DOCSLIB.ORG

Supplementary File 2B Revised

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary File 2B Revised Supplementary file 2B. Differentially expressed genes in aldosteronomas compared to incidentalomas, ranked according to statistical significance. Acc UGCluster Name Symbol log Fold P - Value Adj. P-Value B Change AI002403 Hs.70312 Cytochrome c oxidase subunit VIIa polypeptide 2 (liver) COX7A2 1,64 1,7E-08 8,1E-05 9,80 N93695 Hs.54609 Glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme GCAT 1,26 2,1E-08 8,1E-05 9,63 N23599 Hs.43396 Transcribed locus 1,92 3,0E-08 8,1E-05 9,28 AA699317 Hs.474949 Ring-box 1 RBX1 1,65 3,7E-08 8,1E-05 9,11 AA491249 Hs.356440 Coiled-coil domain containing 72 CCDC72 1,26 3,9E-08 8,1E-05 9,05 T95745 Data not found 2,54 5,6E-08 8,5E-05 8,71 AA428627 Hs.694739 Nuclear pore complex interacting protein NPIP -1,42 6,0E-08 8,5E-05 8,65 R67915 Hs.268742 Proteasome maturation protein POMP 1,13 6,6E-08 8,5E-05 8,56 T70353 Hs.655728 Aminocarboxymuconate semialdehyde decarboxylase ACMSD -1,63 9,6E-08 8,5E-05 8,21 N74161 Hs.29189 ATPase, class VI, type 11A ATP11A -2,25 1,1E-07 8,5E-05 8,04 AA449463 Hs.632865 KIAA0220-like protein LOC23117 -1,85 1,2E-07 8,5E-05 8,03 W32281 Hs.534453 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13 NDUFA13 1,49 1,3E-07 8,5E-05 7,93 AA485358 Hs.9234 Transmembrane protein 147 TMEM147 1,59 1,3E-07 8,5E-05 7,91 AA670434 Hs.567438 Brain protein I3 BRI3 1,04 1,3E-07 8,5E-05 7,90 N68467 Hs.502823 Peroxiredoxin 5 PRDX5 1,80 1,4E-07 8,5E-05 7,88 H94471 Hs.592605 Occludin OCLN -1,28 1,4E-07 8,5E-05 7,88 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH1 -1,29 1,4E-07 8,5E-05 7,87 R43449 Hs.106529 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assem NDUFAF1 1,44 1,7E-07 9,7E-05 7,68 AA159669 Hs.708260 Transcribed locus, strongly similar to NP_112200.2 transmembrane protein 4 -1,99 1,8E-07 9,8E-05 7,61 H52503 Hs.673820 Transcribed locus -2,45 2,0E-07 9,8E-05 7,53 AA425295 Hs.662502 Transcribed locus 1,74 2,0E-07 9,8E-05 7,52 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,83 2,1E-07 9,8E-05 7,48 AA670351 Hs.485262 Mitochondrial carrier homolog 1 (C. elegans) MTCH1 1,12 2,5E-07 1,1E-04 7,31 AA872057 Hs.714414 Transcribed locus 1,46 2,7E-07 1,2E-04 7,22 AA428058 Hs.532853 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kD NDUFB7 1,34 3,1E-07 1,3E-04 7,10 R06706 Data not found 1,74 3,3E-07 1,3E-04 7,04 AA610066 Hs.98428 Homeobox B6 HOXB6 1,16 3,4E-07 1,3E-04 7,01 AA454862 Hs.423968 Fission 1 (mitochondrial outer membrane) homolog (S. cerevisi FIS1 1,42 3,6E-07 1,3E-04 6,96 AI017101 Hs.558463 Spen homolog, transcriptional regulator (Drosophila) SPEN -0,96 4,0E-07 1,4E-04 6,86 AA676961 Hs.524078 Trafficking protein particle complex 4 TRAPPC4 1,35 4,8E-07 1,5E-04 6,68 AA485734 Hs.183800 Ran GTPase activating protein 1 RANGAP1 1,01 4,8E-07 1,5E-04 6,68 AA455108 Hs.461379 GABA(A) receptor-associated protein-like 2 GABARAPL2 1,52 4,8E-07 1,5E-04 6,67 AA457102 Hs.36959 Zinc finger, AN1-type domain 3 ZFAND3 0,99 4,8E-07 1,5E-04 6,67 T78625 Data not found -1,46 5,1E-07 1,6E-04 6,61 AI016688 Hs.472564 Chromosome 20 open reading frame 52 C20orf52 1,47 5,3E-07 1,6E-04 6,58 AA629712 Hs.502823 Peroxiredoxin 5 PRDX5 1,28 5,4E-07 1,6E-04 6,56 AA863204 Hs.22047 Hypothetical gene supported by BC035379; BC042129 LOC388588 -1,09 5,6E-07 1,6E-04 6,52 H52110 Hs.592142 Transcribed locus -0,99 6,4E-07 1,7E-04 6,40 R96914 Data not found 1,35 6,7E-07 1,7E-04 6,36 AA282134 Hs.79033 Glutaminyl-peptide cyclotransferase (glutaminyl cyclase) QPCT 2,14 6,9E-07 1,7E-04 6,33 AA461527 Hs.491912 COP9 constitutive photomorphogenic homolog subunit 5 (Arabid COPS5 1,08 6,9E-07 1,7E-04 6,33 R64346 Hs.29189 ATPase, class VI, type 11A ATP11A -1,98 7,0E-07 1,7E-04 6,32 AA521108 Hs.645309 Embigin homolog (mouse) EMB -2,02 7,7E-07 1,8E-04 6,22 W69995 Hs.176626 Hemogen HEMGN -1,80 7,8E-07 1,8E-04 6,21 AA490970 Hs.143766 Atrophin 1 ATN1 -1,38 8,0E-07 1,8E-04 6,19 W81098 Hs.21938 Oxysterol binding protein-like 9 OSBPL9 -1,20 8,2E-07 1,8E-04 6,16 AA461048 Hs.80691 Creatine kinase, mitochondrial 2 (sarcomeric) CKMT2 1,97 8,2E-07 1,8E-04 6,16 AA406546 Hs.532082 Interleukin 6 signal transducer (gp130, oncostatin M receptor) IL6ST -1,23 8,8E-07 1,9E-04 6,09 AA670436 Hs.54609 Glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme GCAT 1,11 9,1E-07 1,9E-04 6,06 N66158 Hs.351875 Cytochrome c oxidase subunit VIc COX6C 1,35 9,4E-07 2,0E-04 6,03 AA456931 Hs.351875 Cytochrome c oxidase subunit VIc COX6C 1,44 9,7E-07 2,0E-04 6,00 H10011 Data not found 1,29 1,0E-06 2,0E-04 5,97 AA011025 Hs.413416 Jumonji domain containing 1C JMJD1C -1,31 1,0E-06 2,0E-04 5,96 AA443638 Hs.349470 Synuclein, gamma (breast cancer-specific protein 1) SNCG 2,43 1,0E-06 2,0E-04 5,94 AA156793 Hs.697989 Nuclear receptor coactivator 3 NCOA3 -1,25 1,0E-06 2,0E-04 5,93 T90621 Hs.109052 Chromosome 14 open reading frame 2 C14orf2 1,31 1,1E-06 2,0E-04 5,86 AA180004 Hs.644646 Kinesin family member 5B KIF5B -0,88 1,6E-06 2,3E-04 5,53 N66003 Hs.159492 Spastic ataxia of Charlevoix-Saguenay (sacsin) SACS 1,39 1,6E-06 2,3E-04 5,49 AA457038 Hs.467662 Integrin beta 1 binding protein 1 ITGB1BP1 1,50 1,6E-06 2,3E-04 5,49 AA156781 Hs.561411 S6 H-8 mRNA expressed in chromosome 6-suppressed melanoma cells -1,76 1,7E-06 2,3E-04 5,47 H82435 Hs.647120 Myeloid/lymphoid or mixed-lineage leukemia 3 MLL3 -1,22 1,7E-06 2,3E-04 5,47 N62339 Hs.597147 Transcribed locus -2,05 1,7E-06 2,4E-04 5,44 AA682897 Hs.148178 RAP1 GTPase activating protein RAP1GAP -1,32 1,8E-06 2,5E-04 5,37 AA400471 Data not found 1,03 1,9E-06 2,6E-04 5,33 H80685 Hs.36053 Chromosome 5 open reading frame 13 C5orf13 -1,10 2,0E-06 2,6E-04 5,31 W42587 Hs.131431 Eukaryotic translation initiation factor 2-alpha kinase 2 EIF2AK2 -1,61 2,0E-06 2,6E-04 5,30 T96083 Hs.99528 RAB31, member RAS oncogene family RAB31 -1,40 2,0E-06 2,6E-04 5,28 AI015110 Hs.130960 Transcribed locus 1,28 2,0E-06 2,6E-04 5,27 AA872704 Hs.512676 Ribosomal protein S25 RPS25 1,51 2,1E-06 2,6E-04 5,26 AA416693 Hs.248267 Mercaptopyruvate sulfurtransferase MPST 1,47 2,1E-06 2,6E-04 5,24 N26671 Hs.471610 Armadillo repeat containing 9 ARMC9 1,34 2,1E-06 2,6E-04 5,23 AA453579 Hs.714429 Non-metastatic cells 5, protein expressed in (nucleoside-diphos NME5 1,25 2,2E-06 2,6E-04 5,22 AA505082 Hs.475812 STT3, subunit of the oligosaccharyltransferase complex, homolo STT3B 1,52 2,2E-06 2,7E-04 5,20 AA022561 Hs.676013 Transcribed locus -1,02 2,3E-06 2,7E-04 5,17 AA664180 Hs.386793 Glutathione peroxidase 3 (plasma) GPX3 1,27 2,3E-06 2,7E-04 5,16 AA128316 Hs.437779 Chromosome 11 open reading frame 10 C11orf10 1,27 2,3E-06 2,7E-04 5,14 T68758 Hs.352768 Proteasome (prosome, macropain) subunit, beta type, 1 PSMB1 1,22 2,4E-06 2,8E-04 5,11 AA451851 Hs.102735 Single-stranded DNA binding protein 2 SSBP2 -1,07 2,4E-06 2,8E-04 5,10 AA489012 Hs.444569 Transmembrane protein 49 TMEM49 -1,64 2,5E-06 2,8E-04 5,07 AA401883 Hs.520037 Sialidase 1 (lysosomal sialidase) NEU1 1,13 2,6E-06 2,8E-04 5,06 AA708905 Hs.590909 WAS protein family, member 2 WASF2 -1,04 2,6E-06 2,8E-04 5,04 R24201 Hs.533237 WD repeat domain 36 WDR36 -1,12 2,6E-06 2,8E-04 5,04 T67057 Hs.274539 3-hydroxybutyrate dehydrogenase, type 1 BDH1 1,13 2,6E-06 2,8E-04 5,04 AA398400 Hs.465929 Calponin 1, basic, smooth muscle CNN1 -2,20 2,6E-06 2,8E-04 5,02 T61866 Hs.712619 Importin 7 IPO7 -1,04 2,7E-06 2,8E-04 5,02 AI356451 Hs.652262 CD19 molecule CD19 -1,10 2,7E-06 2,8E-04 5,00 AA044299 Hs.654718 Pyrroline-5-carboxylate reductase family, member 2 PYCR2 1,25 2,8E-06 2,8E-04 4,97 AA973568 Hs.128317 Transcribed locus -2,73 2,8E-06 2,8E-04 4,97 AA464526 Hs.701982 Interleukin 1 receptor, type I IL1R1 -1,67 2,8E-06 2,8E-04 4,96 R85840 Hs.448833 Similar to nuclear pore complex interacting protein LOC440348 -1,00 2,8E-06 2,8E-04 4,95 AA676590 Hs.63335 Telomeric repeat binding factor 2 TERF2 0,84 2,9E-06 2,8E-04 4,95 N49836 Hs.487510 Transmembrane protein 170 TMEM170 1,69 2,9E-06 2,8E-04 4,94 AA130669 Hs.655138 WW domain binding protein 11 WBP11 -1,07 2,9E-06 2,8E-04 4,94 R34240 Hs.713576 Transcribed locus 1,30 3,0E-06 2,8E-04 4,91 AA052960 Hs.4747 Dyskeratosis congenita 1, dyskerin DKC1 0,93 3,0E-06 2,8E-04 4,91 AA644224 Hs.713887 Transcribed locus, strongly similar to NP_060250.2 chromodomain helicase D -1,53 3,1E-06 2,9E-04 4,86 AA883597 Hs.601274 Nudix (nucleoside diphosphate linked moiety X)-type motif 4 ps NUDT4P1 -1,15 3,1E-06 2,9E-04 4,85 AA705060 Hs.406234 Calcium binding protein P22 CHP -1,25 3,2E-06 2,9E-04 4,85 R44578 Hs.527484 Transcribed locus, moderately similar to NP_976028.1 recombining binding pr -0,91 3,2E-06 2,9E-04 4,85 AA634381 Hs.502528 NADH dehydrogenase (ubiquinone) Fe-S protein 3, 30kDa (NAD NDUFS3 1,19 3,4E-06 3,1E-04 4,78 AA460688 Hs.104555 Neuropeptide FF-amide peptide precursor NPFF -0,95 3,4E-06 3,1E-04 4,77 AA496247 Hs.369614 COP9 constitutive photomorphogenic homolog subunit 2 (Arabid COPS2 1,13 3,5E-06 3,1E-04 4,75 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,23 3,5E-06 3,1E-04 4,74 AA609599 Hs.558445 Synovial sarcoma, X breakpoint 3 SSX3 -1,01 3,6E-06 3,1E-04 4,73 AA179391 Hs.278277 3-oxoacid CoA transferase 1 OXCT1 1,93 3,6E-06 3,1E-04 4,71 R66541 Hs.654638 Chromosome 18 open reading frame 32 C18orf32 1,39 3,6E-06 3,1E-04 4,71 H15718 Hs.590970 AXL receptor tyrosine kinase AXL -1,77 3,7E-06 3,1E-04 4,70 AA458860 Hs.187763 Bromodomain containing 4 BRD4 -1,14 3,7E-06 3,1E-04 4,69 N20989 Hs.165859 Anthrax toxin receptor 1 ANTXR1 -1,25 3,7E-06 3,1E-04 4,69 T83665 Hs.591960 Protein associated with topoisomerase II homolog 1 (yeast) PATL1 -0,96 3,7E-06 3,1E-04 4,69 AA251784 Hs.69089 Galactosidase, alpha GLA 0,99 3,8E-06 3,2E-04 4,67 AI198629 Hs.134434 Ovo-like 1(Drosophila)
Load more

Recommended publications
  • ATF4 Promotes Angiogenesis and Neuronal Cell Death and Confers Ferroptosis in a Xct-Dependent Manner
    OPEN Oncogene (2017) 36, 5593–5608 www.nature.com/onc ORIGINAL ARTICLE ATF4 promotes angiogenesis and neuronal cell death and confers ferroptosis in a xCT-dependent manner D Chen1,2,ZFan1,3, M Rauh4, M Buchfelder5, IY Eyupoglu1,5 and N Savaskan1,5,6 Activating transcription factor 4 (ATF4) is a critical mediator of metabolic and oxidative homeostasis and cell survival. ATF4 is elevated in response to diverse microenvironmental stresses, including starvation, ER stress damages and exposure to toxic factors. Here we show that ATF4 expression fosters the malignancy of primary brain tumors (WHO grade III and IV gliomas) and increases proliferation and tumor angiogenesis. Hence, ATF4 expression promotes cell migration and anchorage-independent cell growth, whereas siRNA-mediated knockdown of ATF4 attenuates these features of malignancy in human gliomas. Further experiments revealed that ATF4-dependent tumor promoting effects are mediated by transcriptional targeting the glutamate antiporter xCT/SCL7A11 (also known as system Xc-). Thus, xCT is elevated as a consequence of ATF4 activation. We further found evidence that ATF4-induced proliferation can be attenuated by pharmacological or genetic xCT inhibition and ferroptosis inducers such as sorafenib, erastin and GPx4 inhibitor RSL3. Further, fostered xCT expression promotes cell survival and growth in ATF4 knockdown cells. Moreover, increased xCT levels ameliorate sorafenib and erastin-induced ferroptosis. Conversely, ATF4 knockdown renders cells susceptible for erastin, sorafenib and RSL3-induced ferroptosis. We further identified that ATF4 promotes tumor-mediated neuronal cell death which can be alleviated by xCT inhibition. Moreover, elevated ATF4 expression in gliomas promotes tumor angiogenesis. Noteworthy, ATF4-induced angiogenesis could be diminished by ferroptosis inducers erastin and by GPx4 inhibitor RSL3.
    [Show full text]
  • Cytoplasmic Activation-Induced Cytidine Deaminase (AID) Exists in Stoichiometric Complex with Translation Elongation Factor 1Α (Eef1a)
    Cytoplasmic activation-induced cytidine deaminase (AID) exists in stoichiometric complex with translation elongation factor 1α (eEF1A) Julien Häsler, Cristina Rada, and Michael S. Neuberger1 Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 0QH, United Kingdom Edited by Frederick W. Alt, Howard Hughes Medical Institute, Harvard Medical School, Children’s Hospital Immune Disease Institute, Boston, MA, and approved October 12, 2011 (received for review April 27, 2011) Activation-induced cytidine deaminase (AID) is a B lymphocyte- results reveal that endogenous cytoplasmic AID partakes in a specific DNA deaminase that acts on the Ig loci to trigger antibody complex containing stoichiometric quantities of translation elon- gene diversification. Most AID, however, is retained in the cyto- gation factor 1α (eEF1A), with this association likely implicated in plasm and its nuclear abundance is carefully regulated because the regulation of AID’s intracellular trafficking. off-target action of AID leads to cancer. The nature of the cytosolic AID complex and the mechanisms regulating its release from the Results cytoplasm and import into the nucleus remain unknown. Here, we Flag-Tagging the Endogenous AID Locus in DT40 Cells. We generated show that cytosolic AID in DT40 B cells is part of an 11S complex derivatives of the DT40 B-cell line in which the endogenous AID and, using an endogenously tagged AID protein to avoid overex- locus was modified so as to incorporate a single Flag tag at the pression artifacts, that it is bound in good stoichiometry to the AID N terminus. To allow targeting of both alleles, one targeting translation elongation factor 1 alpha (eEF1A).
    [Show full text]
  • Enzymatic Encoding Methods for Efficient Synthesis Of
    (19) TZZ__T (11) EP 1 957 644 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12N 15/10 (2006.01) C12Q 1/68 (2006.01) 01.12.2010 Bulletin 2010/48 C40B 40/06 (2006.01) C40B 50/06 (2006.01) (21) Application number: 06818144.5 (86) International application number: PCT/DK2006/000685 (22) Date of filing: 01.12.2006 (87) International publication number: WO 2007/062664 (07.06.2007 Gazette 2007/23) (54) ENZYMATIC ENCODING METHODS FOR EFFICIENT SYNTHESIS OF LARGE LIBRARIES ENZYMVERMITTELNDE KODIERUNGSMETHODEN FÜR EINE EFFIZIENTE SYNTHESE VON GROSSEN BIBLIOTHEKEN PROCEDES DE CODAGE ENZYMATIQUE DESTINES A LA SYNTHESE EFFICACE DE BIBLIOTHEQUES IMPORTANTES (84) Designated Contracting States: • GOLDBECH, Anne AT BE BG CH CY CZ DE DK EE ES FI FR GB GR DK-2200 Copenhagen N (DK) HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI • DE LEON, Daen SK TR DK-2300 Copenhagen S (DK) Designated Extension States: • KALDOR, Ditte Kievsmose AL BA HR MK RS DK-2880 Bagsvaerd (DK) • SLØK, Frank Abilgaard (30) Priority: 01.12.2005 DK 200501704 DK-3450 Allerød (DK) 02.12.2005 US 741490 P • HUSEMOEN, Birgitte Nystrup DK-2500 Valby (DK) (43) Date of publication of application: • DOLBERG, Johannes 20.08.2008 Bulletin 2008/34 DK-1674 Copenhagen V (DK) • JENSEN, Kim Birkebæk (73) Proprietor: Nuevolution A/S DK-2610 Rødovre (DK) 2100 Copenhagen 0 (DK) • PETERSEN, Lene DK-2100 Copenhagen Ø (DK) (72) Inventors: • NØRREGAARD-MADSEN, Mads • FRANCH, Thomas DK-3460 Birkerød (DK) DK-3070 Snekkersten (DK) • GODSKESEN,
    [Show full text]
  • Nucleotide Sequence and Analysis of the 58.3 to 65.5-Kb Early Region of Bacteriophage T4
    Volume 14 Number 21 1986 Nucleic Acids Research Nucleotide sequence and analysis of the 58.3 to 65.5-kb early region of bacteriophage T4 Kristoffer Valerie 13.4, John Stevens', Mark Lynch'5, Earl E.Henderson12 and Jon K.de Riel1 'Fels Research Institute, and 2Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140, USA and 3Department of Biochemistry and Biotechnology, Royal Institute of Technology, S-100 44 Stockholm, Sweden Received 21 July 1986; Revised and Accepted 30 September 1986 ABSTRACT The complete 7.2-kb nucleotide sequence from the 58.3 to 65.5-kb early region of bacteriophage T4 has been determined by Maxam and Gilbert sequencing. Computer analysis revealed at least 20 open reading frames (ORFs) within this sequence. All major ORFs are transcribed from the left strand, suggesting that they are expressed early during infection. Among the ORFs, we have identified the pIIII, II, denV and tk genes. The ORFs are very tightly spaced, even over Lapping in some instances, and when ORF interspacing occurs, promoter-like sequences can be implicated. Several of the sequences preceding the ORFs, in particular those at ipIII, ipII, denV, and orf6l.9, can potentially form stable stem-loop structures. INTRODUCTION Recently, considerable progress has been made studying the bacteriophage T4 genome at the molecular level due to the development of T4 strains with unmod- ified DNA suitable for digestion with restriction endonucleases (1). Many T4 genes have since been cloned, sequenced, and their gene products overproduced in Escherichia coli (for review see ref. 2). A majority of the T4 genes studied so far have been essential and non-essential genes with well-characterized pheno- types.
    [Show full text]
  • Genetic Basis of Simple and Complex Traits with Relevance to Avian Evolution
    Genetic basis of simple and complex traits with relevance to avian evolution Małgorzata Anna Gazda Doctoral Program in Biodiversity, Genetics and Evolution D Faculdade de Ciências da Universidade do Porto 2019 Supervisor Miguel Jorge Pinto Carneiro, Auxiliary Researcher, CIBIO/InBIO, Laboratório Associado, Universidade do Porto Co-supervisor Ricardo Lopes, CIBIO/InBIO Leif Andersson, Uppsala University FCUP Genetic basis of avian traits Nota Previa Na elaboração desta tese, e nos termos do número 2 do Artigo 4º do Regulamento Geral dos Terceiros Ciclos de Estudos da Universidade do Porto e do Artigo 31º do D.L.74/2006, de 24 de Março, com a nova redação introduzida pelo D.L. 230/2009, de 14 de Setembro, foi efetuado o aproveitamento total de um conjunto coerente de trabalhos de investigação já publicados ou submetidos para publicação em revistas internacionais indexadas e com arbitragem científica, os quais integram alguns dos capítulos da presente tese. Tendo em conta que os referidos trabalhos foram realizados com a colaboração de outros autores, o candidato esclarece que, em todos eles, participou ativamente na sua conceção, na obtenção, análise e discussão de resultados, bem como na elaboração da sua forma publicada. Este trabalho foi apoiado pela Fundação para a Ciência e Tecnologia (FCT) através da atribuição de uma bolsa de doutoramento (PD/BD/114042/2015) no âmbito do programa doutoral em Biodiversidade, Genética e Evolução (BIODIV). 2 FCUP Genetic basis of avian traits Acknowledgements Firstly, I would like to thank to my all supervisors Miguel Carneiro, Ricardo Lopes and Leif Andersson, for the demanding task of supervising myself last four years.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
    Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human.
    [Show full text]
  • (LRV1) Pathogenicity Factor
    Antiviral screening identifies adenosine analogs PNAS PLUS targeting the endogenous dsRNA Leishmania RNA virus 1 (LRV1) pathogenicity factor F. Matthew Kuhlmanna,b, John I. Robinsona, Gregory R. Bluemlingc, Catherine Ronetd, Nicolas Faseld, and Stephen M. Beverleya,1 aDepartment of Molecular Microbiology, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; bDepartment of Medicine, Division of Infectious Diseases, Washington University School of Medicine in St. Louis, St. Louis, MO 63110; cEmory Institute for Drug Development, Emory University, Atlanta, GA 30329; and dDepartment of Biochemistry, University of Lausanne, 1066 Lausanne, Switzerland Contributed by Stephen M. Beverley, December 19, 2016 (sent for review November 21, 2016; reviewed by Buddy Ullman and C. C. Wang) + + The endogenous double-stranded RNA (dsRNA) virus Leishmaniavirus macrophages infected in vitro with LRV1 L. guyanensis or LRV2 (LRV1) has been implicated as a pathogenicity factor for leishmaniasis Leishmania aethiopica release higher levels of cytokines, which are in rodent models and human disease, and associated with drug-treat- dependent on Toll-like receptor 3 (7, 10). Recently, methods for ment failures in Leishmania braziliensis and Leishmania guyanensis systematically eliminating LRV1 by RNA interference have been − infections. Thus, methods targeting LRV1 could have therapeutic ben- developed, enabling the generation of isogenic LRV1 lines and efit. Here we screened a panel of antivirals for parasite and LRV1 allowing the extension of the LRV1-dependent virulence paradigm inhibition, focusing on nucleoside analogs to capitalize on the highly to L. braziliensis (12). active salvage pathways of Leishmania, which are purine auxo- A key question is the relevancy of the studies carried out in trophs.
    [Show full text]
  • A General Binding Mechanism for All Human Sulfatases by the Formylglycine-Generating Enzyme
    A general binding mechanism for all human sulfatases by the formylglycine-generating enzyme Dirk Roeser*, Andrea Preusser-Kunze†, Bernhard Schmidt†, Kathrin Gasow*, Julia G. Wittmann*, Thomas Dierks‡, Kurt von Figura†, and Markus Georg Rudolph*§ *Department of Molecular Structural Biology, University of Go¨ttingen, Justus-von-Liebig-Weg 11, D-37077 Go¨ttingen, Germany; †Department of Biochemistry II, Heinrich-Du¨ker-Weg 12, University of Go¨ttingen, D-37073 Go¨ttingen, Germany; and ‡Department of Biochemistry I, Universita¨tsstrasse 25, University of Bielefeld, D-33615 Bielefeld, Germany Edited by Carolyn R. Bertozzi, University of California, Berkeley, CA, and approved November 8, 2005 (received for review September 1, 2005) The formylglycine (FGly)-generating enzyme (FGE) uses molecular tases, suggesting a general binding mechanism of substrate sulfa- oxygen to oxidize a conserved cysteine residue in all eukaryotic tases by FGE. sulfatases to the catalytically active FGly. Sulfatases degrade and The details of how O2-dependent cysteine oxidation is mediated remodel sulfate esters, and inactivity of FGE results in multiple by FGE are unknown. As a first step toward the elucidation of the sulfatase deficiency, a fatal disease. The previously determined FGE molecular mechanism of FGly formation, we have previously crystal structure revealed two crucial cysteine residues in the active determined crystal structures of FGE in various oxidation states site, one of which was thought to be implicated in substrate (8). FGE adopts a novel fold with surprisingly little regular sec- 2ϩ binding. The other cysteine residue partakes in a novel oxygenase ondary structure and contains two structural Ca ions and two mechanism that does not rely on any cofactors.
    [Show full text]
  • CDC2 Mediates Progestin Initiated Endometrial Stromal Cell Proliferation: a PR Signaling to Gene Expression Independently of Its Binding to Chromatin
    CDC2 Mediates Progestin Initiated Endometrial Stromal Cell Proliferation: A PR Signaling to Gene Expression Independently of Its Binding to Chromatin Griselda Vallejo1, Alejandro D. La Greca1., Inti C. Tarifa-Reischle1., Ana C. Mestre-Citrinovitz1, Cecilia Ballare´ 2, Miguel Beato2,3, Patricia Saragu¨ eta1* 1 Instituto de Biologı´a y Medicina Experimental, IByME-Conicet, Buenos Aires, Argentina, 2 Centre de Regulacio´ Geno`mica, (CRG), Barcelona, Spain, 3 University Pompeu Fabra (UPF), Barcelona, Spain Abstract Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the peri-implantation phase of pregnancy. We showed that picomolar concentration of progestin R5020 mimics this control in UIII endometrial stromal cells via ERK1-2 and AKT activation mediated by interaction of Progesterone Receptor (PR) with Estrogen Receptor beta (ERb) and without transcriptional activity of endogenous PR and ER. Here we identify early downstream targets of cytoplasmic PR signaling and their possible role in endometrial stromal cell proliferation. Microarray analysis of global gene expression changes in UIII cells treated for 45 min with progestin identified 97 up- and 341 down-regulated genes. The most over-represented molecular functions were transcription factors and regulatory factors associated with cell proliferation and cell cycle, a large fraction of which were repressors down-regulated by hormone. Further analysis verified that progestins regulate Ccnd1, JunD, Usf1, Gfi1, Cyr61, and Cdkn1b through PR- mediated activation of ligand-free ER, ERK1-2 or AKT, in the absence of genomic PR binding.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]