DOCSLIB.ORG

Evolution of Molecular Function in Mammalian Neurons

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2011 Evolution of Molecular Function in Mammalian Neurons Chantal Francis [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, Biology Commons, Cell Biology Commons, and the Molecular Biology Commons Recommended Citation Francis, Chantal, "Evolution of Molecular Function in Mammalian Neurons" (2011). Publicly Accessible Penn Dissertations. 961. https://repository.upenn.edu/edissertations/961 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/961 For more information, please contact [email protected]. Evolution of Molecular Function in Mammalian Neurons Abstract A common question in neuroscience is what forms the neurological basis of the variety of behaviors in mammals. While many studies have compared mammalian anatomy and evolution, few have investigated the physiologic functions of individual neurons in a comparative manner. Neurons’ ability to modify their features in response to stimuli, known as synaptic plasticity, is fundamental for learning and memory. A key feature of synaptic plasticity involves delivering mRNA to distinct domains where they are locally translated. Regulatory coordination of these events is critical for synaptogenesis and synaptic plasticity as defects in these processes can lead to neurological diseases. In this work, we combine computational and experimental biology to investigate subcellular localization of mRNAs in dendrites of mouse and rat neurons. Differential subcellular localization of specific gene products may highlight differential synaptic function and allow the uncovering of evolutionary conserved as well as divergent molecular functions in neurons. First, we performed a comparative analysis of the dendritic transcriptome in mouse and rat via microarrays. We found that their dendritic transcriptome are significantly more divergent than other homologous tissues and that these evolutionarily changes could be associated with transposon activity. Second, we comprehensively determined subcellular expression patterns for neuronal genes in mice and rats via a systematic in situ survey on a curated list of dendritic mRNA from our previous microarray study. This survey highlighted that dendritic localization of specific transcripts occurs in a species- specific fashion. eW uncovered species-specific cis and trans-elements with possible implications in transcript localization and gene expression regulation in neurons. The interactions between these elements might play a major role in the proper development and evolution of complex nervous systems. Our data will be publically available in a database (http://kim.bio.upenn.edu/insitu/public/), which could guide future investigations. Finally, we investigated single cell variability by combining microarrays, RNAseq and in situ experiments. Our preliminary results underlined the extent of this variability and its contributions in establishing cell’s unique identity. In conclusion, our study suggests the existence of species-specific mRNA localization mechanisms and supports the idea that evolution of phenotypes might be linked to the evolution of subcellular localization of transcripts. Degree Type Dissertation Degree Name Doctor of Philosophy (PhD) Graduate Group Biology First Advisor Junhyong Kim Second Advisor Jim Eberwine Keywords mRNA, dendrites, localization, evolution Subject Categories Bioinformatics | Biology | Cell Biology | Molecular Biology This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/961 EVOLUTION OF MOLECULAR FUNCTION IN MAMMALIAN NEURONS Chantal Francis A DISSERTATION in Biology Presented to the Faculties of the University of Pennsylvania in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy 2011 Supervisor of Dissertation Co-Supervisor of Dissertation Signature ____________ Signature ____________ Junhyong Kim, Ph.D. Jim Eberwine, Ph.D. Graduate Group Chairperson Signature_______________ Doris Wagner, Ph.D. Dissertation Committee Nancy Bonini, Ph.D., Professor of Biology, (Dissertation Committee chair) Maja Bucan, Ph.D., Professor of Genetics Dustin Brisson, Ph.D., Assistant Professor of Biology Marc Schmidt, Ph.D., Associate Professor of Biology EVOLUTION OF MOLECULAR FUNCTION IN MAMMALIAN NEURONS COPYRIGHT Chantal Francis 2011 DEDICATION I would like to dedicate this dissertation to my family for all their love and support. Especially to my beloved husband Peter. iii ACKNOWLEDGEMENTS There are no shortcuts for an achievement. None of this work would have been possible without the intellectual and mental support of many, many people to whom I am deeply grateful. I would like to acknowledge the members of my thesis committee: Dr. Nancy Bonini, Dr. Maja Bucan, Dr. Dustin Brisson, and Dr. Marc Schmidt for great advice and constructive criticism throughout these years. Their advice and suggestions helped me to refine and achieve my thesis goals. I would also like to acknowledge all past and current members of the Kim lab: Dan, Dexter, Fan, Hannah, Hoa, Kathryn, Miler, Mugdha, Sheng, Saurav, Shreedhar, and Stephen. Their different backgrounds and amazing computational skills helped me incredibly and allowed me to move forward in my data analysis. Despite the diversity of their work, all Kim lab members were united by their friendliness. This is so important in making your graduate student life more enjoyable! Dan and Miler were always so friendly and available to help me with my basic programming skills. They both are very organized and such talented teachers. They were so patient with me! From my collaboration with Shreedhar, I also learned many aspects related to computational biology as well as life. Stephen’s contribution, creating an online database, was extremely valuable to my in situ project. His extensive computer skills and wise advice helped me avoid lots of computer crashes and data loss. I am grateful to Kathleen (an “unofficial” Kim lab member) for her great advice on surviving the pressures of dissertation writing and for making sure I had something to eat for my late nights in the lab. The hub of talent and kindness from the Kim lab is but a small reflection of who Junhyong is. My first interaction with Junhyong was as a technician and throughout the years the more I interacted with him the deeper my admiration became. It is sincerely impossible for me to describe in few words all my gratitude for such an empathic boss, knowledgeable teacher and advisor, and considerate human being. One of the greatest things that happened to me as a graduate student was to perform my thesis work in a partnership with Dr. Jim Eberwine. This collaboration quickly became the keystone of my thesis thanks to Jim’s generosity and welcome in his lab. Jim was an incredible co-mentor from whom I have learned to be more confident in my thoughts and to think more as a scientist. Beside his extreme talent and passion for iv science, Jim was also very understanding and supportive of my family obligations. For this, I am sincerely thankful. Working in Jim’s lab not only allowed me to learn many new technical skills but also allowed me the unique opportunity to meet and interact with his lab members. I would like to acknowledge Ditte, Jackie, Jai, Jae-Hee, Jenn, Jeanine, Kevin, Pete, Sean, Terri, Tiina and Thom. All of them helped in some way ranging from teaching me single cell dissection, in situ techniques and the beauty of microscopy to even providing advice on my writing. Beside their technical assistance, they have been great co-workers reviving the bench work area with fun discussions about food, American sports games, which was a big novelty for me that I am still learning a lot about, or Nobel prizes. I have to acknowledge that none of my experiments would have been feasible without the thousands of primary neuron cultures that Margie prepared for me. It was always a pleasure going to Margie’s lab to pick up my samples and to see her bright smile that cheered up my day. I am also grateful to the very talented students Irmina, Emily and John who helped me on the immense and tedious tasks of the in situ project during their internship in Jim’s lab. I must also thank Dr. Brian Gregory who opened his lab to me, and walked me through all of the steps in the library preparation of next generation sequencing. Being a TA during the first two years of Graduate school was tough but such a great learning experience. It made me realize how challenging it is to convey your thoughts and understanding to others and that teaching a subject to others is far different from understanding it yourself. I am grateful to Dr. Linda Robinson for training me and for giving me great tips about speaking in public and dealing with delicate situation with students. The underlying force behind my choice to enter graduate school comes from Paul Sniegowski’s lab. I came to the U.S. with a master’s degree and the thought that I was done as far as my education. Joining Paul’s lab revived my passion for science and pushed my ambition further. Paul was an amazing teacher and his former graduate student’s, Heidi and Helen, enthusiasm and persistence in their work was a key motivation for me. My graduate student years were enormously enriched in basic science, technical skills and wonderful discussions with very bright people…it was also full of ups and downs. Junhyong once said: “Graduate school is like a marathon”. It is all about v endurance, learning from the down side and gaining even more force from it to pursue your goals to the end, even though science never ends. If I was able to put this dissertation together and stay physically and mentally sane, it is only because of the support of my friends, family and beloved son and husband. To Helen, Maurits, Vero, Paul, Sophie, and Hélène, meeting you during grad school was such a breath of fresh air! To Danielle & Amr, our friendship and your advice were so valuable to me throughout the toughest moments of my grad school.
Recommended publications
  • A Yeast Phenomic Model for the Gene Interaction Network Modulating

    A Yeast Phenomic Model for the Gene Interaction Network Modulating

    Louie et al. Genome Medicine 2012, 4:103 http://genomemedicine.com/content/4/12/103 RESEARCH Open Access A yeast phenomic model for the gene interaction network modulating CFTR-ΔF508 protein biogenesis Raymond J Louie3†, Jingyu Guo1,2†, John W Rodgers1, Rick White4, Najaf A Shah1, Silvere Pagant3, Peter Kim3, Michael Livstone5, Kara Dolinski5, Brett A McKinney6, Jeong Hong2, Eric J Sorscher2, Jennifer Bryan4, Elizabeth A Miller3* and John L Hartman IV1,2* Abstract Background: The overall influence of gene interaction in human disease is unknown. In cystic fibrosis (CF) a single allele of the cystic fibrosis transmembrane conductance regulator (CFTR-ΔF508) accounts for most of the disease. In cell models, CFTR-ΔF508 exhibits defective protein biogenesis and degradation rather than proper trafficking to the plasma membrane where CFTR normally functions. Numerous genes function in the biogenesis of CFTR and influence the fate of CFTR-ΔF508. However it is not known whether genetic variation in such genes contributes to disease severity in patients. Nor is there an easy way to study how numerous gene interactions involving CFTR-ΔF would manifest phenotypically. Methods: To gain insight into the function and evolutionary conservation of a gene interaction network that regulates biogenesis of a misfolded ABC transporter, we employed yeast genetics to develop a ‘phenomic’ model, in which the CFTR-ΔF508-equivalent residue of a yeast homolog is mutated (Yor1-ΔF670), and where the genome is scanned quantitatively for interaction. We first confirmed that Yor1-ΔF undergoes protein misfolding and has reduced half-life, analogous to CFTR-ΔF. Gene interaction was then assessed quantitatively by growth curves for approximately 5,000 double mutants, based on alteration in the dose response to growth inhibition by oligomycin, a toxin extruded from the cell at the plasma membrane by Yor1.
  • Entrez Symbols Name Termid Termdesc 117553 Uba3,Ube1c

    Entrez Symbols Name Termid Termdesc 117553 Uba3,Ube1c

    Entrez Symbols Name TermID TermDesc 117553 Uba3,Ube1c ubiquitin-like modifier activating enzyme 3 GO:0016881 acid-amino acid ligase activity 299002 G2e3,RGD1310263 G2/M-phase specific E3 ubiquitin ligase GO:0016881 acid-amino acid ligase activity 303614 RGD1310067,Smurf2 SMAD specific E3 ubiquitin protein ligase 2 GO:0016881 acid-amino acid ligase activity 308669 Herc2 hect domain and RLD 2 GO:0016881 acid-amino acid ligase activity 309331 Uhrf2 ubiquitin-like with PHD and ring finger domains 2 GO:0016881 acid-amino acid ligase activity 316395 Hecw2 HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2 GO:0016881 acid-amino acid ligase activity 361866 Hace1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 GO:0016881 acid-amino acid ligase activity 117029 Ccr5,Ckr5,Cmkbr5 chemokine (C-C motif) receptor 5 GO:0003779 actin binding 117538 Waspip,Wip,Wipf1 WAS/WASL interacting protein family, member 1 GO:0003779 actin binding 117557 TM30nm,Tpm3,Tpm5 tropomyosin 3, gamma GO:0003779 actin binding 24779 MGC93554,Slc4a1 solute carrier family 4 (anion exchanger), member 1 GO:0003779 actin binding 24851 Alpha-tm,Tma2,Tmsa,Tpm1 tropomyosin 1, alpha GO:0003779 actin binding 25132 Myo5b,Myr6 myosin Vb GO:0003779 actin binding 25152 Map1a,Mtap1a microtubule-associated protein 1A GO:0003779 actin binding 25230 Add3 adducin 3 (gamma) GO:0003779 actin binding 25386 AQP-2,Aqp2,MGC156502,aquaporin-2aquaporin 2 (collecting duct) GO:0003779 actin binding 25484 MYR5,Myo1e,Myr3 myosin IE GO:0003779 actin binding 25576 14-3-3e1,MGC93547,Ywhah
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions

    Defining Functional Interactions During Biogenesis of Epithelial Junctions

    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
  • Molecular Mechanisms Underlying Noncoding Risk Variations in Psychiatric Genetic Studies

    Molecular Mechanisms Underlying Noncoding Risk Variations in Psychiatric Genetic Studies

    OPEN Molecular Psychiatry (2017) 22, 497–511 www.nature.com/mp REVIEW Molecular mechanisms underlying noncoding risk variations in psychiatric genetic studies X Xiao1,2, H Chang1,2 and M Li1 Recent large-scale genetic approaches such as genome-wide association studies have allowed the identification of common genetic variations that contribute to risk architectures of psychiatric disorders. However, most of these susceptibility variants are located in noncoding genomic regions that usually span multiple genes. As a result, pinpointing the precise variant(s) and biological mechanisms accounting for the risk remains challenging. By reviewing recent progresses in genetics, functional genomics and neurobiology of psychiatric disorders, as well as gene expression analyses of brain tissues, here we propose a roadmap to characterize the roles of noncoding risk loci in the pathogenesis of psychiatric illnesses (that is, identifying the underlying molecular mechanisms explaining the genetic risk conferred by those genomic loci, and recognizing putative functional causative variants). This roadmap involves integration of transcriptomic data, epidemiological and bioinformatic methods, as well as in vitro and in vivo experimental approaches. These tools will promote the translation of genetic discoveries to physiological mechanisms, and ultimately guide the development of preventive, therapeutic and prognostic measures for psychiatric disorders. Molecular Psychiatry (2017) 22, 497–511; doi:10.1038/mp.2016.241; published online 3 January 2017 RECENT GENETIC ANALYSES OF NEUROPSYCHIATRIC neurodevelopment and brain function. For example, GRM3, DISORDERS GRIN2A, SRR and GRIA1 were known to involve in the neuro- Schizophrenia, bipolar disorder, major depressive disorder and transmission mediated by glutamate signaling and synaptic autism are highly prevalent complex neuropsychiatric diseases plasticity.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data

    DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC226881 DYNC1I1 (NM_001135556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DYNC1I1 (NM_001135556) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DYNC1I1 Synonyms: DNCI1; DNCIC1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 DYNC1I1 (NM_001135556) Human Tagged ORF Clone – RC226881 ORF Nucleotide >RC226881 representing NM_001135556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACAAAAGTGACTTAAAAGCTGAGCTAGAGCGCAAAAAGCAGCGCTTAGCACAGATAAGAGAAG AGAAGAAACGGAAGGAAGAGGAGAGGAAAAAGAAAGAGGCTGATATGCAGCAGAAGAAAGAACCCGTTCA GGACGACTCTGATCTGGATCGCAAACGACGAGAGACAGAGGCTTTGCTGCAAAGCATTGGTATCTCACCG GAGCCGCCTCTAGTCCCAACCCCTATGTCTCCCTCCTCGAAATCAGTGAGCACTCCCAGTGAAGCTGGAA GCCAAGACTCAGGCGATCTGGGGCCATTAACAAGGACCCTGCAGTGGGACACAGACCCCTCAGTGCTCCA GCTGCAGTCAGACTCAGAACTTGGAAGAAGACTGCATAAACTGGGCGTGTCAAAGGTCACCCAAGTGGAT TTCCTGCCAAGGGAAGTAGTGTCCTACTCAAAGGAGACCCAGACTCCTCTTGCCACGCATCAGTCTGAAG AGGATGAGGAAGATGAGGAAATGGTGGAATCTAAAGTTGGCCAGGACTCAGAACTGGAAAATCAGGACAA AAAACAGGAAGTGAAGGAAGCCCCTCCAAGAGAGTTGACAGAGGAAGAAAAACAGCAGATCATTCATTCA
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity

    Investigation of Candidate Genes and Mechanisms Underlying Obesity

    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
  • Co-Expression Module Analysis Reveals Biological Processes

    Co-Expression Module Analysis Reveals Biological Processes

    Shi et al. BMC Systems Biology 2010, 4:74 http://www.biomedcentral.com/1752-0509/4/74 RESEARCH ARTICLE Open Access Co-expressionResearch article module analysis reveals biological processes, genomic gain, and regulatory mechanisms associated with breast cancer progression Zhiao Shi1,2, Catherine K Derow3 and Bing Zhang*3 Abstract Background: Gene expression signatures are typically identified by correlating gene expression patterns to a disease phenotype of interest. However, individual gene-based signatures usually suffer from low reproducibility and interpretability. Results: We have developed a novel algorithm Iterative Clique Enumeration (ICE) for identifying relatively independent maximal cliques as co-expression modules and a module-based approach to the analysis of gene expression data. Applying this approach on a public breast cancer dataset identified 19 modules whose expression levels were significantly correlated with tumor grade. The correlations were reproducible for 17 modules in an independent breast cancer dataset, and the reproducibility was considerably higher than that based on individual genes or modules identified by other algorithms. Sixteen out of the 17 modules showed significant enrichment in certain Gene Ontology (GO) categories. Specifically, modules related to cell proliferation and immune response were up-regulated in high- grade tumors while those related to cell adhesion was down-regulated. Further analyses showed that transcription factors NYFB, E2F1/E2F3, NRF1, and ELK1 were responsible for the up-regulation of the cell proliferation modules. IRF family and ETS family proteins were responsible for the up-regulation of the immune response modules. Moreover, inhibition of the PPARA signaling pathway may also play an important role in tumor progression.
  • Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach

    Role of Phytochemicals in Colon Cancer Prevention: a Nutrigenomics Approach

    Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan J van Erk Promotor: Prof. Dr. P.J. van Bladeren Hoogleraar in de Toxicokinetiek en Biotransformatie Wageningen Universiteit Co-promotoren: Dr. Ir. J.M.M.J.G. Aarts Universitair Docent, Sectie Toxicologie Wageningen Universiteit Dr. Ir. B. van Ommen Senior Research Fellow Nutritional Systems Biology TNO Voeding, Zeist Promotiecommissie: Prof. Dr. P. Dolara University of Florence, Italy Prof. Dr. J.A.M. Leunissen Wageningen Universiteit Prof. Dr. J.C. Mathers University of Newcastle, United Kingdom Prof. Dr. M. Müller Wageningen Universiteit Dit onderzoek is uitgevoerd binnen de onderzoekschool VLAG Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Marjan Jolanda van Erk Proefschrift ter verkrijging van graad van doctor op gezag van de rector magnificus van Wageningen Universiteit, Prof.Dr.Ir. L. Speelman, in het openbaar te verdedigen op vrijdag 1 oktober 2004 des namiddags te vier uur in de Aula Title Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Author Marjan Jolanda van Erk Thesis Wageningen University, Wageningen, the Netherlands (2004) with abstract, with references, with summary in Dutch ISBN 90-8504-085-X ABSTRACT Role of phytochemicals in colon cancer prevention: a nutrigenomics approach Specific food compounds, especially from fruits and vegetables, may protect against development of colon cancer. In this thesis effects and mechanisms of various phytochemicals in relation to colon cancer prevention were studied through application of large-scale gene expression profiling. Expression measurement of thousands of genes can yield a more complete and in-depth insight into the mode of action of the compounds.
  • RHOBTB1 CRISPR/Cas9 KO Plasmid (H): Sc-418424

    RHOBTB1 CRISPR/Cas9 KO Plasmid (H): Sc-418424

    SANTA CRUZ BIOTECHNOLOGY, INC. RHOBTB1 CRISPR/Cas9 KO Plasmid (h): sc-418424 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and RHOBTB1 CRISPR/Cas9 KO Plasmid (h) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in human cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L., et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives expression of Cas9 systems. Science 339: 819-823. 2A peptide: allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system. Nuclear localization signal SpCas9 ribonuclease Nat. Protoc. 8: 2281-2308.
  • Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations

    Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations

    Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations by Jelena Perovanovic M.S. in Molecular Biology and Physiology, September 2009, University of Belgrade M.Phil. in Molecular Medicine, August 2013, The George Washington University A Dissertation submitted to The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy August 31, 2015 Dissertation directed by Eric P. Hoffman Professor of Integrative Systems Biology The Columbian College of Arts and Sciences of The George Washington University certifies that Jelena Perovanovic has passed the Final Examination for the degree of Doctor of Philosophy as of May 5, 2015. This is the final and approved form of the dissertation. Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations Jelena Perovanovic Dissertation Research Committee: Eric P. Hoffman, Professor of Integrative Systems Biology, Dissertation Director Anamaris Colberg-Poley, Professor of Integrative Systems Biology, Committee Member Robert J. Freishtat, Associate Professor of Pediatrics, Committee Member Vittorio Sartorelli, Senior Investigator, National Institutes of Health, Committee Member ii © Copyright 2015 by Jelena Perovanovic All rights reserved iii Acknowledgments I am deeply indebted to countless individuals for their support and encouragement during the past five years of graduate studies. First and foremost, I would like to express my gratitude to my mentor, Dr. Eric P. Hoffman, for his unwavering support and guidance, and keen attention to my professional development. This Dissertation would not have been possible without the critical input he provided and the engaging environment he created.
  • OTX2 Homeoprotein Functions in Adult Choroid Plexus

    OTX2 Homeoprotein Functions in Adult Choroid Plexus

    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.28.441734; this version posted April 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. OTX2 homeoprotein functions in adult choroid plexus Anabelle Planques1†, Vanessa Oliveira Moreira1†, David Benacom1, Clémence Bernard1, Laurent Jourdren2, Corinne Blugeon2, Florent Dingli3, Vanessa Masson3, Damarys Loew3, Alain Prochiantz1,4, Ariel A. Di Nardo1* 1. Centre for Interdisciplinary Research in Biology (CIRB), Collège de France, CNRS UMR7241, INSERM U1050, Labex MemoLife, PSL University, Paris, France 2. Genomics Core Facility, Institut de Biologie de l’ENS (IBENS), Département de Biologie, École Normale Supérieure, CNRS, INSERM, PSL University, 75005 Paris, France 3. Institut Curie, Centre de Recherche, Laboratoire de Spectrométrie de Masse Protéomique, 75248 Paris Cedex 05, France 4. Institute of Neurosciences, Chinese Academy of Sciences, 320 Yue Yang Road, Shanghai, 200031, China †contributed equally *corresponding author: [email protected] Abstract Choroid plexus secretes cerebrospinal fluid important for brain development and homeostasis. The OTX2 homeoprotein is critical for choroid plexus development and remains highly expressed in adult choroid plexus. Through RNA sequencing analyses of constitutive and conditional knockdown adult mouse models, we reveal putative roles for OTX2 in choroid plexus function, including cell signaling and adhesion, and show that it regulates the expression of factors secreted into cerebrospinal fluid, notably transthyretin. We show that Otx2 expression impacts choroid plexus immune and stress responses, and also affects splicing which leads to changes in mRNA isoforms of proteins implicated in oxidative stress response and DNA repair.