Supplementary File 2B Revised
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
ATF4 Promotes Angiogenesis and Neuronal Cell Death and Confers Ferroptosis in a Xct-Dependent Manner
OPEN Oncogene (2017) 36, 5593–5608 www.nature.com/onc ORIGINAL ARTICLE ATF4 promotes angiogenesis and neuronal cell death and confers ferroptosis in a xCT-dependent manner D Chen1,2,ZFan1,3, M Rauh4, M Buchfelder5, IY Eyupoglu1,5 and N Savaskan1,5,6 Activating transcription factor 4 (ATF4) is a critical mediator of metabolic and oxidative homeostasis and cell survival. ATF4 is elevated in response to diverse microenvironmental stresses, including starvation, ER stress damages and exposure to toxic factors. Here we show that ATF4 expression fosters the malignancy of primary brain tumors (WHO grade III and IV gliomas) and increases proliferation and tumor angiogenesis. Hence, ATF4 expression promotes cell migration and anchorage-independent cell growth, whereas siRNA-mediated knockdown of ATF4 attenuates these features of malignancy in human gliomas. Further experiments revealed that ATF4-dependent tumor promoting effects are mediated by transcriptional targeting the glutamate antiporter xCT/SCL7A11 (also known as system Xc-). Thus, xCT is elevated as a consequence of ATF4 activation. We further found evidence that ATF4-induced proliferation can be attenuated by pharmacological or genetic xCT inhibition and ferroptosis inducers such as sorafenib, erastin and GPx4 inhibitor RSL3. Further, fostered xCT expression promotes cell survival and growth in ATF4 knockdown cells. Moreover, increased xCT levels ameliorate sorafenib and erastin-induced ferroptosis. Conversely, ATF4 knockdown renders cells susceptible for erastin, sorafenib and RSL3-induced ferroptosis. We further identified that ATF4 promotes tumor-mediated neuronal cell death which can be alleviated by xCT inhibition. Moreover, elevated ATF4 expression in gliomas promotes tumor angiogenesis. Noteworthy, ATF4-induced angiogenesis could be diminished by ferroptosis inducers erastin and by GPx4 inhibitor RSL3. -
Cytoplasmic Activation-Induced Cytidine Deaminase (AID) Exists in Stoichiometric Complex with Translation Elongation Factor 1Α (Eef1a)
Cytoplasmic activation-induced cytidine deaminase (AID) exists in stoichiometric complex with translation elongation factor 1α (eEF1A) Julien Häsler, Cristina Rada, and Michael S. Neuberger1 Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 0QH, United Kingdom Edited by Frederick W. Alt, Howard Hughes Medical Institute, Harvard Medical School, Children’s Hospital Immune Disease Institute, Boston, MA, and approved October 12, 2011 (received for review April 27, 2011) Activation-induced cytidine deaminase (AID) is a B lymphocyte- results reveal that endogenous cytoplasmic AID partakes in a specific DNA deaminase that acts on the Ig loci to trigger antibody complex containing stoichiometric quantities of translation elon- gene diversification. Most AID, however, is retained in the cyto- gation factor 1α (eEF1A), with this association likely implicated in plasm and its nuclear abundance is carefully regulated because the regulation of AID’s intracellular trafficking. off-target action of AID leads to cancer. The nature of the cytosolic AID complex and the mechanisms regulating its release from the Results cytoplasm and import into the nucleus remain unknown. Here, we Flag-Tagging the Endogenous AID Locus in DT40 Cells. We generated show that cytosolic AID in DT40 B cells is part of an 11S complex derivatives of the DT40 B-cell line in which the endogenous AID and, using an endogenously tagged AID protein to avoid overex- locus was modified so as to incorporate a single Flag tag at the pression artifacts, that it is bound in good stoichiometry to the AID N terminus. To allow targeting of both alleles, one targeting translation elongation factor 1 alpha (eEF1A). -
Enzymatic Encoding Methods for Efficient Synthesis Of
(19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN, -
Nucleotide Sequence and Analysis of the 58.3 to 65.5-Kb Early Region of Bacteriophage T4
Volume 14 Number 21 1986 Nucleic Acids Research Nucleotide sequence and analysis of the 58.3 to 65.5-kb early region of bacteriophage T4 Kristoffer Valerie 13.4, John Stevens', Mark Lynch'5, Earl E.Henderson12 and Jon K.de Riel1 'Fels Research Institute, and 2Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140, USA and 3Department of Biochemistry and Biotechnology, Royal Institute of Technology, S-100 44 Stockholm, Sweden Received 21 July 1986; Revised and Accepted 30 September 1986 ABSTRACT The complete 7.2-kb nucleotide sequence from the 58.3 to 65.5-kb early region of bacteriophage T4 has been determined by Maxam and Gilbert sequencing. Computer analysis revealed at least 20 open reading frames (ORFs) within this sequence. All major ORFs are transcribed from the left strand, suggesting that they are expressed early during infection. Among the ORFs, we have identified the pIIII, II, denV and tk genes. The ORFs are very tightly spaced, even over Lapping in some instances, and when ORF interspacing occurs, promoter-like sequences can be implicated. Several of the sequences preceding the ORFs, in particular those at ipIII, ipII, denV, and orf6l.9, can potentially form stable stem-loop structures. INTRODUCTION Recently, considerable progress has been made studying the bacteriophage T4 genome at the molecular level due to the development of T4 strains with unmod- ified DNA suitable for digestion with restriction endonucleases (1). Many T4 genes have since been cloned, sequenced, and their gene products overproduced in Escherichia coli (for review see ref. 2). A majority of the T4 genes studied so far have been essential and non-essential genes with well-characterized pheno- types. -
Genetic Basis of Simple and Complex Traits with Relevance to Avian Evolution
Genetic basis of simple and complex traits with relevance to avian evolution Małgorzata Anna Gazda Doctoral Program in Biodiversity, Genetics and Evolution D Faculdade de Ciências da Universidade do Porto 2019 Supervisor Miguel Jorge Pinto Carneiro, Auxiliary Researcher, CIBIO/InBIO, Laboratório Associado, Universidade do Porto Co-supervisor Ricardo Lopes, CIBIO/InBIO Leif Andersson, Uppsala University FCUP Genetic basis of avian traits Nota Previa Na elaboração desta tese, e nos termos do número 2 do Artigo 4º do Regulamento Geral dos Terceiros Ciclos de Estudos da Universidade do Porto e do Artigo 31º do D.L.74/2006, de 24 de Março, com a nova redação introduzida pelo D.L. 230/2009, de 14 de Setembro, foi efetuado o aproveitamento total de um conjunto coerente de trabalhos de investigação já publicados ou submetidos para publicação em revistas internacionais indexadas e com arbitragem científica, os quais integram alguns dos capítulos da presente tese. Tendo em conta que os referidos trabalhos foram realizados com a colaboração de outros autores, o candidato esclarece que, em todos eles, participou ativamente na sua conceção, na obtenção, análise e discussão de resultados, bem como na elaboração da sua forma publicada. Este trabalho foi apoiado pela Fundação para a Ciência e Tecnologia (FCT) através da atribuição de uma bolsa de doutoramento (PD/BD/114042/2015) no âmbito do programa doutoral em Biodiversidade, Genética e Evolução (BIODIV). 2 FCUP Genetic basis of avian traits Acknowledgements Firstly, I would like to thank to my all supervisors Miguel Carneiro, Ricardo Lopes and Leif Andersson, for the demanding task of supervising myself last four years. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human. -
(LRV1) Pathogenicity Factor
Antiviral screening identifies adenosine analogs PNAS PLUS targeting the endogenous dsRNA Leishmania RNA virus 1 (LRV1) pathogenicity factor F. Matthew Kuhlmanna,b, John I. Robinsona, Gregory R. Bluemlingc, Catherine Ronetd, Nicolas Faseld, and Stephen M. Beverleya,1 aDepartment of Molecular Microbiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bDepartment of Medicine, Division of Infectious Diseases, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; cEmory Institute for Drug Development, Emory University, Atlanta, GA 30329; and dDepartment of Biochemistry, University of Lausanne, 1066 Lausanne, Switzerland Contributed by Stephen M. Beverley, December 19, 2016 (sent for review November 21, 2016; reviewed by Buddy Ullman and C. C. Wang) + + The endogenous double-stranded RNA (dsRNA) virus Leishmaniavirus macrophages infected in vitro with LRV1 L. guyanensis or LRV2 (LRV1) has been implicated as a pathogenicity factor for leishmaniasis Leishmania aethiopica release higher levels of cytokines, which are in rodent models and human disease, and associated with drug-treat- dependent on Toll-like receptor 3 (7, 10). Recently, methods for ment failures in Leishmania braziliensis and Leishmania guyanensis systematically eliminating LRV1 by RNA interference have been − infections. Thus, methods targeting LRV1 could have therapeutic ben- developed, enabling the generation of isogenic LRV1 lines and efit. Here we screened a panel of antivirals for parasite and LRV1 allowing the extension of the LRV1-dependent virulence paradigm inhibition, focusing on nucleoside analogs to capitalize on the highly to L. braziliensis (12). active salvage pathways of Leishmania, which are purine auxo- A key question is the relevancy of the studies carried out in trophs. -
A General Binding Mechanism for All Human Sulfatases by the Formylglycine-Generating Enzyme
A general binding mechanism for all human sulfatases by the formylglycine-generating enzyme Dirk Roeser*, Andrea Preusser-Kunze†, Bernhard Schmidt†, Kathrin Gasow*, Julia G. Wittmann*, Thomas Dierks‡, Kurt von Figura†, and Markus Georg Rudolph*§ *Department of Molecular Structural Biology, University of Go¨ttingen, Justus-von-Liebig-Weg 11, D-37077 Go¨ttingen, Germany; †Department of Biochemistry II, Heinrich-Du¨ker-Weg 12, University of Go¨ttingen, D-37073 Go¨ttingen, Germany; and ‡Department of Biochemistry I, Universita¨tsstrasse 25, University of Bielefeld, D-33615 Bielefeld, Germany Edited by Carolyn R. Bertozzi, University of California, Berkeley, CA, and approved November 8, 2005 (received for review September 1, 2005) The formylglycine (FGly)-generating enzyme (FGE) uses molecular tases, suggesting a general binding mechanism of substrate sulfa- oxygen to oxidize a conserved cysteine residue in all eukaryotic tases by FGE. sulfatases to the catalytically active FGly. Sulfatases degrade and The details of how O2-dependent cysteine oxidation is mediated remodel sulfate esters, and inactivity of FGE results in multiple by FGE are unknown. As a first step toward the elucidation of the sulfatase deficiency, a fatal disease. The previously determined FGE molecular mechanism of FGly formation, we have previously crystal structure revealed two crucial cysteine residues in the active determined crystal structures of FGE in various oxidation states site, one of which was thought to be implicated in substrate (8). FGE adopts a novel fold with surprisingly little regular sec- 2ϩ binding. The other cysteine residue partakes in a novel oxygenase ondary structure and contains two structural Ca ions and two mechanism that does not rely on any cofactors. -
CDC2 Mediates Progestin Initiated Endometrial Stromal Cell Proliferation: a PR Signaling to Gene Expression Independently of Its Binding to Chromatin
CDC2 Mediates Progestin Initiated Endometrial Stromal Cell Proliferation: A PR Signaling to Gene Expression Independently of Its Binding to Chromatin Griselda Vallejo1, Alejandro D. La Greca1., Inti C. Tarifa-Reischle1., Ana C. Mestre-Citrinovitz1, Cecilia Ballare´ 2, Miguel Beato2,3, Patricia Saragu¨ eta1* 1 Instituto de Biologı´a y Medicina Experimental, IByME-Conicet, Buenos Aires, Argentina, 2 Centre de Regulacio´ Geno`mica, (CRG), Barcelona, Spain, 3 University Pompeu Fabra (UPF), Barcelona, Spain Abstract Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the peri-implantation phase of pregnancy. We showed that picomolar concentration of progestin R5020 mimics this control in UIII endometrial stromal cells via ERK1-2 and AKT activation mediated by interaction of Progesterone Receptor (PR) with Estrogen Receptor beta (ERb) and without transcriptional activity of endogenous PR and ER. Here we identify early downstream targets of cytoplasmic PR signaling and their possible role in endometrial stromal cell proliferation. Microarray analysis of global gene expression changes in UIII cells treated for 45 min with progestin identified 97 up- and 341 down-regulated genes. The most over-represented molecular functions were transcription factors and regulatory factors associated with cell proliferation and cell cycle, a large fraction of which were repressors down-regulated by hormone. Further analysis verified that progestins regulate Ccnd1, JunD, Usf1, Gfi1, Cyr61, and Cdkn1b through PR- mediated activation of ligand-free ER, ERK1-2 or AKT, in the absence of genomic PR binding. -
Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG