Orthoptera Zorotypus caudelli GAYA02044618 Zoraptera InR3 Ecdyonurus insignis GCCL01030520 Kremer et al. Ephemera danica GAUK01018742 Ephemeroptera 2018 Eurylophella sp. GAZG01015571 InR2 Xu et al. 2015 Xu & Zhang 2017 Ding et al. 2017 Cluster I Lin et al. 2018

Supplementary Figure 2. Phylogenetic tree and nomenclature of insect insulin receptors and decoy of insulin receptors identified in the Cluster II in 98 species from 23 orders. The tree represents the full version of the simplified tree given in Figure 1 of the main text. Orange arrow marks the Cluster II duplication within Polyneoptera. Red arrow (DR2) marks the loss of the tyrosine kinase domain giving rise to the decoy of insulin receptor gene DR2 (red) in Mecopterida, a group of advanced Holometabola including Diptera, Lepidoptera, Trichoptera and Mecoptera. Asterisks mark the duplication identified in Tribolium castaneum and the multiple duplications in Auchenorrhyncha. The topology and branching supports were inferred using RAxML maximum likelihood algorithm with WAG + Γ model (-ln = 285839.374747) the bootstrap values calculated from 500 replicates are shown for nodes represented in more than 50% of trees. Black dots in the right part of the figure indicate the insect orders included in phylogenetic analyses in previous studies, the boxes give the nomenclature used by previous studies for the identified InR genes. Bold marking in brackets shows the InR nomenclature used in this study for P. simplex and P. apterus InRs.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Cluster II

InR-2 InR1 Lu & Pietrantonio Armisén et al. 2011 2018 >96 Musca domestica XP_011290405 >90 bootstrap Sarcophaga peregrina GGEP01012125 InR2 >80 SDR Kremer et al. value (%) Ceratitis capitata XP_004519681 >65 Drosophila melanogaster NP_650408 2018 >50 Drosophila melanogaster AAF55903 Musca domestica XP_005178583 Sarcophaga peregrina GGEP01027089 Diptera 0.3 Ceratitis capitata XP_004518075 Clunio marinus CRL08130 Anopheles sinensis KFB49958 Aedes aegypti Q93105 Liogma simplicicornis GEMK01036784 Nyssomyia neivai JAV06640 Boreus hyemalis GAYK01004971 Mecoptera Ctenocephalides felis XP_026475386 Ceratophyllus gallinae GAWK02019316 Siphonaptera Plutella xylostella XP_011567916 Bombyx mori NP_001037011 Lepidoptera Danaus plexippus EHJ65074 Annulipalpia sp. GATX01009258_01085969_ Platycentropus radiatus GASS02029169 Trichoptera Chrysopa pallens AVK43099 Neuroptera Xanthostigma xanthostigma GAUI02044701 Raphidioptera Tribolium castaneum XP_008199415 Leptinotarsa decemlineata XP_023021383 Dendroctonus ponderosae XP_019765260 Coleoptera Pogonus chalceus JU427775 Lachesilla contraforcepeta GCWJ01026792 Liposcelis bostrychophila GAYV01001422 Badonnelia titei GDFG01033096 Psocodea Pediculus humanus corporis XM_002430916 Geomydoecus ewingi GCXD01012496 Tanzaniophasma sp. GAXB02030434 Mantophasmatodea Aretaon asperrimus GAWC01055274 Extatosoma tiaratum GAWG01064894 Phasmatodea Timema genevievae GFPR01012227 Prorhinotermes simplex MH560587 (InR1) Zootermopsis nevadensis KDR13786 Cryptotermes secundus PNF35478 Blattodea Blattella germanica HG518668 Leuctra sp. GAUF01084507 Plecoptera Tetrix subulata GASQ02008536 Orthoptera Zorotypus caudelli GAYA02038706 Zoraptera Athalia rosae LOC105688867 Nasonia vitripennis XP_008203941 Fopius arisanus XP_011300657 Cephus cinctus XP_015603667 Hymenoptera Solenopsis invicta JF304722 Apis mellifera NP_001233596 Cordulegaster boltonii GAYO02000575 Epiophlebia superstes GAVW01013590 Odonata Megaloprepus caerulatus GEXY01362158 Ecdyonurus insignis GCCL01041136 Ephemera danica GAUK01018485 Ephemeroptera Lepisma saccharina KX087106 Thermobia domestica GASN02067420 Zygentoma * Thermobia domestica GASN02067910 Halyomorpha halys XP_014273515 Podisus maculiventris GFUB01166485 Jadera haematoloma AVT56264 Alydus pilosus GCVZ01036674 Anasa tristis GCWG01047286 Largus californicus GCXR01064717 Pyrrhocoris apterus KX087103 (InR1a) Largus californicus GCXX01059075 Pyrrhocoris apterus KX087104 (InR1b) * Rhodnius prolixus GECK01011918 Lygus hesperus JAG02168 Pagasa sp. GCXU01030579 Cimex lectularius XP_014256336 Rhagovelia antilleana INR1 Heteroptera Limnoporus dissortis INR1 Aquarius paludum INR1 Gerris buenoi INR1 Microvelia longipes INR1 Hebrus sp. INR1 Hydrometra cumata INR1 Mesovelia furcata INR1 Gerris buenoi INR1-like Aquarius paludum INR1-like Limnoporus dissortis INR1-like Rhagovelia antilleana INR1-like Microvelia longipes INR1-like Mesovelia furcata INR1-like Hydrometra cumata INR1-like Hebrus sp. INR1-like Neotibicen dorsatus GCYV01046097 Diceroprocta seminicta GGPH01129260 Clastoptera arizonana GEDC01006489 Mapuchea sp. GCXN01060330 Graphocephala atropunctata GEBQ01031456 Auchenorrhyncha Homalodisca vitripennis HVIT002229-RA Euscelidius variegatus GFTU01001093 Graminella nigrifrons GAQX01002061 Nilaparvata lugens AIY24638 Phenacoccus solenopsis GGIT01003183 Adelges tsugae GBJX01005109 Daktulosphaira vitifoliae GDEB01020876 Acyrthosiphon pisum XP_008185917 Aphis citricidus ARD07921 Diuraphis noxia XP_015375915 Sternorrhyncha Myzus persicae XP_022180095 Pachypsylla venusta GAOP01060619+21 Diaphorina citri GACJ01002847 InR1 Xu et al. 2015 Bemisia tabaci GEZK01059603 Xu & Zhang 2017 Phlaeothripidae gen. sp. GCYQ01040907 Ding et al. 2017 Frankliniella occidentalis XP_026277828 Thysanoptera Lin et al. 2018 Supplementary Figure 3. Phylogenetic tree and nomenclature of insect insulin receptors and decoy of insulin receptors identified in the Cluster I in 98 species from 23 orders. The tree represents the full version of the simplified tree given in Figure 1 of the main text. Green arrow marks the Cluster I duplication in Gerromorpha, blue arrow (SDR) marks the loss of the tyrosine kinase domain in Muscomorpha, giving rise to the secreted decoy of insulin receptor gene SDR (blue). Asterisks mark the duplication identified in Pyrrhocoridae and in Thermobia domestica. The topology and branching supports were inferred using RAxML maximum likelihood algorithm with WAG + Γ model (-ln = 285839.374747) the bootstrap values calculated from 500 replicates are shown for nodes represented in more than 50% of trees. Black dots in the right part of the figure indicate the insect orders included in phylogenetic analyses in previous studies, the boxes give the nomenclature used by previous studies for the identified InR genes. Bold marking in brackets shows the InR nomenclature used in this study for P. simplex and P. apterus InRs.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

1 4 Muscomorpha 1 0 . 5 Clunio marinus CRL06839 1 Diptera 0.9 0.7 6 2 Culicomorpha Liogma simplicicornis GEMK01029352 1 DR2 0.54 0.9 9 3 Lepidoptera 0.9 9 Lepidoptera 2 Trichoptera Trichoptera 1 Boreus hyemalis GAYK01108088 Mecoptera 1 1 Chrysopa pallens AVK43098 Neuroptera 0.9 9 Xanthostigma xanthostigma GAUI02048109 1 Raphidioptera 4 Coleoptera 1 Coleoptera 5 Hymenoptera 1 Hymenoptera 1 5 Pentatomomorpha 1 1 1 4 Cimicomorpha 0 . 5 1 Heteroptera 8 Gerromorpha 1 Nilaparvata lugens AIY24639 1 1 Auchenorrhyncha 11 Auchenorrhyncha 0.9 9 10 Sternorrhyncha 1 Sternorrhyncha 0.6 1 Phasmatodea 3 Phasmatodea Cluster II 1 1 1 4 Blattodea Blattodea Tetrix subulata GASQ01015035 1 Orthoptera 4 Blattodea Blattodea 0.8 1 1 1 3 Phasmatodea 0.9 8 Phasmatodea 1 0.9 9 Tanzaniophasma sp. GAXB01155547 1 Mantophasmatodea 2 Plecoptera Plecoptera 0.9 7 Tetrix subulata GASQ02006861 Orthoptera Zorotypus caudelli GAYA02044618 1 Zoraptera 3 Ephemeroptera Ephemeroptera

SDR 1 4 Muscomorpha 1 1 1 4 Muscomorpha 1 3 Culicomorpha Diptera 0.9 4 Liogma simplicicornis GEMK01036784 1 0.9 7 Nyssomyia neivai JAV06640 Boreus hyemalis GAYK01004971 1 1 Mecoptera 2 Siphonaptera Siphonaptera 0.9 9 1 1 3 Lepidoptera 0.9 9 Lepidoptera 2 Trichoptera Trichoptera Chrysopa pallens AVK43099 1 Neuroptera 1 Xanthostigma xanthostigma GAUI02044701 1 Raphidioptera 4 Coleoptera 1 Coleoptera 5 Psocodea 0.9 9 Psocodea 10 Sternorrhyncha 1 Sternorrhyncha 6 Hymenoptera Hymenoptera 1 1 7 Pentatomomorpha 1 Rhodnius prolixus GECK01011918 0.9 9 0.9 9

3 Cimicomorpha Cluster I 1 Heteroptera 0 . 5 0 . 5 8 Gerromorpha 1 8 Gerromorpha 0.9 9 9 Auchenorrhyncha Auchenorrhyncha 1 1 2 Thysanoptera Thysanoptera 1 0 . 5 4 Blattodea 0.6 6 1 Blattodea 3 Phasmatodea 0.9 9 0.9 5 Phasmatodea Tanzaniophasma sp. GAXB02030434 Mantophasmatodea Leuctra sp. GAUF01084507 Plecoptera 0 . 5 Tetrix subulata GASQ02008536 0 . 5 Orthoptera Zorotypus caudelli GAYA02038706 Zoraptera 1 3 Odonata 1 1 Odonata 2 Ephemeroptera 1 Ephemeroptera 2 Zygentoma Zygentoma Supplementary Figure 4. Phylogenetic tree of insect insulin receptor genes and decoy of insulin receptor genes identified in 98 species from 23 orders. The numbers in condensed branches indicate the numbers of species. Orange arrow marks the Cluster II duplication within Polyneoptera, red arrow (DR2) marks the loss of the tyrosine kinase domain in advanced Holometabola, giving rise to the decoy of insulin receptor gene DR2 (red). Green arrow marks the Cluster I duplication in Gerromorpha, blue arrow (SDR) marks the loss of the tyrosine kinase domain in Muscomorpha, giving rise to the secreted decoy of insulin receptor gene SDR (blue). The topology and branching supports are based on Bayesian inference (PhyloBayes v4.1).

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

99 Prorhinotermes simplex MH560588 (InR3) 64 Embiratermes neotenicus MN200103 68 Zootermopsis nevadensis KDR21367 61 Cryptotermes secundus XP_023702537 89 Cryptocercus wrighti GAZN02045874 Blattodea 100 Lamproblatta albipalpus GCPS01044670 100 Blattella germanica KN196784_2 Panchlora nivea GGLV01034977 99 77 Peruphasma schultei GAWJ02030221 65 Aretaon asperrimus GAZQ02010804_GAWC01050212 100 Extatosoma tiaratum GAWG01048820 Phasmatodea 100 Medauroidea extradentata GAWD01045541 Timema genevievae GFPR01028898

100 Prorhinotermes simplex MH560589 (InR2) 100 93 Embiratermes neotenicus MN200104 85 Cryptotermes secundus XP_023702527 Cluster II 99 Zootermopsis nevadensis KDR21366 99 Cryptocercus wrighti GAZN02040031 Blattodea 100 Lamproblatta albipalpus GCPS01051046 100 Panchlora nivea GGLV01045863 Blattella germanica KN196784_1 100 100 Extatosoma tiaratum GAWG01064895 82 Medauroidea extradentata GAWD01037141 100 Aretaon asperrimus GAWC01082819 Phasmatodea 100 Peruphasma schultei GAWJ02044630 Timema genevievae GFPR01021056

100 Prorhinotermes simplex MH560587 (InR1) 54 Embiratermes neotenicus MN200105 79 Cryptotermes secundus PNF35478

100 Cryptocercus wrighti GAZN02048104 50 Zootermopsis nevadensis KDR13786 Blattodea 100 Lamproblatta albipalpus GCPS01050204 Panchlora nivea GGLV01061540 100 Blattella germanica_HG518668 99 Medauroidea extradentata GAWD01065534

90 Extatosoma tiaratum GAWG01064894 Cluster I 100 Aretaon asperrimus GAWC01055274 Phasmatodea 100 Peruphasma schultei GAWJ02032289 Timema genevievae GFPR01012227 0.3

Supplementary Figure 5. Detailed phylogenetic tree of insulin receptor gene sequences identified in eight species of Blattodea and five species of Phasmatodea. The topology and branching were inferred using RAxML maximum likelihood algorithm with WAG + Γ model (-ln = 44434.953962), the bootstrap values calculated from 500 replicates are shown for nodes represented in more than 50% of trees.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

57 Tribolium castaneum EFA02828 Holometabola 71 Apis mellifera XP_394771 80 Pyrrhocoris apterus KX087105 (InR2) 58 Nilaparvata lugens AIY24639 Hemiptera Acyrthosiphon pisum XP_001942660 100 Aretaon asperrimus GAWC01082819 100 Extatosoma tiaratum GAWG01064895 Phasmatodea Timema genevievae GFPR01021056 96 Cryptotermes secundus XP_023702527 Prorhinotermes simplex MH560589 (InR2) Blattodea 100 100 Zootermopsis nevadensis KDR21366 Blattella germanica KN196784_1 50 Tetrix subulata GASQ01015035 Orthoptera Xya variegata GCPJ01033443 Zorotypus caudelli GAYA02044618 Zoraptera 74 58 Prorhinotermes simplex MH560588 (InR3) Zootermopsis nevadensis KDR21367 100 Blattodea 100 Cryptotermes secundus XP_023702537 Cluster II 64 Blattella germanica KN196784_2 100 Timema genevievae GFPR01028898 81 100 Aretaon asperrimus GAZQ02010804_GAWC01050212 Phasmatodea Extatosoma tiaratum GAWG01048820 Tanzaniophasma sp. GAXB01155547 Mantophasmatodea Ceuthophilus sp. GAUX02040867 Orthoptera 100 Leuctra sp. GAUF01012297 Plecoptera Perla marginata GATV02011223 Tetrix subulata GASQ02006861 Orthoptera 100 Ephemera danica GAUK01018742 Ephemeroptera Eurylophella sp. GAZG01015571

Apis mellifera NP_001233596 Bombyx mori NP_001037011 Holometabola Drosophila melanogaster AAF55903 Pediculus humanus corporis XP_002430961 Psocodea Tribolium castaneum XP_008199415 Holometabola 100 100 Pyrrhocoris apterus KX087103 (InR1a) Pyrrhocoris apterus KX087104 (InR1b) 80 Nilaparvata lugens AIY24638 Hemiptera Acyrthosiphon pisum XP_008185917 Zorotypus caudelli GAYA02038706 Zoraptera 100 Aretaon asperrimus GAWC01055274 92 Extatosoma tiaratum GAWG01064894 Phasmatodea 71 Timema genevievae GFPR01012227 Tanzaniophasma sp. GAXB02030434 Mantophasmatodea 53 Cryptotermes secundus PNF35478 Cluster I Zootermopsis nevadensis KDR13786 Blattodea 100 100 Prorhinotermes simplex MH560587 (InR1) Blattella germanica HG518668 90 Gryllus bimaculatus GFMG01298068 52 Laupala cerasina GGFB01005618 Ceuthophilus sp. GAUX02032114 Orthoptera Xya variegata GCPJ01052609 Tetrix subulata GASQ02008536 Leuctra sp. GAUF01084507 Plecoptera 0.3 Epiophlebia superstes GAVW01013590 Odonata

Supplementary Figure 6. Detailed phylogenetic tree of insulin receptor gene sequences identified in five species of Orthoptera and major insect lineages for comparison. Orthopteran representatives are marked in red. The topology and branching were inferred using RAxML maximum likelihood algorithm with WAG + Γ model (-ln = 103575.553052; WAG + Γ model), the bootstrap values calculated from 500 replicates are shown for nodes represented in more than 50% of trees.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

0.97 Tribolium castaneum EFA02828 Holometabola 1 Apis melifera XP_394771 1 Pyrrhocoris apterus KX087105 (InR2) 0.87 Nilaparvata lugens AIY24639 Hemiptera Acyrthosiphon pisum XP_001942660 0.84 Tetrix subulata GASQ01015035 Xya variegata GCPJ01033443 Orthoptera 0.83 1 Cryptotermes secundus XP_023702527 1 Prorhinotermes simplex MH560589 (InR2) 1 Blattodea 0.87 Zootermopsis nevadensis KDR21366 Blattella germanica KN196784_1 1 Aretaon asperrimus GAWC01082819 1 Extatosoma tiaratum GAWG01064895 Phasmatodea 1 Timema genevievae GFPR01021056 0.89 Prorhinotermes simplex MH560588 (InR3) 1 Zootermopsis nevadensis KDR21367 Blattodea 1 Cryptotermes secundus XP_023702537 Blattella germanica KN196784_2 1 Cluster II 1 Timema genevievae GFPR01028898 1 1 Aretaon asperrimus GAZQ02010804_GAWC01050212 Phasmatodea Extatosoma tiaratum GAWG01048820 0.82 Tanzaniophasma sp. GAXB01155547 Mantophasmatodea Ceuthophilus sp. GAUX02040867 Orthoptera 0.74 1 Leuctra sp. GAUF01012297 Perla marginata GATV02011223 Plecoptera 0.56 Tetrix subulata GASQ02006861 Orthoptera Zorotypus caudelli GAYA02044618 Zoraptera 1 Ephemera danica GAUK01018742 Ephemeroptera Eurylophella sp. GAZG01015571

1 Bombyx mori NP_001037011 Drosophila melanogaster AAF55903 Apis melifera NP_001233596 Holometabola 0.64 Tribolium castaneum XP_008199415 1 Pediculus humanus corporis XP_002430961 Psocodea 1 Pyrrhocoris apterus KX087103 (InR1a) 0.87 Pyrrhocoris apterus KX087104 (InR1b) Hemiptera 0.61 1 Nilaparvata lugens AIY24638 Acyrthosiphon pisum XP_008185917 0.71 Zorotypus caudelli GAYA02038706 Zoraptera 1 Aretaon asperrimus GAWC01055274 1 Extatosoma tiaratum GAWG01064894 Phasmatodea 1 Timema genevievae GFPR01012227 Cluster I Tanzaniophasma sp. GAXB02030434 Mantophasmatodea 0.55 0.8 Cryptotermes secundus PNF35478 1 1 Zootermopsis nevadensis KDR13786 Blattodea 1 Prorhinotermes simplex MH560587 (InR1) Blattella germanica HG518668 1 Gryllus bimaculatus GFMG01298068 0.96 Laupala cerasina GGFB01005618 0.67 0.99 0.68 Ceuthophilus sp. GAUX02032114 Orthoptera Xya variegata GCPJ01052609 Tetrix subulata GASQ02008536 0.87 Leuctra sp. GAUF01084507 Plecoptera 0.3 Epiophlebia superstes GAVW01013590 Odonata

Supplementary Figure 7. Detailed phylogenetic tree of insulin receptor gene sequences identified in five species of Orthoptera and major insect lineages for comparison. Orthopteran representatives are marked in red. The topology and branching were inferred using Bayesian inference (WAG + Γ model; chain length = 1 milion; MrBayes).

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

InR1 (MH560587) InR2 (MH560589) 1 1 g) (l o

ion 0 0 re ss p e x

e -1 -1 i v

rela t a b a a ab b a b b -2 -2 head digestive tube body cavity gonads head digestive tube body cavity gonads *** * * * *** * * *** ** *** * *** * InR3 (MH560588) 1 worker (log)

n female

i o 0

ss male pre e x

e -1 i v rela t a b a a b a a b -2 head digestive tube body cavity gonads * *** ** ** *** *** *** **

Supplementary Figure 8. Expression pattern of three InRs in somatic tissues and gonads of sterile workers (pseudergates) and neotenic reproductives of both sexes 10 days after their moult from workers in the termite Prorhinotermes simplex. The graphs show qRT-PCR values of the three genes relative to those of the rp49 reference gene and log-transformed to reduce heteroscedasticity. Bars show means, whiskers standard deviations. The transformed data was subjected to two-way analysis of variance with sex and tissues as factors. Gonads (absent in workers) were compared separately between males and females using a t-test. 1-3 asterisks denote significant expression differences at p<0.05, p<0.01, and p<0.001, respectively, between different tissues of each caste/sex. Columns marked with different letters indicate significant inter-caste or inter-sex expression differences at p<0.05 for individual tissues.

For all three InRs, the analyses were evaluated as highly significant, especially due to the significant contribution of the tissues to the total variance (p<10-4 for all three InRs) and the interaction effects (p<7×10-3 for all three InRs). The contribution of caste was retrieved as highly significant for InR3 (p<10-4), while being marginally non- significant for InR2 (p=0.056) and non-significant for InR1 (p=0.12). Post-hoc comparison highlighted several trends in InRs expression among tissues. First, InR2 is highly upregulated in the digestive tube of all castes, while the other two InRs show an opposite pattern, having the smallest expression in the digestive tube, except for workers and InR1. This points to an eventual differential role of the InRs in the nutrient sensing. Last but not least, all InRs had larger expression in the body cavity than in heads in workers and in males (except for InR2 in males). Intercaste differences included significantly higher expressions of all three InRs in heads of females (InR2 also in males) when compared to workers. The same applied for InR3 and the digestive tube. Separate evaluation of InR expression in gonads of reproductives revealed a dramatic difference in InR3 expression in favor of female gonads when compared to very low values in male testes, making the InR3 a female biased gene in all tissues but body cavity. InR1 had high expression values and InR2 moderate expression in gonads of both sexes without striking inter-sex differences.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

growth factor receptor D. melanogaster signal peptide cysteine-rich domain superfamily fibronectin type III domain transmembrane domain AAF55903 receptor L-domain furin-like cysteine-rich domain fibronectin type III superfamily protein tyrosine kinase

2144 aa

A alignment in panel B alignment in panel C 250 aa Furin-like cystein-rich domain

C Supplementary Figure 9. Protein domains and alignments of InRs and decoys of insulin receptors in selected insect taxa. A. Protein domains recognized in a typical InR (D. melanogaster). B. Detail of protein alignment covering Furin-like cystein-rich domain. Red asterisks indicate cysteine residues identified as InR1-specific by Xu et al. (2015), the orange asterisk highlights additional residue unique to Cluster I InRs and SDRs. C. Detail of protein alignment covering transmembrane domain identified in InRs and DR2s. Small black asterisk indicates C terminus in DR2 proteins. N-terminal part of protein tyrosine kinase domain is highlighted in InRs.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

A alignment in panel B alignment in panel C 250 aa L1 receptor L-domain

Drosophila melanogaster (NP_650408) SDR Musca domestica (XP_011290405) Bactrocera dorsalis (XP_011197435) Drosophila melanogaster (AAF55903) Aedes egypti (Q93105) InR Bombyx mori (NP_001037011) Cluster I Pyrrhocoris apterus (InR1a) (KX087103) Pyrrhocoris apterus (InR1b) (KX087104) Nilaparvata lugens (AIY24638) InR Nilaparvata lugens (AIY24639) Cluster II Pyrrhocoris apterus (KX087105) Drosophila melanogaster (NP_724157) Aedes egypti (FAA01101) DR2 Anopheles sinensis (KFB49143) Bombyx mori (XP_004925605) Nilaparvata lugens (XP_022190386.1) Halyomorpha halys (XP_014284376.1) Onthophagus taurus(XP_022910850.1) EGFR Zootermopsis nevadensis (XP_021924577) Drosophila melanogaster (NP_476759) Anopheles sinensis (KFB41066.1) C Fibronectin type III superfamily Drosophila melanogaster (NP_650408) SDR Musca domestica (XP_011290405) Bactrocera dorsalis (XP_011197435) Drosophila melanogaster (AAF55903) Aedes egypti (Q93105) InR Bombyx mori (NP_001037011) Cluster I Pyrrhocoris apterus (InR1a) (KX087103) Pyrrhocoris apterus (InR1b) (KX087104) Nilaparvata lugens (AIY24638) InR Nilaparvata lugens (AIY24639) Cluster II Pyrrhocoris apterus (KX087105) Drosophila melanogaster (NP_724157) Aedes egypti (FAA01101) DR2 Anopheles sinensis (KFB49143) Bombyx mori (XP_004925605) Nilaparvata lugens (XP_022190386.1) Halyomorpha halys (XP_014284376.1) Onthophagus taurus(XP_022910850.1) EGFR Zootermopsis nevadensis (XP_021924577) Drosophila melanogaster (NP_476759) Anopheles sinensis (KFB41066.1) Growth factor receptor cysteine-rich domain superfamily D Supplementary Figure 10. Protein domains and alignments of InRs and decoys of insulin receptors in selected insect taxa compared to epidermal growth factor receptor (EGFR). A. Protein domains recognized in a typical InR (D. melanogaster). B. L1 receptor L-domain. C. L2 receptor L-domain. D. Fibronectin type III superfamily in InRs and Growth factor receptor cysteine-rich domain superfamily in EGFRs.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Bombus terrestris XP_003397946 100 Apoidea Apis mellifera XP_394771

100 Trachymyrmex zeteki XP_018305319 100 98 Acromyrmex echinatior XP_011062671 Formicoidea Wasmannia auropunctata XP_011690939 100 56 Vollenhovia emeryi XP_011882700 Cephus cinctus XP_024940155 Cephoidea 100

Athalia rosae XP_012259845 Cluster II 100 Tenthredinoidea 98 Neodiprion lecontei XP_015518357 Fopius arisanus XP_011310956 Ichneumonoidea 100 Tribolium castaneum EFA02828 Nilaparvata lugens AIY24639

Apis mellifera NP_001233596 100 Apoidea Bombus terrestris XP_003393794 Trachymyrmex zeteki XP_018304053 100 100 100 96 Acromyrmex echinatior XP_011051137 Formicoidea Wasmannia auropunctata XP_011696536 100 Vollenhovia emeryi XP_011864732

100 Trichomalopsis sarcophagae OXU24559 77 Nasonia vitripennis XP_008203941 100 Ceratosolen solmsi marchali XP_011494410 Chalcidoidea

59 Trichogramma pretiosum XP_014228758 Cluster I 82 Copidosoma floridanum XP_014208001

100 Fopius arisanus XP_011300657 Ichneumonoidea Cephus cinctus XP_015603667 Cephoidea

53 Athalia rosae LOC105688867 Tenthredinoidea 100 Neodiprion lecontei XP_015510416 85 Tribolium castaneum XP_008199415 Nilaparvata lugens AIY24638

Tetrodontophora bielanensis GAXI01021207 0.5 Anurida maritima GAUE01001371 Supplementary Figure 11. Detailed phylogenetic tree of insulin receptor gene sequences identified in 15 species of Hymenoptera. The topology and branching were inferred using RAxML maximum likelihood algorithm with WAG + Γ model (-ln = 59986.190587; WAG + Γ model), the bootstrap values calculated from 1000 replicates are shown for nodes represented in more than 50% of trees.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

InR (AAF55903) DR2 (NP_724157) 1 g) o (l 1 ion ss re

p 0 x e e v i t rela a b a b a b a b a b -1 0 head digestive gonads head digestive gonads tube tube *** *** * * ** SDR (NP_650408) 1 g) o

(l male

ion female ss re

p 0 x e e v i t rela -1 head digestive gonads tube ** ** ** * Supplementary Figure 12. Expression pattern of InR and decoy receptor genes SDR and DR2 in somatic tissues and gonads of adult fruit flies Drosophila melanogaster. The graphs show qRT-PCR values of the three genes relative to those of the control reference gene rp49 and log-transformed to reduce heteroscedasticity. Bars show means, whiskers standard deviations. The transformed data was subjected to two-way analysis of variance with sex and tissues as factors. 1-3 asterisks denote significant expression differences at probability values p<0.05, p<0.01, and p<0.001, respectively, between different tissues of each sex. Columns marked with different letters indicate significant inter-sex differences at p<0.05 for individual tissues. All three genes are expressed in all studied tissues of both sexes and have similar expression patterns with low values in the digestive tube and higher expression in the head and gonads. Another general trend is a male- biased expression, most pronounced in the case of DR2. Two-way analysis of variance with sex and tissue as considered factors revealed that for InR and SDR, the tissue differences are the main driving force for the total significance of the tests (p<10-4 and p<5×10-4, respectively), while the inter-sex differences are of secondary importance (p<4×10-3 and p=0.21, interaction p=0.15 and 0.84, respectively). By contrast, the male-female difference was evaluated as the main contributor to the overall significance in DR2 (p<4×10-4), compared to the tissues (p<10-2, interaction p=0.7).

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

InR1a (KX087103) InR2 (KX087105) 15 3 ion

ss 10 2 re p x e e v

i 5 1 t rela a b a b 0 0 brain fat body digestive gonads brain fat body digestive gonads tube tube * * * * ** * ** ** InR1b (KX087104) 2 male

ion 1.5 female ss re p

x 1 e e v i t 0.5 rela a b a b 0 brain fat body digestive gonads tube

* *** *** *** *** ** *** ** *** *** *** Supplementary Figure 13. Expression pattern of three InRs in somatic tissues and gonads of adult linden bugs Pyrrhocoris apterus. The graphs show qRT-PCR values of the three genes relative to those of the control reference gene rp49. Bars show means, whiskers standard deviations. The data was subjected to two-way analysis of variance with sex and tissues as factors. 1-3 asterisks denote significant expression differences at p<0.05, p<0.01, and p<0.001, respectively, between different tissues of each sex. Columns marked with different letters indicate significant inter-sex differences at p<0.05 for individual tissues.

Both InR1a and InR1b genes are expressed in adults of both sexes, just as it is the case for the Cluster II InR (KX087105, hereafter InR2). InR1a shows the highest transcript abundances in all tissues of both sexes, while InR1b the lowest. Expression patterns for all three genes are tissue-specific, the most pronounced differences are observed for InR1b, which show a downregulation in the digestive tube. Some tissues also show a significant effect of sex on the InR expression.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

P. apterus InR1b (KX087104) dsRNA P. apterus InR1a (KX087103) dsRNA P. apterus InR2 (KX087105) dsRNA untranslated region of mRNA A open reading frame 500 bp

InR2 InR1a InR1b dsRNA InR2 100% 50.6% 49.4% dsRNA InR1a 50.9% 100% 76.0% B dsRNA InR1b 44.9% 75.4% 100%

InR1a (KX087103) InR1b (KX087104) 1 1 ion(log)

ss * re

p 0 0 x e

e *** v i t rela -1 -1 dsRNA: egfp InR1a InR1b dsRNA: egfp InR1a InR1b C Supplementary Figure 14. Pyrrhocoris apterus InR transcripts, design of dsRNA and RNAi efficiencies. A. P. apterus InR transcripts with highlighted open reading frames and positions, for which gene-specific dsRNAs were designed. B. Sequence similarity between dsRNA and the corresponding regions in paralogous transcripts agrees with the close relationship between InR1a and InR1b. C. Expression levels (mean±SD) of InRs1a (left) and InR1b (right) indicate gene-specific targeting in heads of the fourth instar larvae after injection of egfp (control), InR1a or InR1b dsRNA. 1-3 asterisks denote significant differences at p<0.05, p<0.01, and p<0.001, respectively, in expression levels resulting from one-way ANOVA followed with Dunnett posthoc test (egfp set as control) on log-transformed data.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

. Pilp1 MN200106 dsRNA (Pilp1)

Pilp2 MN200107 dsRNA (Pilp2/3) Pilp3 100 bp MN200108 dsRNA (Pilp2/3) untranslated region of mRNA A open reading frame

Pilp1 Pilp2 Pilp3 dsRNA Pilp1 100% 41.5% 43.4% B dsRNA Pilp2/3 38.1% 100% 88.9%

Pilp1 (MN200106) Pilp2/3 (MN200107/MN200108) 1 1 ion(log)

ss 0 re

p 0 ** x

e ***

e -1 v i t rela -1 -2 dsRNA: egfp Pilp1 Pilp2/3 dsRNA: egfp Pilp1 Pilp2/3

C Supplementary Figure 15. Pyrrhocoris apterus insulin-like peptide (Pilp) genes. A. Pilp transcripts with highlighted open reading frames and positions, for which dsRNAs were designed. B. Sequence similarity between dsRNA and the corresponding region in paralogous transcripts agrees with the close relationship between Pilp2 and Pilp3. C. Expression levels of Pilp1 (left graph) and Pilp2+3 (right graph) in heads of the fourth instar larvae after injection of egfp (control), Pilp1 or Pilp2+3 dsRNA. 1-3 asterisks denote significant differences at p<0.05, p<0.01, and p<0.001, respectively, in expression levels resulting from one-way ANOVA followed with Dunnett posthoc test (egfp set as control) on log-transformed data.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Ae. aegypti FAA01101.1

D. melanogaster exons (in scale) DR2 NP_724157.1 D. plexippus introns (not in scale) EHJ77075.1 B. mori XP_004925605.1 T. castaneum transmembrane domain EFA01771.1 InR T. castaneum protein tyrosine kinase Cluster II EFA02828.1 A. mellifera 200 bp A XP_394771.5

Ae. aegypti FAA01101.1 D. melanogaster NP_724157.1 D. plexippus EHJ77075.1 B. mori XP_004925605.1 T. castaneum EFA01771.1 T. castaneum EFA02828.1 A. mellifera XP_394771.5

B Supplementary Figure 16. Gene structures of two Tribolium castaneum InR paralogs identified in the Cluster II compared to representative DR2 genes and Cluster II InR of Apis mellifera. A. Schematic depiction of exon (boxes) and intron (dotted lines) structure and homologous intron-exon boundaries (gray vertical lines). White, dark grey and blue color in exons correspond to exon coding in panel B. Regions coding for protein tyrosine kinase (dark orange) and transmembrane domain (light orange) are highlighted. B. Detail of amino acid sequence alignment with exons indicated as color coded boxes under each sequence.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Supplementary Materials and Methods

Expression of D. melanogaster InR, DR2 and SDR White eye (w1118) D. melanogaster strain flies were grown on standard corn meal diet at 25 °C. Five days after adult eclosion male and female flies were CO2-anesthetized and heads, digestive tubes, and gonads were dissected. RNA isolation, reverse transcription and qRT PCR were performed as in P. apterus experiments, with Drosophila-specific primers (Supplementary table 3, Supplementary Material online). The analysis was performed with three biological replicates, each consisting of pooled tissues from 25 individuals. The quantified transcripts were normalized to the level of the reference gene rp49 (Bazalova and Dolezel 2017), the results log-transformed to reduce heteroscedasticity and analyzed using two-way ANOVA (tissue and sex as predictors) in GraphPad 5.00.

Expression of InRs in the termite P. simplex and its caste and tissue specificity The three InR genes identified in Prorhinotermes simplex (Rhinotermitidae) were investigated with respect to mRNA levels and eventual caste and tissue-specific expression. For this purpose, we compared their expression in workers (pseudergates), ten-day-old neotenic males and females. The neotenics were obtained from orphaned groups of 100 workers, kept together with 15 soldiers in 9 cm Petri dishes on moistened sand and offered with blocks of spruce wood (permanent darkness, 26°C). In such groups, the workers start to differentiate into neotenics within 10 days. Groups were controlled every 12h, freshly molted neotenics removed and held for ten days in new groups of 50 workers. Four biological replicates were prepared for each caste and tissue, each of them from pooled tissues of four individuals. Total RNA was isolated using TRI Reagent® (Sigma Aldrich) following the manufacturer's protocol. RNA isolates were treated with RQ1 RNase-Free DNase (Promega) to eliminate contaminant DNA. cDNA template was generated from 0.7 μg of the respective total RNA using the SuperScript III First-Strand Synthesis System (Invitrogen by Life Technologies) and random hexamers. The sequences of specific primers used for amplification are given in supplementary table 3 (Supplementary Material online). qRT-PCR was performed as published earlier (Jirošová et al. 2017). The resulting data was log-transformed to reduce heteroscedasticity and analyzed using two-way ANOVA (tissue and caste/sex as predictors) in GraphPad 5.00.

Expression of P. apterus InRs and its sex and tissue specificity Adults of Pyrrhocoris apterus strain Oldrichovec (Pivarciova et al. 2016) were kept in 0.5 liter glass jars on linden seeds and water ad libitum in long photoperiod (18 hrs light: 6 hrs dark) at 25 °C. Brain, fat body, digestive tube and gonads were dissected in RNAse-free Ringer's solution from males and females 10 days after adult eclosion, anesthetized by CO2. Four biological replicates for each tissue and organ were prepared, each from pooled tissues of five individuals. Total RNA was isolated with the Trizol reagent (Invitrogen). After Turbo DNAse (Ambion/ThermoFisher) treatment, 1 µg of total RNA was used for cDNA synthesis using the SuperScript III reverse transcriptase (Invitrogen). Relative transcript levels were measured by quantitative PCR using the qPCR 2x SYBR Master Mix (Top Bio) and the C1000 Thermal Cycler (Bio-Rad). Primers sequences are listed below in supplementary table 3. All measured transcripts were normalized to the level of the reference gene rp49 (Dolezel et al. 2007). The data was analyzed using two-way ANOVA (tissue and sex as predictors) in GraphPad 5.00.

Identification of P. apterus insulin-like peptide (Pilp) transcripts Insect insulin-like peptides (ILPs) from Drosophila melanogaster (Dilp1-8), Bombyx mori (bombyxin A1-10, B1-12, C1-2, E1, F1, G1) and Nilaparvata lugens (NlILP1-4) were used as a query in BLAST searches in our in-house P. apterus transcriptomic databases. Candidate hits were validated by reciprocal BLAST searches in NCBI database, protein alignments with insect ILPs, and by position of characteristic Cysteine residues in the preprohormone. The mRNA sequences of three identified P. apterus insulin-like peptide (Pilp) transcripts were confirmed by PCR and Sanger sequencing.

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

RNAi-mediated silencing of InRs and Pilps in P. apterus For each InR, gene-specific fragment was designed within the open reading frame in regions where stretches of identity between P. apterus paralogs where the shortest. In case of the closely related paralogs InR1a and InR1b, specificity of silencing was confirmed by qRT PCR from whole head extracts of 4th instar larvae three days after RNAi. The protocol was identical to tissue-specific quantification, with the exception that RNA was isolated from individual heads and processed separately for RNAi efficiency assessments. Because Pilp2 and Pilp3 only differ by several SNPs, both genes were targeted by one common dsRNA. By contrast, Pilp1 is clearly distinct from Pilp2+3. Therefore, one Pilp1-targeting and one Pilp2+3-targeting fragment were designed within the open reading frame and 5´ untranslated region. The resulting primers are given in supplementary table 4 (Supplementary Material online).

Specific fragments were PCR amplified from head total cDNA by PPP Master Mix (Top Bio, Czech Republic), PCR products were purified by QIAquick PCR Purification Kit (Qiagen), ligated into the pGEM-T Easy vector (Promega) and verified by Sanger sequencing. Templates for dsRNA in-vitro synthesis were prepared from pGEM-T Easy clones by PCR using M13 forward and pGEM-RNAi reverse 5’- TAATACGACTCACTATAGGGGACACTATAGAATACT-3’ primer replacing SP6 to T7 promoter. Double-stranded RNA was synthesized using MEGAscript T7 Transcription Kit (Ambion/ThermoFisher) following the manufacturer’s protocol. dsRNA was then precipitated by adding 0.1 volume of sodium acetate (pH = 5) and 2.5 volume of 100 % ethanol and after spinning and washing it was dissolved in Ringer’s solution. As a negative control, 720bp long egfp ORF in pEGFP-N1 (Clontech) was digested with SalI and NotI restriction enzymes and subcloned to pBlueScript KS (-) plasmid. T3 promoter in pBlueScript plasmid was replaced by T7 promoter in in vitro dsRNA transcription template by using M13F 5’- GTAAAACGACGGCCAGT - 3’ and Blue-RNAi-R 5’- AATACGACTCACTATAGGGAACAAAAG - 3’ primers.

th One-day-old 4 -instar P. apterus larvae of both strains were CO2-anesthetized, attached using a double-sided tape to a small tray and injected ventrolateraly into the abdomen under the stereomicroscope using a micromanipulator (Narishige, Japan) equipped with a borosilicate glass capillary needle. 1 µl of 3-4 µg/µl dsRNA dissolved in Ringer’s solution was administered to each larva, which was then transferred to a glass jar supplemented with linden seeds, water, and a folded filter paper. Adult animals were CO2-anesthetized and scored for wing length. The obtained proportions of long-winged vs. short-winged adult phenotypes were compared with the control treatment using an equivalent of Dunnett test adjusted for proportion data (Zar 1999).

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Supplementary Table 1. Insect taxa studied in phylogenetic analyses of InRs and decoy of InRs higher unit order species acc. number note Ametabola Zygentoma Lepisma saccharina KX087106 Thermobia domestica GASN02067420 GASN02067910 Palaeoptera Ephemeroptera Ecdyonurus insignis GCCL01041136 GCCL01030520 Ephemera danica GAUK01018742 AYNC02004105, whole genome shotgun GAUK01018485 AYNC02013259, whole genome shotgun Eurylophella sp. GAZG01015571 Palaeoptera Odonata Cordulegaster boltonii GAYO02000575 Epiophlebia superstes GAVW01013590 Megaloprepus caerulatus GEXY01362158 Polyneoptera Plecoptera Leuctra sp. GAUF01084507 GAUF01012297 Perla marginata GATV02011223 Polyneoptera Zoraptera Zorotypus caudelli GAYA02038706 GAYA02044618 Polyneoptera Orthoptera Ceuthophilus sp. GAUX02040867 used only in detailed analysis (Figures S6, S7) GAUX02032114 used only in detailed analysis (Figures S6, S7) Gryllus bimaculatus GFMG01298068 used only in detailed analysis (Figures S6, S7) Laupala cerasina GGFB01005618 used only in detailed analysis (Figures S6, S7) Tetrix subulata GASQ02008536 GASQ02006861 GASQ01015035 Xya variegata GCPJ01033443 used only in detailed analysis (Figures S6, S7) GCPJ01052609 used only in detailed analysis (Figures S6, S7) Polyneoptera Mantophasmatodea Tanzaniophasma sp. GAXB01155547 GAXB02030434 Polyneoptera Phasmatodea Aretaon asperrimus GAWC01055274 GAWC01082819 GAZQ02010804_GAWC01050212 Extatosoma tiaratum GAWG01064894 GAWG01048820 GAWG01064895 Medauroidea extradentata GAWD01037141 used only in detailed analysis (Figure S5) GAWD01045541 used only in detailed analysis (Figure S5) GAWD01065534 used only in detailed analysis (Figure S5) Peruphasma schultei GAWJ02030221 used only in detailed analysis (Figure S5) GAWJ02044630 used only in detailed analysis (Figure S5) GAWJ02032289 used only in detailed analysis (Figure S5) Timema genevievae GFPR01028898 GFPR01021056 GFPR01012227 Timema cristinae PGFK01000003, PGTA01000614, whole genome shotgun Polyneoptera Blattodea Blattella germanica HG518668 KN196784_1 KN196784_2 Cryptocercus wrighti GAZN02045874 used only in detailed analysis (Figure S5) GAZN02040031 used only in detailed analysis (Figure S5) GAZN02048104 used only in detailed analysis (Figure S5) Cryptotermes secundus XP_023702537 XP_023702527 PNF35478 Embiratermes neotenicus MN200103 used only in detailed analysis (Figure S5) MN200104 used only in detailed analysis (Figure S5) MN200105 used only in detailed analysis (Figure S5) Lamproblatta albipalpus GCPS01044670 used only in detailed analysis (Figure S5) GCPS01051046 used only in detailed analysis (Figure S5) GCPS01050204 used only in detailed analysis (Figure S5) Panchlora nivea GGLV01034977 used only in detailed analysis (Figure S5) GGLV01045863 used only in detailed analysis (Figure S5) GGLV01061540 used only in detailed analysis (Figure S5) Prorhinotermes simplex MH560589 InR2 in this study MH560588 InR3 in this study MH560587 InR1 in this study Zootermopsis nevadensis KDR13786 KDR21367 KDR21366 Paraneoptera Thysanoptera Frankliniella occidentalis XP_026277828 Phlaeothripidae gen. sp. GCYQ01040907 Paraneoptera Sternorrhyncha Acyrthosiphon pisum XP_001942660 XP_008185917 Adelges tsugae GBJX01018946 GBJX01005109 Aphis citricidus ARD07922 ARD07921 Bemisia tabaci XP_018897134 GEZK01059603 Daktulosphaira vitifoliae GDEB01025952 GDEB01020876 Diaphorina citri XP_008479213 GACJ01002847 Diuraphis noxia XP_015363980 XP_015375915 19

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Supplementary Table 1, continued higher unit order species acc. number note Paraneoptera Sternorrhyncha Myzus persicae XP_022180848 XP_022180095 Pachypsylla venusta GAOP01019620 GAOP01060619+21 Phenacoccus solenopsis GGIT01015335 GGIT01003183 Paraneoptera Auchenorrhyncha Campylenchia latipes GCWI01051784 Clastoptera arizonana GEDC01010167 GEDC01006489 Cuerna arida GECZ01003109 Diceroprocta seminicta GGPH01050080 GGPH01129260 Euscelidius variegatus GFTU01002760 GFTU01002463 GFTU01007873 GFTU01003387 GFTU01001093 Graminella nigrifrons GAQX01001711 GAQX01006206 GAQX01002061 Graphocephala atropunctata GEBQ01020846_01005496 GEBQ01031456 Homalodisca liturata GECU01004804 GECU01010637 Homalodisca vitripennis HVIT002229_PA HVIT005314_PA HVIT005312_PA HVIT016189_PA Mapuchea sp. GCXN01044447_1045662 GCXN01060330 Neotibicen dorsatus GCYV01053567 GCYV01046097 Nilaparvata lugens AIY24639 AIY24638 Paraneoptera Heteroptera Alydus pilosus GCVZ01036674 Anasa tristis GCWG01047286 Aquarius paludum INR2 sequences available in Armisén et al. (2018) INR1 sequences available in Armisén et al. (2018) INR1-like sequences available in Armisén et al. (2018) Cimex lectularius XP_014256336 XP_014242611 Gerris buenoi INR2 JHBY02017739; JHBY02040390 whole genome shotgun INR1 JHBY02000552; JHBY02000555; JHBY02000556 whole genome shotgun INR1-like JHBY02104847, whole genome shotgun Halyomorpha halys XP_024217440 XP_014273515 Hebrus sp. INR2 sequences available in Armisén et al. (2018) INR1 sequences available in Armisén et al. (2018) INR1-like sequences available in Armisén et al. (2018) Hydrometra cumata INR2 sequences available in Armisén et al. (2018) INR1 sequences available in Armisén et al. (2018) INR1-like sequences available in Armisén et al. (2018) Jadera haematoloma AVT56265 AVT56264 Largus californicus GCXR01064717 GCXX01059075 Limnoporus dissortis INR2 sequences available in Armisén et al. (2018) INR1 sequences available in Armisén et al. (2018) INR1-like sequences available in Armisén et al. (2018) Lygus hesperus JAG02168 JAG20929 Mesovelia furcata INR2 sequences available in Armisén et al. (2018) INR1 sequences available in Armisén et al. (2018) INR1-like sequences available in Armisén et al. (2018) Microvelia longipes INR2 sequences available in Armisén et al. (2018) INR1 sequences available in Armisén et al. (2018) INR1-like sequences available in Armisén et al. (2018) Oncopeltus fasciatus AVT56270 Pagasa sp. GCXU01030579 GCXU01024823 Podisus maculiventris GFUB01178628 GFUB01166485 Pyrrhocoris apterus KX087104 InR1b in this study KX087103 InR1a in this study KX087105 InR2 in this study Rhagovelia antilleana INR2 sequences available in Armisén et al. (2018) INR1 sequences available in Armisén et al. (2018) INR1-like sequences available in Armisén et al. (2018) Rhodnius prolixus GECK01011918 GECK01019799

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Supplementary Table 1, continued higher unit order species acc. number note Paraneoptera Psocodea Badonnelia titei GDFG01033096 Geomydoecus ewingi GCXD01012496 Lachesilla contraforcepeta GCWJ01026792 Liposcelis bostrychophila GAYV01001422 Pediculus humanus corporis XM_002430916 Holometabola Hymenoptera Acromyrmex echinatior XP_011062671 used only in detailed analysis (Figure S8) XP_011051137 used only in detailed analysis (Figure S8) Apis mellifera NP_001233596 XP_394771 Athalia rosae LOC105688867 XP_012259845 Bombus terrestris XP_003393794 used only in detailed analysis (Figure S8) XP_003397946 used only in detailed analysis (Figure S8) Cephus cinctus XP_024940155 XP_015603667 Ceratosolen solmsi marchali XP_011494410 used only in detailed analysis (Figure S8) Copidosoma floridanum XP_014208001 used only in detailed analysis (Figure S8) Fopius arisanus XP_011300657 XP_011310956 Nasonia vitripennis XP_008203941 Neodiprion lecontei XP_015518357 used only in detailed analysis (Figure S8) XP_015510416 used only in detailed analysis (Figure S8) Solenopsis invicta JF304723 JF304722 Trachymyrmex zeteki XP_018305319 used only in detailed analysis (Figure S8) XP_018304053 used only in detailed analysis (Figure S8) Trichogramma pretiosum XP_014228758 used only in detailed analysis (Figure S8) Trichomalopsis sarcophagae OXU24559 used only in detailed analysis (Figure S8) Vollenhovia emeryi XP_011882700 used only in detailed analysis (Figure S8) XP_011864732 used only in detailed analysis (Figure S8) Wasmannia auropunctata XP_011696536 used only in detailed analysis (Figure S8) XP_011690939 used only in detailed analysis (Figure S8) Holometabola Coleoptera Dendroctonus ponderosae XP_019755840 XP_019765260 Leptinotarsa decemlineata XP_023030119 XP_023021383 Pogonus chalceus JU427775 JU418048 Tribolium castaneum EFA02828 XP_008199415 EFA01771 Holometabola Raphidioptera Xanthostigma xanthostigma GAUI02048109 GAUI02044701 Holometabola Neuroptera Chrysopa pallens AVK43098 AVK43099 Holometabola Lepidoptera Bombyx mori NP_001037011 XP_004925605 DR2 Danaus plexippus EHJ65074 EHJ77075 DR2 Plutella xylostella XP_011567916 XP_011567028 DR2 Holometabola Trichoptera Annulipalpia sp. GATX01009258_01085969 GATX01005845 DR2 GATX01012065 DR2 Platycentropus radiatus GASS02029169 GASS02028789 DR2 Holometabola Siphonaptera Ceratophyllus gallinae GAWK02019316 Ctenocephalides felis XP_026475386 Holometabola Mecoptera Boreus hyemalis GAYK01004971 GAYK01108088 DR2 Holometabola Diptera Aedes aegypti Q93105 FAA01101 DR2 Anopheles sinensis KFB49958 KFB49143 DR2 Ceratitis capitata XP_004518075 XP_004519681 SDR XP_004527212 DR2 Clunio marinus CRL08130 CRL06839 DR2 Drosophila melanogaster AAF55903 NP_650408 SDR NP_724157 DR2 Liogma simplicicornis GEMK01036784 GEMK01029352 DR2 Musca domestica XP_005178583 XP_011290405 SDR XP_011291787 DR2 Nyssomyia neivai JAV06640 Sarcophaga peregrina GGEP01027089 GGEP01012125 SDR GGEP01039589 DR2

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Supplementary Table 2. Accession numbers of genomic sequences used for gene structure analysis

higher unit order species acc. number note Crustacea Cladocera Daphnia pulex FLTH02000001.1 Cluster I Palaeoptera Ephemeroptera Ephemera danica AYNC02013259.1 Cluster I KZ497776.1 Cluster II Polyneoptera Phasmatodea Timema cristinae CM009478.1 Cluster I PGTA01000614 Cluster II Polyneoptera Blattodea Prorhinotermes simplex MH560587 Cluster I (InR1 in this study) MH560588 Cluster II (InR2 + InR3 in this study) Paraneoptera Heteroptera Gerris buenoi KZ651042.1 Cluster I (InR1) JHBY02104847.1 Cluster I (InR1-like) KZ651484.1 + KZ651190.1 Cluster II Pyrrhocoris apterus MN987938 Cluster I (InR1a in this study) MN987939 Cluster I (InR1b in this study) MN987940 Cluster II (InR2 in this study) Paraneoptera Psocodea Pediculus humanus corporis DS235841.1 Cluster I Holometabola Hymenoptera Apis mellifera NC_037639.1 Cluster I NC_037646.1 Cluster II Holometabola Lepidoptera Bombyx mori NW_004582016.1 Cluster I NW_004581734.1 Cluster II (DR2) Holometabola Diptera Aedes aegypti NC_035108.1 Cluster II (DR2) Drosophila melanogaster NT_033777.3 Cluster I (InR, c. map: 93E4-93E9, CG18402) NT_033777.3 Cluster I (SDR, c. map: 88D7, CG3837) NT_033779.5 Cluster II (DR2)

Supplementary Table 3. Primers used for qRT PCR analyses of InRs and decoy of InR

species gene accession number forward primer (5´-3´) reverse primers (5´-3´)

Prorhinotermes simplex InR1 MH560587 CTGCCAGGCTTCACAGACCT ATGCGTCCCGTCCATCATAC InR2 MH560589 CCCGCCATGCTGAGATTTTTG AGCCAGACTCACATATTCAGGATT InR3 MH560588 TTCGCCGTATGTTGCTGATG TCTCAGGAGCCATCCATCGT rp49 GASE02006626 CTGGTGCATAACGTGAAGGAACT CAGGCGAGCATTAGCATTTGTA Pyrrhocoris apterus InR1a KX087103 TGTCAATGTACAGGCAGCAGAT GCTGACCTTGAGAAACAACACC InR1b KX087104 TCCTGATGAGTGGGAAGTAC CTGCACAGGGTTTCACTAAAGAG InR2 KX087105 GCCGAGTCCGAACCTGATGG CTGCCCGAGTTCTAGACCCTGTAT rp49 GDFI01014277 CCGATATGTAAAACTGAGGAGAAAC GGAGCATGTGCCTGGTCTTTT Drosophila melanogaster InR CG18402; AAF55903 AAGTCCTGCGTTACGTCATC TCTCGCCGAAGACCTATGAT SDR CG3837; NP_650408 CATGACAACTGGCTGATGG CGTCTGGAAGTAGCCGATTT DR2 CG10702; NP_724157 GATGTGATGACGCCCTACAT CACCCAAACAGGAAGCAGAT rp49 NM_170460 GATATGCTAAGCTGTCGCACA CACCAGGAACTTCTTGAATCC

Supplementary Table 4. Primers used for dsRNA templates in P. apterus

gene accession number forward primer (5´-3´) reverse primers (5´-3´)

InR1a KX087103 CTGCTAGAATGCCCTACCAA GCATGCAACTTTGTCTCCAT InR1b KX087104 GGTAGAATTGTGGGATTGGA AGCCCCACTTTGTTCAGTAG InR2 KX087105 TTCAGCCTACTACCACAAGAC GTTAGACGACGGACAGTTACA Pilp1 MN200106 ACTTGTTTCAAGGGATCTCCGT ACCTGTTGTAACTTTCAGTTTCAAGT Pilp2/3 MN200107/MN200108 AGAAGGACTCATTTGAGCAGCA CCTGTACTCGAGGATTGACAGG

Smýkal et al. Complex evolution of insect insulin receptors and two homologous decoy receptors SUPPLEMENTARY MATERIAL ONLINE

Supplementary references Bazalova O, Dolezel D. 2017. Daily activity of the housefly, Musca domestica, is influenced by temperature independent of 3' UTR period gene splicing. G3 7:2637‒2649. Dolezel D, Sauman I, Kostal V, Hodkova M. 2007. Photoperiodic and food signals control expression pattern of the clock gene, period, in the linden bug, Pyrrhocoris apterus. J Biol Rhythms 22:335-342. Jirošová A, Jančařík A, Menezes RC, Bazalová O, Dolejšová K, Vogel H, Jedlička P, Buček A, Brabcová J, Majer P, Hanus R, Svatoš A. 2017. Co-option of the sphingolipid metabolism for the production of nitroalkene defensive chemicals in termite soldiers. Insect Biochem Mol Biol 82:52‒61. Pivarciova L, Vaneckova H, Provaznik J, Wu BC, Pivarci M, Peckova O, Bazalova O, Cada S, Kment P, Kotwica- Rolinska J, Dolezel D. 2016. Unexpected geographic variability of the free running period in the linden bug Pyrrhocoris apterus. J Biol Rhythms 31:568‒576. Zar JH. 1999. Biostatistical analysis. New Jersey: Prentice Hall, Inc.