Proquest Dissertations
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assa
Downloaded from genome.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Methods Identification of Promoter Regions in the Human Genome by Using a Retroviral Plasmid Library-Based Functional Reporter Gene Assay Shirin Khambata-Ford,1,5 Yueyi Liu,2 Christopher Gleason,1 Mark Dickson,3 Russ B. Altman,2 Serafim Batzoglou,4 and Richard M. Myers1,3,6 1Department of Genetics, 2Stanford Medical Informatics, 3Stanford Human Genome Center, Stanford University School of Medicine, Stanford, California 94305, USA; 4Department of Computer Science, Stanford University, Stanford, California 94305, USA Attempts to identify regulatory sequences in the human genome have involved experimental and computational methods such as cross-species sequence comparisons and the detection of transcription factor binding-site motifs in coexpressed genes. Although these strategies provide information on which genomic regions are likely to be involved in gene regulation, they do not give information on their functions. We have developed a functional selection for promoter regions in the human genome that uses a retroviral plasmid library-based system. This approach enriches for and detects promoter function of isolated DNA fragments in an in vitro cell culture assay. By using this method, we have discovered likely promoters of known and predicted genes, as well as many other putative promoter regions based on the presence of features such as CpG islands. Comparison of sequences of 858 plasmid clones selected by this assay with the human genome draft sequence indicates that a significantly higher percentage of sequences align to the 500-bp segment upstream of the transcription start sites of known genes than would be expected from random genomic sequences. -
A Dissertation Entitled the Androgen Receptor
A Dissertation entitled The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit Submitted to the Graduate Faculty as partial fulfillment of the requirements for the PhD Degree in Biomedical science Dr. Manohar Ratnam, Committee Chair Dr. Lirim Shemshedini, Committee Member Dr. Robert Trumbly, Committee Member Dr. Edwin Sanchez, Committee Member Dr. Beata Lecka -Czernik, Committee Member Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo August 2011 Copyright 2011, Mesfin Gonit This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of The Androgen Receptor as a Transcriptional Co-activator: Implications in the Growth and Progression of Prostate Cancer By Mesfin Gonit As partial fulfillment of the requirements for the PhD Degree in Biomedical science The University of Toledo August 2011 Prostate cancer depends on the androgen receptor (AR) for growth and survival even in the absence of androgen. In the classical models of gene activation by AR, ligand activated AR signals through binding to the androgen response elements (AREs) in the target gene promoter/enhancer. In the present study the role of AREs in the androgen- independent transcriptional signaling was investigated using LP50 cells, derived from parental LNCaP cells through extended passage in vitro. LP50 cells reflected the signature gene overexpression profile of advanced clinical prostate tumors. The growth of LP50 cells was profoundly dependent on nuclear localized AR but was independent of androgen. Nevertheless, in these cells AR was unable to bind to AREs in the absence of androgen. -
Upregulation of Erp57 Promotes Clear Cell Renal Cell Carcinoma
Liu et al. Journal of Experimental & Clinical Cancer Research (2019) 38:439 https://doi.org/10.1186/s13046-019-1453-z RESEARCH Open Access Upregulation of ERp57 promotes clear cell renal cell carcinoma progression by initiating a STAT3/ILF3 feedback loop Yan Liu1,2†, Jian-Xing Wang1,3†, Zi-Yuan Nie4, Yue Wen1, Xin-Ju Jia5, Li-Na Zhang1, Hui-Jun Duan1* and Yong-Hong Shi1* Abstract Background: ERp57 dysfunction has been shown to contribute to tumorigenesis in multiple malignances. However, the role of ERp57 in clear cell renal carcinoma (ccRCC) remains unclear. Methods: Cell proliferation ability was measured by MTT and colony forming assays. Western blotting and quantitative real-time PCR (qRT-PCR) were performed to measure protein and mRNA expression. Co-immunoprecipitation (CoIP) and proximity ligation assay (PLA) were performed to detect protein-protein interaction. Chromatin immunoprecipitation (ChIP), ribonucleoprotein immunoprecipitation (RIP), and oligo pull-down were used to confirm DNA–protein and RNA–protein interactions. Promoter luciferase analysis was used to detect transcription factor activity. Results: Here we found ERp57 was overexpressed in ccRCC tissues, and the higher levels of ERp57 were correlated with poor survival in patients with ccRCC. In vivo and in vitro experiments showed that ccRCC cell proliferation was enhanced by ERp57 overexpression and inhibited by ERp57 deletion. Importantly, we found ERp57 positively regulated ILF3 expression in ccRCC cells. Mechanically, ERp57 was shown to bind to STAT3 protein and enhance the STAT3- mediated transcriptional activity of ILF3. Furthermore, ILF3 levels were increased in ccRCC tissues and associated with poor prognosis. Interestingly, we revealed that ILF3 could bind to ERp57 and positively regulate its expression by enhancing its mRNA stability. -
Bioinformatics Analysis for the Identification of Differentially Expressed Genes and Related Signaling Pathways in H
Bioinformatics analysis for the identification of differentially expressed genes and related signaling pathways in H. pylori-CagA transfected gastric cancer cells Dingyu Chen*, Chao Li, Yan Zhao, Jianjiang Zhou, Qinrong Wang and Yuan Xie* Key Laboratory of Endemic and Ethnic Diseases , Ministry of Education, Guizhou Medical University, Guiyang, China * These authors contributed equally to this work. ABSTRACT Aim. Helicobacter pylori cytotoxin-associated protein A (CagA) is an important vir- ulence factor known to induce gastric cancer development. However, the cause and the underlying molecular events of CagA induction remain unclear. Here, we applied integrated bioinformatics to identify the key genes involved in the process of CagA- induced gastric epithelial cell inflammation and can ceration to comprehend the potential molecular mechanisms involved. Materials and Methods. AGS cells were transected with pcDNA3.1 and pcDNA3.1::CagA for 24 h. The transfected cells were subjected to transcriptome sequencing to obtain the expressed genes. Differentially expressed genes (DEG) with adjusted P value < 0.05, | logFC |> 2 were screened, and the R package was applied for gene ontology (GO) enrichment and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. The differential gene protein–protein interaction (PPI) network was constructed using the STRING Cytoscape application, which conducted visual analysis to create the key function networks and identify the key genes. Next, the Submitted 20 August 2020 Kaplan–Meier plotter survival analysis tool was employed to analyze the survival of the Accepted 11 March 2021 key genes derived from the PPI network. Further analysis of the key gene expressions Published 15 April 2021 in gastric cancer and normal tissues were performed based on The Cancer Genome Corresponding author Atlas (TCGA) database and RT-qPCR verification. -
Identification of Biomarkers of Metastatic Disease in Uveal
Identification of biomarkers of metastatic disease in uveal melanoma using proteomic analyses Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy Martina Angi June 2015 To Mario, the wind beneath my wings 2 Acknowledgments First and foremost, I would like to acknowledge my primary supervisor, Prof. Sarah Coupland, for encouraging me to undergo a PhD and for supporting me in this long journey. I am truly grateful to Dr Helen Kalirai for being the person I could always turn to, for a word of advice on cell culture as much as on parenting skills. I would also like to acknowledge Prof. Bertil Damato for being an inspiration and a mentor; and Dr Sarah Lake and Dr Joseph Slupsky for their precious advice. I would like to thank Dawn, Haleh, Fidan and Fatima for becoming my family away from home, and the other members of the LOORG for the fruitful discussions and lovely cakes. I would like to acknowledge Prof. Heinrich Heimann and the clinical team at LOOC, especially Sisters Hebbar, Johnston, Hachuela and Kaye, for their admirable dedication to UM patients and for their invaluable support to clinical research. I would also like to thank the members of staff in St Paul’s theatre and Simon Biddolph and Anna Ikin in Pathology for their precious help in sample collection. I am grateful to Dr Rosalind Jenkins who guided my first steps in the mysterious word of proteomics, and to Dr Deb Simpsons and Prof. Rob Beynon for showing me its beauty. -
A Three-Dimensional Organoid Model Recapitulates Tumorigenic Aspects
www.nature.com/scientificreports OPEN A three-dimensional organoid model recapitulates tumorigenic aspects and drug responses of Received: 22 June 2018 Accepted: 10 October 2018 advanced human retinoblastoma Published: xx xx xxxx Duangporn Saengwimol1, Duangnate Rojanaporn2, Vijender Chaitankar3, Pamorn Chittavanich4, Rangsima Aroonroch5, Tatpong Boontawon4, Weerin Thammachote4, Natini Jinawath4, Suradej Hongeng6 & Rossukon Kaewkhaw4 Persistent or recurrent retinoblastoma (RB) is associated with the presence of vitreous or/and subretinal seeds in advanced RB and represents a major cause of therapeutic failure. This necessitates the development of novel therapies and thus requires a model of advanced RB for testing candidate therapeutics. To this aim, we established and characterized a three-dimensional, self-organizing organoid model derived from chemotherapy-naïve tumors. The responses of organoids to drugs were determined and compared to relate organoid model to advanced RB, in terms of drug sensitivities. We found that organoids had histological features resembling retinal tumors and seeds and retained DNA copy-number alterations as well as gene and protein expression of the parental tissue. Cone signal circuitry (M/L+ cells) and glial tumor microenvironment (GFAP+ cells) were primarily present in organoids. Topotecan alone or the combined drug regimen of topotecan and melphalan efectively targeted proliferative tumor cones (RXRγ+ Ki67+) in organoids after 24-h drug exposure, blocking mitotic entry. In contrast, methotrexate showed the least efcacy against tumor cells. The drug responses of organoids were consistent with those of tumor cells in advanced disease. Patient-derived organoids enable the creation of a faithful model to use in examining novel therapeutics for RB. Retinoblastoma (RB) is a serious childhood retinal tumor that, if lef untreated, can cause death within 1–2 years. -
Single Cell Derived Clonal Analysis of Human Glioblastoma Links
SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig. -
Supplementary Table 1
Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7